- Email: [email protected]
Effect of the Synadenium carinatum latex lectin (ScLL) on Leishmania (Leishmania) amazonensis infection in murine macrophages
Experimental Parasitology 128 (2011) 61–67
Contents lists available at ScienceDirect
Experimental Parasitology journal homepage: www.elsevier.com/locate/yexpr
Effect of the Synadenium carinatum latex lectin (ScLL) on Leishmania (Leishmania) amazonensis infection in murine macrophages Sandra R. Afonso-Cardoso a, Claudio Vieira Silva a, Marcelo S. Ferreira b, Maria A. Souza a,⇑ a b
Instituto de Ciências Biomédicas, Universidade Federal de Uberlândia, MG, Brazil Faculdade de Medicina, Universidade Federal de Uberlândia, MG, Brazil
a r t i c l e
i n f o
Article history: Received 3 November 2010 Received in revised form 27 January 2011 Accepted 1 February 2011 Available online 12 February 2011 Keywords: Leishmania (Leishmania) amazonensis Synadenium carinatum Leishmanicidal activity Nitric oxide Lectin
a b s t r a c t Antiparasitic effect of a lectin isolated from Synadenium carinatum latex (ScLL) was evaluated against Leishmania (Leishmania) amazonensis promastigotes/amastigotes. Pretreatment of murine inflammatory peritoneal macrophages with ScLL reduced by 65.5% the association index of macrophages and L. (L) amazonensis promastigotes. Expression of cytokines (IL-12, IL-1 and TNF-a) was detected in infected macrophages pretreated with ScLL (10 lg/mL). ScLL also reduced the growth of L. (L) amazonensis amastigote intracellular forms, showing no in vitro cytotoxic effects in mammalian host cells. ScLL treatment in infected murine inflammatory peritoneal macrophages did not induce nitric oxide production, suggesting that a nitric oxide independent pathway is activated to decrease the number of intracellular Leishmania. Ó 2011 Elsevier Inc. All rights reserved.
1. Introduction Pentavalent antimonials are still the first choice drugs for leishmaniasis treatment, despite their cardiac and renal toxicity. Moreover, there is retention of antimony in the tissues, which is responsible for toxic effects (Tuon et al., 2008; David and Craft, 2009; Berman, 1988) thus, it is desirable to develop new drugs. Treatments based on herbal medicines have gain momentum worldwide, mainly due to the validation of alternative therapies by traditional medical systems by the identification of compounds derived from medicinal plants of the aboriginal pharmacopeia (Calixto, 2000; Elvin-Lewis, 2001). Approximately 80,000 vegetal species with therapeutic properties had already been isolated from Brazilian native species of plants and lectins are among the new compounds studied. Lectins are widely distributed in nature and they can be found in seeds, leaves, barks, bulbs, rhizomes, roots cotyledon and tubers of many plants depending on the species (Cummings, 1997) and they are involved in the events of many biological interactions, such as the intracellular translocation of glycoproteins and soluble molecules. In addition to involvement in the regulation of endocytosis, cell migration, adhesion and immune defense processes. The ability of the lectin to interact specifically with carbohydrates makes them valuable instruments in varied
biological research work, and the use of these tools has expanded continuously (Peumans and van Damme, 1995). Lectins such as the ConBr from Canavalia braziliensis and KM+ from Artocarpus integrifolia induce IFN-c and IL-12 p40 production promoting a reversal of the Th2 cytokine pattern to Th1 pattern in BALB/c mice infected with Leishmania amazonensis and Leishmania major, respectively (Barral-Netto et al., 1996; Panunto-Castelo et al., 2001). Previous study from our group had described the isolation, purification and characterization of the D-galactose-binding lectin (ScLL) from the Euphorbiaceae Synadenium carinatum latex (Souza et al., 2005). We have also demonstrated that ScLL in association with Leishmania-soluble antigen developed partial protection in immunized and challenged mice with L. amazonensis promastigote form, by increased levels of specific IgG2a and mRNA expression of cytokines in lesion (IFN-c, IL-12, TNF-a) (Afonso-Cardoso et al., 2007). Furthermore, ScLL showed immunoregulatory functions by oral administration which significantly inhibited neutrophil and eosinophil extravasations in models of acute and chronic inflammation, and reduced eosinophil and mononuclear blood counts during chronic inflammation (Rogerio et al., 2007). Here we investigated the effects of ScLL on L. amazonensis promastigotes interaction with murine inflammatory peritoneal macrophages. 2. Materials and methods
⇑ Corresponding author. Address: Instituto de Ciências Biomédicas, Universidade Federal de Uberlândia, Av. Pará, 1720, Bloco 6T07, Campus Umuarama, 38400-902 Uberlândia, MG, Brazil. Fax: +55 34 3218 2333. E-mail address: [email protected] (M.A. Souza). 0014-4894/$ - see front matter Ó 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.exppara.2011.02.006
2.1. Obtainment and purification of the lectin Popularly known as ‘‘Leiteirinha or folha Santa’’, the S. carinatum species was harvested in Uberlandia, Minas Gerais, and registered
62
S.R. Afonso-Cardoso et al. / Experimental Parasitology 128 (2011) 61–67
in the Herbarium of the Federal University of Uberlandia (HUFU 38354). Proteins were extracted from fresh latex by gentle shaking with deionised water, in the proportion 1:5, for 48 h at 4 °C. The mixture was centrifuged (3500 g, 30 min, 4 °C; Eppendorf centrifuge) and filtered through nitrocellulose membranes (0.45 mm pore size; Merck, Göttingen, Germany) to yield a crude extract. D-Galactose-binding lectin (ScLL) was purified in immobilized Dgalactose column on agarose (Pierce, Rockford, IL, the USA), equilibrated with 0.005 M borate-buffer at pH 7.2 (BBS). ScLL was eluted with 0.4 M D-galactose in BBS (BBS-D-gal) and dialyzed against Tris buffer pH 7.2 (Souza et al., 2005) and the protein concentration was determined (Lowry et al., 1951). 2.2. Parasite culture Leishmania (Leishmania) amazonensis (IFLA/BR/67/PH8) promastigote forms were cultured in brain–heart infusion (BHI) medium, (Oxoid Ltd., Basingstoke, Hampshire, UK), described elsewhere (Nogueira de Melo et al., 2006) supplemented with 10% fetal calf serum (Cultilab, Campinas, Brazil), 100 lg/mL gentamycin and 2 mM L-glutamine (Gibco BRL-Life Technologies, New York, USA), at 26 °C. Parasites in the stationary phase were used in the experimental infection of macrophages. 2.3. Macrophage culture Inflammatory peritoneal macrophages were harvested from BALB/c mice previously inoculated with 3% thioglycollate medium (Gibco, Gaithersburg, MD). The cells were centrifuged and adjusted to 1 106/mL in RPMI 1640 medium supplemented with 2 mM of L-glutamine (Life Technologies, Grand Island, NY), 10% fetal bovine serum (Life Technologies), 100 U/mL penicillin (Sigma Chemical Co., St. Louis, MO, USA), 100 lg/mL streptomycin (Sigma), 1 mM sodium pyruvate and 100 mM MEM non-essential amino acids (Life Technologies; complete medium). The macrophage suspension was seeded (2 105/200 lL/well) onto cover slips in 24-well flat-bottomed plates (Corning Corporation; Cambridge, MA, USA) and then incubated for 2 h in a humidified chamber at 37 °C, containing 5% CO2. Adherent cells (95% macrophages) were washed three times with PBS (pH 7.2), and incubated for 48 h with either RPMI medium alone or medium containing ScLL (100, 50 and 10 lg/mL), LPS (10 lg/ml) and IFN-c (40 ng/mL). Lectin ConA (5 lg/mL), PHA (10 lg/mL) and Jacalin (10 lg/mL) were used as reference. 2.4. Infection of macrophages and NO production Murine inflammatory peritoneal macrophages were either treated or not treated with 100, 50 and 10 lg/mL of ScLL 48 h prior to the macrophage-parasite interaction. Nonadherent cells were removed by washing and adherent macrophages were infected with L. amazonensis promastigotes in the stationary growth phase. The parasites and macrophages were quickly brought into contact by centrifugation at 20 °C (130g, 5 min) and incubated at room temperature for 3 h before being washed to remove free parasites. Infected macrophages were cultured under cover slip in complete medium in a humidified chamber at 37 °C, containing 5% CO2 for 24, 48 and 72 h, and then to analyze Giemsa stained. The percentage of infected macrophages was determined by counting 100 cells in triplicate by the same specialist. The association index was determined by multiplying the percentage of infected macrophages by the mean number of parasites per infected cell. An association index was considered as the number of parasites that actually infected the macrophages. Nitrite present in the supernatants of murine inflammatory peritoneal macrophages was determined by Griess reaction by adding 50 ll of supernatants to
96-well flat-bottomed plates containing 50 ll of Griess reagent [1% sulfanilamide/0.1% N-(1-naphthyl)ethylenediamine dihydrochloride/2.5% H3PO4]. The samples were assayed in quadruplicate. The absorbance was measured (Multiskan MS microplate reader, LabSystems Oy, Helsink, Finland) at 540 nm and the nitrite concentration was determined from a standard curve of sodium nitrite. The results were expressed as lM nitrite/105 cells. All results presented in this work are representative of three other experiments performed independently. 2.5. Cytotoxity assay ScLL cytotoxicity in macrophages was measured by a classical neutral red uptake (NRU) assay (Borenfreund and Puerner, 1985; Rosa et al., 2003). Briefly, murine inflammatory peritoneal macrophages were cultivated in 96-well microtiter plates (150 ll containing 105 cells/mL in RPMI complete medium/well) at 37 °C in a humidified 5% CO2 atmosphere. Twenty-four hours post incubation, 50 ll ScLL at 100, 50 and 10 lg/mL were added to cell cultures; 50 ll RPMI medium were added to the control cells and incubated for an additional 48 h. Control and treated cells were washed three times with PBS (pH 7.2) and neutral red solution (0.3%) was added and incubated for 3 h at 37 °C and the cells were then washed three times with PBS. A solution (100 ll) containing 1% acetic acid and 50% ethanol was added and the optical density of the supernatants was measured at 540 nm. Cell viability was determined using the formula [100 (L2/L1) 100], where L1 is the percentage of viable control cells and L2 is the percentage of viable treated cells, as previously described (Delorenzi et al., 2001). 2.6. Cytokines and iNOS expression by conventional RT-PCR The mRNA was isolated from murine inflammatory peritoneal macrophages cultured for 24, 48 and 72 h post infection with L. amazonensis, using a RNA kit (RNeasy Mini Kit, Quiagen) according to the manufacturer’s instructions. The cDNA was obtained using an iScript™ cDNA Synthesis kit (Bio-Rad Laboratories, Hercules, CA, USA). The PCR used 8 ll of master mix (0.2 mM dNTP, 1 ll of 10 PCR buffer, 0.2 lM of each primer, IL-1b, IL-12, TNF-a and iNOS; Table 1), 4.4 ll of water, 1 U/ll of Taq DNA Polimerase, 1.5 mM MgCl2 (Invitrogen Life Technologies, Carlsbad, CA, USA) and 2 ll cDNA of each sample. The sequence of the used primers is listed (Table 1). The reaction was carried at 95 °C/2 min, 94 °C/ 1 min, 57 °C/1 min and 72 °C/1 min, for 37 cycles in a thermocycler (Applied Biosystems, CA, USA). Analysis of PCR products obtained was carried out by electrophoresis in a 2% agarose gel stained with ethidium bromide. It was glyceraldehyde-3-phosphate dehydrogenase (GAPDH) primer as the normal pattern of expression. The bands were visualized under ultraviolet light (Höefer Pharmacia Biotech San Francisco Incorporation, CA, USA). The efficiency-corrected quantification was performed automatically by relative expression (RE) software based on relative standard curves describing the PCR efficiencies of the used cytokines, iNOS and GAPDH genes. The values were within the linear range of standard
Table 1 Sequence of primers. Target
IL-10 IL-12 p35 TNF-a iNOS GAPDH
Oligonucleotide sequence (50 –30 ) Forward
Reverse
TCATGGCATTTTGAACGAG AGACCAGAGACATGGAGTCATA
GCACCTTGGAAGCCCTACAG TGCTTCACACTTCAGGAAAG
GATCTCAAGACAACCAACATGTG GATGGTCAAGATCCAGAGAGGTCT CATGGCCTTCCGTCTTCCTA
CTCCAGCTGGAAGACTCCTCCCAG AATTCGAGGCCACCCACC GGTCCTCACTGTAGCCCAAGAT
63
S.R. Afonso-Cardoso et al. / Experimental Parasitology 128 (2011) 61–67
curve, and results were expressed as cytokine and iNOS/GAPDH ratio (the test sample divided by cytokine and iNOS/GAPDH ratio of the calibrator sample 100%), and therefore, samples were normalized. 2.7. Statistical analysis All experiments were performed in triplicate. The mean and standard error of at least three experiments were determined. Statistical analysis of the differences between mean values obtained for experimental groups was performed by analysis of variance (one-way-ANOVA). Significant differences were analyzed by the Tukey–Kramer Multiple Comparison Tests (GraphPad InStat 3 for Windows Program). p < 0.05 was considered significant. 3. Results 3.1. Infection of macrophages Twenty-four hours post infection with L. (L.) amazonensis, murine inflammatory peritoneal macrophages stimulated previously with ScLL (100, 50 and 10 lg/mL) showed 55.7%, 65.5% and 45.3% of infection, respectively, while the control cells (stimulated only with medium) was 100% infected (Table 2). The percentage of infection in macrophages pretreated with ScLL (100, 50 and 10 lg/mL), for 48 and 72 h was also reduced when compared to controls (Table 2). So, the parasite burden was significantly reduced when compared to the control (only medium). The cells pretreated with IFN-c showed 50% of infection and the lowest average of parasites per cell (7.5), for 72 h (Table 2). Macrophages pretreated with the lectin ConA, Jacalin and PHA, showed no significant alterations in percentage of infection and in the average of parasite per cells in culture for 24–72 h (Table 2). 3.2. NO production The detection of NO production it was significantly lower (p < 0.05) when murine inflammatory peritoneal macrophages were pretreated with different concentrations of lectin ScLL (100, 50 and 10 lg/mL) in comparison to cells treated with LPS and IFN-c for 24, 48 and 72 h (Fig. 1). 3.3. Expression of cytokines and iNOS by conventional RT-PCR A conventional RT-PCR showed that the different concentrations of ScLL used in the pretreatment schedule induced mRNA expression of cytokines and iNOS in infected and cultured macrophages for 24 and 72 h. There was high IL-12 relative expression in macrophages stimulated with ScLL (10 and 100 lg/mL), IFN-c
Fig. 1. NO production by peritoneal macrophages. Supernatants of macrophages treated with ScLL (100, 50, 10 lg/mL), LPS (10 lg/ml), IFN-c (40 ng/mL), Con-A (5 lg/mL), Jacalin (10 lg/mL), PHA (10 lg/mL) and infected L. (L.) amazonensis promastigotes were collected and the nitrite level of each system was determined by Griess reaction as described in Section 2. (A) 24 h; (B) 48 h; (C) 72 h post infection. Columns shown nitrite levels (means ± standard deviations from three independent experiments) expressed in lM. ⁄p < 0.05.
and Jacalin, cultured for 24 h (Fig. 2). IL-1b was expressed in cells pretreated with different concentration ScLL (100, 50 and 10 lg/
Table 2 Inflammatory macrophages infection index by L. (L.) amazonensis. Treatments
Hours post infection 24
Medium 100 lga 50 lg 10 lg LPS IFN-c Con-A Jacalin PHA *
P < 0.05. ScLL lectin.
a
48
72
Infection (%)
Parasites/cell (average)
Infection (%)
Parasites/cell (average)
Infection (%)
Parasites/cell (average)
100.00 55.70 65.50 45.30 57.50 50.00 60.70 65.30 60.60
(75) (30) (25) (30) (40) (20) (65) (45) (45)
100.00 40.30 50.20 40.40 50.50 25.30 60.50 60.60 60.70
(75) (25) (25) (25) (37.5) (17.5) (75) (60) (60)
100.00 41.70 51.30 40.50 46.50 20.50 53.70 63.60 64.80
(65) (17.5)* (20)* (20)* (30) (7.5) (60) (45) (60)
64
S.R. Afonso-Cardoso et al. / Experimental Parasitology 128 (2011) 61–67
Fig. 2. Expression and relative intensity of cytokines and iNOS by conventional RT-PCR assay in mice inflammatory macrophage 24 h post infection by L. (L.) amazonensis. Bars represent the relative intensity of mRNA expression of cytokines and iNOS in the murine inflammatory peritoneal macrophages pretreated with ScLL (100, 50, 10 lg/mL), LPS (10 lg/ml), IFN-c (40 ng/mL), Con-A (5 lg/mL), Jacalin (10 lg/mL), PHA (10 lg/mL) 48 h prior to infection by L. (L.) amazonensis promastigotes. Medium was used as control. GAPDH expression was used as the normal patterns of mRNA expression.
mL) in the culture for 24 h, and remaining detectable at 72 h of the culture (Fig. 3). On the other hand, there was not detection of IL-10 expression in presence of the lectin in different concentration (data not shown). A TNF-a relative expression was observed in period of 24 h, only in macrophages stimulated with ScLL (10 lg/ml) and IFN-c and an alteration in this profile was observed in infected macrophages cultured for 72 h (Figs. 2 and 3). ConA, PHA and Jacalin were used to control in this experiment (Figs. 2 and 3). 4. Discussion A general lack of effective and inexpensive chemotherapeutic agents is observed for treatment of parasitic protozoan diseases
that occur mainly in the developing world, such as leishmaniasis. Pentavalent antimonial drugs are the first-line treatment for leishmaniasis in most affected areas. Amphotericin B and pentamidine are used as alternative drugs (Tuon et al., 2008; David and Craft, 2009). These agents are not orally active and require long-term parenteral rout administration they also produce severe side effects and are expensive (Blum and Hatz, 2009). Therefore, new drugs are urgently required. In this sense, new drugs of herbal origin discovered through ethnopharmacological studies have shown interesting results. Moreover, several natural compounds with antileishmanial activity have been investigated in various laboratories and correspond to the following groups: alkaloid, terpene, quinone, lactone, coumarin, acetogenin of
S.R. Afonso-Cardoso et al. / Experimental Parasitology 128 (2011) 61–67
65
Fig. 3. Expression and relative intensity of cytokines and iNOS by conventional RT-PCR assay in murine inflammatory peritoneal macrophages 72 h post infection by L. (L.) amazonensis. Bars represent the relative intensity of mRNA expression of cytokine and iNOS in the murine inflammatory peritoneal macrophages pretreated with ScLL (100, 50, 10 lg/mL), LPS (10 (g/ml), IFN-c (40 ng/mL), Con-A (5 lg/mL), Jacalin (10 lg/mL), PHA (10 lg/mL) 48 h prior to infection by L. (L.) amazonensis promastigotes. Medium was used as control. GAPDH expression was used as the normal patterns of mRNA expression.
annonaceae, chalcone, tetralone, lignan, saponin and lectin (Delorenzi et al., 2001). Recently, we describe a novel pharmacological activity obtained from lectin of S. carinatum latex that conferred partial protection to immunized animals with different concentrations of this lectin (Afonso-Cardoso et al., 2007). In this work, we showed also an in vitro inhibitory activity of ScLL on the development of L. (L)
amazonensis into macrophage, and did not show any effect on the viability or morphology of the macrophages (data not shown). It was observed an infection index lower in macrophages pretreated with ScLL and infected by L. (L) amazonensis when compared with control. So, the phagocytic activity of these macrophages was modified during ScLL pretreatment, what suggests some alteration in the phagocytosis process by block or competing
66
S.R. Afonso-Cardoso et al. / Experimental Parasitology 128 (2011) 61–67
of the lectin and parasite. To initiate a successful infection parasites must gain entry into macrophages, and also withstand or circumvent their killing and degradative functions. However, to sustain a chronic infection, parasites must also subvert macrophage-accessory-cell activities and ablate the development of protective immunity (Alexander et al., 1999). Macrophage is armed with antimicrobial mechanisms that intracellular organisms must evade in order to survive. During infection the interactions between parasites and host cells occur in two stages. First, during initial phagocytosis of promastigotes, macrophages can undergo an oxidative response stimulated by the phagocytic event that produces superoxide (O2) as part of the respiratory burst of human and murine macrophages. Second, post infection when amastigote is into the macrophage, the quiescent macrophage can be activated to potentially kill intracellular Leishmania. Another antileishmanial oxidant produced by activated macrophages is NO that is the most relevant to killing established intracellular amastigotes (Gantt et al., 2001). In an in vitro study using Xylitol it was observed that Xylitol stimulated macrophage NO production as which inhibited the macrophage infection by L. amazonensis (Ferreira et al., 2008). Although strong evidence that NO plays an important role in murine leishmaniasis, it remains controversial whether NO plays a role in antileishmanial responses of human macrophages. Thus, in order to determine whether detectable NO was produced during infection of macrophages with L. amazonensis, we measured nitrite produced from NO released into culture supernatants of infected macrophages as well as the modulation of NO expression during the interaction in the presence of ScLL. We demonstrated that macrophages pretreated with ScLL did not produce significant amount of nitrite, in comparison to non treated macrophages. So, there was mRNA expression of iNOS and cytokine such as IL-1b, IL-12, TNF-a in treated and infected macrophage. However, it has been demonstrated that these cytokines fail to activate macrophages and to kill Leishmania mexicana/amazonensis (Abu-Dayyeh et al., 2010). The detection of iNOS mRNA suggests that a post transcriptional inhibitory pathway of iNOS may be activated by ScLL. Previous reports showed that various natural flavonoids are known to have anti-inflammatory activity in mammalian cells, and their action in inflammation has been attributed to their antioxidant activity, as well as to their ability to suppress NO production in macrophages (Matsuda et al., 2003; Kim et al., 1999). NO synthesis by phagocytes depends on the expression of an NOS isoform (iNOS), which is induced by interferon-c (IFN-c), tumor necrosis factor-a (TNF-a) and bacterial endotoxins, and is crucial for eliminating intracellular pathogens internalized by these cells (Green et al., 1991). However, the continuous elevated production of NO may account for several disorders associated with chronic inflammatory disorders, such as, inflammatory bowel diseases (Grisham et al., 2002). Thus, natural flavonoids are very promising as therapeutic agents for inflammation (Lai and Yen, 2002) and highly active against Leishmania (V.) peruviana (Marín et al., 2009). Several classes of natural flavonoids inhibit NO production by inflammatory cells such as activated peritoneal macrophages (Krol et al., 1995), RAW 264.7 cells (Wang and Mazza, 2002) and C6-astrocytes (Soliman and Mazzio, 1998), in vitro. Our results suggest that the lectin (ScLL) from S. carinatum latex inhibited synthesis of NO by murine macrophages probably by a similar pathway to flavonoids compounds. Another possible pathway activated by ScLL during its anti-inflammatory effects may be by activating annexin 1 (ANX-1). ANX-1 is an anti-inflammatory protein induced by glucocorticoid. Like glucocorticoid, ANX-1 and derived peptides inhibit eicosanoid synthesis, block leukocyte migration and induce apoptosis of inflammatory cells. Previous results suggested that some of the anti-inflammatory effects of ANX-1 may be mediated by the release of IL-10, which, in turn, inhibits NO release (Ferlazzo et al., 2003).
So, in this study, inflammatory macrophages treated with ScLL showed no significant NO production but parasite proliferation was significantly decreased however nitric oxide has been identified as a key molecule for leishmanicidal function of macrophages. On the other hand, it has been demonstrated that Leishmania guyanensis amastigotes die inside macrophages through an apoptotic process that is independent of nitric oxide and is mediated by reactive oxygen intermediates generated in the host cell during infection (Sousa-Franco et al., 2006). Our data indicated that other pathways besides NO release are important for parasite clearance. However, the induction of apoptosis by ScLL in Leishmania parasites is still to be available. Taken together, the results presented here suggest that this lectin provide motivation for further exploration of, particularly as antileishmanial agents. Acknowledgments This work was performed with financial support of Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq), Fundação de Amparo à Pesquisa de Minas Gerais (Fapemig) and Sustainable Science Institute (SSI). References Abu-Dayyeh, I., Hassani, K., Westra, E.R., Mottram, J.C., Olivier, M., 2010. Comparative study of the ability of Leishmania mexicana promastigotes and amastigotes to alter macrophage signaling and functions. Infection and Immunity 78, 2428–2445. Afonso-Cardoso, S.R., Rodrigues, F.H., Gomes, M.A.B., Silva, A.G., Rocha, A., Guimarães, A.H.B., Candeloro, I., Favoreto Jr., S., Ferreira, M.S., Souza, M.A., 2007. Protective effect of lectin from Synadenium carinatum on Leishmania amazonensis infection in BALB/c mice. Korean Journal Parasitology 45, 255–266. Alexander, J., Satoskar, A.R., Russel, D.G., 1999. Leishmania species: models of intracellular parasitism. Journal Cell of Science 112, 2993–3002. Barral-Netto, M., Von Sohsten, R.L., Teixeira, M., Dos Santos, W.L.C., Pompeu, M.L., Moreira, R.A., Oliveira, J.T.A., Cavada, B.S., Falcoff, E., Barral, A., 1996. In vivo protective effect of the lectin from Canavalia brasiliensis on BALB/c mice infected by Leishmania amazonensis. Acta Tropica 60, 237–250. Berman, J.D., 1988. Chemotherapy for leishmaniasis: biochemical mechanisms, clinical efficacy, and future strategies. Reviews Infect Disease 10, 560–586. Blum, J.A., Hatz, C.F., 2009. Treatment of cutaneous leishmaniasis in travelers 2009. Journal of Travel Medicine 16, 123–131. Borenfreund, E., Puerner, J.A., 1985. Toxicity determined in vitro by morphological alterations and neutral red absorption. Toxicology Letter 24, 119–124. Calixto, J.B., 2000. Efficacy, safety, quality control, marketing and regulatory guidelines for herbal medicines (phytotherapeutic agents). Brazilian Journal Medical Biological Research 33, 179–189. Cummings, R.D., 1997. In: Gabius, H.J., Gabius, S. (Eds.), Glycosciences, Status and Perspectives. Chapman & Hall GmbH, Weinheim, Germany, pp. 191–199. David, C.V., Craft, N., 2009. Cutaneous and mucocutaneous leishmaniasis. Dermatologic Therapy 22, 491–502. Delorenzi, J.C., Attias, M., Gattass, C.R., Andrade, M., Rezende, C., Cunha-Pinto, A., Henriques, A.T., Bou-Habib, D.C., Saraiva, E.M.B., 2001. Antileishmanial activity of an indole alkaloid from Pesquiera australis. Antimicrobial Agents Chemotherapy 45, 1349–1354. Elvin-Lewis, M., 2001. Should we be concerned about herbal remedies. Journal of Ethnopharmacology 75, 141–164. Ferlazzo, V., D’Agostino, P., Milano, S., Caruso, R., Feod, S., Cillari, E., Parente, L., 2003. Anti-inflammatory effects of annexin-1: stimulation of IL-10 release and inhibition of nitric oxide synthesis. International Immunopharmacology 3, 1363–1369. Ferreira, A.S., de Souza, M.A., Barbosa, N.R., da Silva, S.S., 2008. Leishmania amazonensis: xylitol as inhibitor of macrophage infection and stimulator of macrophage nitric oxide production. Experimental Parasitology 119, 74–79. Gantt, K.R., Goldman, T.L., McCornick, M.L., Miller, M.A., Jeronimo, S.M.B., Nascimento, E.T., Britigan, B.E., Wilson, M.E., 2001. Oxidative responses of human and murine macrophages during phagocytosis of Leishmania chagasi. Journal of Immunology 167, 893–901. Green, S.J., Nacy, C.A., Meltzer, M.S., 1991. Cytokine-induced synthesis of nitrogen oxides in macrophages: a protective host response to Leishmania and other intracellular pathogens. Journal Leukocyte Biology 50, 93–103. Grisham, M.B., Pavlick, K.P., Laroux, F.S., Hoffman, J., Bharwani, S., Wolf, R.E., 2002. Nitric oxide and chronic gut inflammation: controversies in inflammatory bowel disease. Journal Investigative Medicine 50, 272–283. Kim, H.K., Cheon, B.S., Kim, Y.H., Kim, S.Y., Kim, H.P., 1999. Effects of naturally occurring flavonoids on nitric oxide production in macrophage cell line RAW 264.7 and their structure–activity relationships. Biochemical Pharmacology 58, 759–765.
S.R. Afonso-Cardoso et al. / Experimental Parasitology 128 (2011) 61–67 Krol, W., Czuba, Z.P., Treadgill, M.D., Cunningham, B.D., Pietse, G., 1995. Inhibition of nitric oxide (NO) production in murine macrophages by flavones. Biochemical Pharmacology 50, 1031–1035. Lai, H.H., Yen, G.C., 2002. Inhibitory effect of isoflavones on peroxynitrite mediated low-density lipoprotein oxidation. Bioscience Biotechnology Biochemistry 66, 22–28. Lowry, O.H., Rosebrough, N.J., Faar, A.L., Randall, R.J., 1951. Protein measurement with the folin phenol reagent. Journal of Biological Chemistry 193, 265–275. Marín, C., Boutaleb-Charki, S., Díaz, J.G., Huertas, O., Rosales, M.J., Pérez-Cordon, G., Guitierrez-Sánchez, R., Sánchez-Moreno, M., 2009. Antileishmaniasis activity of flavonoids from Consolida oliverian. Journal Natural Products 72, 1069–1074. Matsuda, H., Morikawa, T., Ando, S., Toguchida, I., Yoshikawa, M., 2003. Structural requirements of flavonoids for nitric oxide production inhibitory activity and mechanism of action. Bioorganic & Medicinal Chemistry 11, 1995–2000. Nogueira de Melo, A.C., d’Avila-Levy, C.M., Dias, F.A., Armada, J.L., Silva, H.D., Lopes, A.H., Santos, A.L., Branquinha, M.H., Vermelho, A.B., 2006. Peptidases and gp63like proteins in Herpetomonas megaseliae: possible involvement in the adhesion to the invertebrate host. International Journal for Parasitology 36, 415–422. Panunto-Castelo, A., Souza, M.A., Roque-Barreira, M.C., Silva, J.S., 2001. KM+, a lectin from Artocarpus integrifolia, induces IL-12p40 production by macrophages and switches from type 2 to type 1 cell mediated immunity against L. major antigens, resulting in BALB/c mice resistence to infection. Glycobiology 11, 1035–1042. Peumans, W.J., van Damme, E.J., 1995. The role of lectins in plant defense. Histochemical Journal 27, 254–271.
67
Rogerio, A.P., Cardoso, C.R., Fontanari, C., Souza, M.A., Afonso-Cardoso, S.R., Silva, E.V.G., Koyama, N.S., Basei, F.L., Soares, E.G., Calixto, J.B., Stowell, S.R., DiasBaruffi, M., Faccioli, L.H., 2007. Anti-asthmatic potential of a D-galactosebinding lectin from Synadenium carinatum latex. Glycobiology 17, 795–804. Rosa, M.S.S., Mendonça-Filho, R.R., Bizzo, H.R., Rodrigues, I.A., Soares, R.M.A., SoutoPadrón, T., Alviano, C.S., Lopes, A.H.C.S., 2003. Antileishmanial activity of linalool-rich essential oil from Croton Cajucara. Antimicrobial Agents Chemotherapy 47, 1895–1901. Soliman, K.F., Mazzio, E.A., 1998. In vitro attenuation of nitric oxide production in C6 astrocyte cell culture by various dietary compounds. Proceedings of the Society for Experimental Biology and Medicine 218, 390–397. Sousa-Franco, J.S., Araújo-Mendes, E., Silva-Jardim, I., Santos, J.L., Faria, D.R., Dutra, W.O., Horta, M.F., 2006. Infection-induced respiratory burst in BALB/c macrophages kills Leishmania guyanensis amastigotes through apoptosis: possible involvement in resistance to cutaneous leishmaniasis. Microbes and Infection 8, 390–400. Souza, M.A., Amâncio-Pereira, F., Barros-Cardoso, C.R., Gomes-Silva, A., Silva, E.G., Andrade, L.R., Pena, J.D.O., Lanza, H., Afonso-Cardoso, S.R., 2005. Isolation and partial characterization of a D-galactose-binding lectin from the látex of Synadenium carinatum. Brazilian Archive Biological Technology 48, 705–716. Tuon, F.F., Amato, V.S., Graf, M.E., Siqueira, A.M., Nicodemo, A.C., Amato-Neto, V., 2008. Treatment of New World cutaneous leishmaniasis – a systematic review with a meta-analysis. International Journal of Dermatology 47, 109–124. Wang, J., Mazza, G., 2002. Inhibitory effects of anthocyanins and other phenolic compounds on nitric oxide production in LPS/IFN-gamma-activated RAW 264.7 macrophages. Journal of Agricultural and Foods Chemical 50, 850–857.
Contents lists available at ScienceDirect
Experimental Parasitology journal homepage: www.elsevier.com/locate/yexpr
Effect of the Synadenium carinatum latex lectin (ScLL) on Leishmania (Leishmania) amazonensis infection in murine macrophages Sandra R. Afonso-Cardoso a, Claudio Vieira Silva a, Marcelo S. Ferreira b, Maria A. Souza a,⇑ a b
Instituto de Ciências Biomédicas, Universidade Federal de Uberlândia, MG, Brazil Faculdade de Medicina, Universidade Federal de Uberlândia, MG, Brazil
a r t i c l e
i n f o
Article history: Received 3 November 2010 Received in revised form 27 January 2011 Accepted 1 February 2011 Available online 12 February 2011 Keywords: Leishmania (Leishmania) amazonensis Synadenium carinatum Leishmanicidal activity Nitric oxide Lectin
a b s t r a c t Antiparasitic effect of a lectin isolated from Synadenium carinatum latex (ScLL) was evaluated against Leishmania (Leishmania) amazonensis promastigotes/amastigotes. Pretreatment of murine inflammatory peritoneal macrophages with ScLL reduced by 65.5% the association index of macrophages and L. (L) amazonensis promastigotes. Expression of cytokines (IL-12, IL-1 and TNF-a) was detected in infected macrophages pretreated with ScLL (10 lg/mL). ScLL also reduced the growth of L. (L) amazonensis amastigote intracellular forms, showing no in vitro cytotoxic effects in mammalian host cells. ScLL treatment in infected murine inflammatory peritoneal macrophages did not induce nitric oxide production, suggesting that a nitric oxide independent pathway is activated to decrease the number of intracellular Leishmania. Ó 2011 Elsevier Inc. All rights reserved.
1. Introduction Pentavalent antimonials are still the first choice drugs for leishmaniasis treatment, despite their cardiac and renal toxicity. Moreover, there is retention of antimony in the tissues, which is responsible for toxic effects (Tuon et al., 2008; David and Craft, 2009; Berman, 1988) thus, it is desirable to develop new drugs. Treatments based on herbal medicines have gain momentum worldwide, mainly due to the validation of alternative therapies by traditional medical systems by the identification of compounds derived from medicinal plants of the aboriginal pharmacopeia (Calixto, 2000; Elvin-Lewis, 2001). Approximately 80,000 vegetal species with therapeutic properties had already been isolated from Brazilian native species of plants and lectins are among the new compounds studied. Lectins are widely distributed in nature and they can be found in seeds, leaves, barks, bulbs, rhizomes, roots cotyledon and tubers of many plants depending on the species (Cummings, 1997) and they are involved in the events of many biological interactions, such as the intracellular translocation of glycoproteins and soluble molecules. In addition to involvement in the regulation of endocytosis, cell migration, adhesion and immune defense processes. The ability of the lectin to interact specifically with carbohydrates makes them valuable instruments in varied
biological research work, and the use of these tools has expanded continuously (Peumans and van Damme, 1995). Lectins such as the ConBr from Canavalia braziliensis and KM+ from Artocarpus integrifolia induce IFN-c and IL-12 p40 production promoting a reversal of the Th2 cytokine pattern to Th1 pattern in BALB/c mice infected with Leishmania amazonensis and Leishmania major, respectively (Barral-Netto et al., 1996; Panunto-Castelo et al., 2001). Previous study from our group had described the isolation, purification and characterization of the D-galactose-binding lectin (ScLL) from the Euphorbiaceae Synadenium carinatum latex (Souza et al., 2005). We have also demonstrated that ScLL in association with Leishmania-soluble antigen developed partial protection in immunized and challenged mice with L. amazonensis promastigote form, by increased levels of specific IgG2a and mRNA expression of cytokines in lesion (IFN-c, IL-12, TNF-a) (Afonso-Cardoso et al., 2007). Furthermore, ScLL showed immunoregulatory functions by oral administration which significantly inhibited neutrophil and eosinophil extravasations in models of acute and chronic inflammation, and reduced eosinophil and mononuclear blood counts during chronic inflammation (Rogerio et al., 2007). Here we investigated the effects of ScLL on L. amazonensis promastigotes interaction with murine inflammatory peritoneal macrophages. 2. Materials and methods
⇑ Corresponding author. Address: Instituto de Ciências Biomédicas, Universidade Federal de Uberlândia, Av. Pará, 1720, Bloco 6T07, Campus Umuarama, 38400-902 Uberlândia, MG, Brazil. Fax: +55 34 3218 2333. E-mail address: [email protected] (M.A. Souza). 0014-4894/$ - see front matter Ó 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.exppara.2011.02.006
2.1. Obtainment and purification of the lectin Popularly known as ‘‘Leiteirinha or folha Santa’’, the S. carinatum species was harvested in Uberlandia, Minas Gerais, and registered
62
S.R. Afonso-Cardoso et al. / Experimental Parasitology 128 (2011) 61–67
in the Herbarium of the Federal University of Uberlandia (HUFU 38354). Proteins were extracted from fresh latex by gentle shaking with deionised water, in the proportion 1:5, for 48 h at 4 °C. The mixture was centrifuged (3500 g, 30 min, 4 °C; Eppendorf centrifuge) and filtered through nitrocellulose membranes (0.45 mm pore size; Merck, Göttingen, Germany) to yield a crude extract. D-Galactose-binding lectin (ScLL) was purified in immobilized Dgalactose column on agarose (Pierce, Rockford, IL, the USA), equilibrated with 0.005 M borate-buffer at pH 7.2 (BBS). ScLL was eluted with 0.4 M D-galactose in BBS (BBS-D-gal) and dialyzed against Tris buffer pH 7.2 (Souza et al., 2005) and the protein concentration was determined (Lowry et al., 1951). 2.2. Parasite culture Leishmania (Leishmania) amazonensis (IFLA/BR/67/PH8) promastigote forms were cultured in brain–heart infusion (BHI) medium, (Oxoid Ltd., Basingstoke, Hampshire, UK), described elsewhere (Nogueira de Melo et al., 2006) supplemented with 10% fetal calf serum (Cultilab, Campinas, Brazil), 100 lg/mL gentamycin and 2 mM L-glutamine (Gibco BRL-Life Technologies, New York, USA), at 26 °C. Parasites in the stationary phase were used in the experimental infection of macrophages. 2.3. Macrophage culture Inflammatory peritoneal macrophages were harvested from BALB/c mice previously inoculated with 3% thioglycollate medium (Gibco, Gaithersburg, MD). The cells were centrifuged and adjusted to 1 106/mL in RPMI 1640 medium supplemented with 2 mM of L-glutamine (Life Technologies, Grand Island, NY), 10% fetal bovine serum (Life Technologies), 100 U/mL penicillin (Sigma Chemical Co., St. Louis, MO, USA), 100 lg/mL streptomycin (Sigma), 1 mM sodium pyruvate and 100 mM MEM non-essential amino acids (Life Technologies; complete medium). The macrophage suspension was seeded (2 105/200 lL/well) onto cover slips in 24-well flat-bottomed plates (Corning Corporation; Cambridge, MA, USA) and then incubated for 2 h in a humidified chamber at 37 °C, containing 5% CO2. Adherent cells (95% macrophages) were washed three times with PBS (pH 7.2), and incubated for 48 h with either RPMI medium alone or medium containing ScLL (100, 50 and 10 lg/mL), LPS (10 lg/ml) and IFN-c (40 ng/mL). Lectin ConA (5 lg/mL), PHA (10 lg/mL) and Jacalin (10 lg/mL) were used as reference. 2.4. Infection of macrophages and NO production Murine inflammatory peritoneal macrophages were either treated or not treated with 100, 50 and 10 lg/mL of ScLL 48 h prior to the macrophage-parasite interaction. Nonadherent cells were removed by washing and adherent macrophages were infected with L. amazonensis promastigotes in the stationary growth phase. The parasites and macrophages were quickly brought into contact by centrifugation at 20 °C (130g, 5 min) and incubated at room temperature for 3 h before being washed to remove free parasites. Infected macrophages were cultured under cover slip in complete medium in a humidified chamber at 37 °C, containing 5% CO2 for 24, 48 and 72 h, and then to analyze Giemsa stained. The percentage of infected macrophages was determined by counting 100 cells in triplicate by the same specialist. The association index was determined by multiplying the percentage of infected macrophages by the mean number of parasites per infected cell. An association index was considered as the number of parasites that actually infected the macrophages. Nitrite present in the supernatants of murine inflammatory peritoneal macrophages was determined by Griess reaction by adding 50 ll of supernatants to
96-well flat-bottomed plates containing 50 ll of Griess reagent [1% sulfanilamide/0.1% N-(1-naphthyl)ethylenediamine dihydrochloride/2.5% H3PO4]. The samples were assayed in quadruplicate. The absorbance was measured (Multiskan MS microplate reader, LabSystems Oy, Helsink, Finland) at 540 nm and the nitrite concentration was determined from a standard curve of sodium nitrite. The results were expressed as lM nitrite/105 cells. All results presented in this work are representative of three other experiments performed independently. 2.5. Cytotoxity assay ScLL cytotoxicity in macrophages was measured by a classical neutral red uptake (NRU) assay (Borenfreund and Puerner, 1985; Rosa et al., 2003). Briefly, murine inflammatory peritoneal macrophages were cultivated in 96-well microtiter plates (150 ll containing 105 cells/mL in RPMI complete medium/well) at 37 °C in a humidified 5% CO2 atmosphere. Twenty-four hours post incubation, 50 ll ScLL at 100, 50 and 10 lg/mL were added to cell cultures; 50 ll RPMI medium were added to the control cells and incubated for an additional 48 h. Control and treated cells were washed three times with PBS (pH 7.2) and neutral red solution (0.3%) was added and incubated for 3 h at 37 °C and the cells were then washed three times with PBS. A solution (100 ll) containing 1% acetic acid and 50% ethanol was added and the optical density of the supernatants was measured at 540 nm. Cell viability was determined using the formula [100 (L2/L1) 100], where L1 is the percentage of viable control cells and L2 is the percentage of viable treated cells, as previously described (Delorenzi et al., 2001). 2.6. Cytokines and iNOS expression by conventional RT-PCR The mRNA was isolated from murine inflammatory peritoneal macrophages cultured for 24, 48 and 72 h post infection with L. amazonensis, using a RNA kit (RNeasy Mini Kit, Quiagen) according to the manufacturer’s instructions. The cDNA was obtained using an iScript™ cDNA Synthesis kit (Bio-Rad Laboratories, Hercules, CA, USA). The PCR used 8 ll of master mix (0.2 mM dNTP, 1 ll of 10 PCR buffer, 0.2 lM of each primer, IL-1b, IL-12, TNF-a and iNOS; Table 1), 4.4 ll of water, 1 U/ll of Taq DNA Polimerase, 1.5 mM MgCl2 (Invitrogen Life Technologies, Carlsbad, CA, USA) and 2 ll cDNA of each sample. The sequence of the used primers is listed (Table 1). The reaction was carried at 95 °C/2 min, 94 °C/ 1 min, 57 °C/1 min and 72 °C/1 min, for 37 cycles in a thermocycler (Applied Biosystems, CA, USA). Analysis of PCR products obtained was carried out by electrophoresis in a 2% agarose gel stained with ethidium bromide. It was glyceraldehyde-3-phosphate dehydrogenase (GAPDH) primer as the normal pattern of expression. The bands were visualized under ultraviolet light (Höefer Pharmacia Biotech San Francisco Incorporation, CA, USA). The efficiency-corrected quantification was performed automatically by relative expression (RE) software based on relative standard curves describing the PCR efficiencies of the used cytokines, iNOS and GAPDH genes. The values were within the linear range of standard
Table 1 Sequence of primers. Target
IL-10 IL-12 p35 TNF-a iNOS GAPDH
Oligonucleotide sequence (50 –30 ) Forward
Reverse
TCATGGCATTTTGAACGAG AGACCAGAGACATGGAGTCATA
GCACCTTGGAAGCCCTACAG TGCTTCACACTTCAGGAAAG
GATCTCAAGACAACCAACATGTG GATGGTCAAGATCCAGAGAGGTCT CATGGCCTTCCGTCTTCCTA
CTCCAGCTGGAAGACTCCTCCCAG AATTCGAGGCCACCCACC GGTCCTCACTGTAGCCCAAGAT
63
S.R. Afonso-Cardoso et al. / Experimental Parasitology 128 (2011) 61–67
curve, and results were expressed as cytokine and iNOS/GAPDH ratio (the test sample divided by cytokine and iNOS/GAPDH ratio of the calibrator sample 100%), and therefore, samples were normalized. 2.7. Statistical analysis All experiments were performed in triplicate. The mean and standard error of at least three experiments were determined. Statistical analysis of the differences between mean values obtained for experimental groups was performed by analysis of variance (one-way-ANOVA). Significant differences were analyzed by the Tukey–Kramer Multiple Comparison Tests (GraphPad InStat 3 for Windows Program). p < 0.05 was considered significant. 3. Results 3.1. Infection of macrophages Twenty-four hours post infection with L. (L.) amazonensis, murine inflammatory peritoneal macrophages stimulated previously with ScLL (100, 50 and 10 lg/mL) showed 55.7%, 65.5% and 45.3% of infection, respectively, while the control cells (stimulated only with medium) was 100% infected (Table 2). The percentage of infection in macrophages pretreated with ScLL (100, 50 and 10 lg/mL), for 48 and 72 h was also reduced when compared to controls (Table 2). So, the parasite burden was significantly reduced when compared to the control (only medium). The cells pretreated with IFN-c showed 50% of infection and the lowest average of parasites per cell (7.5), for 72 h (Table 2). Macrophages pretreated with the lectin ConA, Jacalin and PHA, showed no significant alterations in percentage of infection and in the average of parasite per cells in culture for 24–72 h (Table 2). 3.2. NO production The detection of NO production it was significantly lower (p < 0.05) when murine inflammatory peritoneal macrophages were pretreated with different concentrations of lectin ScLL (100, 50 and 10 lg/mL) in comparison to cells treated with LPS and IFN-c for 24, 48 and 72 h (Fig. 1). 3.3. Expression of cytokines and iNOS by conventional RT-PCR A conventional RT-PCR showed that the different concentrations of ScLL used in the pretreatment schedule induced mRNA expression of cytokines and iNOS in infected and cultured macrophages for 24 and 72 h. There was high IL-12 relative expression in macrophages stimulated with ScLL (10 and 100 lg/mL), IFN-c
Fig. 1. NO production by peritoneal macrophages. Supernatants of macrophages treated with ScLL (100, 50, 10 lg/mL), LPS (10 lg/ml), IFN-c (40 ng/mL), Con-A (5 lg/mL), Jacalin (10 lg/mL), PHA (10 lg/mL) and infected L. (L.) amazonensis promastigotes were collected and the nitrite level of each system was determined by Griess reaction as described in Section 2. (A) 24 h; (B) 48 h; (C) 72 h post infection. Columns shown nitrite levels (means ± standard deviations from three independent experiments) expressed in lM. ⁄p < 0.05.
and Jacalin, cultured for 24 h (Fig. 2). IL-1b was expressed in cells pretreated with different concentration ScLL (100, 50 and 10 lg/
Table 2 Inflammatory macrophages infection index by L. (L.) amazonensis. Treatments
Hours post infection 24
Medium 100 lga 50 lg 10 lg LPS IFN-c Con-A Jacalin PHA *
P < 0.05. ScLL lectin.
a
48
72
Infection (%)
Parasites/cell (average)
Infection (%)
Parasites/cell (average)
Infection (%)
Parasites/cell (average)
100.00 55.70 65.50 45.30 57.50 50.00 60.70 65.30 60.60
(75) (30) (25) (30) (40) (20) (65) (45) (45)
100.00 40.30 50.20 40.40 50.50 25.30 60.50 60.60 60.70
(75) (25) (25) (25) (37.5) (17.5) (75) (60) (60)
100.00 41.70 51.30 40.50 46.50 20.50 53.70 63.60 64.80
(65) (17.5)* (20)* (20)* (30) (7.5) (60) (45) (60)
64
S.R. Afonso-Cardoso et al. / Experimental Parasitology 128 (2011) 61–67
Fig. 2. Expression and relative intensity of cytokines and iNOS by conventional RT-PCR assay in mice inflammatory macrophage 24 h post infection by L. (L.) amazonensis. Bars represent the relative intensity of mRNA expression of cytokines and iNOS in the murine inflammatory peritoneal macrophages pretreated with ScLL (100, 50, 10 lg/mL), LPS (10 lg/ml), IFN-c (40 ng/mL), Con-A (5 lg/mL), Jacalin (10 lg/mL), PHA (10 lg/mL) 48 h prior to infection by L. (L.) amazonensis promastigotes. Medium was used as control. GAPDH expression was used as the normal patterns of mRNA expression.
mL) in the culture for 24 h, and remaining detectable at 72 h of the culture (Fig. 3). On the other hand, there was not detection of IL-10 expression in presence of the lectin in different concentration (data not shown). A TNF-a relative expression was observed in period of 24 h, only in macrophages stimulated with ScLL (10 lg/ml) and IFN-c and an alteration in this profile was observed in infected macrophages cultured for 72 h (Figs. 2 and 3). ConA, PHA and Jacalin were used to control in this experiment (Figs. 2 and 3). 4. Discussion A general lack of effective and inexpensive chemotherapeutic agents is observed for treatment of parasitic protozoan diseases
that occur mainly in the developing world, such as leishmaniasis. Pentavalent antimonial drugs are the first-line treatment for leishmaniasis in most affected areas. Amphotericin B and pentamidine are used as alternative drugs (Tuon et al., 2008; David and Craft, 2009). These agents are not orally active and require long-term parenteral rout administration they also produce severe side effects and are expensive (Blum and Hatz, 2009). Therefore, new drugs are urgently required. In this sense, new drugs of herbal origin discovered through ethnopharmacological studies have shown interesting results. Moreover, several natural compounds with antileishmanial activity have been investigated in various laboratories and correspond to the following groups: alkaloid, terpene, quinone, lactone, coumarin, acetogenin of
S.R. Afonso-Cardoso et al. / Experimental Parasitology 128 (2011) 61–67
65
Fig. 3. Expression and relative intensity of cytokines and iNOS by conventional RT-PCR assay in murine inflammatory peritoneal macrophages 72 h post infection by L. (L.) amazonensis. Bars represent the relative intensity of mRNA expression of cytokine and iNOS in the murine inflammatory peritoneal macrophages pretreated with ScLL (100, 50, 10 lg/mL), LPS (10 (g/ml), IFN-c (40 ng/mL), Con-A (5 lg/mL), Jacalin (10 lg/mL), PHA (10 lg/mL) 48 h prior to infection by L. (L.) amazonensis promastigotes. Medium was used as control. GAPDH expression was used as the normal patterns of mRNA expression.
annonaceae, chalcone, tetralone, lignan, saponin and lectin (Delorenzi et al., 2001). Recently, we describe a novel pharmacological activity obtained from lectin of S. carinatum latex that conferred partial protection to immunized animals with different concentrations of this lectin (Afonso-Cardoso et al., 2007). In this work, we showed also an in vitro inhibitory activity of ScLL on the development of L. (L)
amazonensis into macrophage, and did not show any effect on the viability or morphology of the macrophages (data not shown). It was observed an infection index lower in macrophages pretreated with ScLL and infected by L. (L) amazonensis when compared with control. So, the phagocytic activity of these macrophages was modified during ScLL pretreatment, what suggests some alteration in the phagocytosis process by block or competing
66
S.R. Afonso-Cardoso et al. / Experimental Parasitology 128 (2011) 61–67
of the lectin and parasite. To initiate a successful infection parasites must gain entry into macrophages, and also withstand or circumvent their killing and degradative functions. However, to sustain a chronic infection, parasites must also subvert macrophage-accessory-cell activities and ablate the development of protective immunity (Alexander et al., 1999). Macrophage is armed with antimicrobial mechanisms that intracellular organisms must evade in order to survive. During infection the interactions between parasites and host cells occur in two stages. First, during initial phagocytosis of promastigotes, macrophages can undergo an oxidative response stimulated by the phagocytic event that produces superoxide (O2) as part of the respiratory burst of human and murine macrophages. Second, post infection when amastigote is into the macrophage, the quiescent macrophage can be activated to potentially kill intracellular Leishmania. Another antileishmanial oxidant produced by activated macrophages is NO that is the most relevant to killing established intracellular amastigotes (Gantt et al., 2001). In an in vitro study using Xylitol it was observed that Xylitol stimulated macrophage NO production as which inhibited the macrophage infection by L. amazonensis (Ferreira et al., 2008). Although strong evidence that NO plays an important role in murine leishmaniasis, it remains controversial whether NO plays a role in antileishmanial responses of human macrophages. Thus, in order to determine whether detectable NO was produced during infection of macrophages with L. amazonensis, we measured nitrite produced from NO released into culture supernatants of infected macrophages as well as the modulation of NO expression during the interaction in the presence of ScLL. We demonstrated that macrophages pretreated with ScLL did not produce significant amount of nitrite, in comparison to non treated macrophages. So, there was mRNA expression of iNOS and cytokine such as IL-1b, IL-12, TNF-a in treated and infected macrophage. However, it has been demonstrated that these cytokines fail to activate macrophages and to kill Leishmania mexicana/amazonensis (Abu-Dayyeh et al., 2010). The detection of iNOS mRNA suggests that a post transcriptional inhibitory pathway of iNOS may be activated by ScLL. Previous reports showed that various natural flavonoids are known to have anti-inflammatory activity in mammalian cells, and their action in inflammation has been attributed to their antioxidant activity, as well as to their ability to suppress NO production in macrophages (Matsuda et al., 2003; Kim et al., 1999). NO synthesis by phagocytes depends on the expression of an NOS isoform (iNOS), which is induced by interferon-c (IFN-c), tumor necrosis factor-a (TNF-a) and bacterial endotoxins, and is crucial for eliminating intracellular pathogens internalized by these cells (Green et al., 1991). However, the continuous elevated production of NO may account for several disorders associated with chronic inflammatory disorders, such as, inflammatory bowel diseases (Grisham et al., 2002). Thus, natural flavonoids are very promising as therapeutic agents for inflammation (Lai and Yen, 2002) and highly active against Leishmania (V.) peruviana (Marín et al., 2009). Several classes of natural flavonoids inhibit NO production by inflammatory cells such as activated peritoneal macrophages (Krol et al., 1995), RAW 264.7 cells (Wang and Mazza, 2002) and C6-astrocytes (Soliman and Mazzio, 1998), in vitro. Our results suggest that the lectin (ScLL) from S. carinatum latex inhibited synthesis of NO by murine macrophages probably by a similar pathway to flavonoids compounds. Another possible pathway activated by ScLL during its anti-inflammatory effects may be by activating annexin 1 (ANX-1). ANX-1 is an anti-inflammatory protein induced by glucocorticoid. Like glucocorticoid, ANX-1 and derived peptides inhibit eicosanoid synthesis, block leukocyte migration and induce apoptosis of inflammatory cells. Previous results suggested that some of the anti-inflammatory effects of ANX-1 may be mediated by the release of IL-10, which, in turn, inhibits NO release (Ferlazzo et al., 2003).
So, in this study, inflammatory macrophages treated with ScLL showed no significant NO production but parasite proliferation was significantly decreased however nitric oxide has been identified as a key molecule for leishmanicidal function of macrophages. On the other hand, it has been demonstrated that Leishmania guyanensis amastigotes die inside macrophages through an apoptotic process that is independent of nitric oxide and is mediated by reactive oxygen intermediates generated in the host cell during infection (Sousa-Franco et al., 2006). Our data indicated that other pathways besides NO release are important for parasite clearance. However, the induction of apoptosis by ScLL in Leishmania parasites is still to be available. Taken together, the results presented here suggest that this lectin provide motivation for further exploration of, particularly as antileishmanial agents. Acknowledgments This work was performed with financial support of Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq), Fundação de Amparo à Pesquisa de Minas Gerais (Fapemig) and Sustainable Science Institute (SSI). References Abu-Dayyeh, I., Hassani, K., Westra, E.R., Mottram, J.C., Olivier, M., 2010. Comparative study of the ability of Leishmania mexicana promastigotes and amastigotes to alter macrophage signaling and functions. Infection and Immunity 78, 2428–2445. Afonso-Cardoso, S.R., Rodrigues, F.H., Gomes, M.A.B., Silva, A.G., Rocha, A., Guimarães, A.H.B., Candeloro, I., Favoreto Jr., S., Ferreira, M.S., Souza, M.A., 2007. Protective effect of lectin from Synadenium carinatum on Leishmania amazonensis infection in BALB/c mice. Korean Journal Parasitology 45, 255–266. Alexander, J., Satoskar, A.R., Russel, D.G., 1999. Leishmania species: models of intracellular parasitism. Journal Cell of Science 112, 2993–3002. Barral-Netto, M., Von Sohsten, R.L., Teixeira, M., Dos Santos, W.L.C., Pompeu, M.L., Moreira, R.A., Oliveira, J.T.A., Cavada, B.S., Falcoff, E., Barral, A., 1996. In vivo protective effect of the lectin from Canavalia brasiliensis on BALB/c mice infected by Leishmania amazonensis. Acta Tropica 60, 237–250. Berman, J.D., 1988. Chemotherapy for leishmaniasis: biochemical mechanisms, clinical efficacy, and future strategies. Reviews Infect Disease 10, 560–586. Blum, J.A., Hatz, C.F., 2009. Treatment of cutaneous leishmaniasis in travelers 2009. Journal of Travel Medicine 16, 123–131. Borenfreund, E., Puerner, J.A., 1985. Toxicity determined in vitro by morphological alterations and neutral red absorption. Toxicology Letter 24, 119–124. Calixto, J.B., 2000. Efficacy, safety, quality control, marketing and regulatory guidelines for herbal medicines (phytotherapeutic agents). Brazilian Journal Medical Biological Research 33, 179–189. Cummings, R.D., 1997. In: Gabius, H.J., Gabius, S. (Eds.), Glycosciences, Status and Perspectives. Chapman & Hall GmbH, Weinheim, Germany, pp. 191–199. David, C.V., Craft, N., 2009. Cutaneous and mucocutaneous leishmaniasis. Dermatologic Therapy 22, 491–502. Delorenzi, J.C., Attias, M., Gattass, C.R., Andrade, M., Rezende, C., Cunha-Pinto, A., Henriques, A.T., Bou-Habib, D.C., Saraiva, E.M.B., 2001. Antileishmanial activity of an indole alkaloid from Pesquiera australis. Antimicrobial Agents Chemotherapy 45, 1349–1354. Elvin-Lewis, M., 2001. Should we be concerned about herbal remedies. Journal of Ethnopharmacology 75, 141–164. Ferlazzo, V., D’Agostino, P., Milano, S., Caruso, R., Feod, S., Cillari, E., Parente, L., 2003. Anti-inflammatory effects of annexin-1: stimulation of IL-10 release and inhibition of nitric oxide synthesis. International Immunopharmacology 3, 1363–1369. Ferreira, A.S., de Souza, M.A., Barbosa, N.R., da Silva, S.S., 2008. Leishmania amazonensis: xylitol as inhibitor of macrophage infection and stimulator of macrophage nitric oxide production. Experimental Parasitology 119, 74–79. Gantt, K.R., Goldman, T.L., McCornick, M.L., Miller, M.A., Jeronimo, S.M.B., Nascimento, E.T., Britigan, B.E., Wilson, M.E., 2001. Oxidative responses of human and murine macrophages during phagocytosis of Leishmania chagasi. Journal of Immunology 167, 893–901. Green, S.J., Nacy, C.A., Meltzer, M.S., 1991. Cytokine-induced synthesis of nitrogen oxides in macrophages: a protective host response to Leishmania and other intracellular pathogens. Journal Leukocyte Biology 50, 93–103. Grisham, M.B., Pavlick, K.P., Laroux, F.S., Hoffman, J., Bharwani, S., Wolf, R.E., 2002. Nitric oxide and chronic gut inflammation: controversies in inflammatory bowel disease. Journal Investigative Medicine 50, 272–283. Kim, H.K., Cheon, B.S., Kim, Y.H., Kim, S.Y., Kim, H.P., 1999. Effects of naturally occurring flavonoids on nitric oxide production in macrophage cell line RAW 264.7 and their structure–activity relationships. Biochemical Pharmacology 58, 759–765.
S.R. Afonso-Cardoso et al. / Experimental Parasitology 128 (2011) 61–67 Krol, W., Czuba, Z.P., Treadgill, M.D., Cunningham, B.D., Pietse, G., 1995. Inhibition of nitric oxide (NO) production in murine macrophages by flavones. Biochemical Pharmacology 50, 1031–1035. Lai, H.H., Yen, G.C., 2002. Inhibitory effect of isoflavones on peroxynitrite mediated low-density lipoprotein oxidation. Bioscience Biotechnology Biochemistry 66, 22–28. Lowry, O.H., Rosebrough, N.J., Faar, A.L., Randall, R.J., 1951. Protein measurement with the folin phenol reagent. Journal of Biological Chemistry 193, 265–275. Marín, C., Boutaleb-Charki, S., Díaz, J.G., Huertas, O., Rosales, M.J., Pérez-Cordon, G., Guitierrez-Sánchez, R., Sánchez-Moreno, M., 2009. Antileishmaniasis activity of flavonoids from Consolida oliverian. Journal Natural Products 72, 1069–1074. Matsuda, H., Morikawa, T., Ando, S., Toguchida, I., Yoshikawa, M., 2003. Structural requirements of flavonoids for nitric oxide production inhibitory activity and mechanism of action. Bioorganic & Medicinal Chemistry 11, 1995–2000. Nogueira de Melo, A.C., d’Avila-Levy, C.M., Dias, F.A., Armada, J.L., Silva, H.D., Lopes, A.H., Santos, A.L., Branquinha, M.H., Vermelho, A.B., 2006. Peptidases and gp63like proteins in Herpetomonas megaseliae: possible involvement in the adhesion to the invertebrate host. International Journal for Parasitology 36, 415–422. Panunto-Castelo, A., Souza, M.A., Roque-Barreira, M.C., Silva, J.S., 2001. KM+, a lectin from Artocarpus integrifolia, induces IL-12p40 production by macrophages and switches from type 2 to type 1 cell mediated immunity against L. major antigens, resulting in BALB/c mice resistence to infection. Glycobiology 11, 1035–1042. Peumans, W.J., van Damme, E.J., 1995. The role of lectins in plant defense. Histochemical Journal 27, 254–271.
67
Rogerio, A.P., Cardoso, C.R., Fontanari, C., Souza, M.A., Afonso-Cardoso, S.R., Silva, E.V.G., Koyama, N.S., Basei, F.L., Soares, E.G., Calixto, J.B., Stowell, S.R., DiasBaruffi, M., Faccioli, L.H., 2007. Anti-asthmatic potential of a D-galactosebinding lectin from Synadenium carinatum latex. Glycobiology 17, 795–804. Rosa, M.S.S., Mendonça-Filho, R.R., Bizzo, H.R., Rodrigues, I.A., Soares, R.M.A., SoutoPadrón, T., Alviano, C.S., Lopes, A.H.C.S., 2003. Antileishmanial activity of linalool-rich essential oil from Croton Cajucara. Antimicrobial Agents Chemotherapy 47, 1895–1901. Soliman, K.F., Mazzio, E.A., 1998. In vitro attenuation of nitric oxide production in C6 astrocyte cell culture by various dietary compounds. Proceedings of the Society for Experimental Biology and Medicine 218, 390–397. Sousa-Franco, J.S., Araújo-Mendes, E., Silva-Jardim, I., Santos, J.L., Faria, D.R., Dutra, W.O., Horta, M.F., 2006. Infection-induced respiratory burst in BALB/c macrophages kills Leishmania guyanensis amastigotes through apoptosis: possible involvement in resistance to cutaneous leishmaniasis. Microbes and Infection 8, 390–400. Souza, M.A., Amâncio-Pereira, F., Barros-Cardoso, C.R., Gomes-Silva, A., Silva, E.G., Andrade, L.R., Pena, J.D.O., Lanza, H., Afonso-Cardoso, S.R., 2005. Isolation and partial characterization of a D-galactose-binding lectin from the látex of Synadenium carinatum. Brazilian Archive Biological Technology 48, 705–716. Tuon, F.F., Amato, V.S., Graf, M.E., Siqueira, A.M., Nicodemo, A.C., Amato-Neto, V., 2008. Treatment of New World cutaneous leishmaniasis – a systematic review with a meta-analysis. International Journal of Dermatology 47, 109–124. Wang, J., Mazza, G., 2002. Inhibitory effects of anthocyanins and other phenolic compounds on nitric oxide production in LPS/IFN-gamma-activated RAW 264.7 macrophages. Journal of Agricultural and Foods Chemical 50, 850–857.