Effect of sub-chronic exposure to selenium and astaxanthin on Channa argus: Bioaccumulation, oxidative stress and inflammatory response

Chemosphere 244 (2020) 125546

Contents lists available at ScienceDirect

Chemosphere journal homepage: www.elsevier.com/locate/chemosphere

Effect of sub-chronic exposure to selenium and astaxanthin on Channa argus: Bioaccumulation, oxidative stress and inflammatory response Mu-Yang Li a, c, d, e, Chun-Shan Gao b, Xiao-Yan Du b, Lei Zhao a, c, d, e, Xiao-Tian Niu a, c, d, e, Gui-Qin Wang a, c, d, e, *, Dong-Ming Zhang a, c, d, e, ** a

College of Animal Science and Technology, Jilin Agricultural University, Changchun, Jilin, 130118, China Freshwater Fisheries Research Institute of Jilin Province, Changchun, Jilin, 130000, China Ministry of Education Laboratory of Animal Production and Quality Security, Jilin Agricultural University, Changchun, Jilin, 130118, China d Joint Laboratory of Modern Agricultural Technology International Cooperation, Ministry of Education, Jilin Agricultural University, Changchun, Jilin, 130118, China e Jilin Provincial Key Laboratory of Animal Nutrition and Feed Science, Jilin Agricultural University, Changchun, Jilin, 130118, China b c

h i g h l i g h t s
Exposure to waterborne Se induced significant bioaccumulation in specific tissues.
The profile of Se accumulation: kidney z liver > spleen > intestine > gill > muscle.
Oxidative stress and inflammatory response were affected following exposure to waterborne Se.
Astaxanthin supplementation effectively attenuated Se-induced toxicity.

a r t i c l e i n f o

a b s t r a c t

Article history: Received 12 October 2019 Received in revised form 2 December 2019 Accepted 3 December 2019 Available online 4 December 2019

Selenium (Se) is the most common micronutrient and that becomes toxic when present at higher concentrations in aquatic environments. Astaxanthin (AST) has been documented to possess antioxidant and anti-inflammatory properties. The aim of this study was to explore the potential of dietary AST and Se exposure on oxidative stress, and inflammatory response in Channa argus. After acclimation, 540 fish were randomly distributed into nine groups housed in twenty-seven glass tanks. The fish were exposed for 8 weeks to waterborne Se at 0, 100 and 200 mg L1 or dietary AST at 0, 50 and 100 mg kg1. The results shown that Se accumulation in the kidney, liver, spleen, intestine and gill were significantly increased following Se exposure, dietary 50 and 100 mg kg1 AST supplementation decreased the accumulation of Se in the kidney, liver, spleen, and intestine. In addition, AST supplementation can decrease oxidative stress and inflammatory response in the liver and spleen following exposure to waterborne Se. These results indicate that AST has the potential to alleviate the effects of Se toxicity in C. argus. © 2019 Elsevier Ltd. All rights reserved.

Handling editor: Willie Peijnenburg Keywords: Astaxanthin Selenium Oxidative stress Inflammatory response Channa argus

1. Introduction Selenium (Se) is an essential trace-element that naturally and ubiquitously occurs in the environment (Gobi et al., 2018). It can

* Corresponding author. College of Animal Science and Technology, Jilin Agricultural University, Changchun, Jilin, 130118, China ** Corresponding author. College of Animal Science and Technology, Jilin Agricultural University, Changchun, Jilin, 130118, China E-mail addresses: [email protected] (G.-Q. Wang), [email protected] (D.-M. Zhang). https://doi.org/10.1016/j.chemosphere.2019.125546 0045-6535/© 2019 Elsevier Ltd. All rights reserved.

regulate lipid metabolism or eliminate excessive reactive oxygen species in animals by synthesizing Se-related antioxidant enzymes, but excessive accumulation is toxic (Kim and Kang, 2015). However, there is very narrow between basic nutrient requirements and toxic doses. High concentrations of Se can be released in mining activities, petrochemical production, agricultural and industrial wastewater (Lemly, 2002). Once Se enters the water environment, it can rapidly accumulate in aquatic animal to reach toxic levels through waterborne and dietary Se exposure (Li et al., 2018a). In general, Se content in natural water such as lakes and rivers are in the range of 1e10 mg L1 though Se content is higher than 1000 mg L1 in mining

2

M.-Y. Li et al. / Chemosphere 244 (2020) 125546

activities, petrochemical production and industrial wastewater (Elia et al., 2011; Kim and Kang, 2014; Gobi et al., 2018). It is well known that many trace elements, including cadmium, manganese, cobalt, lead, mercury, tin, etc., have unknown biological effects and can accumulate in animal organ (Vermeulen, 2003; Karaytug et al., 2007; Yin et al., 2018a, 2018b). Selenium can also accumulate rapidly in fish upon occurrence of high levels of waterborne Se (Li et al., 2018a). Excessive levels of Se accumulation in tissues can affect inflammatory resistance, immune and antioxidant function (Gobi et al., 2018; Li et al., 2018a). Increased inflammatory response can lead to excessive inflammatory factors such as interleukins (ILs) in many organisms, affecting the physiological, biochemical and enzymatic reactions of fish (Kim and Kang, 2015; Li et al., 2018a). ILs are major pro-inflammatory cytokines, originating from lymphocytes, macrophages and monocytes (Li et al., 2018b). IL-1 and IL-8 play a vital role in the regulation of inflammatory cascade and defensive responses (Gou et al., 2018; Li et al., 2019d). Our previous study also suggested that exposure to Se promoted levels of IL-1 and IL-8 (Li et al., 2018a). Apart from inflammatory, waterborne Se exposure inhibits growth, acetylcholinesterase activity and hematological alterations (Kim and Kang, 2014). Therefore, it is necessary to develop potential antagonists against Se-induced inflammatory response, immune response and oxidative stress. Naturally occurring products, astaxanthin (AST), are widely used in the antagonist research on environmental stressors due to its green, economical, and effective (Jagruthi et al., 2014; Yi et al., 2014; Liu et al., 2016; Han et al., 2018; Li et al., 2018b; Wang et al., 2018). AST can be naturally synthesized in some bacteria, microalgae, haematococcus pluvialis and phaffia rhodozyma, which have the advantages of growing in a wide variety of sources, being biodegradable, lacking drug resistance, and being environmentally friendly (Jagruthi et al., 2014; Li et al., 2019a). Our previous study and others reports shown that AST has a variety of biological effects, including can promoting growth, anti-inflammatory and antioxidant status in Channa argus (Yi et al., 2014; Liu et al., 2016; Li et al., 2019a). Wang et al. (2018) have demonstrated that AST can alleviate the oxidative damage induced by high pH stress in Chinese mitten crab (Wang et al., 2018). Jagruthi et al. (2014) have suggested that diets rich in AST can promote growth performance, immune responses and disease resistance in Cyprinus carpio (Jagruthi et al., 2014). In China, C. argus is a commonly farmed fish species. Previous study has shown that diets rich in plan flavonoid and Bacillus subtilis can reduce the toxicity of trace element accumulation (Yin et al., 2018a, 2018b; Li et al., 2019c). However, there have been limited toxicological studies investigating potential antagonists against waterborne Se exposure. To date, there has been no report on the effects of AST supplementation in relation to Se toxicity. Thus, this study aimed to investigate the protective effects of dietary AST and Se exposure on the Se accumulation, oxidative stress and inflammatory response in C. argus.

meal, 12.9% poultry meal, 5% gluten, 5% spraying blood meal, 3% peanut meal, 17.5% flour, 5.9% fish oil, 1% squid offal, 1.5% monocalcium phosphate, 1.5% vitamin premix, 1% mineral mixture, 3% zeolite (Dry matter: crude protein 48.1%, crude lipid 11.3%, ash 12.3%, carbohydrate 20.1%, gross energy, 19.3 kJ g1). The AST,  98% (HPLC, Yuanye Biotechnology, Shanghai, China) was sprayed into the basal diet at doses of 0, 50 and 100 mg kg1 according to the procedures described by our previous study (Li et al., 2019a). Healthy C. argus, juvenile northern snakehead, with similar size 14.58 ± 0.34 g, were purchased from a local fish farm. The fish were placed in 300 L glass aquaria with aerated filtered dechlorinated water and acclimated for two weeks. Water quality parameters including temperature (24 ± 1  C), ammonia (0e0.3 mg L1), pH (7.3e7.4), nitrites (0e0.05 mg L1), dissolved oxygen (6.20 ± 6.40 mg L1) and light cycle (14 h light, 10 h dark photoperiod). After acclimation, 540 fish were randomly distributed into nine groups housed in twenty-seven glass tanks. Each group was exposed to waterborne Se (Sigma, St. Louis, MO, USA) and/or dietary AST. The Se concentrations were 0, 100 and 200 mg L1 and the concentrations of AST were 0, 50 and 100 mg kg1, respectively. The Se concentrations have been used in our previous study (Li et al., 2018a). The fish were hand-fed twice (08:00 and 16:00) a day for 8 weeks at rate of 3% of body weight. Tanks water was replaced one third every two days and then Se were added upon the experimental concentrations. 2.3. Se accumulation At 8 weeks, fish were anesthetized (300 mg L1 MS-222), liver, kidney, spleen, intestine, gill, muscle from each group were sampled to detect Se concentration. Se concentrations were measured by using the method published by our previous study (Li et al., 2018a). Briefly, all tissues were freeze-dried before analysis and cold-digested with 65% (v/v) HNO3. The digested samples were harvested by centrifugation at 10,000g for 30 min and the clear liquid used for Se determination in an atomic absorption spectrometer AA-6300 (Shimadzu, Japan). Water sample were collected and analysed for Se concentration in the same way as tissues, presented in Table 1. 2.4. Oxidative stress The liver and spleen samples were used to analyze the oxidative stress parameters. Superoxide dismutase (SOD) activity, catalase (CAT) activity, glutathione-S-transferase (GST) activity, glutathione peroxidase (GPx) activity, malondialdehyde (MDA) content, protein carbonyl (PC) content were measured according to the method described by Jiang et al. (2017) (Jiang et al., 2017) and Li et al., 2019a,b,c,d were using commercial kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China).

2. Materials and methods 2.5. Related genes expression assay 2.1. Ethical statement and conflict of interest All of the experimental fish handling procedures were used in accordance with NIH Guide on the care and use of fish for scientific purposes developed by the Ethics Committee of Jilin Agricultural University (approval number 20181008). The authors declare that they have no conflict of interest. 2.2. Experimental diet, fish and design The basal diet was composed of 38.7% fish meal, 4% soybean

IL-1b, TNF-a, IL-8, HSP60, HSP70, HSP90, NF-kB p65, MyD88, IkB-a and GR transcriptional expression in liver and spleen were assessed by qPCR. Extraction of total RNA by TRIzol Kit (Takara, Dalian, China). Reverse transcriptase synthesis kit is used to reverse transcribe RNA into DNA. Gene expression levels were measured by useing SYBR with Premix Ex TaqTM П kit (Takara, Dalian, China). The GenBank accession numbers for the selected genes and primer sequences indicated in Table 2. The levels of gene expression were calculated using the 2 DDCt method and normalized using b-actin expression.

M.-Y. Li et al. / Chemosphere 244 (2020) 125546

3

Table 1 Nominal and actual Se concentration in water (mg/L). Groups

Nominal concentration

Actual Se concentration in the experiment weeks

S0A0 S0A1 S0A2 S1A0 S1A1 S1A2 S2A0 S2A1 S2A2

0 0 0 100 100 100 200 200 200

0.07 ± 0.01a 0.06 ± 0.01a 0.07 ± 0.01a 103.46 ± 4.63b 102.44 ± 3.28b 105.54 ± 3.29b 208.63 ± 5.14c 205.55 ± 6.36c 207.32 ± 5.41c

Note: The Data are presented as mean ± S.D. (n ¼ 9). Values in rows with same superscript does not differ significantly (P > 0.05). S0A0: control group; S0A1: AST 50 mg kg1 group; S0A2: AST 100 mg kg1 group; S1A0: Se 100 mg L1 basal diet group; S1A1: Se 100 mg L1, AST 50 mg kg1 group; S1A2: Se 100 mg L1, AST 100 mg kg1 group; S2A0: Se 200 mg L1, basal diet group; S2A1: Se 200 mg L1, AST 50 mg kg1 group; S2A2: Se 200 mg L1, AST 100 mg kg1 group.

Table 2 Real-time PCR primer sequences. Name

Sequence (50 -3’)

product length

Tm ( C)

GenBank ID/Reference

HSP90-F HSP90-R HSP70-F HSP70-R GR-F GR-R MyD88-F MyD88-R HSP60-F HSP60-R IL-1-F IL-1-R IL-8-F IL-8-R TNF-a-F TNF-a-R NF-kB p65-F NF-kB p65-R IkBa-F IkBa-R b-actin-F b-actin-R

TGTATGTCAGGAGGGTGTTT TAGATTGATTTCTGGTTTTC ATTTTGAATGTGTCTGCGGT ACTTGCTGATGATGGGGTTA GGGAAAGACCAGGACTCATA TTCTTGGTTTTCCGTGCTTC AAAGTTGACTTGTGGACGAT ATTGACAGCAACTTTCCCAC CAACCAGCACCGCAAACCT ACCACCTGAAGCCCAACCT GTTTACCTGAACATGTCGGCTTACG AGGGTGCTGATGTTCAGCCCA GAGTCTGAGCAGCCTGGGAGT CTGTTCGCCGGTTTTCAGTG ACAATACCACCCCAGGTCCCA ACGCAGCATCCTCTCATCCAT CAGCCAAAACCAAGAGGGAT TCGGCTTCGTAGTAGCCATG AAAATGTTACCGTGCCAGGAC ATGTATCACCGTCGTCAGTC CACTGTGCCCATCTACGAG CCATCTCCTGCTCGAAGTC

263bp

55

KU946993.1/Li et al. (2019a,b,c,d)a

232bp

56

KU883613.1/Li et al. (2019a,b,c,d)a

241bp

60

KC847473/Li et al. (2019a,b,c,d)a

237bp

61

KT206230.1/Li et al. (2019a,b,c,d)a

189bp

61

KU883612.1/Li et al. (2019a,b,c,d)a

233bp

59

JN085956.1/Li et al. (2019a,b,c,d)a

154bp

61

HF585631/Li et al. (2019a,b,c,d)a

250 bp

61

KF134538.1/Li et al. (2019a,b,c,d)a

233bp

62

KP409186.1/Li et al. (2019a,b,c,d)a

152bp

60

EF407571.1/Li et al. (2019a,b,c,d)a

196bp

57

EF452499/Li et al. (2019a,b,c,d)a

a Mu-Yang Li et al., Astaxanthin enhances hematology, antioxidant and immunological parameters, immune-related gene expression, and disease resistance against in Channa argus, Aquaculture International (2019) 27:735e746.

2.6. Statistical analysis

AST following exposure to 200 mg L1 waterborne Se.

The results were analysed by one-way ANOVA using SPSS 20.0 (IBM, USA). Data were expressed as (Mean ± S.D.), Tukey’s multiple comparison was carried out. P < 0.05 as significant difference.

3.2. Oxidative stress

3. Results 3.1. Se accumulation Se accumulation in six tissues were measured at 8 weeks after waterborne exposure Se and dietary AST supplementation is presented in Fig. 1. The highest levels of Se accumulation were observed in the kidney. Significant accumulation (P < 0.05) in the kidney was observed following exposure to 100 and 200 mg L1 waterborne Se after 8 weeks. Se accumulation in liver, spleen, intestine and gill were also notably increased (P < 0.05) following exposure to 100 and 200 mg L1 waterborne Se after 8 weeks. However, dietary AST supplementation significantly decreased Se accumulation concentrations (P < 0.05) in kidney and liver following exposure to 100 and 200 mg L1 waterborne Se. Se accumulation in spleen and intestine were also significantly decreased (P < 0.05) with supplementation of 50 and 100 mg kg1

Oxidative stress parameters (MDA, PC, CAT, SOD, GPx and GST) in liver and spleen at 8 weeks of waterborne exposure Se and dietary AST supplementation are summarized in Fig. 2. MDA and PC levels were significantly increased (P < 0.05) following exposure to 100 and 200 mg L1 waterborne Se. However, when fish were supplemented with 50 and 100 mg kg1 AST significantly decreased (P < 0.05) MDA contents in liver and spleen compared with the same Se dose groups. PC content in liver and spleen was also significantly decreased (P < 0.05) with supplementation of 50 and 100 mg kg1 AST following exposure to 200 mg L1 waterborne Se. In the co-treatment of the AST and 100 mg L1 Se dose groups, no significant difference (P > 0.05) in PC content was observed except for the 100 mg kg1 AST group in spleen. SOD activity was significantly decreased (P < 0.05) in liver and spleen exposed to100 and 200 mg L1 waterborne Se. However, SOD activity in liver and spleen was significantly increased (P < 0.05) with supplementation of 50 and 100 mg kg1 AST following exposure to 100 mg L1 waterborne Se. In the co-treatment of the AST and 200 mg L1 Se dose groups, no significant difference

4

M.-Y. Li et al. / Chemosphere 244 (2020) 125546

Fig. 1. Se accumulation (kidney, liver, spleen, intestine, gill and muscle) of C. argus (n ¼ 9) after exposure to different dose of Se (0, 100 and 200 mg L1) or dietary AST (0, 50 and 100 mg kg1) at 8 weeks. Data are expressed as the mean ± S.D. Bar with different letters are significantly (P < 0.05) different by Tukey test on the same sampling interval.

(P > 0.05) in SOD activity was observed except for the 100 mg kg1 AST mg kg1 group in liver. No notable difference (P > 0.05) in CAT activity was observed in the liver and spleen after Se exposure except for the 200 mg L1 waterborne Se in spleen. Dietary AST supplementation significantly increased CAT activity (P < 0.05) in kidney and liver following exposure to 100 mg L1 waterborne Se. Compared with the control group, no notable difference (P > 0.05) in GPx activity was observed in the liver and spleen exposed to 100 and 200 mg L1 waterborne Se. GPx activity was significantly increased (P < 0.05) with the co-treatment of the 100 mg kg1 AST and 100 mg L1 Se dose groups, 50 mg kg1 AST and 200 mg L1 Se dose groups in liver, 100 mg kg1 AST and 200 mg L1 Se dose groups in spleen. GST activity was significantly decreased (P < 0.05) in liver and spleen exposed to 200 mg L1 waterborne Se. However, GST activity

in liver and spleen was significantly increased (P < 0.05) with supplementation of 50 and 100 mg kg1 AST following exposure to 200 mg L1 waterborne Se. 3.3. NF-kB and GR signaling pathway gene expression Relative gene expression (IL-1b, TNF-a, IL-8, HSP60, HSP70, HSP90, NF-kB p65, MyD88, IkB-a and GR) in the liver and spleen of C. argus after exposure to Se and dietary AST are summarized in Fig. 3, Fig. 4, and Fig. 5. After 8 weeks, the mRNA levels of IL-1b, TNF-a and IL-8 were significantly increased (P < 0.05) following exposure to 100 and 200 mg L1 waterborne Se. However, when fish were supplemented with 50 and 100 mg kg1 AST significantly decreased (P < 0.05) IL1b and IL-8 mRNA levels in liver and spleen compared with the same Se dose groups. TNF-a mRNA level in liver and spleen was also

M.-Y. Li et al. / Chemosphere 244 (2020) 125546

5

Fig. 2. Oxidative stress parameters in the liver and spleen (SOD: superoxide dismutase, CAT: catalase, GST: glutathione-S-transferase, GPx: glutathione peroxidase, MDA: malondialdehyde and PC: protein carbonyl) of C. argus (n ¼ 9) after exposure to different dose of Se (0, 100 and 200 mg L1) or dietary AST (0, 50 and 100 mg kg1) at 8 weeks. Data are expressed as the mean ± S.D. Bar with different letters are significantly (P < 0.05) different by Tukey test on the same sampling interval.

significantly decreased (P < 0.05) with supplementation of 50 and 100 mg kg1 AST following exposure to 200 mg L1 waterborne Se. In the co-treatment of the AST and 100 mg L1 Se dose groups, no significant difference (P > 0.05) in TNF-a mRNA level was observed except for the 100 mg kg1 AST mg kg1 group in spleen. NF-kB p65 and MyD88 mRNA levels were significantly increased (P < 0.05) following exposure to 100 and 200 mg L1 waterborne Se. NF-kB p65 and MyD88 mRNA levels in liver and spleen were significantly decreased (P < 0.05) with supplementation of 50 and 100 mg kg1 AST following exposure to 200 mg L1 waterborne Se. NF-kB p65 and MyD88 mRNA levels were also significantly decreased (P < 0.05) with supplementation of 50 and 100 mg kg1 AST following exposure to 100 mg L1 waterborne Se in spleen of C. argus. IkB-a mRNA level in liver and spleen were significantly increased (P < 0.05) with supplementation of 50 and 100 mg kg1 AST following exposure to 100 and 200 mg L1 waterborne Se. No notable difference (P > 0.05) in GR mRNA level was observed in the liver and spleen after Se exposure. However, when fish were supplemented with AST significantly increased (P < 0.05) GR mRNA level in spleen and liver compared with the same Se dose groups except for the 100 mg L1 waterborne exposure Se in liver. HSP60, HSP70 and HSP90 mRNA levels were significantly increased (P < 0.05) following exposure to 100 and 200 mg L1 waterborne Se. No notable difference (P > 0.05) in HSP60 mRNA level was observed in the liver and spleen after dietary AST. HSP70 and HSP90 mRNA levels in liver and spleen were significantly decreased (P < 0.05) with supplementation of 50 and 100 mg kg1 AST compared with the same Se dose groups. 4. Discussion Due to bioaccumulation, Se levels in fish tissues were significantly higher than in the surrounding waters (Li et al., 2018a). In this study, exposure to waterborne Se caused significant accumulation in the kidney (the highest accumulation in all tissues) of C. argus. Our previous study also suggested that the kidney was the major bioaccumulation tissue of C. argus exposed to Se (Li et al., 2018a). Kim and Kang (2014) demonstrated that the kidney and liver were major se-accumulating organs exposed to waterborne Se. In the present study, exposure to waterborne Se, the liver was

also found to be significantly accumulated, but lower than the kidney (Kim and Kang, 2014). Elia et al. (2011) also suggested that the bioaccumulation in the tissues of Cyprinus carpio exposed to dietary Se was kidney > liver > muscle (Elia et al., 2011). Our previous study also suggested that the bioaccumulation in the tissues of C. argus exposed to waterborne Se was kidney > liver > spleen > intestine > gill > muscle (Li et al., 2018a). Exposure to waterborne Se also caused significant accumulation in the spleen, intestine and gill of C. argus in this study. However, in this study AST strikingly reduced Se content in the kidney, liver, spleen and intestine following exposure to waterborne Se. Similarly, AMRF diets can reduce the Se accumulation in tissues (such as kidney, liver, spleen and intestine) of C. argus following exposure to waterborne Se (Li et al., 2019c). The difference of trace elements accumulation between tissues is closely related to metabolic activities (Yin et al., 2018b). Karaytug et al. (2007) and Yin et al. (2018a,b) suggested that liver, spleen and intestine are important metabolically active organs and are prone to accumulation of toxic substances (Karaytug et al., 2007; Yin et al., 2018a). High Se exposure causes the hyper-accumulated Se, which generate oxidative stress and is one of the important mechanisms of Se toxicity (Li et al., 2018a). The liver and spleen are important organs for toxic metabolism and immunity. Our previous study suggested Se accumulation in liver can affect antioxidant function and cause oxidative stress (Li et al., 2018a). Elia et al. (2011) also suggested that high level Se diets can cause oxidative stress in liver and spleen of Cyprinus carpio (Elia et al., 2011). MDA and PC are reliable indicators of oxidative stress (Jiang et al., 2017). In this study, oxidative stress products (MDA and PC) were significantly increased following exposure to waterborne Se. Similarly, our previous study also demonstrated that MDA was significantly increased following exposure to waterborne Se (Li et al., 2018a), which may be associated with the Se accumulation in spleen and liver that hinder normal antioxidant function. Therefore, reducing oxidative stress products may be an effective antioxidant intervention approach for oxidative stress. In this study, AST significantly decreased MDA and PC contents in liver and spleen after Se exposure, which may be due to the AST diet removing some of the Se accumulation. The antioxidant defense system is the first line of defense against oxidative stress, connecting pollutants and metabolic changes in aquatic animal (Elia et al., 2011; Gobi et al., 2018).

6

M.-Y. Li et al. / Chemosphere 244 (2020) 125546

Fig. 3. Relative gene expression (TNF-a, IL-1b and IL-8) in the liver and spleen of C. argus (n ¼ 9) after exposure to different dose of Se (0, 100 and 200 mg L1) or dietary AST (0, 50 and 100 mg kg1) at 8 weeks. Data are expressed as the mean ± S.D. Bar with different letters are significantly (P < 0.05) different by Tukey test on the same sampling interval.

CAT, SOD, GPx and GST, known as antioxidant enzymes, can effectively protect cells from oxidative stress and catalyze the reduction of PC and MDA (Jiang et al., 2017). Wang et al. (2018) have demonstrated that AST can alleviate the oxidative damage induced by high pH stress in Eriocheir sinensis (Wang et al., 2018). Additionally, Han et al. (2018) found that dietary AST can reduce oxidative stress in Portunus trituberculatus (Han et al., 2018). Our previous study also showed AST can notably enhanced CAT, SOD and GPx activity in serum of C. argus (Li et al., 2019a). In the present study, AST significantly enhanced the levels of CAT, SOD and GPx in liver and spleen after Se exposure. Therefore, the notable elevation of antioxidant enzyme levels may be a defense mechanism in response to oxidative stress induced by waterborne Se exposure. The inflammatory response system can be used as a potential biomarker that may be sensitive enough to assess toxic substances (Li et al., 2019c). In addition, Inflammatory response can induce oxidative stress in fish (Kim and Kang, 2015; Gobi et al., 2018; Li

et al., 2018a). IL-1b, IL-8 and TNF-a are major pro-inflammatory cytokines, which play an important role in activation, proliferation, differentiation of T and B cells and in the initiation inflammatory response (Gou et al., 2018; Li et al., 2019b, 2019d). Our previous study has demonstrated that IL-1b and TNF-a levels were significantly increased in spleen and liver of C. argus following exposure to waterborne Se (Li et al., 2018a). Similarly, the present results showed that Se exposure significantly upregulates IL-1b, IL8 and TNF-a mRNA levels in spleen and liver of C. argus, which may be related to the accumulation of Se in liver and spleen. However, AST significantly reduced IL-1b, IL-8 and TNF-a mRNA levels after waterborne Se exposure. Our previous study has shown that AST can improve the anti-inflammatory ability of C. argus, which may be achieved by inhibiting NF-kB signaling pathway and p65 phosphorylation (Li et al., 2018b). Previous study has suggested that tributyltin can activate NF-kB protein and increase the levels of inflammatory factors (Zhang

M.-Y. Li et al. / Chemosphere 244 (2020) 125546

7

Fig. 4. Relative gene expression (NF-kB p65, IkB-a, MyD88 and GR) in the liver and spleen of C. argus (n ¼ 9) after exposure to different dose of Se (0, 100 and 200 mg L1) or dietary AST (0, 50 and 100 mg kg1) at 8 weeks. Data are expressed as the mean ± S.D. Bar with different letters are significantly (P < 0.05) different by Tukey test on the same sampling interval.

8

M.-Y. Li et al. / Chemosphere 244 (2020) 125546

Fig. 5. Relative gene expression (HSP60, HSP70 and HSP90) in the liver and spleen of C. argus (n ¼ 9) after exposure to different dose of Se (0, 100 and 200 mg L1) or dietary AST (0, 50 and 100 mg kg1) at 8 weeks. Data are expressed as the mean ± S.D. Bar with different letters are significantly (P < 0.05) different by Tukey test on the same sampling interval.

et al., 2017). Our previous study also showed that Se-induced inflammatory responses are associated with the activation of the NFkB pathways (Li et al., 2019c). NF-kB was an effective inflammatory transcript, which can effectively regulate the transcription of inflammatory cytokines (Neurath and Pettersson, 1997; An et al., 2002; Ko et al., 2017). In response to inflammatory responses, the NF-kB pathways is activated by sequestration from IkB (Li et al., 2018b, 2019c). In this study, we observed the levels of NF-kB p65 gene expression as well as positive correlation with IL-1b, IL-8 and TNF-a gene expression. However, AST significantly downregulated NF-kB p65 mRNA levels, but upregulated IkB-a mRNA levels after waterborne Se exposure in the present study, suggesting that AST reduced IL-1b, IL-8 and TNF-a levels that may be attributed to the down-regulation of p65 levels and up-regulation of IkB levels. In addition, we also found that AST can decrease the gene expression of MyD88 after waterborne Se exposure. In general, the activation of MyD88 is caused by the stimulation of exogenous antigens, such as bacteria and bacterial extracellular product, LPS (Neurath and

Pettersson, 1997; Li et al., 2008). Therefore, Se may activate NF-kB signaling pathway by activating MyD88. GR is a member of the nuclear receptor superfamily and glucocorticoid-dependent transcription factor, which compete with NF-kB for phosphate groups (Tsurufuji et al., 1979; Kanelakis et al., 1999; Garside et al., 2004). Therefore, elevated GR levels contribute to the resistance of the inflammatory response. In this study, AST significantly increased GR mRNA levels in spleen and liver of C. argus, which may contribute to the inhibition of NF-kB p65 levels. Similarly, our previous study also showed that dietary Allium mongolicum Regel flavonoids can increase the gene expression of GR after waterborne Se exposure (Li et al., 2019c). Heat-shock proteins are synthesized by adverse stimulated in the environment (Metzger et al., 2012), therefore, they are also considered to be biomarkers of stress levels in fish. Our previous study showed that dietary Allium mongolicum Regel flavonoids can decrease the levels of HSPs after waterborne Se exposure (Li et al., 2019c). In the present study, AST showed a similar trend for HSP70

M.-Y. Li et al. / Chemosphere 244 (2020) 125546

and HSP90 levels in spleen and liver of C. argus after waterborne Se exposure. The reduction of HSP70 and HSP90 in the spleen and liver may be attributed to a decrease in the accumulation of Se and a decrease in the levels of inflammation and oxidative stress. In conclusion, the results of this study suggest that AST can decrease Se-accumulation, oxidative stress and inflammatory response following Se exposure in C. argus. Author contributions Mu-Yang Li: designed study, analysed data, conducted experiment, drafted paper. Chun-Shan Gao: designed study, analysed data. Xiao-Yan Du: organized data. Lei Zhao: analysed data. XiaoTian Niu: organized data. Gui-Qin Wang: conducted experiment. Dong-Ming Zhang: modified paper. Declaration of competing interest No conflict of interest exits in the submission of this manuscript, and manuscript is approved by all authors for publication. I would like to declare on behalf of my co-authors that the work described was original research that has not been published previously, and not under consideration for publication elsewhere, in whole or in part. Acknowledgments The research was supported by natural science foundation of science and technology department of Jilin Province (20200101025JC), the earmarked fund for modern agro-industry technology research system (CARS-46) and national natural science foundation of China (NO.31372540). References An, S.J., Pae, H.O., Oh, G.S., Choi, B.M., Jeong, S., Jang, S.I., Oh, H., Kwon, T.O., Song, C.E., Chung, H.T., 2002. Inhibition of TNF-a, IL-1b, and IL-6 productions and NF-kB activation in lipopolysaccharide-activated RAW 264.7 macrophages by catalposide, an iridoid glycoside isolated from catalpa ovata G. Don (Bignoniaceae). Int. Immunopharmacol. 2, 1173e1181. Elia, A.C., Prearo, M., Pacini, N., Dorr, A.J., Abete, M.C., 2011. Effects of selenium diets on growth, accumulation and antioxidant response in juvenile carp. Ecotoxicol. Environ. Saf. 74, 166e173. Garside, H., Stevens, A., Farrow, S., Normand, C., Houle, B., Berry, A., Maschera, B., Ray, D., 2004. Glucocorticoid ligands specify different interactions with NFkappaB by allosteric effects on the glucocorticoid receptor DNA binding domain. J. Biol. Chem. 279, 500e509. Gobi, N., Vaseeharan, B., Rekha, R., Vijayakumar, S., Faggio, C., 2018. Bioaccumulation, cytotoxicity and oxidative stress of the acute exposure selenium in Oreochromis mossambicus. Ecotoxicol. Environ. Saf. 162, 147e159. Gou, C., Wang, J., Wang, Y., Dong, W., Shan, X., Lou, Y., Gao, Y., 2018. Hericium caputmedusae (Bull.:Fr.) Pers. polysaccharide enhance innate immune response, immune-related genes expression and disease resistance against Aeromonas hydrophila in grass carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 72, 604e612. Han, T., Li, X., Wang, J., Wang, C., Yang, M., Zheng, P., 2018. Effects of dietary astaxanthin (AX) supplementation on pigmentation, antioxidant capacity and nutritional value of swimming crab, Portunus trituberculatus. Aquaculture 490, 169e177. Jagruthi, C., Yogeshwari, G., Anbazahan, S.M., Mari, L.S., Arockiaraj, J., Mariappan, P., Sudhakar, G.R., Balasundaram, C., Harikrishnan, R., 2014. Effect of dietary astaxanthin against Aeromonas hydrophila infection in common carp, Cyprinus carpio. Fish Shellfish Immunol. 41, 674e680. Jiang, J., Yin, L., Li, J.Y., Li, Q., Shi, D., Feng, L., Liu, Y., Jiang, W.D., Wu, P., Zhao, Y., 2017. Glutamate attenuates lipopolysaccharide-induced oxidative damage and mRNA expression changes of tight junction and defensin proteins, inflammatory and apoptosis response signaling molecules in the intestine of fish. Fish Shellfish Immunol. 70, 47e55.

9

Kanelakis, K.C., Morishima, Y., Dittmar, K.D., Galigniana, M.D., Takayama, S., Reed, J.C., Pratt, W.B., 1999. Differential effects of the hsp 70-binding protein BAG-1 on glucocorticoid receptor folding by the hsp90-based chaperone machinery. J. Biol. Chem. 274, 34134e34140. Karaytug, S., Erdem, C., Cicik, B., 2007. Accumulation of cadmium in the gill, liver, kidney, spleen, muscle and brain tissues of Cyprinus carpio. Ekoloji 16, 16e22. Kim, J.H., Kang, J.C., 2014. The selenium accumulation and its effect on growth, and haematological parameters in red sea bream, Pagrus major, exposed to waterborne selenium. Ecotoxicol. Environ. Saf. 104, 96e102. Kim, J.H., Kang, J.C., 2015. Oxidative stress, neurotoxicity, and non-specific immune responses in juvenile red sea bream, Pagrus major, exposed to different waterborne selenium concentrations. Chemosphere 135, 46e52. Ko, E.Y., Cho, S.H., Kwon, S.H., Eom, C.Y., Jeong, M.S., Lee, W.W., Kim, S.Y., Heo, S.J., Ahn, G., Kang, P.L., 2017. The roles of NF-kB and ROS in regulation of proinflammatory mediators of inflammation induction in LPS-stimulated zebrafish embryos. Fish Shellfish Immunol. 68, 7e18. Lemly, A.D., 2002. Selenium Assessment in Aquatic Ecosystems, vol. 63. Springer, pp. 292e296. Li, M.-Y., Liu, X.-Y., Xia, C.-G., Wang, G.-Q., Zhang, D.-M., 2019a. Astaxanthin enhances hematology, antioxidant and immunological parameters, immunerelated gene expression, and disease resistance against in Channa argus. Aquacult. Int. 27, 735e746. Li, M., Zhu, X., Tian, J., Liu, M., Wang, G., 2018a. Bioaccumulation, oxidative stress, immune responses and immune-related genes expression in northern snakehead fish, Channa argus, exposure to waterborne selenium. Mol. Biol. Rep. 46, 947e955. Li, M., Zhu, X., Tian, J., Liu, M., Wang, G., 2019b. Dietary flavonoids from Allium mongolicum Regel promotes growth, improves immune, antioxidant status, immune-related signaling molecules and disease resistance in juvenile northern snakehead fish (Channa argus). Aquaculture 501, 473e481. Li, M.Y., Guo, W.Q., Guo, G.L., Zhu, X.M., Niu, X.T., Shan, X.F., Tian, J.X., Wang, G.Q., Zhang, D.M., 2019c. Effect of sub-chronic exposure to selenium and Allium mongolicum Regel flavonoids on Channa argus: bioaccumulation, oxidative stress, immune responses and immune-related signaling molecules. Fish Shellfish Immunol. 91, 122e129. Li, M.Y., Sun, L., Niu, X.T., Chen, X.M., Tian, J.X., Kong, Y.D., Wang, G.Q., 2018b. Astaxanthin protects lipopolysaccharide-induced inflammatory response in Channa argus through inhibiting NF-kappaB and MAPKs signaling pathways. Fish Shellfish Immunol. 86, 280e286. Li, M.Y., Zhu, X.M., Niu, X.T., Chen, X.M., Tian, J.X., Kong, Y.D., Zhang, D.M., Zhao, L., Wang, G.Q., 2019d. Effects of dietary Allium mongolicum Regel polysaccharide on growth, lipopolysaccharide-induced antioxidant responses and immune responses in Channa argus. Mol. Biol. Rep. 46, 2221e2230. Li, Z., Zhang, D.K., Yi, W.Q., Ouyang, Q., Chen, Y.Q., Gan, H.T., 2008. NF-kB p65 antisense oligonucleotides may serve as a novel molecular approach for the treatment of patients with ulcerative colitis. Arch. Med. Res. 39, 729e734. Liu, F., Shi, H., Guo, Q., Yu, Yebing, Wang, A., Lv, F., Shen, W., 2016. Effects of astaxanthin and emodin on the growth, stress resistance and disease resistance of yellow catfish (Pelteobagrus fulvidraco). Fish Shellfish Immunol. 51, 125e135. Metzger, D.C., Pratt, P., Roberts, S.B., 2012. Characterizing the effects of heavy metal and vibrio exposure on hsp 70 expression in crassostrea gigas gill tissue. J. Shellfish Res. 31, 627e630. Neurath, M.F., Pettersson, S., 1997. Predominant Role of NF-kB p65 in the pathogenesis of chronic intestinal inflammation. Immunobiology 198, 91. Tsurufuji, S., Sugio, K., Takemasa, F., 1979. The role of glucocorticoid receptor and gene expression in the anti-inflammatory action of dexamethasone. Nature 280, 408e416. Vermeulen, N.P., 2003. Fish bioaccumulation and biomarkers in environmental risk assessment: a review. Environ. Toxicol. Pharmacol. 13, 57e149. Wang, Z., Cai, C.F., Cao, X.M., Zhu, J.M., He, J., Wu, P., Ye, Y.T., 2018. Supplementation of dietary astaxanthin alleviated oxidative damage induced by chronic high pH stress, and enhanced carapace astaxanthin concentration of Chinese mitten crab Eriocheir sinensis. Aquaculture 483, 230e237. Yi, X., Xu, W., Zhou, H., Zhang, Y., Luo, Y., Zhang, W., Mai, K., 2014. Effects of dietary astaxanthin and xanthophylls on the growth and skin pigmentation of large yellow croaker Larimichthys croceus. Aquaculture 433, 377e383. Yin, Y., Yue, X., Zhang, D., Zhang, P., Abdallah, A., Yin, Y., Cai, Y., Li, Y., 2018a. Study of bioaccumulation, hematological parameters, and antioxidant responses of Carassius auratus gibelio exposed to dietary lead and Bacillus subtilis. Biol. Trace Elem. Res. 6, 1e8. Yin, Y., Zhang, P., Yue, X., Du, X., Li, W., Yin, Y., Yi, C., Li, Y., 2018b. Effect of subchronic exposure to lead (Pb) and Bacillus subtilis on Carassius auratus gibelio: bioaccumulation, antioxidant responses and immune responses. Ecotoxicol. Environ. Saf. 161, 755e762. Zhang, C.N., Zhang, J.L., Ren, H.T., Zhou, B.H., Wu, Q.J., Sun, P., 2017. Effect of tributyltin on antioxidant ability and immune responses of zebrafish ( Danio rerio ). Ecotoxicol. Environ. Saf. 138, 1e8.