Effects of a dietary antioxidant blend and vitamin E on growth performance, oxidative status, and meat quality in broiler chickens fed a diet high in oxidants

IMMUNOLOGY, HEALTH, AND DISEASE Effects of a dietary antioxidant blend and vitamin E on growth performance, oxidative status, and meat quality in broiler chickens fed a diet high in oxidants T. Lu,* A. F. Harper,* J. Zhao,† and R. A. Dalloul*1 *Department of Animal and Poultry Sciences, Virginia Tech, Blacksburg 24061; and †Novus International Inc., St. Charles, MO 63304 stance level was lower in the AOX birds than the VE treatment birds in all phases (P < 0.05). High oxidant diet treatment birds had greater α-1-acid glycoprotein levels on d 10 than SC and PC birds (P < 0.05). The AOX, PC, and SC birds had a greater level of uric acid than the HO and VE+AOX birds on d 10. Superoxide dismutase expression in the liver was less with the HO treatment compared with the SC treatment on d 7 (P < 0.05). The vitamin E concentration in the breast muscle was greatest in the VE birds, whereas vitamin A concentration was greater in the PC birds compared with the SC birds on d 21 (P < 0.05). Compared with VE and AOX, the HO treatment had greater drip loss (P < 0.05). In conclusion, dietary addition of AOX was effective in improving growth, moderately restored the whole body antioxidant capability, and reduced drip loss.

Key words: broiler chicken, antioxidant, performance, meat quality, oxidative status 2014 Poultry Science 93:1–9 http://dx.doi.org/10.3382/ps.2013-03826

INTRODUCTION

et al., 1996). In addition, these oxidants induced oxidative stress in broilers and negatively affected fresh meat quality traits, especially in flavor, color, drip loss, texture, and nutritive value (Gray et al., 1996; Lauridsen et al., 1999). A diet high in polyunsaturated fatty acids (PUFA) tends to increase the potential for lipid peroxidation and reduce the antioxidative capability of broilers (Jung et al., 2010). To prevent oxidative deterioration of dietary components, synthetic antioxidants such as ethoxyquin and propyl gallate are added to the feed for their effective control of dietary lipid oxidation (Madhavi and Salunkhe, 1995). In addition, ethoxyquin improves growth performance (Cabel et al., 1988; Dibner et al., 1996; Wang et al., 1997) and stabilizes lipids in meat when supplemented in the diet (Bartov and Bornstein, 1972, 1981; Webb et al., 1978). Propyl gallate is a polyphenol widely used to chelate iron ions, which are a catalyzer in the oxidation process (Madhavi and Salunkhe, 1995), and to improve stability of vegetable oils under storage (Pinkowski et al., 1986; Hawrysh et al., 1992).

Supplementation of fats and oils in commercial broiler diets has become routine to achieve the recommended energy requirement, and realize optimum growth and feed efficiency. Vegetable oils, which are rich in unsaturated fatty acids, are particularly susceptible to oxidation. The oxidation process involves the generation of free radicals, which may then react with molecular oxygen to produce peroxide free radicals and lipid peroxidation (Sherwin, 1978; Fellenberg and Speisky, 2006). Oxidation products can negatively affect energy and lipid soluble nutrient values in the diet (Sherwin, 1978), be cytotoxic to the body (Esterbauer, 1993), and impair broiler health and growth (Engberg

©2014 Poultry Science Association Inc. Received December 12, 2013. Accepted March 17, 2014. 1 Corresponding author: [email protected]

1

Downloaded from http://ps.oxfordjournals.org/ at Universite Laval on June 13, 2014

ABSTRACT The aim of the study was to determine the effects of a dietary antioxidant blend (AB) and vitamin E on performance, oxidative status, and meat quality. Cobb 500 male broilers (n = 1,200, d 0) were randomly distributed into 6 treatments with 10 replicate pens. Treatments included 1) HO: high oxidant diet, vitamin E at 10 IU/kg, 3% oxidized soybean oil, 3% polyunsaturated fatty acid (PUFA) source; 2) VE: the HO diet with vitamin E at 200 IU/kg; 3) AOX: the HO diet with AB at 135 mg/kg; 4) VE+AOX: the HO diet with vitamin E at 200 IU/kg and AB at 135 mg/kg; 5) SC: standard control; and 6) PC: positive control, the SC diet with AB at 135 mg/kg. From d 0 through d 21, high oxidant diet treatment birds had greater BW, ADG, and ADFI than the SC birds; the AOX birds had better G:F on d 10 and 42, and from d 0 to 42 than SC birds (P < 0.05). The plasma TBA reactive sub-

2

Lu et al.

The combination of both had growth performance benefits in broilers (Tavarez et al., 2011). The objective of this study was to evaluate the effect of the antioxidant blend (AB; ethoxyquin and propyl gallate) and vitamin E, a nutrient and antioxidant, on growth performance, oxidative status, and meat quality in broilers fed diets high in oxidants.

MATERIALS AND METHODS Birds and Experimental Design

Sample Acquisition and Preparation Blood samples were collected by brachial venipuncture into 4-mL heparin vacuum tubes from one tagged chicken at the end of each phase. On d 7, 14, and 21, one bird per pen (n = 10 per treatment) was randomly selected for euthanasia by cervical dislocation to provide tissue samples. The central lobe of the liver from each chicken was flash frozen in liquid nitrogen, and then stored along with plasma samples at −80°C until assays were conducted. On d 42, one chicken from each pen was harvested in the processing facility for samples and carcass data collection.

Plasma TBA Reactive Substances, Alpha-1Acid Glycoprotein, and Uric Acid Thiobarbituric acid reactive substances (TBARS) were determined using a commercial kit from Cayman Chemical Company (Ann Arbor, MI). To determine the concentrations of uric acid and α-1-acid glycoprotein (AGP) in the plasma, commercial kits were acquired from Teco Diagnostics (Anaheim, CA) and Life Diagnostics (West Chester, PA), respectively, and used according to the manufacturers’ recommendations.

Table 1. Description of treatments used in the broiler study Control (nonoxidized oil and no PUFA source)2

Treatment (oxidized oil and PUFA source)1 Item oil,3

Oxidized soybean % Nonoxidized soybean oil, % 4 PUFA source, % Vitamin E, mg/kg Antioxidant blend,5 mg/kg

HO

VE

AOX

VE+AOX

SC

PC

3 0 3 10 0

3 0 3 200 0

3 0 3 10 135

3 0 3 200 135

0 3 0 10 0

0 3 0 10 135

1HO: high oxidant diet with vitamin E level at NRC requirement of 10 IU/kg (NRC, 1994), 3% oxidized oil, 3% polyunsaturated fatty acid (PUFA) source; VE: HO supplemented with vitamin E level at 200 IU/kg; AOX: HO supplemented with an antioxidant blend (AB, ethoxyquin and propyl gallate) at 135 mg/kg; VE+AOX: HO supplemented with vitamin E level at 200 IU/kg and AB at 135 mg/kg. 2SC: standard control, vitamin E level at NRC requirement of 10 IU/kg (NRC, 1994), 3% nonoxidized soy oil, no PUFA source supplement; PC: positive control, SC supplemented with AB at 135 mg/kg. 3Oxidized oil was heated to 95°C to reach peroxide value of 180 mEq/kg of oil, provided by Novus International Inc., St. Charles, MO. 4Trevera, algae-based product, provided approximately 55.57% crude fat (containing 41% docosahexaenoic acid), 4,000 kcal of ME/kg, and 16.7% protein, Novus International Inc., St. Charles, MO. 5Agrado Plus, an antioxidant blend of ethoxyquin and propyl gallate, Novus International Inc.

Downloaded from http://ps.oxfordjournals.org/ at Universite Laval on June 13, 2014

The complete protocol was reviewed and approved by the Virginia Tech Institutional Animal Care and Use Committee. Cobb 500 male broilers (n = 1,200, 44.7 ± 0.8 g) were acquired at day of hatch (CobbVantress Inc., Wadesboro, NC) and placed in group pens in an environmentally controlled facility at the Virginia Tech Turkey Center (Blacksburg). Chickens were randomly distributed into 60 floor pens to balance initial weight across treatments and were assigned to 6 treatments with 10 replicate pens each and 20 birds per pen. Treatments included 1) HO: high oxidant diet with vitamin E at 10 IU/kg (NRC, 1994), 3% oxidized oil, 3% PUFA source [containing docosahexaenoic acid (DHA) at 41.2%]; 2) VE: the HO diet with vitamin E at 200 IU/kg; 3) AOX: the HO diet with AB at 135 mg/kg, 4) VE+AOX: the HO diet with both vitamin E at 200 IU/kg and AB at 135 mg/kg; 5) SC: standard control, a corn-soy diet with vitamin E at 10 IU/kg, 3% nonoxidized soy oil, no PUFA source; and 6) PC: positive control, the SC diet with AB at 135 mg/kg. Treatment and control diet information, and diet composition are summarized in Tables 1 and 2. The antioxidant blend (Agrado Plus), PUFA source (Trevera) and oxidized oil were provided by Novus International Inc. (St. Charles, MO). To prepare the oxidized oil, soybean oil was heated to 95°C and oxidized by continuously bubbling air at a rate of 80 L/min for up to 72 h. Peroxide values were determined hourly according to AOCS (2007) methods (peroxide value ace-

tic acid chloroform method, Cd853) to reach peroxide value of approximately 180 mEq/kg of oil. Formulations were adjusted according to phase feeding practices as chickens advanced in age and weight as recommended by the breeder (Cobb-500, 2012): starter (d 0 to 10), grower (d 11 to 21), and finisher (d 23 to 42). The broiler grower house had negative pressure ventilation with side wall inlets and fans, circulation fans, and end wall fans with a Choretime Choretronics environment control system (Milford, IN). Pens were 1.22 × 2.44 m in dimension on concrete floors bedded with fresh wood shavings. Each pen was equipped with a nipple drinker line and galvanized tube feeder. Broilers were weighed by pen, and feed consumption determined on d 10, 21, and 42.

3

DIETARY ANTIOXIDANT BLEND AND VITAMIN E Table 2. Composition of broiler diets fed during 3 growing phases1 Starter (d 0 to 10) Item

Treatment

Control

Treatment

59.74 30.42 3.00 0.00 3.00 0.00 1.69 0.80 0.35 0.24 0.37 0.06 0.10 0.05 0.08 0.05 0.05 0.00 0.00 100.00

56.48 30.04 3.00 3.00 0.00 3.00 1.70 0.80 0.35 0.25 0.37 0.06 0.10 0.05 0.08 0.05 0.05 0.00 0.62 100.00

63.72 26.72 3.00 0.00 3.00 0.00 1.60 0.74 0.35 0.18 0.33 0.04 0.10 0.05 0.07 0.05 0.05 0.00 0.00 100.00

60.50 26.28 3.00 3.00 0.00 3.00 1.60 0.74 0.35 0.19 0.33 0.04 0.10 0.05 0.07 0.05 0.05 0.00 0.65 100.00

3,090.53 21.62 0.90 0.45 0.72 1.34 0.65 1.01 0.87 0.27

3,092.05 21.66 0.90 0.45 0.71 1.34 0.65 1.00 0.86 0.27

3,133.58 20.16 0.85 0.43 0.69 1.19 0.60 0.94 0.79 0.25

3,134.98 20.17 0.85 0.43 0.68 1.19 0.60 0.93 0.79 0.25

Finisher (d 22 to 42) Control 66.945 25.50 1.39 0.00 3.00 0.00 1.51 0.73 0.35 0.10 0.24 0.00 0.10 0.05 0.06 0.00 0.00 0.025 0.00 100.00 3,164.19 18.88 0.76 0.38 0.65 1.05 0.51 0.82 0.70 0.23

Treatment 63.845 25.03 1.39 3.00 0.00 3.00 1.52 0.73 0.35 0.11 0.24 0.00 0.10 0.05 0.06 0.00 0.00 0.025 0.55 100.00 3,170.88 18.90 0.76 0.38 0.64 1.05 0.51 0.82 0.70 0.23

1Treatment diets include HO, VE, AOX, and VE+AOX. Control diets include SC and PC. HO: high oxidant diet with vitamin E level at NRC requirement of 10 IU/kg (NRC, 1994), 3% oxidized oil, 3% polyunsaturated fatty acid (PUFA) source; VE: HO supplemented with vitamin E level at 200 IU/kg; AOX: HO supplemented with an antioxidant blend (AB, ethoxyquin and propyl gallate) at 135 mg/kg; VE+AOX: HO supplemented with vitamin E level at 200 IU/kg and AB at 135 mg/kg. SC: standard control, vitamin E level at NRC requirement of 10 IU/kg (NRC, 1994), 3% nonoxidized soy oil, no PUFA source supplement; PC: positive control, SC supplemented with AB at 135 mg/kg. They were mixed using separate basal diets. 2TREVERA, algae-based product, provided approximately 55.57% crude fat (containing 41% docosahexaenoic acid), 4,000 kcal of ME/kg and 16.7% protein, Novus International Inc., St. Charles, MO. 3Methionine supplement, 84% methionine, Novus International Inc. 4Provided per kilogram of diet: iron as ferrous sulfate, 40 mg; manganese as manganese sulfate and manganous oxide, 120 mg; zinc as zinc oxide, 210 mg; cobalt as cobalt carbonate, 2.2 mg; iodine as calcium iodate, 132 mg. 5Concentrated vitamin premix provided the following per kilogram of diet: vitamin A, 13,000 IU; vitamin D, 5,000 IU; vitamin E, 10 IU; vitamin K, 3 mg; biotin, 0.15 mg/kg; folic acid, 2 mg/kg; niacin, 60 mg/kg; pantothenate, 15 mg/kg; riboflavin, 9 mg/kg; thiamine, 3 mg/kg; pyridoxamine, 4 mg/kg; cobalamin, 0.02 mg/kg; Harlan Laboratories Inc., Madison, WI. 6Provided 55 mg/kg monensin, Elanco Animal Health, Greenfield, IN. 7Provided 30.5 mg/kg bacitracin, Alpharma LLC, Bridgewater, NJ. 8Provided 6.1 mg/kg virginiamycin, Phibro Animal Health Co., Teaneck, NJ.

Muscle Vitamin A and E Vitamin A and vitamin E concentrations in the breast muscle were determined by HPLC following the procedures described by Arnaud et al. (1991) and Katsanidis and Addis (1999). Briefly, a 0.25-g muscle sample was added with standard tocopherol, retinol, and ascorbic acid, followed by saponification solution [55% 2H5OH in distilled water and 11% KOH (wt/ vol)]. The muscle sample was heated at 80°C for 15 min for saponification. After extraction with cyclohexane containing 0.01% of butylated hydroxytoluene (BHT), samples were evaporated and the residue was reconstituted in ethanol with 0.01% BHT. Samples then were transferred into an Eppendorf tube and centrifuged for

5 min at 13,000 × g at 4°C and then analyzed by chromatography (Agilent Technologies HPLC system 1100 series, Santa Clara, CA) using an Agilent 18 Hypersil 125 mm × 4.0 mm column. A 25-µL injection volume was used. Flow rate was 1.5 mL/min with mobile phase methanol:water of 95:5. The UV detection was at 325 nm for vitamin A and 294 nm for vitamin E.

RNA Extraction, Reverse Transcription, and Real-Time PCR A 20 to 30 mg aliquot of each liver sample was weighed, placed into a 2-mL microcentrifuge tube along with 5-mm stainless-steel beads and 600 μL of lysis buffer, and homogenized using the TissueLyser II system

Downloaded from http://ps.oxfordjournals.org/ at Universite Laval on June 13, 2014

Ingredient, %  Corn   Soybean meal   Poultry by-product   PUFA source2   Nonoxidized soybean oil   Oxidized soybean oil   Diocalcium phosphate  Limestone  Salt   l-Lysine HCl  MHA3  Threonine   Mineral premix4   Vitamin E free premix5   Choline chloride   Coban 906   BMD 507   Stafac 208  Sand  Total Calculated nutrient level   ME, kcal/kg   CP, %   Ca, %   Available P, %   Total P, %   Digestible Lys, %   Digestible Met, %   Digestible TSAA, %   Digestible Thr, %   Digestible Trp, %

Control

Grower (d 11 to 21)

4

Lu et al.

Carcass Characteristics and Meat Quality Objective color measurements were determined on the left side breast muscle surface, using a portable Minolta CR300 colorimeter (Ramsey, NJ) with D65 il-

luminant, 0° observer and calibrated against a standard white tile (Holmer et al., 2009). Mean L* (lightness), a* (redness), and b* (yellowness) values were collected from 3 separate locations on the surface of the breast. The left sides of the breast muscle samples were used for drip loss analysis. Breast fillets were individually weighed, sealed in plastic bags, stored at 4°C for 24 h, and then reweighed (Saenmahayak et al., 2010). The right side breast muscle samples were frozen, ground, and homogenized. For pH determination, samples were added in 5 mM iodoacetate at 10 mL/g (Solomon, 1987). Muscle lactate concentration was determined using an enzyme analytical method (Hammelman et al., 2003). First, a 100-mg sample was added in 1 mL of 0.5 M perchloric acid, centrifuged (13,000 × g) for 5 min at 4°C, and 600 μL of supernatant was transferred to 150 mL of KOH (2 M). After a 1:1 dilution, 50 μL of the extract was added to 1.5 mL of 0.1 M reaction buffer (200 mM Tris-hydrazine, 0.4 mM NAD, pH 9.0). The OD1 (OD value before lactate dehydrogenase was added) value was measured by absorbance at 340 nm in triplicate, and OD2 (OD value after the reaction with lactate dehydrogenase) value was obtained after adding lactate dehydrogenase (40 μL; 4 IU/sample; Sigma Chemical, Perth, WA) and incubated for 2 h at 25°C. Absorbance values associated with muscle lactate were determined by subtracting OD1 from OD2 and quantified by lactate standards. Lactate concentration was reported as micromoles per gram of muscle.

Statistical Analysis Data were analyzed using the GLIMMIX procedure of the Statistical Analysis System (9.2 SAS Institute Inc., Cary, NC). Pen was the experimental unit (n = 10). Growth performance and plasma data were conducted via repeated measures by day. The model included the fixed effects of dietary treatment and sampling day. Means and SE calculations were determined using the least squares means statement, with the slice option to separate treatment means by sampling day. Other data were analyzed using GLM procedure. Tukey’s multiple comparison test was conducted at a significance level of α = 0.05.

RESULTS Growth Performance Growth performance results within individual diet phases and cumulative phases of the experiment are summarized in Table 3. When performance was assessed on d 10, d 21, and the first 21 d cumulatively, compared with the SC chickens, a combination of oxidized oil plus PUFA source improved growth with greater BW and least ADG and ADFI in HO, VE, AOX, and VE+AOX treatments. However, this trend did not continue in the finisher phase (d 22 to 42). Chickens in AOX and VE+AOX showed the heaviest BW from d 10 on. Both

Downloaded from http://ps.oxfordjournals.org/ at Universite Laval on June 13, 2014

(Qiagen, Valencia, CA) according to the manufacturer’s recommendation. Total RNA was extracted using the RNeasy mini kit following the animal tissue protocol (Qiagen). Total RNA concentration was determined at optical density (OD) 260 nm (NanoDrop-1000, Thermo Fisher Scientific, Waltham, MA) and RNA purity was verified by evaluating the ratio of OD 260 nm to OD 280 nm. The quality of the RNA was examined by agarose gel electrophoresis. Total RNA was diluted to 0.2 μg/μL using nuclease-free water. Reverse transcription was accomplished using the high-capacity cDNA Reverse Transcription kit (Applied Biosystems, Carlsbad, CA) following the manufacturer’s protocol, and the cDNA was stored at −20°C. Quantitative real-time PCR (qRT-PCR) was performed using an ABI 7500 FAST Real-Time PCR System (Applied Biosystems). The cDNA was diluted 1:20 in nuclease-free water and then 1 μL of the diluted cDNA was added to each well of a 96-well plate followed by 9 μL of real-time PCR master mix [containing 5 μL of FAST SYBR Green Master Mix (Applied Biosystems), 1 μL each of 5 μM forward and reverse primers, and 2 μL of sterile nuclease-free water]. During the PCR reaction, samples were subjected to an initial denaturation phase at 95°C for 20 s followed by 40 cycles of denaturation at 95°C for 3 s and annealing and extension at 60°C for 30 s. Gene expression for catalase (CAT), glutathione peroxidase (GSH-Px), and superoxide dismutase (SOD) was analyzed using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an endogenous control. The PCR was performed using the following primers: CAT forward primer: 5′ TGAAGCGGTGGCAAAGC 3′; CAT reverse primer: 5′ GCCAGCACCAGTGGTCAAG 3′; GSH-Px forward primer: 5′ TTGTAAACATCAGGGGCAAA 3′; GSH-Px reverse primer: 5′ TGGGCCAAGATCTTTCTGTAA 3′; SOD forward primer: 5′ AGGGGGTCATCCACTTCC 3′, SOD reverse primer 5′ CCCATTTGTGTTGTCTCCAA 3′; GAPDH forward primer: 5′ CCTAGGATACACAGAGGACCAGGTT 3′, GAPDH reverse primer: 5′ GGTGGAGGAATGGCTGTCA 3′. Each reaction was run in duplicate. Primers were designed using the Primer Express 3.0 software (Applied Biosystems) and synthesized by MWG Operon (Huntsville, AL). Results from qRT-PCR were analyzed using the 7500 Real-Time PCR software (Applied Biosystems). Average gene expression relative to the GAPDH endogenous control for each sample was calculated using the 2−ΔΔCt method (Livak and Schmittgen, 2001). The calibrator for each gene was the average ΔCt ([Ct of target gene] − [Ct of GAPDH]) value from the liver of standard control group on d 7.

5

DIETARY ANTIOXIDANT BLEND AND VITAMIN E Table 3. Growth performance across treatments Treatment1 Variable

44.13 18.38B 26.10B 0.704B 227.93B   57.05AB 87.50B 0.652 855.44B   100.90AB 179.48AB 0.562CD 2,974.35B   38.63B 58.17B 0.664   69.77AB 118.82A 0.587CD

VE  

44.15 18.57B 26.21B 0.709B 229.89B   57.22AB 88.02B 0.650 859.35B   93.17C 168.19C 0.554D 2,815.83C   38.82AB 58.59B 0.660   65.99C 113.39B 0.582D

AOX  

44.13 21.05A 27.45A 0.767A 254.62A   58.78A 90.74A 0.648 901.24A   102.19AB 173.29B 0.590A 3,047.25A   40.81A 60.89A 0.670   71.50A 117.09A 0.611A

VE+AOX  

44.50 20.15A 26.89AB 0.751A 245.98A   58.50A 90.36A 0.647 889.52A   103.18A 177.31AB 0.582AB 3,056.36A   40.24AB 60.13AB 0.670   71.71A 118.72A 0.604AB

SC  

44.07 14.9C 24.23C 0.614C 193.05C   53.83C 79.36C 0.679 785.22C   103.49A 179.04A 0.578B 2,958.56B   35.29C 53.11C 0.660   69.39AB 116.07AB 0.598B

PC  

44.00 19.02B 26.49B 0.718B 234.23B   55.66BC 86.87B 0.641 846.49B   99.49B 173.80B 0.572BC 2,935.81B   38.21B 58.11B 0.660   68.85B 115.96AB 0.594BC

SEM  

0.26 0.33 0.34 0.011 3.30   0.88 0.73 0.010 10.73   1.45 1.15 0.004 24.20   0.51 0.51 0.01   0.58 0.80 0.003

P-value  

0.820 <0.001 <0.001 <0.001 <0.001   <0.001 <0.001 0.158 <0.001   <0.001 <0.001 <0.001 <0.001 <0.001 <0.001 <0.001 0.920   <0.001 <0.001 <0.001

 

A–DMeans

within rows that do not have a common superscript differ significantly (P < 0.01). high oxidant diet with vitamin E level at NRC requirement of 10 IU/kg (NRC, 1994), 3% oxidized oil, 3% polyunsaturated fatty acid (PUFA) source; VE: HO supplemented with vitamin E level at 200 IU/kg; AOX: HO supplemented with an antioxidant blend (AB, ethoxyquin and propyl gallate) at 135 mg/kg; VE+AOX: HO supplemented with vitamin E level at 200 IU/kg and AB at 135 mg/kg; SC: standard control, vitamin E level at NRC requirement of 10 IU/kg (NRC, 1994), 3% nonoxidized soy oil, no PUFA source supplement; PC: positive control, SC supplemented with AB at 135 mg/kg. 1HO:

treatments had greater ADG than chickens in SC and PC treatments from d 0 to 10 and from d 10 to 21. The AOX and VE+AOX treatments had the best G:F from d 0 to 10 and AOX alone had better G:F compared with the HO, VE, SC, and PC treatments from d 22 to 42 and throughout the 42-d experimental period (P < 0.001). The VE treatment birds fell behind other treatments in BW, ADG, and ADFI in the finisher phase (P < 0.001).

Plasma AGP, Uric Acid, and TBARS The high oxidant treatments had higher AGP levels compared with the control diets fed birds (SC and PC) on d 10 and VE+AOX treatment had higher AGP levels compared with the controls on d 21 (Figure 1A); however, there was no difference among treatments on d 42. There was a greater concentration of uric acid in AOX, SC, and PC treatments compared with HO and VE+AOX treatments on d 10 (P = 0.01, Figure 1B). However, the difference among treatments did not continue during the later phases, as measured on d 21 and 42 (P > 0.05). On all sampling days, the levels of TBARS in the AOX and VE+AOX treated birds were comparable with those of the SC and PC treated birds (Figure 1C). The TBARS levels in the HO and VE treatments were greater than AOX, SC, and PC treatments on d 21, and VE treatment alone was greatest on d 42.

Breast Muscle Vitamins A and E The concentrations of vitamin A and E in the breast muscle are summarized in Table 4. It seems that the high oxidant treatments did not have significant effect on the concentrations of vitamins A and E. As expected, on d 21, a high dosage of vitamin E supplemented to the VE birds resulted in the greatest vitamin E concentration in the breast muscle, followed by the VE+AOX treatment (P < 0.001). On d 42, the VE birds still exhibited a greater concentration of vitamin E, as did the PC birds. The vitamin E concentration in the muscle of the VE+AOX birds was comparable with that of the HO, AOX, and SC groups. The concentration of muscle vitamin A was greater in the PC birds compared with the SC birds on d 21, whereas there was no significant difference among treatments on d 42.

Antioxidant Enzyme Gene Expression in the Liver Most of these enzymes did not differ among treatments (data not shown), except that SOD showed greater expression in SC birds compared with the HO birds (2.04 vs. 1.09; P < 0.05). On d 21, the expression of SOD tended (P = 0.093) to be less in HO birds, as well. On d 7, the SC birds tended to have a greater GSH-Px activity (P = 0.094).

Downloaded from http://ps.oxfordjournals.org/ at Universite Laval on June 13, 2014

d 0–10   d 0 BW, g   ADG, g   ADFI, g  G:F   d 10 BW, g d 10–21   ADG, g   ADFI, g  G:F   d 21 BW, g d 22–42   ADG, g   ADFI, g  G:F   d 42 BW, g d 0–21   ADG, g   ADFI, g  G:F d 0–42   ADG, g   ADFI, g  G:F

HO

6

Lu et al.

Carcass Characteristics and Meat Quality

DISCUSSION

Figure 1. Plasma oxidative stress indicators. HO: high oxidant diet with vitamin E level at NRC requirement of 10 IU/kg (NRC, 1994), 3% oxidized oil, 3% polyunsaturated fatty acid source; VE: the HO diet supplemented with vitamin E level at 200 IU/kg; AOX: the HO diet supplemented with an antioxidant blend (AB, ethoxyquin and propyl gallate) at 135 mg/kg; VE+AOX: the HO diet supplemented with vitamin E level at 200 IU/kg and AB at 135 mg/kg; SC: standard control, vitamin E level at NRC requirement of 10 IU/kg (NRC, 1994), 3% nonoxidized soy oil, no polyunsaturated fatty acid source supplement, PC: positive control, the SC diet supplemented with AB at 135 mg/kg. AGP = α-1-acid glycoprotein, TBARS = TBA reactive substances. Means on the same sampling day with no common letter (a,b) differ significantly (P < 0.05).

Polyunsaturated fats and oils in animal diets are prone to oxidation. A large body of research suggests that the addition of oxidized oil negatively affects weight gain and feed conversion ratio in broilers (Cabel et al., 1988; Lin et al., 1989; Engberg et al., 1996; Wang et al., 1997; Ajum et al., 2004; McGill et al., 2011; Tavarez et al., 2011). In the present study, better growth performance occurred in the first 4 treatments supplemented with a PUFA source at 3% (pure DHA approximately 0.68%) in the presence of oxidized oil. This may be due to greater digestibility of unsaturated fat (Crespo and Esteve-Garcia, 2001; Newman et al., 2002; Ferrini et al., 2008). Also, it is likely that DHA had beneficial effects on growth during early growth phases. As reported, fish oil as a PUFA source added at 2 and 4% (containing DHA 0.22 and 0.44% in the diet) increased broiler BW gain from d 1 to 38 by 5.6 and 4.2%, respectively, and final BW by 6.5 and 4.6%, respectively (López-Ferrer et al., 2001). However, when DHA levels in the diet reached 0.72% by adding 8.2% fish oil, there was no significant growth improvement in broilers (López-Ferrer et al., 1999). In the current study, the DHA level was less than 0.72%, which explains why high oxidant treatments showed beneficial effects on growth. This effect did not continue in the finisher phase, which is probably due to compensatory growth of SC birds during the later production phase. In general, the addition of AB in the diet stimulated growth independent of the use of oxidized oil and PUFA source. This is in line with previous findings where its main compound ethoxyquin improved growth performance (Cabel et al., 1988; Dibner et al., 1996; Wang et al., 1997) and the supplementation of AB had growth performance benefits in boilers (Tavarez et al., 2011).

Downloaded from http://ps.oxfordjournals.org/ at Universite Laval on June 13, 2014

The individual carcass yields were not significantly different among the treatments, except for the tender yield. The PC birds had larger tender yield compared with the HO and VE+AOX treatments (6.92 vs. 5.47 and 5.48, P = 0.007, data not shown). There were no significant treatment differences in a* and L* in the breast muscle, but the VE treatment had a lower b* compared with the VE+AOX, SC, and PC birds (3.27 vs. 6.34, 5.93, and 5.55, P = 0.003, data not shown). The ultimate pH of the HO fed birds in the breast muscle was lower than the VE+AOX birds, and the HO-fed birds showed a greater drip loss compared with the VE and AOX birds (P < 0.01, Figure 2). Muscle samples from the VE+AOX fed birds had greater pH, which was consistent with lower observed lactate level compared with the HO and PC birds. The drip loss of the individual VE and AOX treatments were less than the HO treatment (1.33, 1.24, vs. 2.63%, P = 0.007); however, the combination of the two did not have an additive effect.

7

DIETARY ANTIOXIDANT BLEND AND VITAMIN E Table 4. Vitamins E and A concentrations in the breast muscle Treatment1 Item d 21   Vitamin   Vitamin d 42   Vitamin   Vitamin

HO E, mg/kg A, μg/kg E, mg/kg A, μg/kg

1.07C 62.00AB   1.06B 118.80

VE  

11.27A 56.40AB   11.39A 93.80

AOX  

1.19C 46.75AB   1.53B 117.00

VE+AOX  

6.01B 43.20AB   2.01B 154.40

SC  

1.51C 28.00B   1.14B 143.80

PC  

1.52C 84.20A   9.76A 143.60

SEM  

0.34 8.42   0.54 20.34

P-value  

<0.001 0.006   <0.001 0.404

A–CMeans

in rows with no common superscript differ significantly (P < 0.01). high oxidant diet with vitamin E level at NRC requirement of 10 IU/kg (NRC, 1994), 3% oxidized oil, 3% polyunsaturated fatty acid (PUFA) source; VE: HO supplemented with vitamin E level at 200 IU/kg; AOX: HO supplemented with an antioxidant blend (AB, ethoxyquin and propyl gallate) at 135 mg/kg; VE+AOX: HO supplemented with vitamin E level at 200 IU/kg and AB at 135 mg/kg; SC: standard control, vitamin E level at NRC requirement of 10 IU/kg (NRC, 1994), 3% nonoxidized soy oil, no PUFA source supplement, PC: positive control, SC supplemented with AB at 135 mg/kg. 1HO:

Figure 2. Breast quality across treatments on d 42. HO: high oxidant diet with vitamin E level at NRC requirement of 10 IU/kg (NRC, 1994), 3% oxidized oil, 3% polyunsaturated fatty acid source; VE: the HO diet supplemented with vitamin E level at 200 IU/kg; AOX: the HO diet supplemented with an antioxidant blend (AB, ethoxyquin and propyl gallate) at 135 mg/kg; VE+AOX: the HO diet supplemented with vitamin E level at 200 IU/kg and AB at 135 mg/kg; SC: standard control, vitamin E level at NRC requirement of 10 IU/kg (NRC, 1994), 3% nonoxidized soy oil, no polyunsaturated fatty acid source supplement, PC: positive control, the SC diet supplemented with AB at 135 mg/kg. Means in the same trait with no common letter (a–c) differ significantly (P < 0.05).

Under stress, an acute phase protein response can restore homeostasis and restrict microbial growth in an antibody-independent manner (Murata et al., 2004). A common acute phase protein in avian species (Lee et al., 2010), AGP, exerts its inflammatory and immunomodulating properties under stress (Hochepied et al., 2003). In this study, a greater concentration of AGP in the high oxidant diet treatments of this study reflects a greater stress status compared with the control groups (SC and PC) on d 10. Oxidative stress induces lipid peroxidation and peroxidation products are formed after radical attack at the broken double bonds (Fellenberg and Speisky, 2006). The concentration of TBARS in blood is used as a biomarker of radical-induced damage and endogenous lipid peroxidation. In this study, restoration of plasma TBARS to normal levels with the AOX treatment may be due to an enhancement of the body’s antioxidant defense system. A greater TBARS level in the VE birds on d 42 probably suggests a prooxidant effect of vitamin E when fed at high dietary concentration in the current model. A functioning antioxidant system is required, especially during conditions of oxidative stress. Uric acid is a primary nitrogen waste product in most animals, but it works as one of the nonenzymatic antioxidants in humans and birds (Lin et al., 2008). It functions as a protective component against oxidative stress and reduces tissue damage associated with ROS production (Carro et al., 2010). Greater uric acid in the AOX, SC, and PC treatments of this study indicates an enhanced nonenzymatic system compared with the HO and VE+AOX treatments in the early growth phase (d 10). The concentration of vitamin E in the breast muscle in VE-treated birds was expected to be greater than other treatments. Antioxidant inclusion in the diet has been shown to reduce cellular consumption of vitamin E (Bartov and Bornstein, 1972, 1981; Tavarez et al., 2011). The greater vitamin E concentration in the PC-treated birds suggests a sparing effect of AB for vitamin E in nonoxidized oil treatment. However, in the high oxidant diet treatments (HO, VE, AOX, and VE+AOX), the sparing effect was not significant. Pre-

Downloaded from http://ps.oxfordjournals.org/ at Universite Laval on June 13, 2014

When added at 200 mg/kg level in the presence of oxidized oil and DHA, vitamin E possibly acted as a prooxidant as reflected by poorer growth in the finisher phase. In this current model, an excessive supplementation of dietary vitamin E could not effectively improve growth performance, which may have resulted from an imbalance of antioxidants, such as vitamins C and E. Due to a relatively low vitamin C level in the diet, vitamin E may not have been regenerated, and led to the accumulation of vitamin E radicals (radicals derived from α-tocopherol), which can act as prooxidants (Hamre et al., 1997). Similarly, Englmaierova et al. (2011) reported a decreased BW by d 35 of feeding with a greater dietary vitamin E level at 100 mg/kg under the nonstressed condition.

8

Lu et al.

ACKNOWLEDGMENTS The project was funded in part by Novus International Inc., and the John Lee Pratt Fellowship provided support for the lead author. The assistance of Dale Shumate, agricultural supervisor at the Virginia Tech Turkey Research Center (Blacksburg), was essential

to this study. In addition, the assistance of numerous graduate students and technical staff in the Department of Animal and Poultry Sciences at Virginia Tech is gratefully acknowledged.

REFERENCES Ajum, M. I., I. H. Mirza, A. G. Khan, and A. Azim. 2004. Effect of fresh versus oxidized soybean oil on growth performance, organ weights and meat quality of broiler chicks. Pakistan Vet. J. 24:173–178. AOCS. 2007. Official Methods and Recommended Practices of the AOCS. 6th ed. Am. Oil Chem. Soc., Champaign, IL. Arnaud, J., I. Fortis, S. Blachier, D. Kia, and A. Favier. 1991. Simultaneous determination of retinol, alpha-tocopherol and betacarotene in serum by isocratic high-performance liquid chromatography. J. Chromatogr. 572:103–116. Bartov, I., and S. Bornstein. 1972. Comparisons of BHT and ethoxyquin as antioxidants in the nutrition of broilers. Poult. Sci. 51:859–868. Bartov, I., and S. Bornstein. 1981. Stability of abdominal fat and meat of broilers: Combined effect of dietary vitamin E and synthetic antioxidants. Poult. Sci. 60:1840–1845. Cabel, M. C., P. W. Waldroup, W. D. Shermer, and D. F. Calabotta. 1988. Effects of ethoxyquin feed preservative and peroxide level on broiler performance. Poult. Sci. 67:1725–1730. Carro, M. D., E. Falkenstein, W. J. Radke, and H. Klandorf. 2010. Effects of allopurinol on uric acid concentrations, xanthine oxidoreductase activity and oxidative stress in broiler chickens. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 151:12–17. Cobb-500. 2012. Broiler Performance & Nutrition Supplement. Accessed Aug. 27, 2012. http://www.ugachick.co/manuals/ Cobb500ManNutriPg.pdf. Crespo, N., and E. Esteve-Garcia. 2001. Dietary fatty acid profile modifies abdominal fat deposition in broiler chickens. Poult. Sci. 80:71–78. Dibner, J. J., C. A. Atwell, M. L. Kitchell, W. D. Shermer, and F. J. Ivey. 1996. Feeding of oxidized fats to broilers and swine: Effects on enterocyte turnover, hepatocyte proliferation and the gut associated lymphoid tissue. Anim. Feed Sci. Technol. 62:1–13. Engberg, R. M., C. Lauridsen, S. K. Jensen, and K. Jakobsen. 1996. Inclusion of oxidized vegetable oil in broiler diets. Its influence on nutrient balance and on the antioxidative status of broilers. Poult. Sci. 75:1003–1011. Englmaierova, M., I. Bubancova, T. Vit, and M. Skrivan. 2011. The effect of lycopene and vitamin E on growth performance, quality and oxidative stability of chicken leg meat. Czech J. Anim. Sci. 56:536–543. Esterbauer, H. 1993. Cytotoxicity and genotoxicity of lipid-oxidation products. Am. J. Clin. Nutr. 57:779S–785S. Fellenberg, M. A., and H. Speisky. 2006. Antioxidants: Their effects on broiler oxidative stress and its meat oxidative stability. World’s Poult. Sci. J. 62:53–70. Ferrini, G., M. D. Baucells, E. Esteve-Garcia, and A. C. Barroeta. 2008. Dietary polyunsaturated fat reduces skin fat as well as abdominal fat in broiler chickens. Poult. Sci. 87:528–535. Gray, J. I., E. A. Gomaa, and D. J. Buckley. 1996. Oxidative quality and shelf life of meats. Meat Sci. 43(S1):111–123. Hammelman, J. E., B. C. Bowker, A. L. Grant, J. C. Forrest, A. P. Schinckel, and D. E. Gerrard. 2003. Early postmortem electrical stimulation simulates PSE pork development. Meat Sci. 63:69–77. Hammelman, J. E., B. C. Bowker, A. L. Grant, J. C. Forrest, A. P. Schinckel, and D. E. Gerrard. 2003. Early postmortem electrical stimulation simulates PSE pork development. Meat Sci. 63:69–77. Hamre, K., R. Waagbo, R. K. Berge, and O. Lie. 1997. Vitamins C and E interact in juvenile Atlantic salmon (Salmo salar L.). Free Radic. Biol. Med. 22:137–149. Hawrysh, Z. J., M. K. Erin, Y. C. Lin, and R. T. Hardin. 1992. Propyl gallate and ascorbyl palmitate affect stability of canola oils in accelerated storage. J. Food Sci. 57:1234–1238.

Downloaded from http://ps.oxfordjournals.org/ at Universite Laval on June 13, 2014

vious work has also suggested a sparing effect of ethoxyquin for vitamin A (Bartov and Bornstein, 1972). However, in this study, the vitamin A sparing effect of AB was only found in the PC treatment when it was compared with the SC treatment on d 21. Most of the antioxidant enzymes in the liver did not differ on d 7, 14, and 21, which again suggests that the oxidative status in the liver was moderately altered. The lower expression of SOD in the HO treatment indicates suppressed antioxidant capability in those birds. Cellular and subcellular membranes high in PUFA are susceptible to oxidation. When membrane integrity is disturbed by free radicals, cellular water may leak out, causing greater drip loss (Mahan, 2001). Compared with HO treatment, a relatively lower drip loss of VE and AOX treatments suggests they have the potential to protect muscle cell membrane integrity from damage induced by high oxidants. During the conversion of muscle to meat, lactic acid builds up in the tissue, leading to a reduction in pH. The lower pH in the VE+AOX treatment was consistent with a greater concentration of lactate compared with the HO and PC treatments in this study. Once the pH has reached the isoelectric point of the major proteins, especially myosin (approximately 5.4), they lose their ability to attract and bind water. In addition, the electrostatic forces that help maintain myofilament space are also reduced near the isoelectric point. Therefore, interfilament space is reduced and rigor bonds can be formed (Huff-Lonergan and Lonergan, 2007). This may explain why the HO birds with the greatest lactate concentration and the lowest pH had the greatest drip loss. Drip loss has been previously shown to be positively related to redness a* and yellowness b* in different broiler lines (Le Bihan-Duval et al., 1999). There were no significant treatment differences in a* in the current study, but the VE treatment had the lowest b* coupled with reduced drip loss. Tavarez et al. (2011) reported that b* was increased by dietary inclusion of oxidized oil. However, in the current study, though the VE+AOX treatment showed greater b* value than VE treatment, it was not different than the nonoxidized oil treatments (SC and PC). In summary, compared with the SC diet, feeding broilers diets containing oxidized oil and a PUFA source had some beneficial effects on early phase growth. Dietary addition of AOX alone moderately restored the whole body antioxidant capability as measured by uric acid and TBARS. The addition of AB alone and high VE reduced drip loss, but VE may exert a prooxidant property in the finisher phase as measured by growth.

DIETARY ANTIOXIDANT BLEND AND VITAMIN E

López -Ferrer, S., M. Baucells, A. Barroeta, and M. Grashorn. 2001. n-3 enrichment of chicken meat. 1. Use of very long-chain fatty acids in chicken diets and their influence on meat quality: Fish oil. Poult. Sci. 80:741–752. Madhavi, D. L., and D. K. Salunkhe. 1995. Antioxidant. Page 89 in Food Additive Toxicology. J. A. Maga and A. T. Tu, ed. Marcel Dekker, New York, NY. Mahan, D. C. 2001. Selenium and Vitamin E. Page 281–310 in Swine Nutrition. A. J. Lewis and L. L. Southern, ed. Swine Nutrition. CRC Press, Washington, DC. McGill, J., E. McGill, A. Kamyab, and J. Firman. 2011. Effect of high peroxide value fats on performance of broilers in a normal immune state. Int. J. Poult. Sci. 10:241–246. Murata, H., N. Shimada, and M. Yoshioka. 2004. Current research on acute phase proteins in veterinary diagnosis: An overview. Vet. J. 168:28–40. Newman, R. E., W. L. Bryden, E. Fleck, J. R. Ashes, W. A. Buttemer, L. H. Storlien, and J. A. Downing. 2002. Dietary n-3 and n-6 fatty acids alter avian metabolism: Metabolism and abdominal fat deposition. Br. J. Nutr. 88:11–18. NRC. 1994. Nutrient Requirements of Poultry. 9th rev. ed. Natl. Acad. Press, Washington, DC. Pinkowski, P. L., K. B. Witherly, C. D. Harvey, and V. A. Tadjalli. 1986. Sensory and gas-chromatography techniques to evaluate the stability of oils. J. Am. Oil Chem. Soc. 63:410. Saenmahayak, B., S. F. Bilgili, J. B. Hess, and M. Singh. 2010. Live and processing performance of broiler chickens fed diets supplemented with complexed zinc. J. Appl. Poult. Res. 19:334–340. Sherwin, E. R. 1978. Oxidation and antioxidants in fat and oil processing. J. Am. Oil Chem. Soc. 55:809–814. Solomon, M. B. 1987. Comparison of methods used for measuring pH in muscle-tissue. J. Food Sci. 52:1428–1429. Tavarez, M. A., D. D. Boler, K. N. Bess, J. Zhao, F. Yan, A. C. Dilger, F. K. McKeith, and J. Killefer. 2011. Effect of antioxidant inclusion and oil quality on broiler performance, meat quality, and lipid oxidation. Poult. Sci. 90:922–930. Wang, S. Y., W. Bottje, P. Maynard, J. Dibner, and W. Shermer. 1997. Effect of Santoquin and oxidized fat on liver and intestinal glutathione in broilers. Poult. Sci. 76:961–967. Webb, J. E., J. D. Yates, and C. C. Brunson. 1978. Effects of feeding antioxidants, ascorbic-acid, citric-acid, and minerals on storage stability of precooked, frozen broiler parts. Poult. Sci. 57:1170.

Downloaded from http://ps.oxfordjournals.org/ at Universite Laval on June 13, 2014

Hochepied, T., F. G. Berger, H. Baumann, and C. Libert. 2003. Alpha(1)-acid glycoprotein: An acute phase protein with inflammatory and immunomodulating properties. Cytokine Growth Factor Rev. 14:25–34. Holmer, S. F., R. O. McKeith, D. D. Boler, A. C. Dilger, J. M. Eggert, D. B. Petry, F. K. McKeith, K. L. Jones, and J. Killefer. 2009. The effect of pH on shelf-life of pork during aging and simulated retail display. Meat Sci. 82:86–93. Huff-Lonergan, E., and S. M. Lonergan. 2007. New frontiers in understanding drip loss in pork: Recent insights on the role of postmortem muscle biochemistry. J. Anim. Breed. Genet. 124(Suppl. 1):19–26. Jung, S., J. H. Choe, B. Kim, H. Yun, Z. A. Kruk, and C. Jo. 2010. Effect of dietary mixture of gallic acid and linoleic acid on antioxidative potential and quality of breast meat from broilers. Meat Sci. 86:520–526. Katsanidis, E., and P. B. Addis. 1999. Novel HPLC analysis of tocopherols, tocotrienols, and cholesterol in tissue. Free Radic. Biol. Med. 27:1137–1140. Lauridsen, C., J. H. Nielsen, P. Henckel, and M. T. Sorensen. 1999. Antioxidative and oxidative status in muscles of pigs fed rapeseed oil, vitamin E, and copper. J. Anim. Sci. 77:105–115. Le Bihan-Duval, E., N. Millet, and H. Remignon. 1999. Broiler meat quality: Effect of selection for increased carcass quality and estimates of genetic parameters. Poult. Sci. 78:822–826. Lee, K. W., S. H. Lee, H. S. Lillehoj, G. X. Li, S. I. Jang, U. S. Babu, M. S. Park, D. K. Kim, E. P. Lillehoj, A. P. Neumann, T. G. Rehberger, and G. R. Siragusa. 2010. Effects of direct-fed microbials on growth performance, gut morphometry, and immune characteristics in broiler chickens. Poult. Sci. 89:203–216. Lin, C. F., A. Asghar, J. I. Gray, D. J. Buckley, A. M. Booren, R. L. Crackel, and C. J. Flegal. 1989. Effects of oxidized dietary oil and antioxidant supplementation on broiler growth and meat stability. Br. Poult. Sci. 30:855–864. Lin, H., D. De Vos, E. Decuypere, and J. Buyse. 2008. Dynamic changes in parameters of redox balance after mild heat stress in aged laying hens (Gallus gallus domesticus). Comp. Biochem. Physiol. C Toxicol. Pharmacol. 147:30–35. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(− delta delta c(t)) method. Methods 25:402–408. López -Ferrer, S., M. Baucells, A. Barroeta, and M. Grashorn. 1999. n-3 enrichment of chicken meat using fish oil: Alternative substitution with rapeseed and linseed oils. Poult. Sci. 78:356–365.

9