Effect of T-2 toxin-contaminated diet on common carp (Cyprinus carpio L.)

Fish & Shellfish Immunology 60 (2017) 458e465

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Full length article

Effect of T-2 toxin-contaminated diet on common carp (Cyprinus carpio L.) Iveta Matejova a, b, Martin Faldyna b, *, Helena Modra c, Jana Blahova a, Miroslava Palikova d, Zdenka Markova d, Ales Franc e, Monika Vicenova b, Libor Vojtek f, Jana Bartonkova f, Pavla Sehonova a, Martin Hostovsky a, Zdenka Svobodova a a Department of Animal Protection, Welfare and Behavior, University of Veterinary and Pharmaceutical Sciences Brno, Palackeho tr. 1946/1, 612 42 Brno, Czechia b Department of Immunology, Veterinary Research Institute, Hudcova 296/70, 621 00 Brno, Czechia c Department of Zoology, Fisheries, Hydrobiology and Apiculture, Mendel University in Brno, Zemedelska 1, 613 00 Brno, Czechia d Department of Ecology and Diseases of Game, Fish and Bees, University of Veterinary and Pharmaceutical Sciences Brno, Palackeho tr. 1946/1, 612 42 Brno, Czechia e Department of Pharmaceutics, University of Veterinary and Pharmaceutical Sciences Brno, Palackeho tr. 1946/1, 612 42 Brno, Czechia f Department of Animal Physiology and Immunology, Masaryk University, 61137 Brno, Czechia

a r t i c l e i n f o

a b s t r a c t

Article history: Received 24 July 2016 Received in revised form 6 November 2016 Accepted 9 November 2016 Available online 10 November 2016

The T-2 toxin, a fungal metabolite produced by Fusarium molds, occurs in a range of agriculture products. Reduced availability of fish meal has led to increasing use of cereals as a source of protein in commercial aquaculture feeds, which has increased the potential for mycotoxin contamination. The purpose of this study was to investigate toxicity of T-2 toxin intake in common carp (Cyprinus carpio L.) using haematological, biochemical and immunological parameters and oxidative stress indices. In a four-week feeding trial, fish were fed a commercial diet with 5.3 mg/kg T-2 toxin added. Ingestion of contaminated diet did not lead to mortality of fish, probably due to lower feed intake. On the other hand, it significantly affected haematological variables such as haematocrit, haemoglobin, red blood cell counts leading to anemia and white blood cell counts leading to leukopenia due to lymphopenia. Plasma glucose concentration and alanine amino transferase activity showed a significant increase while triglycerides concentration decreased. Activity of ceruloplasmin was significantly decreased in plasma. Further, liver glutathione Stransferase activity was significantly increased and catalase activity decreased, in parallel with a significant increase in caudal kidney catalase activity and a decrease in glutathione peroxidase activity. Finally, lipid peroxidation (detected as malondialdehyde) was significantly increased in the liver and caudal kidney. Changes in non-specific immune response and cytokine levels in head kidney indicated immune system sensitivity to T-2 toxin. Overall, the results demonstrate that this feed-borne mycotoxin is able to induce anaemia and oxidative stress and cause changes in the immune response of common carp. © 2016 Elsevier Ltd. All rights reserved.

Keywords: Mycotoxin Trichothecenes Fusarium TBARS Complement Phagocytes

1. Introduction The T-2 toxin is a trichothecene mycotoxin produced by a number of Fusarium species. These fungi infect crops such as maize, barley, wheat and soy in the field and their toxins contaminate the grains and theirs products [1]. Over recent years, plant protein has become an increasingly affordable replacement for fishmeal,

* Corresponding author. E-mail address: [email protected] (M. Faldyna). http://dx.doi.org/10.1016/j.fsi.2016.11.032 1050-4648/© 2016 Elsevier Ltd. All rights reserved.

leading to an increase in the risk of mycotoxin contamination in aquacultural feeds [2]. Naturally contaminated ingredients used in commercial fish feeds remain toxic, even after extrusion processing [3]. In fish, dietary exposure to 1.5e5.0 mg/kg T-2 toxin is responsible for a decrease in body weight and feed conversion, depressed haematocrit and haemoglobin values and histopathological changes to the stomach and kidneys [3,4]. In rainbow trout (Oncorhynchus mykiss), feeding with >2.5 mg/kg T-2 toxin resulted in a reduction in growth in parallel with reduced feed intake

I. Matejova et al. / Fish & Shellfish Immunology 60 (2017) 458e465

efficiency and depressed haematocrit and haemoglobin concentration, the results being dose-dependent. Higher doses (>8 mg/kg) caused shedding of epithelial cells of the intestinal mucosa along with focal haemorrhaging and an enlarged spleen and gall bladder [5,6] Exposure of early zebrafish embryo life-stages to 0.20 mmol/L or higher caused behavioural changes and induced overproduction of reactive oxygen species (ROS) and cellular apoptosis, leading to tail deformities and cardiovascular defects [7]. While herbi- or omnivorous fish appear less sensitive to the effects of mycotoxins than carnivorous fish, they are at higher risk of exposure as commercial feed for herbivorous fish contains a higher ratio of plant-sourced ingredients [8]. One of the most important omnivorous species in aquacultural production is the common carp (Cyprinus carpio L.). In this study, we assess the effects of T-2 toxin-contaminated feed on the carp's immune system and measure a range of haematological, biochemical and oxidative stress parameters. 2. Materials and methods 2.1. Fish and experimental conditions Common carp (n ¼ 120; 77 ± 20 g) obtained from the breeding facility of the Department of Zoology, Fisheries, Hydrobiology and Apiculture at Mendel University in Brno (Czech Republic) were randomly assigned to eight 200 L tanks (15 carp per tank). The fish were maintained in a flow-through bath system with a 12 h exchange, with photoperiod maintained at 12 h light:12 h dark. The aquaria were continuously aerated and cleaned daily by siphoning off faeces and debris. The fish were acclimatised to laboratory conditions for two weeks, during which time they received a twice-daily excess of preweighed commercial diet (Skretting F-1P B40 2.5 mm, Trout Nutrition Deutschland GmbH, Germany) at a ratio of 1% of estimated body mass. After the adaptation period, the tanks were randomly divided into four control and four experimental groups. During the four-week experimental trial, the experimental groups were fed a diet containing 5.34 mg/kg T-2 toxin (Sigma Aldrich, Czech Republic; D0156) and the control groups the same diet without the T-2 toxin (see below). Water quality parameters throughout the acclimatisation and exposure period were as follows: water temperature 21.8e23.4  C, dissolved oxygen 83.3e95.5% and pH 7.9e8.3. Chemical parameters were: total ammonia   0.1e0.25 mg/L, NO 3 60 mg/L, NO2 3e5 mg/L and Cl 16 mg/L. At the end of the trial, blood samples were collected from the control (n ¼ 28; seven fish per tank) and experimental (n ¼ 28; seven fish per tank) groups by puncturing the caudal vessels with a heparin-treated syringe, the blood then being placed in 1.5 mL tubes containing sodium heparin (0.01 mL/mL of blood). Plasma samples obtained by centrifuging blood at 800 g (4  C, 10 min) were stored at 85  C until analysed for ferric reducing ability of plasma (FRAP), ceruloplasmin activity and biochemical parameters. After blood sampling, the fish were euthanised and tissue samples taken for oxidative stress parameters (caudal kidney, liver) and quantitative real-time PCR (head kidney, liver). 2.2. Preparation of feed The experimental diet was prepared by adding T2-toxin (Sigma Aldrich) to commercial pellets (Skretting F-1P B40 2.5 mm) in several separate steps. First, 19.5 g of Eudragit® E 100 (Basic Butylated Methacrylate Copolymer, Evonik Industries, Germany) was dissolved in 116.5 g of ethanol (Merck, Germany) by mixing with an Ikamag electromagnetic stirrer (IKA, Germany) for 60 min (“solution A”). A 10 mL aliquot of ethanol was injected into a vial

459

containing 25 mg of T2-toxin in order to reconstitute the toxin. Next, the reconstituted toxin was then poured into a beaker and made up to 50.0 g with ethanol. Forty grams of this solution (“solution B”) was mixed with “solution A”, producing a solution equivalent to 20 mg T2-toxin. A 20 mg equivalent was prepared instead of 15 mg as up to 33% loss of T2-toxin is expected during preparation of pellets with such a small amount of active substance. This level of loss has been experimentally verified when preparing pellets by the same method with other substances [9,10]. Next, 2964.9 g of pellets and 15.6 g of Aerosil® 200 (Hydrophilic Fumed Silica, Evonik Industries, Germany) were placed into a Cube Mixer KB 15 blender (Erweka, Germany) and mixed for five minutes at 40 rpm, after which 176.0 g of the 20 mg T2-toxin mixture (“solution A” þ “solution B”) was uniformly and carefully poured onto the surface of the blended excipients. The mixture thus moistened was then kneaded for five minutes at 40 rpm. The final mixture was then placed in a Memmert UNB 500 hot air dryer (Fischer Scientific, Germany) at 50  C for four hours. The uniform solid dispersion of T2-toxin in the polymer was formed on the pellet surface. As a result, it is assumed that the pellets have a highly uniform content of active substance, with a theoretical efficiency of 5 mg of T2-toxin per kg of impregnated pellets. The control feed was prepared the same methods without the T2 toxin adding. 2.3. Analysis of mycotoxins Content of T-2 toxin; HT-2 toxin; deoxynivalenol; 3acetyldeoxynivalenol; 15-acetylnivalenol; diacetoxyscirpenol; fumonisin B1, B2 and B3; nivalenol; ochratoxin A and zearalenone in control and experimental feed was analysed using liquid chromatography-tandem mass spectrometry (LC-MS/MS) according to ISO 17025 standard methods at the Metrology and Testing Laboratory of the Institute of Chemical Technology (Prague, Czech Republic). Analysis of the feed used in this study indicated 5.34 mg/ kg of T-2 toxin in the experimental diet. All other mycotoxins in the experimental control feeds were below the limits of detection. 2.4. Haematological and biochemical profile Determination of erythrocyte count (RBC) and leukocyte count (WBC) was carried out on heparinised blood diluted with NattHerricks solution at a ratio of 1:200. Haemoglobin concentration (Hb) was determined using the photometric cyanohaemoglobin method. Haematocrit values (PCV) were determined using ‘deduction perfect centrifugation’ of blood in capillary tubes. These procedures, along with mean corpuscular volume (MCV), mean corpuscular haemoglobin (MCH) and mean corpuscular haemoglobin concentration (MCHC), were carried out using the unified methods for haematological examination of fish of Svobodova et al. [11]. Blood smears were stained using May-Grünwald and GiemsaRomanowski stains. Two hundred leukocytes were counted for each smear and classified as absolute values of neutrophil granulocytes, lymphocytes and monocytes. Blood plasma obtained from heparinised blood samples was also used for the determination of biochemical indices covering parameters of metabolism of sugars, proteins, fat, and ions and enzymes associated with function of liver, including glucose, total protein (TP), albumin (ALB), ammonium, triglycerides (TAG), total cholesterol (CHOL), inorganic phosphorus, total calcium, lactate, lactate dehydrogenase (LDH), alanine aminotransferase (ALT), aspartate aminotransferase (AST), and alkaline phosphatase (ALP). All analyses were performed using aKonelab 20i biochemical analyser (Thermo Electron Co., Finland) or commercial kits (Biovendor PLC, Czech Republic).

460

I. Matejova et al. / Fish & Shellfish Immunology 60 (2017) 458e465

2.5. Immunological profile Complement activity was measured using the bioluminescent K12Escherichia coli strain (pEGFPluxABCDEamp) described in Atosuo et al. [12]. Light emitted by living cells was measured using aLM01-Tluminometer (Immunotech, Czech Republic). Total complement activity was determined against 100,000 cells/well. Diminishment of the light signal was positively correlated with decreasing viability of bacteria. Relative results of complement activity were computed as the difference between final time of measurement (two hours) and the time needed to kill 50% of bacterial cells. Phagocyte oxidative burst was measured using the luminolenhanced chemiluminescent method as a phagocytosis marker. Phagocytes were activated using opsonised Zymosan A from Saccharomyces cerevisiae (Sigma, USA; opsonised through incubation with carp serum) at a final concentration of 0.25 mg/L. The luminescent signal produced by luminol dissolved in borate buffer (pH ¼ 9) was measured using the LM01-T luminometer (Immunotech, Czech Republic). Fresh blood samples were diluted 50times in Hank's balanced buffer. The results are expressed as total intensity of respiratory (oxidative) burst defined by the integral of the reaction curve area, as described in Buchtikova et al. [13]. Level of total immunoglobulins (Igs) was measured using zinc sulphate heptahydrate (0.7 mol/L, pH ¼ 5.8) precipitation according to McEwan et al. [14]. Igs concentration was quantified as the total protein level in the sample before and after precipitation, calculated using a commercially available kit (Bio-Rad, USA). Final Igs concentration (g/L) was determined as the difference between total plasma protein concentration and the concentration of proteins in the supernatant after precipitation and centrifugation.

2.6. Quantitative RT-PCR Samples of head kidney and liver tissue were removed from randomly selected fish in the control (n ¼ 6; three per aquarium) and experimental (n ¼ 6; three per aquarium) groups and immediately stabilised in RNA later (Qiagen, Germany). These samples were kept at 4  C for 24 h and subsequently frozen at 85  C. The samples were removed from the stabilisation reagent, lysed in 1 mL TRI reagent RT (Molecular Research Center, USA) and homogenised on a MagNALyser (Roche, Switzerland) with zirconia/silica beads (BioSpec Products, USA). After 4-Bromoanisole phase separation in the TRI Reagent, the total RNA was isolated and purified using the RNeasy Kit (Qiagen, Germany) according to the manufacturer's instructions. Reverse transcription of RNA was carried out using MMLV reverse transcriptase (200 U) (Invitrogen, UK) and oligo-dT primers at 37  C for 1.5 h. The cDNA was stored at 20  C until PCR analysis. Quantitative real-time PCR (qRT-PCR) was performed with the 480 Light Cycler (Roche) using the QuantiTect SYBR Green PCR Kit (Qiagen, Germany). The primers for real-time amplification of the four most important inflammatory cytokines (TNF-a, IL-1b, TGF-b, IL-10) and genes for stress and detoxification (cytochrome P450 2F2, CYP450 2F2; catalase, CAT), blood clotting (fibrinogen, FIB), hypoxia-inducible gene (erythropoietin, EPO) and biomarkers of stress and environmental insult (heat shock proteins, HSP60 and HSP70), along with primers for two candidate reference genes (40S and b-actin), were all adapted from Reynders et al. [15], Stolte et al. [16], Bernier et al. [17] and Xing et al. [18] (Table 1). The 40S gene was selected for normalisation of expression data using the Ref. Finder tool (http://www.leonxie.com/referencegene.php). The relative expression of the gene of interest (GOI) was calculated according to the formula: [1/(2CtGOI)])/[1/(2Ctb40S)] [19].

Table 1 List of primers used for real-time PCR. Gene

Forward primer 50 - 30

Reverse primer 30 - 50

TNF-a IL-1b TGF-b IL-10 CYP450 2F2 CAT FIB EPO HSP60 HSP70 40S b-actin

GCTGTCGCTTCACGCTCAA TAGGAGGCCAGTGGCTCTGT ACGCTTTATTCCCAACCAAA AAGGAGGCCAGTGGCTCTGT GCCATTAGCATCAGACCC GCCAAAGTGTTCGAGC GGCAGACGGATGTTTAC CCCATTACGCCCCATCTG CGCTCAGGTGGCTACTATTTC TGAGAACATCAACGAGCCCA CCGTGGGTGACATCGTTACA GCTATGTGGCTCTTGACTTCGA

CCTTGGAAGTGACATTTGCTTTT CCTGAAGAGGAGGCTGTCA GAAATCCTTGCTCTGCCTCA CCTGAAGAAGAGGCTGTCA CAATGCACTTCAGGAGAC GGTGAGTCTGCGGATT ATGCCGCTCATCTCAA TCCCATGCCTCCTTAATGAAA ACACCCTTACGACCGACTTTC TTGTCAAAGTCCTCCCCACC TCAGGACATTGAACCTCACTGTCT CCGTCAGGCAGCTCATAGCT

CYP450 2F2 e cytochrome P450 2F2; CAT e catalase; FIB e fibrinogen; EPO e erythropoietin; HSP60 and HSP70 e heat shock proteins.

2.7. Biomarkers of oxidative stress and detoxifying enzymes Activity of detoxifying enzymes (glutathione S-transferase, GST) and indices of oxidative stress (glutathione reductase, GR; glutathione peroxidase, GPx; catalase, CAT; concentration of thiobarbituric acid reactive substances, TBARS) were measured in samples of liver and caudal kidney. The tissue samples were homogenised in a phosphate buffer (pH ¼ 7.4) and divided into two portions: the first for measuring TBARS and the second centrifuged (11,000 g, 4  C, 20 min) to obtain a supernatant fraction for measuring indices of oxidative stress and protein content. Activity of GST was determined by measuring conjugation of 1chloro-2,4-dinitrobenzene with reduced glutathione at 340 nm [20], activity being expressed as the nmol of the product formed per min per mg of protein. Activity of GR was determined spectrophotometrically by measuring NADPH oxidation at 340 nm [21]. Activity of GPx was calculated from the rate of NADPH oxidation caused by reaction with GRat340 nm when H2O2 was used as oxidizing agent as already described [22], while activity of GR and GPx was expressed as the nmol of NADPH consumption per min per mg of protein. Activity of CAT was determined spectrophotometrically by measuring H2O2 breakdown at 240 nm, specific activity being expressed as the mmol of decomposed H2O2 per min per mg of protein [23]. Protein concentration was measured using bicinchoninic acid [24]. To check lipid peroxidation, malondialdehyde was measured by the TBARS method at 535 nm, as described by Lushchak et al. [25], with concentration expressed as nmol of TBARS per gram of tissue wet weight. Defrosted plasma samples were used to spectrophotometrically determine ceruloplasmin activity, according to Ceron and Martinez-Subiela [26], and FRAP, according to Haluzova et al. [27], using a Konelab 20i biochemical analyser (Thermo Fisher Scientific, USA). 2.8. Statistical analysis All statistical analyses were undertaken using GraphPad Prism 5 statistical software (GraphPad Software, USA). Data were assessed using the unpaired non-parametric Mann-Whitney U test, with differences considered statistically significant at *p < 0.05, **p < 0.01 and ***p < 0.001. 3. Results No mortalities occurred during the 28-day experiment following intake of T-2 toxin at an experimental concentration of 5.3 mg/kg. Fish in all groups were observed taking the pellets for at

I. Matejova et al. / Fish & Shellfish Immunology 60 (2017) 458e465

least 20 min, though fish in the experimental group displayed perceptibly less interest in feeding. 3.1. Haematological and biochemical profile Consumption of the T-2 toxin-contaminated diet led to a significant decrease (p < 0.001) in Hb, RBC, PCV and WBC, including lymphocytes and neutrophil granulocytes (bands and segments). In contrast, the number of monocytes and other haematological indices did not change (Table 2). A significant increase (p < 0.001) in ALT and glucose was observed in blood plasma, along with a significant decrease (p < 0.05) in TAG, following exposure to T-2 toxin (Table 3). Other biochemical blood plasma indices (TP, ALB, AST, ALP, lactate, LDH, inorganic phosphorus, total calcium, ammonium, CHOL) showed no significant change following exposure to T-2 toxin (data not shown). 3.2. Immunological profile

461

Table 3 Biochemical indices for common carp in control (n ¼ 36) and experimental groups (n ¼ 28) fed with T-2 toxin-contaminated diet (5.3 mg/kg) for 28 days. Indices

Control

Experimental

ALT (mkat/L) GLU (mmol/L) TAG (mmol/L)

1.47 ± 0.24 3.36 ± 0.15 2.12 ± 0.10

3.51 ± 0.36*** 4.14 ± 0.12*** 1.75 ± 0.10*

Data are expressed as mean ± SEM. Significant differences between groups are shown as * (p < 0.05) or *** (p < 0.001). ALT e alanine aminotransferase; GLU e glucose; TAG e triacylglycerols; SEM e standard error of the mean.

Table 4 Immunological indices for common carp in control (n ¼ 20) and experimental groups (n ¼ 20) fed with T-2 toxin-contaminated diet (5.3 mg/kg) for 28 days. Group

Control

Experimental

CL (curve area in thousands) CL (area in thousands per 1000 phagocytes) Total Igs(g/L) Complement (min)

74.77 ± 14.88 17.48 ± 3.68 9.85 ± 1.49 48.60 ± 3.80

24.88 ± 7.37** 7.66 ± 1.75* 8.47 ± 0.96 63.40 ± 4.04*

A decrease in the number of band and segment neutrophils correlated well with a significant decrease (p < 0.01) in phagocyte activity (phagocyte oxidative burst). This decline was apparent even when activity was recalculated per 1000 phagocytes (p < 0.05). The level of total immunoglobulins decreased following T-2 toxin consumption, though the decrease was not statistically significant. In contrast, non-specific humoral immunity (complement activation) was significantly increased (p < 0.05; Table 4).

Data are expressed as mean ± SEM. Significant differences between groups are shown as * (p < 0.05) or ** (p < 0.01). CL e chemiluminescence; SEM e standard error of the mean.

3.3. Quantitative RT-PCR

4. Discussion and conclusion

Genes for TNF-a (p < 0.01) and IL-10 (p < 0.05) were significantly up-regulated in head kidneys of T-2 toxin-treated fish. Other genes in the head kidney did not differ significantly after 28-days exposure. No significant difference in mRNA expression was observed in the liver in either the control or experimental groups (Fig. 1).

The T-2 toxin is known to be a potent myelotoxin and haematotoxin in humans and land-based animals [28]; however, limited information is available concerning the haematological effects of T2 toxin on fish. In general, abnormal levels of RBC and WBC would occur either as a consequence of their destruction in the circulatory system or failure of haematopoiesis. With red blood cells, the T-2 toxin is able to interact with the cell membranes of circulating erythrocytes and disrupt red cell morphology, leading to anaemia [29]. In our study, the decrease in RBC, Hb and PCV values with no change in MCV, MCH and MCHC were found. The lack of any change in mRNA expression for erythropoietin in T-2 treated fish in our study suggests that the decrease in RBC is a result of haemolysis, rather than a decrease in erythropoietin synthesis. The normal erythrocyte characteristics (MCV, MCH, MCHC) observed reflect haematopoiesis physiological processes without the influence of T-

3.4. Oxidative stress indices and detoxifying enzyme There was a significant increase (p < 0.001) in GST activity and decrease (p < 0.001) in CAT activity in the liver of treated fish. In contrast, there was a significant increase in CAT activity (p < 0.01) and decrease (p < 0.01) in GPx activity in the caudal kidney. Lipid peroxidation (TBARS) in both the liver and caudal kidney was significantly enhanced in fish treated with the T-2 toxin compared

to the control group (p < 0.01; Table 5). Compared to the control, ceruloplasmin activity was significantly increased (p < 0.001) in fish exposed to the T-2 toxin (Table 6).

Table 2 Haematological indices for common carp in control (n ¼ 20) and experimental groups (n ¼ 20) fed with a T-2 toxin-contaminated diet (5.3 mg/ kg) for 28 days. Parameter

Control

Experimental

RBC (T/L) MCV (f/L) MCH (p/g) MCHC (g/L) Hb (g/L) PCV (L/L) WBC (G/L) Lymphocytes (G/L) Neutrophil granulocytes (bands þ segments) (G/L) (Meta)myelocytes (G/L) Monocytes (G/L)

2.03 ± 0.11 173.49 ± 9.44 42.61 ± 2.05 247.53 ± 3.92 82.57 ± 1.49 0.34 ± 0.01 31.65 ± 3.66 30.46 ± 3.48 0.74 ± 0.13 0.11 ± 0.03 0.31 ± 0.05

1.56 ± 0.06*** 182.91 ± 6.90 44.12 ± 1.92 241.08 ± 3.93 66.86 ± 1.19*** 0.28 ± 0.01*** 15.13 ± 1.84*** 14.42 ± 1.71*** 0.18 ± 0.04*** 0.23 ± 0.05 0.30 ± 0.09

Data are expressed as mean ± SEM. Significant differences between groups are shown as *** (p < 0.001). Hb e haemoglobin concentration; PCV e haematocrit; WBC e leukocyte count; RBC e erythrocyte count; MCV e mean corpuscular volume; MCH e mean corpuscular haemoglobin; MCHC e mean corpuscular haemoglobin concentration; SEM e standard error of the mean.

462

I. Matejova et al. / Fish & Shellfish Immunology 60 (2017) 458e465

Fig. 1. Graphs showing values for gene expression versus the house-keeping gene 40S. Bars represent geometric mean values.

I. Matejova et al. / Fish & Shellfish Immunology 60 (2017) 458e465 Table 5 Oxidative stress indices for the liver and caudal kidney of common carp in control (n ¼ 36) and experimental groups (n ¼ 36) fed with T-2 toxin-contaminated diet (5.3 mg/kg) for 28 days. Group

Liver

Caudal kidney

Control

Experimental

Control

Experimental

CAT GPx GR GST TBARS

293.45 ± 14.24 189.78 ± 7.32 7.62 ± 0.23 90.33 ± 2.89 16.56 ± 0.65

220.08 ± 10.68*** 208.10 ± 6.57 7.77 ± 0.31 108.80 ± 3.04*** 26.00 ± 1.08***

34.83 ± 2.13 302.16 ± 8.39 18.14 ± 1.07 470.36 ± 27.65 11.04 ± 0.59

43.93 ± 2.41** 265.29 ± 9.68** 18.32 ± 1.60 434.80 ± 14.14 15.08 ± 0.99**

Data are expressed as mean ± SEM. Significant differences between groups are shown as ** (p < 0.01) or *** (p < 0.001). CAT e catalase (mmol/min/mg protein); GPxe glutathione peroxidase (nmol/min/ mg protein); GR e glutathione reductase (nmol/min/mg protein); GST e glutathione S-transferase (nmol/min/mg protein); TBARS e thiobarbituric acid reactive substance (nmol/gw.w.); SEM e standard error of the mean.

Table 6 Activity of ceruloplasmin and ferric reducing ability (FRAP) in plasma of common carp in control (n ¼ 36) and experimental groups (n ¼ 36) fed with T-2 toxincontaminated diet (5.3 mg/kg) for 28 days. Group

Control

Experimental

Ceruloplasmin (DA/min x 10,000) FRAP (Fe2þ equivalent mmol/L)

97.96 ± 3.98 701.17 ± 15.74

137.82 ± 9.30*** 746.26 ± 20.88

Data are expressed as mean ± SEM. Significant differences between groups are shown as *** (p < 0.001). SEM e standard error of the mean.

2 toxin. In previous studies, dose-dependent depression of PCV and Hb concentration has also been observed in rainbow trout and channel catfish (Ictalurus punctatus) following dietary intake of T-2 toxin [3,6]. Previous studies on the effect of T-2 toxin on circulating white blood cells have shown strong leukopenia [28]. Indeed, the most pronounced changes in our study were observed in WBC and lymphocyte count, with both indices falling below 50%. The ratio of neutrophil granulocyte forms also changed in our study, with the number of mature forms (bands and segments) decreasing. This was partially compensated for by an increase in the number of younger, less mature forms (metamyelocytes and myelocytes). The decrease in neutrophil count in T-2 treated fish was correlated with a drop in phagocytic activity measured as chemiluminescence in whole blood assay. This decrease was also significant when the results were recalculated to 1000 phagocytes. The drop in phagocytic activity was a result of the change in the ratio between mature and immature neutrophils; since immature forms do not release as many oxygen radicals as do mature forms. This indicates suppression of the non-specific cellular immune response. While phagocytic activity decreased, humoral non-specific immunity (represented by complement system activity) showed significant growth compared with untreated fish. This supports the hypothesis that the T-2 toxin, in addition to its well-known immune-suppressing properties, could also have an immune-stimulating effect under certain circumstances, e.g. when fed in low concentrations. This suggests a hormesis-like (a phenomenon characterized by low-dose stimulation and high-dose inhibition) effect of T-2 toxin, which is known in many other xenobiotics. Alternatively, it could also be a demonstration of the fish's innate immunity system attempting an immediate defense response against possibly dangerous pathogens, suggesting that cellular innate immunity could be partly compensated for by humoral non-specific immunity. While most previous studies on fish and other animals have shown an increase in serum antibody level [30], humoral specific

463

immunity (Igs) in our study was slightly diminished (though not significantly). These findings suggest that the T-2 toxin could display either an immune-stimulating or an immune-suppressing effect on the fish's immune system, depending (mainly) on toxin concentration. Plasma biochemical parameters are mainly measured as a means of determining general fish health status. Carbohydrates, as the main source of energy in animals, act as an important indicator of stress levels in fish. The observed increase in plasma glucose level observed in this study, therefore, is indicative of a stress response to the presence of the T-2 toxin and its metabolites. Gabriel and George [31] have previously shown that an increase in ALT in blood plasma is indicative of liver dysfunction in aquatic organisms under stress. The observed decrease in TAG concentration in blood plasma could be the result of the T-2 toxin affecting lipid metabolism in the liver. Alternatively, as TAG is one of the fish's energy sources for compensating stress, the decrease in TAG could be a consequence of long-term stress [32]. Although many studies suggest that the primary toxic effect of the T-2 toxin (along with other trichothecenes) is its ability to act as a potent inhibitor of protein synthesis [33e35], we observed no such effect on carp plasma protein concentration. The effect of the T-2 toxin on haematological, immunological and biochemical parameters is closely linked with T-2 toxininduced enhancement of oxygen-metabolite concentration. One of the primary antioxidant enzymes responsible for protection from oxidative stress is CAT. Catalase, which is mainly located in the peroxisomes, is responsible for metabolising hydrogen peroxide [36,37]. The significant reduction in CAT activity, with no effect of mRNA expression, observed in carp liver in this study could have been caused by long-lasting oxidative stress. As the liver is the primary organ affected by the T-2 toxin, such depletion was not noted in the kidney. The tripeptide glutathione (GSH) plays a critical role in protecting cells from oxidative damage. While GPx catalyses the reduction of both H2O2 and fatty acid peroxides into their corresponding alcohols, GSH is oxidised to glutathione disulphide. The decrease in GPx activity in caudal kidney (but not in liver) can be explained through GSH depletion caused by long-term exposure to T-2 toxin. Opposite trend e enhancement of fish glutathione peroxidase in the presence of reduced glutathione e has already been described [38]. Balogh et al. [4] described a decrease in GSH concentration and liver GPx activity in the second week of a four week trial after feeding common carp with T-2 toxin at a concentration of 2.45 mg/kg. GST are a family of detoxification phase II enzymes that provide cellular protection against the toxic effects of a variety of chemicals [39]. In addition, GST are also able to metabolize ROS. The significantly increased hepatic GST activity (p < 0.001) observed in our study, therefore, probably represents a detoxification response to xenobiotic exposure. These results are in accordance with a study conducted by Kravchenko et al. [40], who observed an increase of GST activity after exposing carp to T-2 toxin. Oxidative stress analysis indicated that CAT and GST play a main role in scavenging ROS and in the detoxification process following administration of T2 toxin. Malondialdehyde (MDA) is a well-characterized oxidation product of polyunsaturated fatty acids and the reaction of MDA and 2-thiobarbituric acid, resulting in the production of TBARS, is one of the most widely used indicators of oxidative stress [41]. Induction of lipid peroxidation by free radicals following T-2 toxin exposure has been described for a range of animal species [42,43]. We also observed elevated TBARS values in both liver and caudal kidney in our study, thereby confirming the hypothesis that the T-2 toxin is responsible for free radical generation and lipid peroxidation.

464

I. Matejova et al. / Fish & Shellfish Immunology 60 (2017) 458e465

Values for TBARS reflect lipid peroxidation by T-2 toxin-generated ROS. Note, however, that oxidative stress can also be caused by hyperglycaemia [44]. The increase in plasma ceruloplasmin activity observed in our study confirms antioxidant activity as one of ceruloplasmin's physiological functions [45]. A number of other studies have shown a similar effect on ceruloplasmin activity after addition of different pollutants to water in which rainbow trout, yellow perch (Perca flavescens) and common carp were swimming [27,46,47]. In conclusion, feed contaminated with high doses of theT-2 toxin induced significant changes in carp metabolism, and particularly in haematological and immunological parameters. The main effects of such contamination were leukopenia and mild anaemia. The T-2 toxin did not upregulate mRNA expression of cytochrome P450, HSP or protein synthesis, indicating a relatively high resistance level to the T-2 toxin in carp. These results provide a better understanding of the toxicological effects of the T-2 toxin on cultured fish such as common carp, an important species in commercial aquaculture. Acknowledgements This work was supported through projects IGA 31/2014/FVHE, KUS QJ1210013 and LO1218 of the Ministry of Education, Youth and Sports of the Czech Republic.

[16]

[17]

[18]

[19]

[20] [21] [22] [23] [24]

[25]

[26] [27]

References [28] [1] G. Schatzmayr, E. Streit, Global occurrence of mycotoxins in the food and feed chain: facts and figures, World Mycotoxin J. 6 (2013) 213e222. [2] P. Encarnacao, G. Santos, K. Naehrer, Prevalence of mycotoxins in some major aquafeed ingredients, Aquacult. Asia. Pac. 10 (2012) 14e16. [3] B.B. Manning, M.H. Li, E.H. Robinson, P.S. Gaunt, A.C. Camus, G.E. Rottinghaus, Response of channel catfish to diets containing T-2 toxin, J. Aquat. Anim. Health 15 (2003) 229e238. zes, Effect of long term feeding of T-2 [4] K. Balogh, M. Heincinger, J. Fodor, M. Me and HT-2 toxin contaminated diet on the glutathione redox status and lipid peroxidation processes in common carp (Cyprinus carpio L.), Acta Biol. Szeged. 53 (2009) 23e27. [5] W.F.O. Marasas, J.R. Bamburg, E.B. Smalley, F.M. Strong, W.L. Ragland, B.E. Degurse, Toxic effect on trout, rats and mice of T-2 toxin produced by the fungus Fusarium tricinctum (Cd.) Snyd. et Hans, Toxicol. Appl. Pharmacol. 15 (1969) 471e482. [6] H.A. Poston, J.L. Coffin, G.F. Combs, Biological effects of dietary T-2 toxin in rainbow trout, Salmo gairdneri, Aqua. Toxicol. 2 (1982) 79e88. [7] G. Yuan, Y. Wang, X. Yuan, T. Zhang, J. Zhao, L. Huang, S. Peng, T-2 toxin induces developmental toxicity and apoptosis in zebrafish embryos, J. Environ. Sci. 26 (2014) 917e925. [8] C. Pietsch, S. Kersten, P. Burkhardt-Holm, H. Valenta, S. Danicke, Occurence of deoxynivalenol and zearalenone in commercial fish feed: an initial study, Toxins 5 (2013) 184e192. [9] I. Matejova, H. Modra, J. Blahova, A. Franc, P. Fictum, M. Sevcikova, Z. Svobodova, The effect of mycotoxin deoxynivalenol on haematological and biochemical indicators and histopathological changes in rainbow trout (Oncorhynchus mykiss), Biomed. Res. Int. (2014). Article ID 310680. [10] R. Dobsikova, J. Blahova, A. Franc, J. Jakubik, I. Mikulikova, H. Modra, K. Novotna, Z. Svobodova, Effect of b-1.3/1.6-D-glucan derived from oyster mushroom Pleurotus ostreatus on biomedical, haematological, biochemical, and immunological indices in rainbow trout (Oncorhynchus mykiss), Neuroendocrinol. Lett. 33 (2012) 96e106. [11] Z. Svobodova, D. Pravda, H. Modra, Methods of Haematological Examination of Fish, Faculty of Fisheries and Protection of Waters, University of South Bohemia in Ceske Budejovice Czech Republic, Ceske Budejovice (in Czech), 2012. [12] J. Atosuo, J. Lehtinen, L. Vojtek, E.M. Lilius, Escherichia coli K-12 (pEGFPluxABCDEamp): a tool for analysis of bacterial killing by antibacterial agents and human complement activities on a real-time basis, Luminescence 28 (2013) 771e779. [13] S. Buchtikova, A. Simkova, K. Rohlenova, M. Flajshans, A. Lojek, E.M. Lilius, P. Hyrsl, The seasonal changes in innate immunity of the common carp (Cyprinus carpio), Aquaculture 318 (2011) 169e175. [14] A.D. McEwan, E.W. Fisher, I.E. Selman, Observations on immune globulin levels of neonatal calves and their relationship to disease, J. Comp. Pathol. 80 (1970) 259e265. [15] H. Reynders, K. Van Campenhout, L. Bervoets, W.M. De Coen, R. Blust, Dynamics of cadmium accumulation and effects in common carp (Cyprinus

[29]

[30]

[31] [32]

[33]

[34] [35]

[36]

[37]

[38]

[39]

[40] [41]

[42]

[43]

[44]

carpio) during simultaneous exposure to water and food (Tubifex tubifex), Environ. Toxicol. Chem. 25 (2006) 1558e1567. E.H. Stolte, S.B. Nabuurs, N.R. Bury, A. Sturm, G. Flik, H.F. Savelkoul, B.M. LidyVerburg-van Kemenade, Stress and innate immunity in carp: corticosteroid receptors and pro-inflammatory cytokines, Mol. Immunol. 46 (2008) 70e79. N.J. Bernier, M. Gorissen, G. Flik, Differential effects of chronic hypoxia and feed restriction on the expression of leptin and its receptor, food intake regulation and the endocrine stress response in common carp, J. Exp. Biol. 215 (2012) 2273e2282. H. Xing, Z. Wang, H. Wu, X. Zhao, T. Liu, S. Li, S. Xu, Assessment of pesticide residues and gene expression in common carp exposed to atrazine and chlorpyrifos: health risk assessments, Ecotoxicol. Environ. Saf. 113 (2015) 491e498. P. Zelnickova, J. Matiasovic, B. Pavlova, H. Kudlackova, F. Kovaru, M. Faldyna, Quantitative nitric oxide production by rat, bovine and porcine macrophage, Nitric Oxide 19 (2008) 36e41. W.H. Habig, M.J. Pabst, W.B. Jacoby, Glutathione S-transferases, First enzymatic step in mercapturic acid formativ, J. Biol. Chem. 249 (1974) 7130e7139. I. Carlberg, B. Mannervik, Purification and characterization of the flavoenzyme glutathione reductase from rat liver, J. Biol. Chem. 250 (1975) 5475e5480. L. Flohe, W.A. Gunzler, Assays of glutathione peroxidase, Methods Enzymol. 105 (1984) 114e121. H. Aebi, Catalase in vitro, Methods Enzymol. 105 (1984) 121e126. P.K. Smith, R.I. Krohn, G.T. Hermanson, A.K. Mallia, F.H. Gartner, M.D. Provenzano, E.K. Fujimoto, N.M. Goeke, B.J. Olson, D.C. Klenk, Measurement of protein using bicinchoninic acid, Anal. Biochem. 150 (1985) 76e85. V.I. Lushchak, T.V. Bagnyukova, O.V. Lushchak, J.M. Storey, K.B. Storey, Hypoxia and recovery perturb free radical processes and antioxidant potential in common carp (Cyprinus carpio) tissues, Int. J. Biochem. Cell. Biol. 37 (2005) 1319e1330. J.J. Ceron, S. Martinez-Subiela, An automated spectrophotometric method for measuring canine ceruloplasmin in serum, Vet. Res. 35 (2004) 671e679. I. Haluzova, H. Modra, J. Blahova, P. Marsalek, Z. Siroka, L. Groch, Z. Svobodova, Effects of subchronic exposure to Spartakus (prochloraz) on common carp Cyprinus carpio, Neuroendocrinol. Lett. 31 (2010) 105e113. D. Parent-Massin, Haematotoxicity of trichothecenes, Toxicol. Lett. 153 (2004) 75e81. M.I. Gyongyossy-Issa, R.T. Card, D.J. Fergusson, G.G. Khachatourians, Prehemolytic erythrocyte deformability changes caused by trichothecene T-2 toxin: an ektacytometer study, Blood Cells 11 (1986) 393e407. S. Pepeljnjak, Z. Petrinec, S. Kovacic, M. Segvic, Screening toxicity study in young carp (Cyprinus carpio L.) on feed amended with fumonisin B1, Mycopathologia 156 (2002) 139e145. U.U. Gabriel, A.D.I. George, Plasma enzymes in Clarias gariepinus exposed to chronic levels of round up (glyphosate), Environ. Ecol. 23 (2005) 271e276. I. Mikulikova, H. Modra, J. Blahova, P. Marsalek, L. Groch, Z. Siroka, K. Kruzikova, J. Jarkovsky, S. Littnerova, Z. Svobodova, The effects of Click 500 Sc (terbuthylazine) on common carp Cyprinus carpio under (sub)chronic conditions, Neuroendocrinol. Lett. 32 (2011) 15e24. J.J. Pestka, H.R. Zhou, Y. Moon, Y.J. Chung, Cellular and molecular mechanisms for immune modulation by deoxynivalenol and other trichothecenes: unravelling a paradox, Toxicol. Lett. 153 (2004) 61e73. O. Rocha, K. Ansari, F.M. Doohan, Effects of trichothecene mycotoxins on eukaryotic cells: a review, Food Addit. Contam. 22 (2005) 369e378. W.L. Thomson, R.W. Wannemacher Jr., In vivo effects of T-2 toxin on synthesis of proteins and DNA in rat tissues, Toxicol. Appl. Pharmacol. 105 (1990) 483e491. R.T. Di Giulio, J.N. Meyer, Reactive oxygen species and oxidative stress, in: R.T. Di Giulio, D.E. Hinton (Eds.), The Toxicology of Fishes, CRC Press, Boca Raton, 2008, pp. 273e326. D. Schlenk, R. Handy, S. Steinert, M.H. Depledge, W. Benson, Biomarkers, in: R.T. Di Giulio, D.E. Hinton (Eds.), The Toxicology of Fishes, CRC Press, Boca Raton, 2008, pp. 683e732. T. Nakano, M. Sato, M. Takeuchi, Partial purification and properties of glutathione peroxidase from carp hepatopancreas, Comp. Biochem. Physiol. 102B (1992) 31e35. D. Schlenk, M. Celander, E.P. Gallagher, S. George, M. James, S.W. Kullman, P. van den Hurk, K. Willett, Biotransformation in fishes, in: R.T. Di Giulio, D.E. Hinton (Eds.), The Toxicology of Fishes, CRC Press, Boca Raton, 2008, pp. 153e234. L.V. Kravchenko, V.T. Galash, L.T. Avreneva, A.E. Kranauskas, On the sensitivity of carp, Cyprinus carpio, to mycotoxin T-2, J. Ichthyol. 29 (1989) 156e160. J. Liu, H.C. Yeo, S.J. Doniger, B.N. Ames, Assay of aldehydes from lipid peroxidation: gas chromatographyemass spectrometry compared to thiobarbituric acid, Anal. Biochem. 245 (1997) 161e166. A.F. Rizzo, F. Atroshi, M. Ahotupa, S. Sankari, E. Elovaara, Protective effect of antioxidants against free radical-mediated lipid peroxidation induced by DON or T-2 toxin, J. Vet. Med. 41 (1994) 81e90. lez de Meía, Effect of lycopene on lipid M. Leal, A. Shimada, F. Ruíz, E. Gonza peroxidation and glutathione-dependent enzymes induced by T-2 toxin in vivo, Toxicol. Lett. 109 (1999) 1e10. F. Boyer, J.B. Vidot, A.G. Dubourg, P. Rondeau, M.P. Essop, E. Bourdon, Oxidative stress and adipocyte biology: focus on the role of AGEs, Oxid. Med. Cell. Longev. (2015). Article ID 534873.

I. Matejova et al. / Fish & Shellfish Immunology 60 (2017) 458e465 [45] J. Healy, K. Tipton, Ceruloplasmin and what it might do, J. Neural. Trams 114 (2007) 777e781. [46] M. Dunier, A.K. Siwicki, J. Scholtens, S.D. Molin, C. Vergnet, M. Studnicka, Effects of lindan exposure on rainbow trout (Oncorhynchus mykiss) immunity; III. Effect on nonspecific immunity and B lymphocyte functions, Ecotox.

465

Environ. Safe 27 (1994) 324e334. [47] C. Dautremepuits, D.J. Marcogliese, A.D. Gendron, M. Fournier, Gill and head kidney antioxidant processes and innate immune system responses of yellow perch (Perca flavescens) exposed to different contaminants in the St. Lawrence River, Canada, Sci. Total. Environ. 407 (2009) 1055e1064.