Effects of 7S globulin 3 derived from the adzuki bean [Vigna angularis] on the CSP- and eDNA- dependent biofilm formation of Streptococcus mutans

Archives of Oral Biology 102 (2019) 256–265

Contents lists available at ScienceDirect

Archives of Oral Biology journal homepage: www.elsevier.com/locate/archoralbio

Effects of 7S globulin 3 derived from the adzuki bean [Vigna angularis] on the CSP- and eDNA- dependent biofilm formation of Streptococcus mutans

T

⁎

Hidenobu Senpukua, , Shota Mohria,b, Mamiko Miharaa,b, Toshiaki Araia, Yusuke Suzukia, Yoji Saekia,b a b

Department of Bacteriology I, National Institute of infectious Diseases, Shinjuku-ku, Tokyo, Japan Health Science Section, Central Laboratory, Lotte Co., Ltd, Saitama-Shi, Saitama, Japan

A R T I C LE I N FO

A B S T R A C T

Keywords: Biofilm 7S globulin 3 Adzuki bean [Vigna angularis] Streptococcus mutans Quorum sensing system Competence stimulating peptide

Objective: Streptococcus mutans is a principal bacterium that forms pathogenic biofilm involved in the development of dental caries. S. mutans possesses a quorum sensing system (QS) stimulated by competence stimulating peptide (CSP), which is associated with bacteriocin production, genetic competency and biofilm formation. Inhibiting CSP-dependent QS is one of the aims leading to the inhibition of biofilm formation and is useful for establishing new prevention systems for dental caries. Design: In this study, we selected adzuki bean [Vigna angularis] extract as a candidate component to inhibit CSPdependent biofilm formation among various foods. To purify an inhibitory component from the adzuki extracts, we performed the salting-out method, two rounds of ion-exchange chromatography, and SDS and native PAGE. Results: A primary protein band that inhibits CSP-dependent biofilm formation appeared at approximately 50 kDa and was identified as 7S globulin 3 (7S3), a major seed storage protein in adzuki bean. To determine the characteristics of 7S3 as an inhibitory component, aggregated proteins were extracted from the adzuki crude extracts at pH values lower than 6. The aggregated proteins inhibited CSP- and eDNA-dependent biofilm formation and showed 50 kDa band, which is identical with 7S3 in the purified sample. Moreover, 7S globulin 3 in the adzuki bean extract directly interacted with CSP at low pH conditions but not at neutral conditions, and inhibited CSP-dependent bacteriocin production. Conclusion: It was suggested that 7S3 might be a safe and useful material to prevent pathogenic activities in the biofilm formation of S. mutans.

1. Introduction Dental caries is recognized as an infectious disease that is caused by biofilms that accumulate on the surface of teeth. Streptococcus mutans is one of the primary bacteria that form the pathogenic biofilm that causes tooth decay and is considered to be an important etiological agent for dental caries (Loesche, 1986; Marsh, 1999). S. mutans produces glucosyltransferases (Gtfs), which polymerize the glucosyl moiety from sucrose, generating adhesive glucans (Bowen & Koo, 2011). The Gtfs and their glucan products　constitute the sucrose-dependent pathway that is central to plaque formation and caries development (Banas, Fountain, Mazurkiewicz, Sun, & Vickerman, 2007; Gregoire, Xiao, & Silva, 2011). In addition to the participation of these glucans, a glucan-independent mechanism induced by extra-cellular DNA (eDNA), which is produced in quorum sensing systems (QS) to interfere with both the social (density) and physical (mass-transfer) environment, is also involved in

⁎

biofilm formation (Das, Sharma, Busscher, van der Mei, & Krom, 2010; Das, Sehar, & Manefield, 2013). S. mutans utilizes QS to adapt to environmental perturbations and survive under severe conditions (Li, Tang, & Aspiras, 2002). S. mutans produces an auto-inducer, the competence-stimulating peptide (CSP), which is a 21 amino acid peptide that functions as a signal in comdependent QS systems. Com-dependent QS systems primarily consist of various pathways that are activated following bacteriocin production, genetic transformation, acid tolerance, and the formation of stress-induced multidrug-tolerant persister cells (Cramton, Gerke, Schnell, Nichols, & Götz, 1999; Lemme, Gröbe, Reck, Tomasch, & WagnerDöbler, 2011; Leung & Lévesque, 2012; Li, Lau, & Tang, 2002; Li, Tang et al., 2002; Kreth, Merritt, Shi, & Qi, 2005; Perry, Jones, Peterson, Cvitkovitch, & Lévesque, 2009). A previous study indicated that the com-dependent QS system is involved in biofilm formation (Ahn, Wen, & Burne, 2006; Cvitkovitch, Li, & Ellen, 2003). In another study, comC

Corresponding author at: Department of Bacteriology I, National Institute of Infectious Diseases, 1-23-1 Toyama, Shinjuku-ku, Tokyo, 162-8640, Japan. E-mail address: [email protected] (H. Senpuku).

https://doi.org/10.1016/j.archoralbio.2019.04.010 Received 2 August 2018; Received in revised form 18 March 2019; Accepted 15 April 2019 0003-9969/ © 2019 Elsevier Ltd. All rights reserved.

Archives of Oral Biology 102 (2019) 256–265

H. Senpuku, et al.

2.2. Real-time PCR

mutants that were unable to produce CSP formed biofilms that were architecturally different from those of the wild-type strain (Li, Tang et al., 2002; Perry, Cvitkovitch, & Lévesque, 2009; Petersen, Pecharki, & Scheie, 2004). Through the com system, CSP induces bacteriocin and autolysin and DNA is released from bacterial cells that are destroyed by bacteriocin and autolysin. For clarification, a bacteriocin is produced by one strain and exerts bactericidal activity against another strain; by contrast, an autolysin destroys its own cells. These outcomes suggested that the DNA increase in cell death and eDNA production by CSP had a positive impact on biofilm formation (Li, Hanna, Svensäter, Ellen, & Cvitkovitch, 2001; Perry, Cvitkovitch et al., 2009; Petersen et al., 2004; Qi, Kreth, & Lévesque, 2005; Petersen, Tao, & Scheie, 2005; Zhang, Ou, Wang, & Ling, 2009). eDNA, which is considered to be genomic DNA that is released by dead cells, serves important functions as a factor for initial surface attachment and an adhesive factor among bacteria that are associated with the biofilm development. Furthermore, during the development of the mature biofilm, cell death and lysis occur inside of the microcolony, releasing eDNA, which regulates the stability of the biofilm structure (Jennings, Storek, & Ledvina, 2015; Ma, Conover, & Lu, 2009; Rice, Mann, & Endres, 2007; Whitchurch, Tolker-Nielsen, Ragas, & Mattick, 2002). CSPs were also identified in various strains of other groups of streptococci, but it was suggested that CSPs are speciesspecific and, in several instances, specific to certain groups of strains (Håvarstein, Hakenbeck, & Gaustad, 1997; Li et al., 2001; Pozzi, Masala, & Iannelli, 1996) For oral care, using sterilization agents that have broad-spectrum antimicrobial-activity may lead to broken health microbiome and induce oral infection of pathogens as a side effect (de la Fuente-Nunez, Torres, Mojica, & Lu, 2017) because promoting a balanced microbiome is important effectively maintain or restore oral health (Kilian, Chapple, & Hannig, 2016). However, an antagonist of CSP may specifically interfere with S. mutans-dependent communities and not interfere health microbiome. Therefore, the regulation of CSP activity is an effective and safe method to inhibit cariogenic biofilm formation while maintaining a healthy microbiome, and an antagonist of CSP may specifically affect the composition of the indigenous microbial communities, leading to the induction of S. mutans virulence activities. The most prevalent method for preventing dental caries is the physical procedure of tooth brushing. In addition, the routine intake of anti-caries materials can considerably contribute to the prevention of dental caries. Because edible materials are appropriate for this objective, we searched for preventive materials from various vegetables (prune, wolfberry, adzuki bean, black-eyed peas, runner bean, kidney bean and soy bean) that could inhibit CSP-stimulated biofilm formation. In this study, we discovered that the extract of adzuki bean [Vigna angularis], which is a primary ingredient in Japanese food and is eaten throughout the world, inhibited CSP-dependent biofilm formation under conditions including small amounts of sucrose at concentrations that were not high enough to produce a biofilm. This extract also inhibited bacteriocin production in S. mutans, and we further identified the primary active substance. This study identified a novel material from adzuki bean as a safe material for the prevention of biofilm-associated diseases, such as dental caries.

To measure S. mutans gene expressions in planktonic and biofilm cells from FSC-7 and FSC-8 (Motegi, Takagi, & Yonezawa, 2006) in TSB with 0.25% sucrose, the total RNA was isolated at 8 or 14 h after culture. We assessed expression of 11 genes listed in Supplemental Table S1 and selected randomly from CSP-dependent genes among 74 genes that were previously identified in a microarray analysis (Motegi et al., 2006). To analyze the gene expression quantitatively in Real-time PCR, PCR was performed using various primers (Table S1), various cycles (25–35) and SYBR® Premix Ex Taq™ (Takara Bio Inc., Otsu Shiga, Japan) in an Applied Biosystems 7300 (Applied Biosystems, CA). The results were normalized using the conserved primers LARNA5, which were selected on the basis of a comparison between the available 16 s rRNA sequences of lactobacilli and gram-positive bacteria including oral streptococci (Lau, Sung, Lee, Morrison, & Cvitkovitch, 2002), or ldh (lactate dehydrogenase) as the international control. The relative changes in gene expression between planktonic and biofilm cells were calculated using the Comparative CT Method. 2.3. Construction of the sunL, hp and pqq mutant strains The SMU482 (sunL), SMU1507 (hp), and SMU1508 (pqq) genes were identified in the S. mutans UA159 database (http://www.genome.ou. edu/smutans.html). The mutants of these genes were constructed using a PCR ligation mutagenesis method (Lau et al., 2002) with slight modifications in S. mutans UA159. Briefly, a BamHI restriction site was incorporated into the oligonucleotide primers used to generate the upstream and downstream regions of the three genes (Table 1). The PCR products and pResEmMCS10 (Shiroza & Kuramitsu, 1993) were digested with BamHI, and the digested fragments were ligated. The resultant amplicons were transformed into S. mutans strains. Chromosomal DNA of an erythromycin (Em) resistant transformant was extracted and confirmed for gene disruption using PCR with the primer pairs up-forward and down-reverse. Confirmation of the Em cassette insertion causing the gene disruption was performed using Southern blots or PCR. 2.4. Biofilm formation assay A biofilm formation quantitative analysis was conducted using a previously described method with slight modifications (Motegi et al., 2006; Tamura, Yonezawa, & Motegi, 2009). For the establishment of the CSP-dependent biofilm formation assay, the 21-amino acid CSP peptide (amino acid sequence: NH2-SGSLSTFFRLFNRSFTQALGK−COOH) was chemically synthesized (FUNAKOSHI, Tokyo, Japan). A mixture containing a 20-μL suspension of S. mutans (OD600 nm = 0.3), 20 μL of the synthesized CSP solution (final concentration 1 μM), a 50-μL sample solution from adzuki extract, with a two-fold serial Table 1 Primer lists for construction of mutants.

2. Materials and methods 2.1. Bacterial strains and cultivation conditions In this study, we used S. mutans UA159 (a serotype C strain), which is a cariogenic dental pathogen and the UA159 sunL mutant, which is a model strain for eDNA-dependent biofilm formation. S. mutans was grown under aerobic conditions with 5% CO2, 75% N2 and 20% O2 in brain heart infusion broth (BHI, Difco Laboratories, Detroit, MI) at 37 °C prior to inoculation into 96-well microtiter pates.

Primer

Nucleotides sequence

Amplicon

SMU482UF SMU482UR (Bam) SMU482DF (Bam) SMU482DR SMU1507UF SMU1507UR (Bam) SMU1507DF (Bam) SMU1507DR SMU1508UF SMU1508UR (Bam) SMU1508DF (Bam) SMU1508DR

5’5’5’5’5’5’5’5’5’5’5’5’-

sunLU

GATTTTGCTGTCAACGTTCA -3’ GGGGATCCTTAAGACAAAAAGGGCACC -3’ GGGGATCCTGTCGTTGATGGTTGTCTT -3’ TTCAACTGGACTAGCTTGT-3’ GTAGAGCTAATAATGGAAGC -3’ GGGGATCCCAACAAAATCTCTCTTCCC -3’ GGGGATCCGAGGAGACACCTATATTAC-3’ CTTAGGGTTCCAATCCAAAA -3’ TGGTTCTCTCTAGAGAGAT -3’ GGGGATCCCTGCTTCTGCTGAACAATA -3’ GGGGATCCTATGATGAAGAGGAAAGCG-3’ TTCCAATATCAATTAGCAGGG -3’

Endonuclease recognition sequences are underlined. 257

sunLD hpU hpD pqqU pqqD

Archives of Oral Biology 102 (2019) 256–265

H. Senpuku, et al.

dilution, and 10 μL of distilled water was mixed with 100 μL of Tryptic soy broth without dextrose (TSB) or Todd Hewitt broth (THB) supplemented with sucrose (final concentration: TSB with 0.05% sucrose) in a 96-well microtiter plate. For the eDNA-dependent biofilm formation assay, the S. mutans UA159 sunL mutant and UA159 were added with various concentrations (0, 10, 100 and 500 μg/mL) of adzuki extract to aggregate or nonaggregate samples, and 50 μg/mL of commercial soybean extract with and without 1 μM CSP into TSB with 0.25% glucose. Then, the microtiter plates were incubated at 37 °C with 5% CO2 under anaerobic conditions for 16 h. After the incubation, the liquid medium was removed, and the wells of the microtiter plate were rinsed twice with double distilled water (dDW). Next, the plate was desiccated, and the biofilm was stained with safranin (0.25% safranin–0.5% ethanol–H2O, Muto Pure Chemicals, Tokyo Japan) for 15 min. After that, the wells were washed twice with dDW to remove the excess staining solution and desiccated. Safranin was extracted from the biofilm with 100 μL of 70% (v/v) ethanol, and the absorbance at 492 nm (A492) was measured using a plate reader (Thermo Bioanalysis Japan, Tokyo, Japan). To observe live and dead cells in the biofilm, the biofilm was stained using a FilmTracer Live/Dead Biofilm Viability kit (Molecular Probes, Inc., Eugene, OR, USA) that was applied to the biofilms at a final concentration of 5 μM and 30 μM of SYTO 9 and propidium iodide, respectively. The biofilms were incubated with the dyes at room temperature for 20–40 min and subsequently imaged using a confocal microscope (LSM700 Meta NLO CLSM) (Carl Zeiss, Inc., Thornwood, NY, USA). The ratio of dead cells (red intensity) to live cells (green intensity) in the confocal images was calculated using the analytical software ZEN (Carl Zeiss).

1.0 mL/min. These fractions were analysed using SDS-PAGE with 12.5% polyacrylamide gels. The gels were stained with Coomassie brilliant blue G250 (CBB, Wako Chemicals, Tokyo, Japan).

2.8. LC–MS/MS conditions and analysis The protein extracted from the SDS-PAGE gel was digested with trypsin and sent to Leave a Nest Co., Ltd. (Tokyo, Japan) for the identification of the sequence homology using LC–MS/MS.

2.9. Bacteriocin production assays Bacteriocin production was assayed using a method previously described, with slight modifications (Suzuki, Nagasawa, & Senpuku, 2017; Tamura et al., 2009). S. mutans GS5 produces a bacteriocin that inhibits a group C streptococcal strain RP66 but UA159 do not produce it (Paul & Slade, 1975). However, GS5 comC mutant do not produce a bacteriocin. The production is restored by adding of CSP in GS5 comC mutant. Effects of inhibitor on CSP activities are clearly observed in the bacteriocin assay system using GS5 comC mutant and CSP. Briefly, 2 μL of CSP (100 μM or 1 M) was pre-treated with 18 μl of 7S globulin-3 (0.34 μg/ mL) that was purified from adzuki extract in sterile DW at 37 °C for 1 h. Next, 4 μL of each CSP solution was pre-treated with 7S globulin-3 (final concentration, 10 μM or 100 μM CSP) and mixed with 36 μL of a cell suspension (S. mutans GS5 or S. mutans GS5.comC−, OD600 = 0.5) in TSB with 0.25% sucrose, spread onto BHI 2.5% agar plates and incubated at 37 °C for 6 h. The plates after incubation were overlaid with 4 mL of BHI 1% agar broth including Streptococcus RP66 (OD600 = 0.3), diluted to 1:100 and incubated at 37 °C for 24 h. Finally, the inhibition zone diameter of each sample was measured. As a control, we used bovine serum albumin (BSA; IWAI Chemicals, Tokyo, Japan) at the same concentrations used for 7S globulin-3.

2.5. Preparation of vegetables extracts To search for preventive materials from various vegetables (prune, wolfberry, adzuki been, black-eyed peas, runner bean, kidney bean, and soy bean), which were randomly selected, vegetables were ground using a mill and extracted with dDW (1:10 w/v; 2 h; room temperature). Ultimately, the extract was centrifuged at 13,000 x g for 10 min and filtered. The supernatant was freeze-dried.

2.10. Native and SDS-PAGE The fractions with biofilm formation inhibitory activity and the CSPs that were pre-treated with adzuki extracts were separated using SDS and native PAGE on an 8% polyacrylamide gel (e-PAGEL, ATTO Corp., Tokyo, Japan) with and without SDS, and an 15% poly acrylamide gel (ATTO) with SDS. Prior to the electrophoretic analysis, these samples were diluted with an equal volume of native- or SDS-PAGE buffer {0.06 M Tris-HCl (Amersham Pharmacia Biotech, Buckinghamshire, UK), pH 6.8, 20% glycerol (Wako Pure Chemical Industries Ltd, Osaka, Japan), 0 or 1% (wt/vol) SDS (Wako), 0 or 1% 2mercaptoethanol (2-ME, Merck kGaA), and 0.0012% bromophenol blue (Wako)}. The SDS-PAGE samples were heated at 100 °C for 3 min just prior to being loaded on the gel. The CSPs that were pre-treated with adzuki extract for 1 h at 37 °C were not heated or run on the gel. Electrophoretic separation of the proteins was performed for 70 min at 25 mA. Then, the gels were stained with CBB or the silver stain kit (COSMO Bio Co. LTD, Tokyo, Japan) to detect the protein bands. A primary protein band in the fraction showing inhibitory activity was extracted by homogenization in dDW. The slurry was centrifuged at 12,000×g to remove debris, and the supernatant was dialysed.

2.6. Ammonium sulfate fractionation The adzuki bean extract was dissolved in dDW, and solid ammonium sulfate was slowly added to 30%, 40%, 50%, and 60% saturation with stirring at 4 °C and incubated for 1 h. Each precipitate was collected by centrifugation at 13,000 x g for 10 min and dissolved with dDW, dialysed in dDW and freeze-dried. The supernatant of the sample with 60% saturation after centrifugation was also dialysed in dDW and freeze-dried. The protein concentration was quantified using a BCA assay kit according to the manufacturer’s instructions (Thermo Scientific, MA, USA). 2.7. Ion-exchange chromatography The 30–60% ammonium sulfate precipitate was dissolved in 50 mM sodium phosphate buffer (pH 7.0) and loaded onto a diethyl amino ethyl (DEAE)-cellulose column (φ2.0 cm × 72.0 cm) that was preequilibrated with 50 mM sodium phosphate buffer (pH 7.0) and eluted with a 0 to 0.5 M NaCl linear gradient in the same buffer at a flow rate of 1.0 mL/min. The absorbance at 280 nm and the biofilm inhibition activity of each eluted fraction (5 mL) were measured. Biofilm formation activity was calculated as follows: 1 - (biofilm formation index of sample / biofilm formation index of control)×100. The fractions with biofilm formation inhibitory activity were collected, dialysed in 50 mM Tris-HCl buffer (pH 8.0), loaded onto a DEAE-cellulose column that was pre-equilibrated with 50 mM Tris-HCl buffer (pH 8.0) and eluted with a 0 to 0.5 M NaCl linear gradient in the same buffer at a flow rate of

2.11. Statistical analysis The statistical significance of the differences between groups was determined using Student’s t-test. For comparisons among multiple groups, one-way analysis of variance (ANOVA) and the Bonferroni correction were used. P-values of less than 0.05 indicated a significant difference. The data were analysed with Microsoft Excel and SPSS (IBM SPSS Statistics 24: IBM corporation, Armonk, NY). 258

Archives of Oral Biology 102 (2019) 256–265

H. Senpuku, et al.

Fig. 1. Establishment of CSP-dependent biofilm formation. To establish CSP-dependent biofilm formation, S. mutans UA159 was cultivated with various concentrations of CSP in TSB with 0.05% sucrose (A). The ratio of dead cells to live cells were calculated in confocal images of the biofilm formation stimulated with various concentrations of CSP using the analysis software ZEN (B). The data are expressed as the mean ± standard deviation of three independent experiments (*P < 0.05, vs control, no CSP). C: Control.

3. Results

the confocal microscope (Fig. 1B). The ratio was increased in a dosedependent manner when CSP was used at concentrations greater than 1.0 μM (Fig. 1B). Biofilms induced by CSP were inhibited by DNase I in THB with 0.05% sucrose (Fig. 2AB) and in TSB with 0.05% sucrose (data not shown). Therefore, the biofilms induced by CSP were eDNAdependent because they were inhibited by DNase I.

3.1. Establishment of CSP-dependent biofilm formation To establish the CSP-dependent biofilm formation assay, various concentrations of CSP were added to the biofilm formation assay of S. mutans UA159 in TSB or THB including 0.05% sucrose, which is not a high enough sugar concentration for significant biofilm production. Wild-type S. mutans was used for the CSP-dependent biofilm formation assay to investigate the effect of the test sample on S. mutans in its natural state. CSP concentrations greater than 0.25 μM induce significant biofilm formation compared to the control, which lacked CSP in TSB with 0.05% sucrose (Fig. 1A). The CSP-dependent biofilm formation was also analysed, and dead cells predominated compared with the control, which was another medium of THB with 0.05% sucrose but without CSP (Fig. 2AB). At 1 μM CSP, the biofilm formation reached its peak level (Fig. 1A). The ratio of dead cells to live cells was also calculated to elucidate the effect of CSP on biofilm formation; cells were stained using the Live/Dead biofilm Viability kit and observed under

3.2. Purification of the inhibitor of CSP-dependent biofilm formation from adzuki extracts To investigate the effects of vegetable extracts on the formation of CSP-dependent biofilms, their samples were added to the biofilm formation assay. Extracts of adzuki bean inhibited CSP-dependent biofilm formation more than 50% as compared with control: no vegetable in THB with 0.05% sucrose (Supplemental Fig. S1). Prune, kidney been, wolfberry, black eyed peas and runner bean extracts slightly inhibited the biofilm formation. In contrast, soy bean extracts did not inhibit the biofilm formation. In further experiments, adzuki extracts are selected as a preventive material to the CSP-dependent biofilm formation. The 259

Archives of Oral Biology 102 (2019) 256–265

H. Senpuku, et al.

Fig. 2. Observation of eDNA-dependent biofilm formation induced by CSP. (A) Effect of DNase-I on biofilm formations of S. mutans UA159 were observed in THB with 0.05% sucrose. The data indicate the mean ± standard deviation (SD) of triplicate experiments. The experiments were performed three times, with similar results obtained in each. The asterisks indicate a significant difference between the two groups (Student’s ttest; p < 0.01, no MVs vs MVs or no DNase I vs DNase I). (B) The biofilm formations of S. mutans UA159 induced by CSP and the effect of DNase-I on the biofilm formation were analysed using the LIVE/DEAD BacLight viability kit. Stained cells were observed with confocal microscopy and analysed (Zen). Representative data from more than three independent experiments are presented in the pictures.

extracted protein resulted in a single band at 50 kDa on SDS-PAGE (Fig. 4B). This protein inhibited biofilm formation in a dose-dependent manner (Fig. 4C). These results suggest that this inhibitor is a complex protein, and the inhibitory activity is simple. To specifically identify this inhibitory protein, LSeMS/MS analysis was performed. The results of the sequence homology revealed that this protein exhibited a high degree of homology (56.0%, sequence coverage) with 7S globulin 3 (7S3)(Accession, gi/16701318), which is the major storage protein (49728 Mr, Normal mass) of adzuki bean seeds (Vigna angularis) (Fukuda, Maruyama, Salleh, Mikami, & Utsumi, 2008).

biofilm formation significantly decreased in a dose-dependent manner with adzuki extract at a concentration of 0.25 mg/mL or greater in THB with 0.05% sucrose (Fig. 3A). This inhibitory effect was also observed in TSB with 0.05% sucrose (data not shown). Next, we aimed to assess the general molecular weight of the active substances. Dialysis in dDW using cellulose tubes (40–50 Å, EIDIA CO., Ltd., Tokyo, Japan) and ammonium sulfate precipitation was performed. The 30%–60% precipitates inhibited CSP-dependent biofilm formation. To purify the protein components, the 30%–60% precipitates of the active samples were collected and applied to a DEAE-cellulose column in phosphate sodium buffer (pH 7.0) and fractionated twice (Fig. 3B). Then, the fractions were applied to the CSP-dependent biofilm formation assay. Fractions No. 31 to No. 61 were determined to be the protein-eluted samples (Fig. 3C) and were grouped into three classes according to the SDS-PAGE band pattern, as follows: group 1: fraction No. 31 to 35, group 2: fraction No. 37 to 41, and group 3: fraction No. 43 to 61. Groups 1 and 2 significantly inhibited biofilm formation, but group 3 resulted in only a slight inhibition (Fig. 3D). The number of protein bands for group 1 (No. 31, 33 and 35) on SDS-PAGE was less than that of group 2 (Fig. 3C, No. 37, 39 and 41) and protein was observed in a single smear band at more than 100 kDa on native PAGE (Fig. 4A). The

3.3. Characteristics of 7S3 in the adzuki crude extracts The 7S globulins (7S1, 7S2 and 7S3) are major storage proteins in adzuki (Fukuda et al., 2008), and 7S3 is less soluble at a lower pH (u = 0.5%) and highly soluble at pH 6 to 9 (u = 0.08%). This phenomenon may be because adzuki 7S3 contains one more acidic amino acid compared with adzuki 7S1 and 7S2 (Fukuda, Prak, Fujioka, Maruyama, & Utsumi, 2007). To characterize 7S3 in the adzuki crude extracts, the samples were incubated at both a pH of 7.2 and a pH of than 6 and prepared with 1N HCl. When the pH was less than 6, the 260

Archives of Oral Biology 102 (2019) 256–265

H. Senpuku, et al.

Fig. 3. Effects of purified proteins in adzuki bean extract on CSP-dependent biofilm formation. S. mutans UA159 was cultivated with various concentrations of adzuki extract in THB with 0.05% sucrose supplemented with 1 μM CSP (A). The inhibition activities were calculated for each fraction. The resulting fractions were applied to the CSP-dependent biofilm formation assay. The active fractions were collected and applied on the same DEAE-cellulose column again in Tris-HCl buffer (pH8.0) (B). Fractions from No. 31 to No. 61 were grouped into three classes (group 1: fraction No. 31 to 35, group 2: fraction No. 37 to 41, group 3: fraction No. 43 to 61) according to SDS-PAGE based upon the 8% polyacrylamide gel band pattern (C). These fraction samples were then applied to the 1 mM CSP-dependent biofilm (D). The data are expressed as the mean ± standard deviation of three independent experiments (*P < 0.05, vs control, no sample). C: Control.

3.4. Establishment of an eDNA-dependent biofilm formation model

samples were aggregated and had a milky colour in the solution (Fig. 5A). To compare the molecular size of the aggregates and nonaggregates in the adzuki samples, these samples were divided into aggregates and non-aggregates by centrifugation. The aggregates dissolved in PBS at a pH of 7.2, and the non-aggregates and commercial 7S3 from soybean were analysed by SDS-PAGE using a 12.5% acrylamide gel. After SDS-PAGE and staining with CBB, a 50-kDa band appeared in the aggregate sample that was identical to the band in the purified inhibitor of 7S3 (Figs. 4B and 5 B). However, a 75-kDa band principally appeared in commercial 7S3 from soybean, and various bands were observed in the non-aggregate sample from the adzuki extracts (Fig. 5B).

We firstly detected the CSP-dependent 21 genes among 74 genes that were previously identified in a microarray analysis (Motegi et al., 2006) (unpublished data). To identify the biofilm-associated genes in 10 genes (Supplemental Table 1) selected randomly from CSP-dependent genes, the expression of genes was observed between planktonic and biofilm cells in clinical strains (FSC-7 and FSM-8) isolated in a previous paper (Motegi et al., 2006). We determined three genes {sunL (SMU482), hp (SMU1507, hypothetical protein), and pqq (SMU1508)} relatively exhibited differences as compared to other genes (Supplemental Fig. S2). However, there were no significant differences in the expression of genes. sunL is located upstream of pppL (SMU483) and pknB (SMU484) involved in the biofilm formation, and contained a promoter to pppL and pknB in S. mutans (Banu, Conrads, & Rehrauer,

Fig. 4. Purified inhibitor from adzuki extract and the effect of the inhibitor on biofilm formation. Native PAGE (A) and SDS-PAGE (B) using active fractions from adzuki extract in DEAE-ion exchange chromatography. M; marker, S: sample from adzuki extract. (C) The effects of adzuki extracts on CSP-stimulated biofilm formation of S. mutans UA159 were observed in THB with 0.05% sucrose. The cell suspension and the extract were cultivated at 37 °C for 16 h in 96-well polystyrene microtiter plates. The data are expressed as the mean ± standard deviation of three independent experiments (*P < 0.05, vs control: no sample).

261

Archives of Oral Biology 102 (2019) 256–265

H. Senpuku, et al.

Fig. 5. Observation of aggregation and the molecular size of the aggregates in adzuki extract. Aggregation of adzuki extracts was observed at a pH of 7.2 and a pH less than 6.0 (A). Commercial 7S3 along with both the aggregate sample and non-aggregated sample from the Azuki extract were applied to SDS-PAGE (B). The gels were stained with CBB. Representative data from more than three independent experiments are presented in the pictures.

Fig. 6. Establishment of eDNA-dependent biofilm formation using S. mutans mutants. S. mutans UA159, UA159.sunL and UA159.gtfBC− were cultivated with various concentrations of DNase-I in TSB supplemented with 0.25% glucose for 8 h (A). The data indicate the mean ± standard deviation (SD) of triplicate experiments. The experiments were performed three times, with similar results obtained in each. The asterisks indicated a significant difference between the two groups (Student’s t-test; p < 0.05, DNase vs no DNase). At 7 or 8 h after culture, the biofilm formations stained with 0.5% safranin were observed in microscope (B). Representative data from more than three independent experiments were presented in the pictures.

Fig. 7. Effect of aggregate and non-aggregate samples from adzuki extract and commercial 7S3 on eDNA-dependent biofilm formation. Various concentrations (10, 100 and 500 μg/ mL) of aggregate and non-aggregate samples from adzuki extract (A), and 50 μg/mL commercial 7S3 (B) were applied into S. mutnas UA159 sunL mutant and the CSP-stimulated biofilm formation of S. mutans UA159 in TSB with 0.25% glucose, respectively. The cell suspension and extract were cultivated at 37 °C for 16 h in a 96-well polystyrene microtiter plate. The data are expressed as the mean ± standard deviation of three independent experiments (*P < 0.05, vs control: no sample).

(Supplemental Fig. S3A). However, the sunL mutation induced more biofilm formation (Supplemental Fig. S3B) and aggregation (Supplemental Fig. S3C) than with the wild-type strain and other mutants under conditions including glucose. Expression of pppL and pknB were inhibited by mutation of sunL in S. mutans (data not shown). The biofilm formation of the UA159 sunL mutant was significantly inhibited by DNase I but the biofilm formation of wild type was slightly inhibited by

2010; Hussain, Branny, & Allan, 2006). hp and pqq are located downstream of rgg (SMU1509) involved in regulator to Com-dependent quorum sensing (Cook & Federle, 2014). Therefore, these genes may be indirectly associated with the biofilm formation. To clear role of these genes, the mutants for these genes were constructed and compared with wild type in the aggregation, biofilm and aggregation assays. Growth of the sunL mutant did not change to the wild type and other mutants 262

Archives of Oral Biology 102 (2019) 256–265

H. Senpuku, et al.

DNase I (Fig. 6). Therefore, the biofilm formation of the UA159 sunL mutant, which has a pknB-associated phenotype, was largely induced and eDNA-dependent under conditions with glucose and has been useful as a model for observing the inhibitory effects of new agents on eDNA-dependent biofilm formation.

concentrations of 0.25 and 0.5 mg/mL at pH 5 but not at pH 7 (Fig. 8B, lanes 6 and 7). Therefore, the production of bacteriocin was inhibited by the direct interaction between 7S-globulin and CSP, but the inhibition was restricted by conditions such as a low pH and a low concentration of CSP or inhibitor.

3.5. Effects of aggregate sample from adzuki extracts on eDNA-dependent biofilm formation

4. Discussion Oral biofilm consists of more than 700 bacterial phylotypes (Aas, Paster, Stokes, Olsen, & Dewhirst, 2005). Tooth surfaces are colonized in a repeatable and sequential manner, i.e., pioneer species are followed by secondary colonizers (Kolenbrander, Palmer, & Rickard, 2006; Quirynen, Vogels, & Pauwels, 2005). It is generally known that S. mutans is a major cariogenic agent that regulates the biofilm formation of this bacterium and biofilms that incorporate other oral bacteria on the tooth surface (Xiao, Klein, & Falsetta, 2012). The CSP produced by S. mutans is related to various cariogenic factors, and the inhibition of CSP can effectively regulate the aetiology of S. mutans and the biofilm formation by complex species (Cramton et al., 1999; Lemme et al., 2011; Leung & Lévesque, 2012; Li, Lau et al., 2002; Li, Tang et al., 2002; Kreth et al., 2005; Perry, Jones et al., 2009). We established a CSP-dependent biofilm formation assay using S. mutans under condition including small amounts of sucrose at concentrations that were not high enough to produce a biofilm, and the resulting biofilm exhibited a higher ratio of dead cells to live cells compared with the biofilm that lacked CSP. In this study, it was confirmed that CSP-dependent biofilm formation involving a high ratio of dead to live cells was eDNA-dependent, as the biofilm formation was significantly inhibited by DNase I. The inhibitory effect of the proteins in the adzuki bean extract were discovered through screening for the inhibitory effects of various food extracts on the CSP-dependent biofilm formation. The adzuki bean protein extracts inhibited CSP-dependent bacteriocin production in addition to its effects on the biofilm formation. We attempted to separate the inhibitory proteins in the extracts using ammonium sulfate precipitation and DEAE ion-exchange chromatography. The results suggested that the protein in the adzuki bean extracts that was responsible for decreasing the biofilm was 7S3. The aggregate sample in the lower pH of 6 was identical at a 50 kDa band to the purified 7S3, and this sample inhibited eDNA-dependent biofilm formation by the S. mutans UA159 sunL mutant and eDNA-dependent biofilm formation by the S. mutans UA159 induced by CSP compared to a non-aggregated sample. The characteristics of the aggregated sample indicated that 7S3 was the primary inhibitor of CSP in the adzuki sample. Commercial 7S3 purified from soy bean also inhibited the CSP-dependent biofilm formation but total extracts did not inhibit the biofilm formation. Soy bean extracts contain a small amount of sucrose, which is a substrate for the synthesis of glucan (Nagasawa, Sato, & Senpuku, 2017). This contamination of sucrose in soy bean sample may counteract the inhibition by 7S3 to the CSP-dependent biofilm formation. Therefore, the effects of total extracts in vegetables might be dependent on the proportion of

To investigate whether an aggregate sample of 7S globulin 3 from adzuki extracts in a pH of less than 6 inhibits the eDNA-dependent biofilm formation, aggregate samples were applied to the biofilm formation assay using the S. mutans UA159 sunL mutant under conditions non-adding CSP. The aggregate samples significantly inhibited the biofilm formation at all concentrations in TSB with 0.25% glucose (Fig. 7A). The non-aggregate samples significantly inhibited the biofilm formation at 100 and 500 μg/mL but not at 10 μg/mL. The inhibition levels at 100 and 500 μg/mL were higher in the aggregate samples compared with the non-aggregate samples. The aggregate samples inhibited the CSP-dependent biofilm formation of S. mutans on the plate in TSB with 0.05% sucrose (data not shown). Therefore, the direct effect of 7S3 to CSP on the inhibitory mechanism is not clear, but the 7S3 aggregate (at a pH less than 6.0) inhibited eDNA-dependent biofilm formation. To confirm the inhibitory effect of commercial 7S3 from soybean on CSP-dependent biofilm formation, commercial 7S3 was applied to the biofilm formation assay using CSP-stimulated S. mutans. The commercial 7S3 significantly inhibited CSP-dependent biofilm formation, whereas no samples lacked this activity (Fig. 7B). The inhibitory effects of 7S3 were also confirmed in kidney bean (data not shown). 3.6. Direct effect of 7S3 on CSP To observe the direct effect of 7S3 on the activity of CSP, CSP was pre-treated with 7S3 from adzuki extracts and applied to the CSP-dependent bacteriocin production assay. Wild-type GS5 resulted in a significant inhibition circle (diameter, 30 mm) in the culture of the indicator strain Streptococcus RP66, but GS5 comC mutant resulted in only a small inhibition circle (diameter, 10 mm; Fig. 8A). After stimulation of the GS5 comC mutant with 10 μM and 100 μM CSP, the inhibition circles were significantly increased (30 mm and 35 mm). However, the CSP-dependent inhibition circle was reduced by 10 μM CSP only, following the pre-treatment with 7S3 (Fig. 8A). In contrast, the inhibitory effects were not observed when 100 μM CSP was used. Therefore, the inhibitor was not completely effective against CSP at a high concentration. To confirm the direct interaction between the 7Sglobulin 3 and the CSP, the pre-treated CSP was applied to SDS-PAGE and stained using the silver staining kit. CSP was clearly observed as a smear band at less than 10 kDa (Fig. 8B, lane 1 and 2). After the pretreatment of CSP with 7S3, the smear bands disappeared at 7S3

Fig. 8. Bacteriocin production and the interaction between adzuki extract and CSP. The effects of adzuki extract on CSP (10 μM and 100 μM)-dependent bacteriocin production were observed on BHI ager plates (A). S. mutans GS5 and S. mutans GS5 comC mutant + CSP exhibited a significant circle of inhibition on the growth of the indicator strain, Streptococcus RP66. However, pre-treatment with 10 μM CSP with the sample purified from the adzuki extract resulted in only a small circle, which was similar to that of the control, S. mutans GS5 comC mutant. CSP was pre-treated with the sample purified from adzuki extracts at a pH of 5.0 7.2 and applied to SDS-PAGE using a 15% polyacrylamide gel (B). 1, Molecular marker; 2, 0.2 mM CSP; 3, 0.1 mM CSP; 4, adzuki extract 1.0 mg/mL; 5 and 9, adzuki extract 0.125 mg/mL + 0.1 mM CSP; 6 and 10, adzuki extract 0.25 mg/mL + 0.1 mM CSP; 7 and 11, adzuki extract 0.5 mg/mL + 0.1 mM CSP; 8 and 12, adzuki extract 1.0 mg/mL + 0.1 mM CSP. At a pH of 5.0, the bands from CSP disappeared following pre-treatment with purified adzuki extracts, but this did not occur at a pH of 7.2. Representative data from more than three independent experiments are presented in the pictures. 263

Archives of Oral Biology 102 (2019) 256–265

H. Senpuku, et al.

Appendix A. Supplementary data

other components for 7S3, and mix effects of other components and 7S3. However, there is a possibility that 7S3 directly affected eDNA-dependent activities after CSP stimulation to inhibit the biofilm formation. We examined the mechanism through which 7S3 led to a decrease in CSP-dependent biofilm formation. We directly applied adzuki extracts to CSP in the bacteriocin production assay, which was another assay that involved CSP. After the direct treatment of CSP with 7S3 for 1 h, CSP lost bacteriocin production activity during the growth of S. mutans on the BHI agar plate. However, it was also considered that, in addition to the direct interaction of 7S3 with CSP, 7S3 might have indirectly affected ComD (the CSP receptor) on the cell surface. To confirm that the interaction was direct, adzuki extract was applied to CSP, and the mixtures were incubated at pH 5.0 or pH 7.2, applied to SDSPAGE and analysed by silver staining following electrophoresis. It was observed that 7S3 interacted with CSP at pH 5.0 but not at pH 7.2 in SDS-PAGE. Low pH conditions (pH less than 6.0) induced the aggregation of 7S3 in the adzuki extracts, and the conformational change led to the interaction with CSP. Therefore, in the biofilm assay using THB and TSB with 0.05% sucrose or 0.25% glucose, S. mutans produced acid during growth via the fermentation of carbohydrates, and the pH decreased to less than pH 6.0 in the medium. At lower pH values, 7S3 was positively charged and not dissolved. At this pH, CSP is not charged and therefore may be physically trapped by the aggregation of 7S3 and, consequently, may inhibit the eDNA-dependent activities induced by CSP. The 7S globulins account for approximately 80% of the total proteins of the adzuki bean, and the protein concentration of the adzuki bean extract was approximately 30% (Schuler, Ladin, Pollaco, Freyer, & Beachy, 1982). This study and the results of the relative activity of the 7S globulin suggested that the 7S globulin was the most effective component in the extract. The 7S globulin is the primary storage protein of other beans, such as the French bean, cowpea, jack bean and mung bean, and there is high sequence homology among these 7S globulins (Carbonro, 2006; Fukushima, 1991; Meng & Ma, 2001). We applied commercial 7S3 from soybean and kidney beans to the CSPdependent biofilm formation assay, and these samples inhibited the biofilm formation. These findings suggest that the bean 7S3 may be a common inhibitor of the biofilm formation stimulated by CSP. 7S globulin is a primary component of adzuki bean, which has been consumed throughout the world for a long time. Therefore, it can be assumed that this is a safe material for human consumption. The components responsible for inhibiting CSP may affect various aetiologies of streptococci, including S. mutans and S. mutans-dependent multispecies biofilm formation without substituted microbism. In conclusion, we demonstrated that the adzuki bean extract may be a safe and useful material for routine oral care to prevent dental caries as an aid to tooth brushing.

Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.archoralbio.2019.04. 010. References Aas, J. A., Paster, B. J., Stokes, L. N., Olsen, I., & Dewhirst, F. E. (2005). Defining the normal bacterial flora of the oral cavity. Journal of Clinical Microbiology, 43, 5721–5732. Ahn, S. J., Wen, Z. T., & Burne, R. A. (2006). Multilevel control of competence development and stress tolerance in Streptococcus mutans UA159. Infection and Immunity, 74, 1631–1642. Banas, J. A., Fountain, T. L., Mazurkiewicz, J. E., Sun, K., & Vickerman, M. M. (2007). Streptococcus mutans glucan-binding protein - A affects Streptococcus gordonii biofilm architecture. FEMS Microbiological Letter, 267, 80–88. Banu, L. D., Conrads, G., Rehrauer, H., Hussain, H., Allan, E., & van der Ploeg, J. R. (2010). The Streptococcus mutans serine/threonine kinase, PknB, regulates competence development, bacteriocin production, and cell wall metabolism. Infection and Immunity, 78, 2209–2220. Bowen, W. H., & Koo, H. (2011). Biology of Streptococcus mutans-derived glucosyltransferases: role in extracellular matrix formation of cariogenic biofilms. Caries Research, 45, 69–86. Carbonro, M. (2006). 7S globulins from Phaseolus vulgaris L.: Impact of structural aspects on the nutritional quality. Bioscience, Biotechnology, and Biochemistry, 70, 2620–2626. Cook, M. C., & Federle, M. (2014). J. Peptide pheromone signaling in Streptococcus and Enterococcus. FEMS Microbiology Review, 38, 473–492. Cramton, S. E., Gerke, C., Schnell, N. F., Nichols, W. W., & Götz, F. (1999). The intercellular adhesion (ica) locus is present in Staphylococcus aureus and is required for biofilm formation. Infection and Immunity, 67, 5427–5433. Cvitkovitch, D. G., Li, Y. H., & Ellen, R. P. (2003). Quorum sensing and biofilm formation in Streptococcal infections. Journal of Clinical Investigations. 112, 1626–1632. Das, T., Sharma, P. K., Busscher, H. J., van der Mei, H. C., & Krom, B. P. (2010). Role of extracellular DNA in initial bacterial adhesion and surface aggregation. Applied and Environmental Microbiology, 76, 3405–3408. Das, T., Sehar, S., & Manefield, M. (2013). The roles of extracellular DNA in the structural integrity of extracellular polymeric substance and bacterial biofilm development. Environmental Microbiological Reports, 5, 778–786. de la Fuente-Nunez, C., Torres, M. D., Mojica, F. J., & Lu, T. K. (2017). Next-generation precision antimicrobials: Towards personalized treatment of infectious diseases. Current Opinion in Microbiology, 37, 95–102. Fukuda, T., Maruyama, N., Salleh, M. R., Mikami, B., & Utsumi, S. (2008). Characterization and crystallography of recombinant 7S globulins of Adzuki bean and structure-function relationships with 7S globulins of various crops. Journal of Agriculture Food Chemistry, 56, 4145–4153. Fukuda, T., Prak, K., Fujioka, M., Maruyama, N., & Utsumi, S. (2007). Physicochemical properties of native adzuki bean (Vigna angularis) 7S globulin and the molecular cloning of its cDNA isoforms. Journal of Agriculture Food Chemistry, 55, 3667–3674. Fukushima, D. (1991). Structures of plant storage proteins and their functions. Food Reviews International, 7, 353–381. Gregoire, S., Xiao, J., Silva, B. B., Gonzalez, I., Agidi, P. S., Klein, M. I., et al. (2011). Role of glucosyltransferase B in interactions of Candida albicans with Streptococcus mutans and with an experimental pellicle on hydroxyapatite surfaces. Applied and Environmental Microbiology, 77, 6357–6367. Håvarstein, L. S., Hakenbeck, R., & Gaustad, P. (1997). Natural competence in the genus Streptococcus: evidence that streptococci can change pherotype by interspecies recombinational exchanges. Journal of Bacteriology, 179, 6589–6594. Hussain, H., Branny, P., & Allan, E. (2006). Eukaryotic-type serine/threonine protein kinase is required for biofilm formation, genetic competence, and acid resistance in Streptococcus mutans. Journal of Bacteriology, 188, 1628–1632. Jennings, L. K., Storek, K. M., Ledvina, H. E., et al. (2015). Pel is a cationic exopolysaccharide that cross-links extracellular DNA in the Pseudomonas aeruginosa biofilm matrix. Proceedings of the National Academy of Sciences of the United States of America, 112, 11353–11358. Kilian, M., Chapple, I. L. C., Hannig, M., Marsh, P. D., Meuric, V., Pedersen, A. M., et al. (2016). The oral microbiome - an update for oral healthcare professionals. British Dental Journal, 221, 657–666. Kolenbrander, P. E., Palmer, R. J., Jr., Rickard, A. H., Jakubovics, N. S., Chalmers, N. I., & Diaz, P. I. (2006). Bacterial interactions and successions during plaque development. Periodontology 2000, 42, 47–79. Kreth, J., Merritt, J., Shi, W., & Qi, F. (2005). Co-ordinated bacteriocin production and competence development: A possible mechanism for taking up DNA from neighbouring species. Molecular Microbiology, 57, 392–404. Lau, P. C., Sung, C. K., Lee, J. H., Morrison, D. A., & Cvitkovitch, D. G. (2002). PCR ligation mutagenesis in transformable streptococci: Application and efficiency. Journal of Microbiological Methods, 49, 193–205. Lemme, A., Gröbe, L., Reck, M., Tomasch, J., & Wagner-Döbler, I. (2011). Subpopulationspecific transcriptome analysis of competence-stimulating-peptide-induced Streptococcus mutans. Journal of Bacteriology, 193, 1863–1877. Leung, V., & Lévesque, C. M. (2012). A stress-inducible quorum-sensing peptide mediates the formation of persister cells with noninherited multidrug tolerance. Journal of Bacteriology, 194, 2265–2274.

Conflict of interest We have no conflicts of interest regarding the contents of this article. Acknowledgements We thank Itaru Suzuki and Takanori Tsugane for their technical support and valuable discussions. This work was supported in part by Grants-in-Aid for the Development of Scientific Research (21390506, 24659821 and 16K11537) from the Ministry of Education, Culture, Sports, Science and Technology of Japan and by the Research Program on Emerging and Re-emerging Infectious Diseases from the Japan Agency for Medical Research and Development, AMED (40105502). We would like to thank American Journal Experts (https://www.aje.com) for English language editing. 264

Archives of Oral Biology 102 (2019) 256–265

H. Senpuku, et al.

Petersen, F. C., Tao, L., & Scheie, A. A. (2005). DNA binding-uptake system: A link between cell-to-cell communication and biofilm formation. Journal of Bacteriology, 187, 4392–4400. Pozzi, G., Masala, L., Iannelli, F., Manganelli, R., Havarstein, L. S., Piccoli, L., et al. (1996). Competence for genetic transformation in encapsulated strains of Streptococcus pneumoniae: Two allelic variants of the peptide pheromone. Journal of Bacteriology, 178, 6087–6090. Qi, F., Kreth, J., Lévesque, C. M., Kay, O., Mair, R. W., Shi, W., et al. (2005). Peptide pheromone induced cell death of Streptococcus mutans. FEMS Microbiological Letter, 251, 321–326. Quirynen, M., Vogels, R., Pauwels, M., Haffajee, A. D., Socransky, S. S., Uzel, N. G., et al. (2005). Initial subgingival colonization of ‘pristine’ pockets. Journal of Dental Research, 84, 340–344. Rice, K. C., Mann, E. E., Endres, J. L., Weiss, E. C., Cassat, J. E., Smeltzer, M. S., et al. (2007). The cidA murein hydrolase regulator contributes to DNA release and biofilm development in Staphylococcus aureus. Proceedings of the National Academy of Sciences of the United States of America, 104, 8113–8118. Schuler, M. A., Ladin, B. F., Pollaco, J. C., Freyer, G., & Beachy, R. N. (1982). Structural sequences are conserved in the genes coding for the alpha, alpha’ and beta-subunits of the soybean 7S seed storage protein. Nucleic Acids Research, 10, 8245–8261. Shiroza, T., & Kuramitsu, H. K. (1993). Construction of a model secretion system for oral streptococci. Infection and Immunity, 61, 3745–3755. Suzuki, Y., Nagasawa, R., & Senpuku, H. (2017). Inhibiting effects of fructanase on competence-stimulating peptide-dependent quorum sensing system in Streptococcus mutans. Journal of Infection and Chemotherapy, 23, 634–641. Tamura, S., Yonezawa, H., Motegi, M., Nakao, R., Yoneda, S., Watanabe, H., et al. (2009). Inhibiting effects of Streptococcus salivarius on competence-stimulating peptide-dependent biofilm formation by Streptococcus mutans. Oral Microbiology and Immunology, 24, 152–161. Whitchurch, C. B., Tolker-Nielsen, T., Ragas, P. C., & Mattick, J. S. (2002). Extracellular DNA required for bacterial biofilm formation. Science, 295, 1487. Xiao, J., Klein, M. I., Falsetta Lu, M. L. B., Delahunty, C. M., Yates, J. R., 3rd, et al. (2012). The exopolysaccharide matrix modulates the interaction between 3D architecture and virulence of a mixed-species oral biofilm. PLoS Pathogens, 8, e1002623. Zhang, K., Ou, M., Wang, W., & Ling, J. (2009). Effects of quorum sensing on cell viability in Streptococcus mutans biofilm formation. Biochemistry Biophysical Research Communications, 379, 933–938.

Li, Y. H., Hanna, M. N., Svensäter, G., Ellen, R. P., & Cvitkovitch, D. G. (2001). Cell density modulates acid adaptation in Streptococcus mutans: Implications for survival in biofilms. Journal of Bacteriology, 183, 6875–6884. Li, Y. H., Lau, P. C., Tang, N., Svensäter, G., Ellen, R. P., & Cvitkovitch, D. G. (2002). Novel two-component regulatory system involved in biofilm formation and acid resistance in Streptococcus mutans. Journal of Bacteriology, 184, 6333–6342. Li, Y. H., Tang, N., Aspiras, M. B., Lau, P. C., Lee, J. H., Ellen, R. P., et al. (2002). A quorum-sensing signaling system essential for genetic competence in Streptococcus mutans is involved in biofilm formation. Journal of Bacteriology, 184, 2699–2708. Loesche, W. J. (1986). Role of Streptococcus mutans in human dental decay. Microbiology and Molecular Biology Reviews: MMBR, 50, 353–380. Ma, L., Conover, M., Lu, H., Parsek, M. R., Bayles, K., & Wozniak, D. J. (2009). Assembly and development of the Pseudomonas aeruginosa biofilm matrix. PLoS Pathogens, 5, e1000354. Marsh, P. D. (1999). Microbiologic aspects of dental plaque and dental caries. Dental Clinical North America, 43, 599–614. Meng, G. T., & Ma, C. Y. (2001). Thermal properties of Phaseolus angularis (red bean) globulin G. Food Chemistry, 73(June (4)), 453–460. Motegi, M., Takagi, Y., Yonezawa, H., Hanada, N., Terajima, J., Watanabe, H., et al. (2006). Assessment of genes associated with Streptococcus mutans biofilm morphology. Applied and Environmental Microbiology, 72, 6277–6287. Nagasawa, R., Sato, T., & Senpuku, H. (2017). Raffinose induces biofilm formation by Streptococcus mutans in low concentrations of sucrose by increasing production of extracellular DNA and fructan. Applied and Environmental Microbiology, 83(15) pii: e00869–17. Paul, D., & Slade, H. D. (1975). Production and properties of an extracellular bacteriocin from Streptococcus mutans bacteriocidal for group A and other streptococci. Infection and Immunity, 12, 1375–1385. Perry, J. A., Cvitkovitch, D. G., & Lévesque, C. M. (2009). Cell death in Streptococcus mutans biofilms: A link between CSP and extracellular DNA. FEMS Microbiological Letter, 299, 261–266. Perry, J. A., Jones, M. B., Peterson, S. N., Cvitkovitch, D. G., & Lévesque, C. M. (2009). Peptide alarmone signalling triggers an auto-active bacteriocin necessary for genetic competence. Molecular Microbiology, 72, 905–917. Petersen, F. C., Pecharki, D., & Scheie, A. A. (2004). Biofilm mode of growth of Streptococcus intermedius favored by a competence-stimulating signaling peptide. Journal of Bacteriology, 186, 6327–6331.

265