Effects of alternate feeding with different lipid sources on fatty acid composition and bioconversion in European sea bass (Dicentrarchus labrax)

Aquaculture 464 (2016) 28–36

Contents lists available at ScienceDirect

Aquaculture journal homepage: www.elsevier.com/locate/aquaculture

Effects of alternate feeding with different lipid sources on fatty acid composition and bioconversion in European sea bass (Dicentrarchus labrax) Hatice Asuman Yılmaz a, Geneviève Corraze b, Stéphane Panserat b, Orhan Tufan Eroldoğan a,⁎ a b

University of Çukurova, Faculty of Fisheries, Department of Aquaculture, 01330, Adana, Turkey INRA, UMR1419 Nutrition Metabolism Aquaculture, F-64310 Saint-Pée-sur-Nivelle, France

a r t i c l e

i n f o

Article history: Received 8 March 2016 Received in revised form 6 June 2016 Accepted 8 June 2016 Available online 09 June 2016 Keywords: Fatty acid bioconversion activities Feeding schedules European sea bass Vegetable oils

a b s t r a c t The aim of this study was to evaluate the effects of alternate feeding schedules, in which diets with different lipid sources were alternated, on fatty acid profile, accumulation of long chain omega-3 polyunsaturated fatty acids (n−3 LC-PUFA) and expression of selected fatty acid bioconversion genes in European sea bass juveniles. Five treatments were administered to fish; fish oil treatment (FO; continuously fed a fish oil (FO)-diet), canola oil treatment (CO; continuously fed a canola oil (CO)-diet), blend oil treatment (BLD; continuously fed with a diet containing both FO and CO), alternate schedule treatment (AST; fish fed for 3 weeks with CO and the following 3 weeks with BLD), and finishing schedule treatment (FST; fish fed for 9 weeks with CO and the following 3 weeks with FO) for 12 weeks. Significantly higher SGR and lower FCR were detected in fish fed the FO, BLD and FST diets compared to those fed with CO and AST diets. As expected, the n−3 LC-PUFA accumulation (mainly EPA and DHA) was generally decreased in the whole body, flesh and liver in the CO fish compared to FO fish. Although the FST and AST fish consumed the same quantity of fish oil and canola oil throughout the experimental period, the proportion of n−3 LC-PUFA in the flesh of the FST fish was significantly higher than in the AST fish, confirming the major effect of the fish oil intake at the final stages (3 weeks) of the experiment. Moreover, no significant effects were detected at the molecular level for hepatic transcriptional factors involved in the regulation of the fatty acid bioconversion metabolic pathway (peroxisome proliferator activated receptors-α; PPARα and sterol regulatory element binding proteins-1; SREBP1), or in the key enzymes involved in fatty acid bioconversion (D6-desaturase enzyme; D6D and fatty acid elongases; ELOVLs) across all treatments, suggesting that the n−3 LC-PUFA level in sea bass cannot be modified through increased fatty acid bioconversion capacities in the liver (at least a molecular level). In conclusion, a nutritional modulation of n−3 LC-PUFA content in flesh was observed in relation to the feeding schedules independently to modifications of the fatty acid bioconversion capacities. Statement of relevance: We previously shown an increasing LCPUFA activity in freshwater fish fed with alternate feeding regimes. Thus, this promoted us to find more information on possible mechanisms involved in this effect in marine species that needs further clarification related with genes involved in bioconversion of fatty acids. In the present study, even though the analysis of gene expression showed that there was a huge individual difference in response to alternative feeding, especially PPAR-α and SREBP1, there are some potential effects underlying these feeding regimes. However, there is still a need for further nutritional studies to confirm the absence of effects of alternate feeding on genes involved in fatty acid synthesis in fish, hence possible innovative feeding strategies towards more efficient use of dietary fish oil should be identified. © 2016 Elsevier B.V. All rights reserved.

1. Introduction In recent years the replacement of fish oil in aquafeed has become an increasingly important issue due to a stagnant supply and the continuous increase in the demand of this product for aquaculture feeds ⁎ Corresponding author. E-mail address: [email protected] (O.T. Eroldoğan).

http://dx.doi.org/10.1016/j.aquaculture.2016.06.013 0044-8486/© 2016 Elsevier B.V. All rights reserved.

(Turchini et al., 2009). Therefore, the identification and evaluation of alternatives to fish oil in aquaculture feeds or improving the efficiency of fish oil use has gained significant momentum. With respect to fish oil replacement, practical alternatives at present include vegetable oils that lack the omega-3 long chain polyunsaturated fatty acids (n − 3 LCPUFA), eicosapentaenoic (20:5n − 3, EPA) and docosahexaenoic (22:6n−3, DHA) acids. Canola oils are among the most abundantly produced vegetable oils globally, and are good candidates to replace of

H.A. Yılmaz et al. / Aquaculture 464 (2016) 28–36

aquaculture feeds (Gunstone, 2010; Turchini and Mailer, 2010). The potential replacement of fish oil with canola oil into fish feeds was previously investigated, particularly for their ready and constant availability, relatively low price and energy availability (Turchini and Mailer, 2010). Studies on the effects of reduced n−3 LC-PUFA relative to inclusion levels of vegetable oil at around 50–80% on growth performance of marine species, especially sea bass and sea bream (Sparus aurata), are contradictory (Izquierdo et al., 2003; Nikzad et al., 2012; Xu et al., 2012; Eroldoğan et al., 2012, 2013; Özşahinoğlu et al., 2013), but predominantly resulted in a 50% reduction in EPA and DHA flesh concentrations in sea bass (Bell and Waagbø, 2008). In the meantime, studies have demonstrated that the EPA and DHA content of the flesh of fish fed vegetable oil based diets can be restored up to 70–100% with the use of fish oil-based finishing diets at an appropriate interval before the harvest (Bell et al., 2004; Mourente et al., 2005; Izquierdo et al., 2005). Studies on sea bass and sea bream have shown that restoration of n−3 LC-PUFA to a level similar to those recorded in fish fed a fish oil based diet, could be achieved by a considerably long finishing feeding period of around 14 weeks (Mourente et al., 2005; Izquierdo et al., 2005). Also, the linoleic acid (18:2n − 6), which is abundant in vegetable oils, is known to be selectively retained in fish flesh and resistant to “wash-out” even after switching to a fish oil-based finishing diets (Ng and Gibon, 2010). Thus, the potential detrimental effects of the substitution of dietary fish oil with vegetable oils appears to be addressable by using a finishing diet, however, the efficiency of this practice is low and any information about potential strategies towards improving its efficiency is much needed. In this context, a new strategy that has recently drawn some attention is the potential use of alternating feeding schedules, in which dietary lipid sources are routinely alternated over various time periods. Francis et al. (2009) showed that Murray cod (Maccullochella peelii peelii) are able to retain more EPA and DHA when reared on an alternating feeding schedule (2W; 2 weeks CO diet and following 2 weeks FO diet and 4W; 4 weeks CO diet and following 4 weeks FO diet). These authors found increasing Δ-6 desaturase activity in fish subjected to the weekly alternation schedules of diets containing either fish oil or canola oil as the added lipid source, in comparison to fish continuously fed with a 50/50 blend of fish oil and canola oil. Brown et al. (2010), studying the possible daily alternation of diets in the morning or afternoon feeding, suggested the existence of cyclical circadian patterns in fatty acid deposition in rainbow trout (Oncorhynchus mykiss). More recently, similar high accumulation levels of EPA and DHA in sea bass (2.5 g) fed either vegetable/fish oil diets in cycles or solely fish oil diets have been reported by Mumoğullarında (2012) and Dedeler (2013). The above studies have clearly demonstrated a positive correlation between alternating feeding schedules and n − 3 LC-PUFA metabolism in both freshwater and marine fish species. Based on the roles of SREBP-1 and PPAR-α in lipid/fatty acid metabolism, these two proteins serve as major sensors of fatty acids, in particular n − 3 PUFA, and are thus known as key mediators of gene regulation by fatty acids (Nakamura and Nara, 2003; Nakatani et al., 2003; Nakamura et al., 2004; Howell et al., 2009; Poulsen et al., 2012). PUFA are reported to be ligands of PPAR-α (Price et al., 2000) and suppressors of SREBP (Morton and Shimomura, 1999) in mammals and humans. There has recently been significant interest in the regulation of lipid metabolism genes such as SREBP-1 (Brown and Goldstein, 1997; Eberle et al., 2004), PPAR-α, delta-6 desaturase (Δ6D) and also fatty acid elongases (ELOVLS) (Tocher et al., 2006), as regulators of FA biosynthesis. Results from a number of studies have also suggested that the lower capability of marine fish species to synthesize EPA or DHA from shorter chain precursors could be due to an absence of the regulation of desaturase and elongase activity (Mourente and Dick, 2002; Zheng et al., 2004; Mourente et al., 2005; Geay et al., 2010). However, little information is available on commercially important cultured marine teleosts with respect to the implication of factors such as SREBP1 and PPAR-α activities in relation to fatty acid bioconversion (Geay et

29

al., 2010; Morais et al., 2011; Castro et al., 2014). Even though the LCPUFA biosynthetic pathways in teleosts are known to be further regulated by environmental (e.g. salinity) and nutritional factors (e.g. dietary lipid and fatty acid composition) (Zheng et al., 2005; Santigosa et al., 2011), the regulation of LC-PUFA biosynthesis in relation to the abovementioned proteins (SREBP-1 and PPAR-α) is not thoroughly understood. As previously mentioned, alternating feeding regimes can affect LCPUFA biosynthesis, caused by an up-regulation of genes that control fatty acid metabolism in fish. The possible mechanisms involved in this effect in marine species need further clarification. Thus, the present study aimed to clarify the effects of alternating feeding schedules in which dietary lipid sources are routinely alternated on tissue fatty acid profile and to further investigate the nutritional regulation of genes (D6D, ELOVL, PPAR-α and SREBP-1) involved in fatty acid bioconversion in European sea bass liver, the main tissue involved in fatty acid bioconversion. 2. Materials and methods 2.1. Diets Three experimental diets were specifically formulated and manufactured by Skretting (Norway), to have the same proximate composition (crude protein 50% DM, energy 21.9 kJ/g DM, lipid 20% DM). These diets differed only by lipid sources, containing 100% fish oil (FO), 100% canola oil (CO) and blend oil of these two oil sources (FO/ CO; 1:1, w:w) (Table 1). All diets contained 200 g/kg of fishmeal as the main marine animal protein source. 2.2. Rearing and sampling European sea bass juveniles used in this study were obtained from a local commercial farm (Akuvatur, Ltd., Adana, Turkey) and were transported to an indoor system in the Marine Research Station in Yumurtalık, Adana (36°45′39.85″N 35°42′78″E) where they were held in two fiberglass tanks (2000 L) for a period of four weeks prior to start of the experiment. Fish were then acclimated to new experimental culture conditions at the station before the onset of the trial. Following the acclimation, 600 fish (initial weight ~ 24 g) were distributed randomly into 15 fiberglass tanks of 400-L with 40 fish per tank. Tanks were continuously provided seawater (38 ppt) at a flow rate of approximately 2 L min−1. Water parameters such as pH, salinity and dissolved oxygen were continuously monitored with an oxygen meter (Yellow Springs Instruments, Yellow Springs, OH, USA), a refractometer and a Table 1 Formulation and proximate composition of the experimental diets. Experimental diets FO

CO

BLD

Dietary ingredients (g/kg) Fish meal Soy bean concentrate Hi-pro soy bean Wheat gluten Whole wheat Fish oil Canola oil Premixesa

200 200 200 120.7 117.5 151.2 0.0 10.6

200 200 200 120.7 117.5 0.0 151.2 10.6

200 200 200 120.7 117.5 70.0 81.2 10.6

Proximate composition (%) Dry matter Protein Lipid Ash

85.4 50.7 20.0 12.5

85.7 50.2 20.1 12.3

85.6 50.5 20.0 12.9

a Include vitamins and minerals; Marine Nutrition, Boxmeer, the Netherlands, proprietary composition Skretting ARC, vitamin and mineral supplementation as estimated to cover requirements according to NRC (2011).

30

H.A. Yılmaz et al. / Aquaculture 464 (2016) 28–36

pH meter (pH 315i Set, WTW Measurement Systems, Germany). Water temperature was maintained at 20 ± 1.1 °C. A 12-h light/12-h dark photoperiod regime was in effect during the whole study. The feeding schedules, used in this study, were as follows: • Fish oil treatment (FO): fish were fed with the FO-diet during the entire experiment (12 weeks) • Canola oil treatment (CO): fish were fed with the CO-diet during the entire experiment (12 weeks) • Blend oil treatment (BLD): fish were fed with the BLD-diet (as in Table 1) during the entire experiment (12 weeks) • Alternate schedule treatment (AST): fish were fed 3 weeks with the CO-diet followed by 3 weeks with the BLD-diet. In total, two alternate cycles were implemented throughout the entire experimental period (12 weeks) • Finishing schedule treatment (FST): fish were fed the CO-diet for 9 weeks followed by the FO-diet for a further 3 weeks. In total, one alternate cycle was implemented throughout the entire experimental period (12 weeks) (Fig. 1).

During the experiment fish were fed with a 3 mm extruded diet. The feed, distributed three times a day (09:00, 13:00 and 18:00), was supplied to apparent satiation with great care by giving a small quantity of feed at each time to avoid uneaten pellets. Each feeding was completed in b1 h. The uneaten pellets (when present) were collected from the bottom of each tank using a siphon tube and dried in an oven at 70 °C to a constant weight. Feed intake in each tank was determined every day. At the beginning of the experiment, an initial sample of 15 fish from a common pool of fish was culled and stored at −20 °C for subsequent determination of their initial proximate and lipid compositions (the analyses were conducted on pooled samples of fish each, n = 3). All fish in each treatment were anaesthetized (2-phenoxyethanol at 0.5 mL/L) and then weighed to the nearest 0.01 g individually, after removal of excess surface moisture. At the end of the experiment, all fish were individually weighed and five fish were sampled randomly from each replicate treatment (tank) per diet treatment for subsequent determination of chemical analyses. Whole body, fillet and liver samples were homogenized in a blender and the homogenate from each replicate tank was pooled and stored at −20 °C until analyzed. Furthermore, two fish were also sampled from each tank (6 fish/treatment) for determination of gene analyses. Samples of liver were immediately frozen on liquid nitrogen and stored −80 °C for molecular analyses. All fish handling procedures complied with Turkish guidelines for animal care (No: 28141) set by the Ministry of Food, Agriculture and Livestock.

2.3. Analytical methods 2.3.1. Proximate composition, total lipids and fatty acid analyses Whole body and flesh samples were ground to a homogeneous consistency using a centrifugal mill fitted with a 0.25 mm screen. The homogenate from each replicate tank was pooled (n = 3/treatment) and stored at −20 °C until subsequent analyses. Determination of moisture, ash and protein contents in the diets and fish tissue samples were conducted as described below. Percent moisture samples were dried to constant weight at 103 °C. Ash content was determined by burning the samples at 450 °C for 5 h (AOAC, 1995). Protein (N × 6.25) content was determined using an automated Kjeldahl Kjeltec 2200 (Foss Tecator, Höganäs, Sweden). Gross energy content of the test diets was calculated on the basis of 19, 36 and 15 kJ/g for protein, lipid and carbohydrate, respectively. Lipids were extracted according to the procedure of Folch et al. (1957). Following the lipid extraction, fatty acid methyl esters (FAME) were prepared according to Metcalfe and Schmitz (1961) and analyzed as described previously (Czesny and Dabrowski, 1998) with some modifications. Briefly, the FAME obtained were separated by gas chromatography (Agilent 6890N), equipped with a flame ionization detector and fitted with a DB 23 capillary column (60 m, 0.25 mm i.d. and 0.25 μm) ejector and detector temperature program was 190 °C for 35 min than increasing at 30 °C per min up to 220 °C where it was maintained for 5 min. Carrier gas was hydrogen (2 mL min−1 and split ratio was 30:1). The individual fatty acids were identified by comparing their retention times to that of a standard mix of fatty acids (Supelco 37 component FAME mix). The wet weight gain, specific growth rate, dry feed intake and feed conversion ration were calculated using the following formulae: (1) Wet weight gain (WG) (g) = (final mean wet weight (FW) (g) − initial mean wet weight (IW) (g)) (2) Specific growth rate (SGR) (% body weight/day) = [(ln FW (g) − ln IW (g)) ∕ time (days)] × 100 (3) Dry feed intake (DFI) (g/fish) = total daily dry feed intake ∕ fish over 130 days (4) Feed conversion ratio (FCR) = dry feed fed (g) ∕ weight gain (g).

2.3.2. mRNA level analysis: quantitative RT-PCR Total mRNA of liver was extracted using Trizol reagent (Invitrogen, USA), and quantified by measuring absorbance at 260 nm in a spectrophotometer (NanoDrop Labtech, France). The reverse transcription was performed using the kit QuantiTect® Reverse Transcription (QIAGEN) including a step of genomic DNA elimination. Reactions were carried

Fig. 1. The alternate feeding schedules that were applied during the study.

H.A. Yılmaz et al. / Aquaculture 464 (2016) 28–36

out in 20 μL of volume containing 1 μg of total RNA, 1 μL Quantiscript Reverse Transcriptase, 4 μL Quantiscript RT buffer (5×) and 1 μL Primer Mix and sterile MilliQ water. At the end of the RT reactions, all cDNA were kept at −20 °C. D6D, SREBP-1, PPARα and the housekeeping Elongation Factor 1 (EF1) gene expressions were determined by real time PCR. In this study, EF1 was not regulated by dietary treatment and could be used as a reference gene. The relative mRNA levels of D6D, PPARα and SREBP-1 in each sample were normalized with EF1 expression calculated with the comparative threshold cycle (Ct) method (Whelan et al., 2003). Specific primers (Table 3) were designed from European sea bass sequence of D6D (GenBank accession no. FB671139), SREBP-1 (FN677951), PPARα (AY590300) and EF1 (AJ866727) used as reference gene. The PCR reaction was carried out in i-cycler with an optical module (Bio-Rad, Hercules, CA, USA) in a final volume of 20 μL containing 7.5 μL of SYBR Green Supermix (BioRad, Hercules, CA, USA), 5 nm of each primer and 0.5 μL of cDNA. The PCR program consisted of an initial DNA denaturation of 94 °C for 90 s, followed by 45 cycles at 95 °C for 30 s, 60 °C for 60 s and 80 cycles at 95 °C for 10 s. A triplicate of each reaction was realized for each sample. 2.3.3. Statistical analysis All data were reported as means ± standard deviation (chemical analyses n = 3) throughout the text. These data were analyzed by one-way analysis of variance (ANOVA) at a significance level of 0.05% following confirmation of normality and homogeneity of variance. Also, expression values are normalized by elongation factor-1 alpha (EF1-α) expressed transcripts. Relative fold differences between treatments are presented as means ± S.D. (N = 6 individuals) and were analyzed using one-way ANOVA (P b 0.05). Where significant differences were detected, data were subjected to Student-Newman-Keuls post hoc test for identifying homogeneous subset. All computations were performed using SPSS16.0 (SPSS Inc., Chicago, IL, USA). 3. Result 3.1. Diets Experimental diets were all iso-proteic, iso-lipidic and iso-energetic. The lipid and protein contents of the diets ranged from 20.0% to 20.1% and from 50.2% to 50.1%, respectively (Table 1). The fatty acid composition of the three experimental diets clearly reflected that of the oil source used in the formulation and the main difference in the composition of experimental diets was their fatty acid profile (Table 2). Briefly, the fish oil-diet was characterized by a high content of total n− 3 LCPUFA (28.2%), including EPA (13.3%) and DHA (10.9%). The canoladiet was mainly dominated by oleic acid (18:1n − 9, 50.2%). The EPA and DHA content in the CO-diet were roughly 85% lower than those in the FO-diet. In addition, the blend-diet (BLD) was almost half way between FO and CO diets in relation to relative quantities of individual fatty acids. 3.2. Performance parameters and feed intake All the experimental diets were well accepted by the fish in all the treatments. However, the dietary treatment influenced growth performance of European sea bass in the current study whereas survival was unaffected by dietary treatment. Growth was significantly higher in fish fed the BLD (84.8 ± 0.8 g), FST (84.5 ± 0.4 g) and FO (84.4 ± 1.4 g) compared to those fed the CO (75.4 ± 1.0 g) or AST (77.3 ± 1.3 g) diets. Consistent with this, percentage weight gain was significantly higher in BLD, FST or PST compared with the CO. Significant differences in SGR and FCR were also noted among the experimental treatments over the 12 weeks (Table 4). SGR was significantly higher in the FO, BLD and FST compared to the CO and AST treatments. The FCR was significantly better in FO, BLD and FST across all other treatments.

31

Table 2 Fatty acid composition of the experimental diets (% total lipids). Experimental diets

14:0 16:0 18:0 SFAa 16:1n−7 18:1n−7 18:1n−9 MUFAb 18:2n−6 18:3n−6 20:2n−6 20:3n−6 20:4n−6 n−6 PUFAc n−6 LC-PUFA 18:3n−3 18:4n−3 20:4n−3 20:5n−3 22:6n−3 n−3 PUFAd n−3 LC-PUFA

FO

CO

BLD

5.8 16.9 3.7 27.6 6.0 3.9 15.2 30.2 6.6 1.6 0.9 0.1 0.8 9.7 0.8 3.2 1.0 1.2 13.3 10.9 31.4 28.2

1.0 6.7 2.2 10.8 1.0 3.8 50.2 62.9 17.8 0.8 0.2 0.1 0.1 18.4 0.1 2.2 0.1 0.2 1.6 2.0 7.6 5.4

3.0 10.8 2.8 17.7 2.6 3.6 34.9 45.5 14.8 1.1 0.6 0.1 0.6 16.8 0.6 4.6 0.6 0.6 6.2 5.9 19.7 15.1

a

SFA: Includes 12:0, 14:0, 15:0, 16:0, 17:0, 18:0, 20:0, 22:0 and 24:0. MUFA: Includes 16:1n−7, 18:1n−7, 18:1n−9, 20:1n−9, 22:1n−11, 22:1n−9, 24:1n−9. c n−6 PUFA: Includes 18:2n−6, 18:3n−6, 20:2n−6, 20:3n−6, 20:4n−6. d n−3 PUFA: Includes 18:3n−3, 18:4n−3, 20:4n−3, 20:5n−3, 22:5n−3 and 22:6n−3. b

No significant differences in total feed intake were found among the treatments (Table 4). However, irrespective of the fish oil and canola oil consumption in the FO and CO, an increased consumption of canola oil in the BLD, AST and FST was profoundly seen relative to FO consumption. Also, the fish in the AST and FST received the same amount of fish oil intake over the experimental period, which was significantly lower with respect to BLD and FO treatments. In general, the hepatosomatic index (HSI) of fish in the FO and BLD treatments was lower than those in the AST. The highest viscero fat somatic index (VFI) was found in fish fed the BLD and AST treatments in comparison to other experimental treatments (Table 4). 3.3. Proximate composition Whole body protein content of sea bass receiving the fish oil based diet (FO) was significantly lower than fish fed the BLD, AST, FST or CO diets (Table 5). On the other hand, flesh protein content of the fish in the BLD was significantly lower among all the treatments. In addition, liver protein contents of fish in the CO and BLD treatments were lower than those in the other treatments. Lipid content of whole body, flesh and liver was influenced by dietary treatments (Table 5). The fish fed under FO had higher whole body lipid level compared to the other treatments. On the contrary, the liver lipid content of this treatment displayed lower lipid level as compared to other experimental treatments. There were no significant differences in either the dry matter content of the whole body, flesh or in the liver of fish fed experimental

Table 3 Primers used for each gene expression analysis by q-PCR. Gene

5′-3′ forward primer

5′-3′ reverse primer

Accession no

D6D EF1-α PPAR-α SREBP-1

GCCCTCATCACCAACACC TCCTCTTGGTCGTTTCGCTG ACCTCAGCATCAGGTGACT CTGAGCCAAAACAGAGGAG

ACAGCACAGGTAGCGAGG ACCCGAGGGACATCCTGTG ACTTCGGCTCCATCATGTC GACAGGAAGGAGGGAGGAAG

FB671139 AJ866727 AY590300 FN677951

32

H.A. Yılmaz et al. / Aquaculture 464 (2016) 28–36

Table 4 Growth performance of sea bass fed with the experimental diets for 12 weeks.

Final weight Weight gain (g/fish) SGR FCR Total fish oil intake (g/fish) Total canola oil intake (g/fish) Total feed intake unit (g) HSI VFI

FO

CO

BLD

AST

FST

84.4 ± 1.4a 60.0 ± 1.5a 1.5 ± 0.0a 1.1 ± 0.0b 10.0 ± 0.7a − 2657.8 ± 143.7 1.6 ± 0.0b 3.9 ± 0.0b

75.4 ± 1.0c 51.1 ± 0.9c 1.4 ± 0.01b 1.3 ± 0.1a − 9.8 ± 0.8a 2575.1 ± 155.1 1.9 ± 0.2ab 3.9 ± 0.6b

84.8 ± 0.8a 60.5 ± 0.8a 1.5 ± 0.01a 1.1 ± 0.0b 4.8 ± 0.2b 5.6 ± 0.2c 2763.1 ± 72.0 1.7 ± 0.2b 4.6 + 0.4a

77.3 ± 1.3b 53.0 ± 1.3b 1.4 ± 0.0b 1.2 ± 0.1ab 2.6 ± 0.5c 7.5 ± 0.6b 2559.3 ± 210.0 2.1 ± 0.1a 4.4 + ±0.6a

84.5 ± 0.4a 60.1 ± 0.3a 1.5 ± 0.0a 1.1 ± 0.1b 2.8 ± 0.1c 7.8 ± 0.6b 2542.9 ± 107.7 1.9 ± 0.1ab 3.9 ± 0.5b

Data are expressed as mean ± SD, (n = 3 for final weight, feed intake, SGR and FCR, n = 9 individuals for HSI and VFI). In the same line, values with different superscript letters are significantly different (P b 0.05).

diets. The flesh and liver ash contents showed no significant difference across all treatments.

higher in the flesh of the fish in the FST treatment, competed to those in the CO, AST and BLD treatments.

3.4. Fatty acid composition

3.5. Gene expression in liver

The fatty acid composition of whole body was influenced by the alternating feeding regimes (Table 6). As expected, fatty acid content of the fish mirrored that of their diets. The total levels of saturates was highest (27.1%) in the FO treatment and lowest (20.1%) in the CO treatment. The flesh of the fish fed the FO diet had significantly higher (P b 0.05) levels (27.6%) of total saturates than all other treatments (Table 7). However, total levels of saturates in the liver of fish in the FO treatment (25.9%) were similar to those in FST (25.9%) and AST (25.7%) (Table 8). The total levels of monoenes in whole body and flesh samples were highest (52.2%, 51.2%, respectively) in fish fed the CO diet and lowest (36.8%, 32.0%) in the FO diet. In contrast, the total levels of monoenes in the liver of fish in the CO (58.6%) and AST (56.8%) were significantly higher compared to all other treatments. Oleic acid (18:1n − 9) was the most abundant fatty acid of the monoenes in the whole body, flesh or the liver of fish across all treatments. The oleic acid content in whole body and flesh were similar in the FO treatment. The linoleic (18:2n − 6) content of whole body, flesh and liver was highest in the fish fed the CO treatment (14.9%, 14.9% and 9.6%, respectively). The arachidonic acid (20:4n−6) content in the whole body and liver was significantly higher in the FO treatment, but the level of this fatty acid in the flesh was higher in the AST treatment (1.9%) compared to any of the other treatments. n − 6 PUFA in fish fed the CO diet were significantly higher than those of the other treatments. The level of n − 3 PUFA (mainly EPA and DHA) in the whole body, flesh and liver of sea bass fed the FO diet was significantly higher than all other treatments. However, the proportion of DHA was

Analysis of gene expressions for LC-PUFA biosynthesis (Δ6 desaturase, Elovl5, D6D, SREBP1 and PPAR-α) in the liver of fish fed the experimental diets is shown in Fig. 2. No significant differences in gene expression between all the experimental groups were detected. However, it is important to note that we found a large variability between individuals from the same experimental group in D6D, Elovl5, SREBP1 and PPAR-α gene expression. 4. Discussion In the present study, it was observed that sea bass fed the FST, BLD and FO treatments were larger than fish subjected to any of the other treatments. The results of this experiment indicate that canola oil has negative effect on growth performance. By contrast, numerous studies have shown that the replacement of fish oil by canola oil in aquafeed had minimal detrimental impacts on marine fish (sea bass, sea bream, Senegalese sole, Atlantic salmon) growth performance (Yıldız and Şener, 1997; Tocher et al., 2000; Torstensen et al., 2000; Izquierdo et al., 2005; Montero et al., 2005; Mourente and Bell, 2006; Montero et al., 2008; Turchini et al., 2011; Eroldoğan et al., 2012; Benitez-Dorto et al., 2013; Yılmaz and Eroldoğan, 2015). However, some studies with European sea bass and Atlantic salmon (Salmo salar) have indicated that fish oil replacement with canola oil up to levels of 60–75% was possible with negative effects on fish growth (Torstensen et al., 2004; Mourente et al., 2005) In the present study, fish in FST treatment grew significantly faster than fish in AST treatment during the final finishing period. This is

Table 5 Whole body, muscle and liver proximate composition (%) of sea bass fed the experimental diets for 12 weeks. Initial

FO

CO

BLD

AST

FST

Whole body Protein Lipid Dry matter Ash

21.1 ± 0.2 9.5 ± 0.2 36.4 ± 0.4 5.6 ± 0.2 ab

14.0 ± 0.2d 12.3 ± 0.1a 31.4 ± 0.4 5.0 ± 0.3ab

14.5 ± 0.2c 11.4 ± 0.4b 31.5 ± 0.3 4.5 ± 1.0ab

15.7 ± 0.1a 10.9 ± 0.2c 30.4 ± 0.2 3.7 ± 0.1b

15.2 ± 0.0b 10.2 ± 0.2d 31.3 ± 0.6 5.4 ± 0.5a

15.1 ± 0.2b 10.5 ± 0.3cd 29.8 ± 0.7 4.0 ± 0.2ab

Flesh Protein Lipid Dry matter Ash

22.8 ± 0.3 2.8 ± 0.1 26.2 ± 0.5 3.2 ± 0.0

20.4 ± 0.2a 3.1 ± 0.1c 28.1 ± 0.5 2.4 ± 0.3

20.7 ± 0.2a 4.3 ± 0.2b 28.3 ± 0.6 2.8 ± 0.1

17.9 ± 0.2b 3.3 ± 0.2c 28.4 ± 0.4 2.8 ± 0.3

20.6 ± 0.2a 4.9 ± 0.1a 28.1 ± 0.7 2.5 ± 0.1

20.5 ± 0.1a 4.7 ± 0.0ab 28.3 ± 0.5 2.9 ± 0.1

Liver Protein Lipid Dry matter Ash

10.0 ± 0.8 9.4 ± 0.2 22.3 ± 0.6 2.0 ± 0.2

12.1 ± 1.1a 12.0 ± 0.1c 30.7 ± 0.3 1.3 ± 0.2

10.3 ± 0.4b 13.8 ± 0.2b 30.2 ± 0.6 1.7 ± 0.1

11.1 ± 10.3b 13.5 ± 0.1b 30.4 ± 0.5 1.6 ± 0.3

12.6 ± 0.7a 14.0 ± 0.1a 30.6 ± 0.4 1.3 ± 0.1

12.6 ± 0.4a 13.8 ± 0.1b 30.5 ± 0.4 1.5 ± 0.1

Data are presented as means ± S.D. (N = 3 pools for whole-body composition, flesh and liver analysis). In the same line, values with different superscript letters are significantly different (P b 0.05).

H.A. Yılmaz et al. / Aquaculture 464 (2016) 28–36

33

Table 6 Fatty acid (% of total lipids) composition of whole body of European sea bass fed the various experimental diets for 12 weeks. Fatty acid

Initial

FO

CO

BLD

AST

FST

14:0 16:0 18:0 SFAa 16:1n−7 18:1n−7 18:1n−9 MUFAb 18:2n−6 18:3n−6 20:2n−6 20:3n−6 20:4n−6 n−6 PUFAc n−6 LC-PUFA 18:3n−3 18:4n−3 20:4n−3 20:5n−3 22:6n−3 n−3 PUFAd n−3 LC-PUFA

4.8 ± 0.1 20.4 ± 0.3 1.1 ± 0.0 33.0 ± 0.4 6.0 ± 0.0 2.9 ± 0.0 19.4 ± 0.4 34.7 ± 0.4 10.4 ± 0.1 0.1 ± 0.0 0.1 ± 0.0 0.5 ± 0.0 0.7 ± 0.0 11.8 ± 0.1 1.2 ± 0.1 3.2 ± 0.1 0.8 ± 0.0 1.7 ± 0.1 5.5 ± 0.0 6.1 ± 0.0 18.6 ± 0.0 15.7 ± 0.0

4.2 ± 0.0a 18.0 ± 0.0a 3.7 ± 0.0a 27.1 ± 0.0a 5.8 ± 0.0a 3.7 ± 0.0a 21.9 ± 0.1e 36.8 ± 0.1d 6.9 ± 0.0d 0.3 ± 0.0a 0.2 ± 0.0b 0.5 ± 0.0 0.7 ± 0.0a 8.6 ± 0.1e 1.2 ± 0.9a 3.0 ± 0.0 0.9 ± 0.1 1.5 ± 0.0 9.7 ± 0.0a 10.5 ± 0.0a 27.1 ± 0.0a 24.0 ± 0.0a

1.8 ± 0.0d 13.2 ± 0.0e 3.2 ± 0.0c 20.1 ± 0.4d 2.6 ± 0.0c 2.8 ± 0.6d 39.9 ± 0.9a 52.2 ± 1.3a 14.9 ± 0.7a 0.1 ± 0.0b 0.4 ± 0.1a 0.6 ± 0.0 0.1 ± 0.1d 16.4 ± 0.1a 0.7 ± 0.3c 3.0 ± 0.1 0.8 ± 0.0 0.6 ± 0.0 2.4 ± 0.0e 4.3 ± 0.3d 11.2 ± 1.1d 8.2 ± 0.1d

2.7 ± 0.0b 15.0 ± 0.1b 3.3 ± 0.0b 22.6 ± 0.2b 3.8 ± 0.0b 3.3 ± 0.0b 32.3 ± 1.2d 47.5 ± 0.8c 11.6 ± 0.7c 0.1 ± 0.0b 0.2 ± 0.0b 0.6 ± 0.0 0.4 ± 0.0b 12.9 ± 0.7d 1.0 ± 0.9b 3.1 ± 0.0 0.9 ± 0.2 0.5 ± 0.0 4.9 ± 0.1b 6.5 ± 0.2b 17.2 ± 0.2b 14.1 ± 0.8b

2.1 ± 0.0c 13.7 ± 0.1d 3.3 ± 0.0b 20.6 ± 0.3b 3.0 ± 0.0bc 3.2 ± 0.1c 37.1 ± 0.5b 49.4 ± 0.4b 13.8 ± 0.1ab 0.1 ± 0.0b 0.5 ± 0.0a 0.6 ± 0.0 0.4 ± 0.0c 15.3 ± 0.2b 1.0 ± 0.2b 3.4 ± 0.1 0.9 ± 0.1 0.4 ± 0.0 3.5 ± 0.0d 5.3 ± 0.2c 14.7 ± 0.3c 11.3 ± 0.9c

2.5 ± 0.0bc 14.5 ± 0.1c 3.4 ± 0.0b 21.2 ± 0.3c 3.4 ± 0.1b 3.4 ± 0.0b 35.3 ± 0.4c 48.0 ± 0.4c 12.9 ± 0.1b 0.1 ± 0.0b 0.1 ± 0.0b 0.6 ± 0.0 0.5 ± 0.1b 14.2 ± 0.1c 1.1 ± 0.1b 3.2 ± 0.0 0.9 ± 0.1 0.4 ± 0.1 4.3 ± 0.0c 6.0 ± 0.1bc 16.2 ± 0.3b 13.2 ± 0.3b

Results are means ± SD (N = 3 pools for whole-body composition). In the same line, values with different superscript letters are significantly different (P b 0.05). a SFA: Includes 12:0, 14:0, 15:0, 16:0, 17:0, 18:0, 20:0, 22:0 and 24:0. b MUFA: Includes 16:1n−7, 18:1n−7, 18:1n−9, 20:1n−9, 22:1n−11, 22:1n−9 and 24:1n−9. c n−6 PUFA: Includes 18:2n−6, 18:3n−6, 20:2n−6, 20:3n−6 and 20:4n−6. d n−3 PUFA: Includes 18:3n−3, 18:4n−3, 20:4n−3, 20:5n−3, 22:5n−3 and 22:6n−3.

thought to be associated with the reduced levels of LC-PUFA in the FST treatment positively stimulated lipid metabolism, which led to a growth enhancement when the fish reverted back to fish oil based diet. Turchini et al. (2007) proposed this effect as “lipo-compensatory” growth. Accordingly, a similar effect was noted by Glencross et al. (2003) with the marine fish, red seabream (Pagrus auratus), when they were initially fed a soybean oil based diet and then finished on a fish oil based diet. In the current study, the growth difference amongst the treatments might in part be due to the difference in the FCR of the fish in the CO treatment that was much higher (less efficient) than the other treatments. In fact,

feed intake among the treatments was not significantly affected, suggesting that the type of oil used in the feed formulation had no effect on the feed palatability. This is in accordance with previous observations by Turchini et al. (2009). The lipid content of whole body, flesh and liver was significantly influenced by the dietary lipid source. Fish fed the dietary treatments AST had the highest crude lipid content in flesh and liver samples compared to fish fed the other experimental diets. Similar results were reported in some studies when fish were fed different vegetable oils (Yıldız and Şener, 1997; Montero et al., 2005; Güler and Yıldız, 2011; Turchini et

Table 7 Total fatty acid (% of total lipids) composition of the flesh of European sea bass fed various experiment diets for 12 weeks. Fatty acid 14:0 16:0 18:0 SFAa 16:1n−7 18:1n−7 18:1n−9 MUFAb 18:2n−6 18:3n−6 20:2n−6 20:3n−6 20:4n−6 n−6 PUFAc n−6 LC-PUFA 18:3n−3 18:4n−3 20:4n−3 20:5n−3 22:6n−3 n−3 PUFAd n−3 LC-PUFA

Initial 4.3 ± 0.1 18.7 ± 0.3 4.5 ± 0.1 29.5 ± 0.6 4.6 ± 0.4 2.3 ± 0.4 18.6 ± 0.5 31.9 ± 1.2 9.7 ± 0.2 0.4 ± 0.0 0.1 ± 0.0 0.5 ± 0.0 1.3 ± 0.0 11.7 ± 0.2 1.3 ± 0.4 2.5 ± 0.1 0.8 ± 0.03 0.7 ± 0.1 6.1 ± 0.1 12.4 ± 0.2 23.0 ± 0.3 20.2 ± 0.7

FO

CO a

4.0 ± 0.0 18.0 ± 0.2a 4.2 ± 0.1a 27.6 ± 0.3a 5.5 ± 0.0a 3.5 ± 0.1 18.5 ± 0.2d 32.9 ± 0.3e 7.2 ± 0.1d 0.6 ± 0.0b 0.2 ± 0.0b 0.5 ± 0.0 1.3 ± 0.2b 9.7 ± 0.2c 1.4 ± 0.1b 2.8 ± 0.1b 0.9 ± 0.1 0.8 ± 0.0 10.5 ± 0.1a 12.8 ± 0.3a 29.0 ± 0.4a 26.2 ± 0.3a

BLD d

1.3 ± 0.1 13.3 ± 0.2d 3.9 ± 0.2b 19.6 ± 0.3d 1.9 ± 0.1d 3.3 ± 0.0 40.7 ± 0.0a 51.2 ± 0.3a 14.9 ± 0.1a 0.6 ± 0.0b 0.4 ± 0.1a 0.6 ± 0.0 0.7 ± 0.1e 16.4 ± 0.0a 1.0 ± 0.1c 3.0 ± 0.1ab 0.9 ± 0.05 0.7 ± 0.0 2.4 ± 0.1e 5.3 ± 0.2d 11.7 ± 0.3d 8.7 ± 0.3c

AST b

2.3 ± 0.0 15.6 ± 0.1b 4.0 ± 0.1b 25.9 ± 0.1b 3.4 ± 0.1b 3.3 ± 0.0 33.4 ± 0.4c 42.6 ± 0.6d 11.7 ± 0.2c 0.5 ± 0.0b 0.2 ± 0.0b 0.6 ± 0.0 1.0 ± 0.0d 14.0 ± 0.1b 1.4 ± 0.0b 0.4 ± 0.0c 0.9 ± 0.2 0.7 ± 0.0 7.0 ± 0.0b 7.5 ± 0.1c 15.3 ± 0.1c 13.2 ± 0.3b

FST c

1.8 ± 0.0 14.1 ± 0.0c 3.8 ± 0.0b 20.9 ± 0.0d 2.5 ± 0.1c 3.3 ± 0.0 36.4 ± 0.1b 47.6 ± 0.2b 13.4 ± 0.0b 0.7 ± 0.0a 0.5 ± 0.0a 0.7 ± 0.0 1.9 ± 0.0a 16.2 ± 0.0a 2.1 ± 0.0a 3.2 ± 0.0a 0.9 ± 0.1 0.8 ± 0.0 4.0 ± 0.0d 7.2 ± 0.1c 15.4 ± 0.1c 12.3 ± 0.0bc

Results are means ± SD (N = 3 pools for flesh composition). In the same line, values with different superscript letters are significantly different (P b 0.05). a SFA: Includes 12:0, 14:0, 15:0, 16:0, 17:0, 18:0, 20:0, 22:0 and 24:0. b MUFA: Includes 16:1n−7, 18:1n−7, 18:1n−9, 20:1n−9, 22:1n−11, 22:1n−9 and 24:1n−9. c n−6 PUFA: Includes 18:2n−6, 18:3n−6, 20:2n−6, 20:3n−6 and 20:4n−6. d n−3 PUFA: Includes 18:3n−3, 18:4n−3, 20:4n−3, 20:5n−3, 22:5n−3 and 22:6n−3.

2.2 ± 0.0b 14.4 ± 0.0bc 4.0 ± 0.0b 22.5 ± 0.1c 3.0 ± 0.0bc 3.3 ± 0.0 33.9 ± 0.1c 45.0 ± 0.1c 13.2 ± 0.0b 0.7 ± 0.0a 0.1 ± 0.0b 0.6 ± 0.0 1.2 ± 0.0c 15.1 ± 0.0a 1.4 ± 0.1b 3.2 ± 0.1a 0.9 ± 0.1 0.8 ± 0.1 5.7 ± 0.0c 8.3 ± 0.1b 19.5 ± 0.2b 16.3 ± 0.1b

34

H.A. Yılmaz et al. / Aquaculture 464 (2016) 28–36

Table 8 Total fatty acid (% of total lipids) composition of the liver of European sea bass fed various experimental diets for 12 weeks. Fatty acid

Initial

FO

CO

BLD

AST

FST

14:0 16:0 18:0 SFAa 16:1n−7 18:1n−7 18:1n−9 MUFAb 18:2n−6 18:3n−6 20:2n−6 20:3n−6 20:4n−6 n−6 PUFAc n−6 LC-PUFA 18:3n−3 18:4n−3 20:4n−3 20:5n−3 22:6n−3 n−3 PUFAd n−3 LC-PUFA

3.9 ± 0.2 27.6 ± 0.4 9.4 ± 0.1 42.3 ± 0.4 4.4 ± 0.2 4.0 ± 0.2 32.0 ± 0.2 42.8 ± 0.1 5.2 ± 0.0 0.1 ± 0.1 0.1 ± 0.0 0.6 ± 0.0 0.2 ± 0.1 5.9 ± 0.2 0.4 ± 0.0 3.2 ± 0.1 0.8 ± 0.0 1.1 ± 0.1 1.2 ± 0.1 2.9 ± 0.0 9.5 ± 0.1 5.1 ± 0.4

1.5 ± 0.0a 18.8 ± 0.1a 4.6 ± 0.1a 25.9 ± 0.3a 4.9 ± 0.1a 5.2 ± 0.0a 38.2 ± 0.8d 51.4 ± 0.8c 5.1 ± 0.1d 0.3 ± 0.0a 0.4 ± 0.0 0.8 ± 0.0 0.6 ± 0.1a 6.5 ± 0.1d 0.8 ± 0.1a 2.7 ± 0.1a 0.9 ± 0.1 1.3 ± 0.0 4.6 ± 0.1a 6.3 ± 0.3a 16.2 ± 0.3a 13.5 ± 0.1a

1.3 ± 0.1c 17.8 ± 0.3b 3.9 ± 0.0c 23.8 ± 0.4b 3.4 ± 0.1e 3.5 ± 0.1d 48.8 ± 0.2a 58.6 ± 0.4a 9.6 ± 0.1a 0.1 ± 0.0b 0.4 ± 0.1 0.6 ± 0.0 0.4 ± 0.2ab 10.6 ± 0.3a 0.4 ± 0.0b 2.5 ± 0.0b 0.8 ± 0.0 0.9 ± 0.0 0.9 ± 0.0e 2.1 ± 0.1d 6.4 ± 0.0e 3.9 ± 0.4d

1.4 ± 0.0bc 17.3 ± 0.5b 4.4 ± 0.3ab 23.8 ± 0.8b 3.8 ± 0.1d 3.9 ± 0.0b 43.8 ± 1.1c 54.6 ± 0.9b 8.1 ± 0.2b 0.1 ± 0.0b 0.4 ± 0.0 0.6 ± 0.0 0.3 ± 0.b 9.1 ± 0.2b 0.4 ± 0.0b 2.5 ± 0.0b 0.9 ± 0.2 0.8 ± 0.0 3.0 ± 0.0b 4.6 ± 0.5b 11.6 ± 0.5b 9.0 ± 0.3b

1.3 ± 0.1c 19.4 ± 0.5a 4.1 ± 0.2bc 25.7 ± 0.5a 3.9 ± 0.0c 3.8 ± 0.0c 46.4 ± 0.3b 56.8 ± 0.4a 7.9 ± 0.6b 0.1 ± 0.0b 0.3 ± 0.0 0.7 ± 0.0 0.2 ± 0.0bc 8.7 ± 0.6b 0.6 ± 0.0b 2.5 ± 0.1b 0.9 ± 0.1 0.6 ± 0.0 1.6 ± 0.1d 2.9 ± 0.2c 8.6 ± 0.3d 5.6 ± 0.3c

1.4 ± 0.0b 19.2 ± 0.1a 4.4 ± 0.0ab 25.9 ± 0.2a 4.3 ± 0.0b 4.03 ± 0.1b 44.4 ± 0.3c 55.5 ± 0.4b 6.6 ± 0.5c 0.1 ± 0.0b 0.4 ± 0.0 0.7 ± 0.0 0.3 ± 0.0b 7.6 ± 0.5c 0.4 ± 0.2b 2.6 ± 0.0b 0.9 ± 0.1 0.6 ± 0.1 2.2 ± 0.0c 3.0 ± 0.1c 9.1 ± 0.2c 6.5 ± 0.3c

Results are means ± SD (N = 3 pools for liver composition). In the same line, values with different superscript letters are significantly different (P b 0.05). a SFA: Includes 12:0, 14:0, 15:0, 16:0, 17:0, 18:0, 20:0, 22:0 and 24:0. b MUFA: Includes 16:1n−7, 18:1n−7, 18:1n−9, 20:1n−9, 22:1n−11, 22:1n−9 and 24:1n−9. c n−6 PUFA: Includes 18:2n−6, 18:3n−6, 20:2n−6, 20:3n−6 and 20:4n−6. d n−3 PUFA: Includes 18:3n−3, 18:4n−3, 20:4n−3, 20:5n−3, 22:5n−3 and 22:6n−3.

al., 2011; Köse and Yıldız, 2013; Özşahinoğlu et al., 2013; Yılmaz and Eroldoğan, 2015). In the present study, lipid content of the tissues (flesh, whole body and liver) was differently affected by diets in accordance with previous studies. Regardless of the dietary treatment, the highest lipid content was found in liver followed by whole body (including adipose tissue) and flesh. Increasing lipid content of liver in the present study might be associated with the lipogenesis activity in this organ since the liver is the main site for lipogenesis, followed by other tissues (Segner and Böhm, 1994). Numerous studies, in a wide range of fish species, have shown that flesh fatty acid composition is closely correlated to dietary fatty acid composition and that feeding high levels of vegetable oils will strongly influence the preferential deposition and retention of “unwanted” fatty acids such as 18:2n− 6 and 18:3n− 3 in flesh lipids. Thus, there have been many attempts to overcome this problem in aquaculture practices, such as implementation of “cleaner” feeds (finishing diets as reported in Robin et al., 2003; Bell et al., 2004; Mourente et al., 2005; Izquierdo et al., 2005) or routine alternation of dietary lipid sources (Turchini et al., 2007; Francis et al., 2009; Brown et al., 2010; Mumoğullarında, 2012; Dedeler, 2013). Previous studies have shown that although dietary fatty acids associate with fatty acids deposited in fish tissue, some specific fatty acids (i.e. linoleic acid, linolenic acid, EPA and DHA) were preferentially retained (Bell et al., 2001; Bell et al., 2002; Torstensen et al., 2004). Accordingly, in the present study, it was clearly shown that the fatty acid composition of the whole body, flesh and liver of European sea bass fed with five feeding schedules was reflective of the dietary fatty acid composition (Martínez-Llorens et al., 2007; Eroldoğan et al., 2012; Eroldoğan et al., 2013; Yılmaz and Eroldoğan, 2015). Fish in the FST treatment had significantly higher EPA and DHA contents in the whole body in comparison to fish fed the AST and CO diets, but significantly lower than those fed the FO diet. Once linoleic acid is deposited, it is also known to be selectively retained in fish flesh and resistant to “dilution” even after switching to a fish oil finishing diet (Bell et al., 2003; Arzel et al., 2003; Ng and Chong, 2004). This was amply confirmed in the FST or any other treatments. Ultimately, a great number of studies have focused on the fatty acids bioconversion metabolic pathway, initially on salmonids using ex vitro

methods (Bell et al., 1997; Tocher et al., 1997, 2000, 2002; Stubhaug et al., 2005; Zheng et al., 2005). Fatty acid metabolism is regulated at the molecular level and linked to specific transcriptional factors. It is well documented in mammals that key regulators of desaturase gene expression are SREBP-1 gene products (SREBP-1a, SREBP-1c) and PPARα (Nakamura and Nara, 2002). As in mammals (Nakamura and Nara, 2002; Mullen et al., 2004), transcription of LC-PUFA biosynthesis genes in fish seems to be mediated by SREBP activation and PPAR-α (Geay et al., 2010; Kortner et al., 2012; Castro et al., 2014; Coccia et al., 2014). The effects of dietary fish oil replacement on hepatic gene expression in fish have been recently investigated (Panserat et al., 2008, 2009; Morais et al., 2011). In the present study, there were no significant differences in Δ6 desaturase (D6D), PPAR-α and SREBP1 among the experimental treatments, which do not correlate with the idea of a regulation of these transcriptional factors in our experiment. However, analysis of gene expression showed that there was a huge individual difference in response to alternative feeding, especially PPAR-α and SREBP1, suggesting a potential difference of feed intake between individuals in the same experimental group. Finally, there is still a need for further nutritional studies to confirm the absence of effects of alternate feeding on genes involved in fatty acid synthesis in fish. Moreover, elongase 5 (elovl5) gene expression levels were not detected in all groups. In other studies in marine species, Atlantic cod and sea bass, replacement of fish oil by vegetable oil demonstrated no significant response in the expression and activity of elovl5 at the intestinal level (Morais et al., 2012; Castro et al., 2014), however, increased expression of elovl5 in the liver was observed in both species (Tocher et al., 2006; Castro et al., 2014). In conclusion, this study has stated the possibilities surrounding fish oil reduction in aquafeeds by using alternate feeding regimes. Also, the present findings in our study showed that when CO and FO based diets were routinely alternated, European sea bass were able to increase their efficiency of n−3 LC-PUFA deposition in the flesh. For the question “is there any metabolic mechanism influenced by alternative feeding on genes involved in fatty acid biosynthesis?”. The present study did not give a clear answer since we did not show any significant effect of alternative regimes on gene expression with respect to LC-PUFA biosynthesis due to a high individual variability. There are several issues that still

H.A. Yılmaz et al. / Aquaculture 464 (2016) 28–36

35

References

Fig. 2. Relative expression of Δ6 desaturase (D6D), sterol regulatory element binding protein 1-like (SREBP-1) and the peroxisome proliferators-activated receptors (PPAR-α) genes in the liver from fish fed different feeding schedules (fish oil treatment: FO; canola oil treatment: CO; blend treatment: BLD; alternate treatment: AST; finishing treatment: FST). Relative Transcript (mRNA) levels were measured using real-time quantitative RT-PCR.

need to be addressed to further elucidate the mechanisms leading to the deposition of n−3 LC-PUFA in sea bass. Authors' contributions OTE, HAY, GC and SP conceived the investigation. HAY and OTE contributed to formulate the experimental diets. HAY conducted whole analysis. HAY, GC and SP participated in gene expression analyses. OTE coordinated the work and took primary responsibility for the final content of the manuscript. All authors write, read and approved the final manuscript. Acknowledgment This study was supported by the Scientific Research Project Unit of Çukurova University, Turkey (Grant no: SÜF2011D1). The authors wish to thank to Mr. Abdullatif Ölçülü and Serhat Türkmen for the technical assistance and Dr. Grethe Rosenlund (Skretting in Norway) for manufacturing the experimental diets. We also wish to thank Dr. Giovanni Turchini, Dr. David Francis and Dr. Metin Kumlu for their careful reading and comments for the manuscript.

AOAC (Association of Official Analytical Chemists), 1995. Official Methods of Analysis. 16th ed. Association of Analytical Chemists, Arlington, Virginia, USA. Bell, J.G., Waagbø, R., 2008. Safe and nutritious aquaculture produce: benefits and risks of alternative sustainable aquafeeds. In: Holmer, M., Black, K., Duarte, C.M., Marba, N., Karakassis, I. (Eds.), Aquaculture in the Ecosystem. Springer Science, pp. 185–226. Bell, J.G., Tocher, D.R., Farndale, B.M., Cox, D.I., McKinney, R.W., Sargent, J.R., 1997. The effect of dietary lipid on polyunsaturated fatty acid metabolism in Atlantic salmon (Salmo salar) undergoing parr-smolt transformation. Lipids 32, 515–525. Bell, J.G., McEvoy, J., Tocher, D.R., McGhee, F., Campbell, P.J., Sargent, J.R., 2001. Replacement of fish oil with rape seed oil in diets of Atlantic salmon (Salmo salar) affects tissue lipid compositions and hepatocyte fatty acid metabolism. J. Nutr. 131, 1535–1543. Bell, J.G., Henderson, R.J., Tocher, D.R., McGhee, F., Dick, J.R., Porter, A., Smullen, R.P., Sargent, J.R., 2002. Substituting fish oil with crude palm oil in the diet of Atlantic salmon (Salmo salar) affects muscle fatty acid composition and hepatic fatty acid metabolism. J. Nutr. 132, 222–230. Bell, J.G., McGhee, F., Campbell, P.J., Sargent, J.R., 2003. Rapeseed oil as an alternative to marine fish oil in diets of post-smolt Atlantic salmon (Salmo salar): changes in flesh fatty acid composition and effectiveness of subsequent fish oil metabolism. J. Nutr. 218, 515–528. Bell, J.G., Henderson, R.J., Tocher, D.R., Sargent, J.R., 2004. Replacement of dietary fish oil with increasing levels of linseed oil: modification of flesh fatty acid compositions in Atlantic salmon (Salmo salar) using a fish oil finishing diet. Lipids 39, 223–232. Benitez-Dorto, V., Caballero, M.J., Izquierdo, M., Manchado, M., Infante, C., Zamorano, M.J., Montero, D., 2013. Total substitution of fish oil by vegetable oils in Senegalese sole (Solea senegalensis) diets: effects on fish performance, biochemical composition, and expression of some glucocorticoid receptor-related genes. Fish Physiol. Biochem. 39, 335–349. Brown, M.S., Goldstein, J.L., 1997. The SREBP pathway: regulation of cholesterol metabolism by proteolysis of a membrane-bound transcription factor. Cell 89, 331–340. Brown, T.D., Francis, D.S., Turchini, G.M., 2010. Can dietary lipid source circadian alternation improve omega-3 deposition in rainbow trout? Aquaculture 300, 148–155. Castro, C., Corraze, G., Panserat, S., Oliva‐Teles, A., 2014. Effects of fish oil replacement by a vegetable oil blend on digestibility, postprandial serum metabolite profile, lipid and glucose metabolism of European sea bass (Dicentrarchus labrax) juveniles. Aquac. Nutr. 21, 592–603. Coccia, E., Varricchio, E., Vito, P., Turchini, G.M., Francis, D.S., Paolucci, M., 2014. Fatty acidspecific alterations in leptin, PPARα, and CPT-1 gene expression in the rainbow trout. Lipids 49 (10), 1033–1046. Czesny, S., Dabrowski, K., 1998. The effect of egg fatty acid concentrations on embryo viability in wild and domesticated walleye (Stizostedion vitreum). Aquat. Living Resour. 11, 371–378. Dedeler, H., 2013. The effect of diets including fish oil and vegetable oil sources and their use in cycles growth and fatty acid composition of juvenile European sea bass (Dicentrarchus labrax). An MS Thesis Submitted to the Department of Aquaculture. Cukurova Universty, Adana, Turkey (68 pp.). Eberle, D., Hegarty, B., Bossard, P., Ferre, P., Foufelle, F., 2004. SREBP transcription factors: master regulators of lipid homeostasis. Biochimie 86, 839–848. Eroldoğan, O.T., Turchini, G.M., Yılmaz, A.H., Taşbozan, O., Engin, K., Ölçülü, A., Özşahinoğlu, I., Mumoğullarında, P., 2012. Potential of cottonseed oils fish oil replacer in European sea bass feed formulation. Turk. J. Fish. Aquat. Sci. 12, 787–797. Eroldoğan, O.T., Yılmaz, A.H., Turchini, G.M., Arslan, M., Sirkecioğlu, N.A., Engin, K., Özşahinoğlu, I., Mumoğullarında, P., 2013. Fatty acid metabolism in European sea bass (Dicentrarchus labrax): effects of n−6 PUFA and MUFA in fish oil replaced diets. Fish Physiol. Biochem. 39, 941–955. Folch, J., Lees, M., Stanley, G.H.S., 1957. A simple method for the isolation and purification of total lipids from animal tissues. J. Biol. Chem. 226, 497–509. Francis, D.S., Turchini, G.M., Smith, B.K., Ryan, S.G., De Silva, S.S., 2009. Effects of alternate phases of fish oil and vegetable oil based diets in Murray cod. Aquac. Res. 40, 1123–1134. Geay, F., Santigosa, I., Culi, E., Corporeau, C., Boudry, P., Dreano, Y., Corcos, L., Bodin, N., Vandeputte, M., zambonino-Infante, J.L., Mazurais, D., 2010. Regulation of FADS2 expression and activity in European sea bass (Dicentrarchus labrax, L.) fed a vegetable diet. Comp. Biochem. Physiol. B 156, 237–243. Glencross, B., Hawkins, W., Curnow, J., 2003. Evaluation of canola oils as alternative lipid resources in diets for juvenile red seabream, Pagrus auratus. Aquac. Nutr. 9, 305–315. Güler, M., Yıldız, M., 2011. Effects of dietary fish oil replacement by cottonseed oil on growth performance and fatty acid composition of rainbow trout (Oncorhynchus mykiss). Turk. J. Vet. Anim. Sci. 35, 157–167. Gunstone, F.D., 2010. The world's oils and fats. In: Turchini, G.M., Ng, W.K., Tocher, D.R. (Eds.), Fish Oil Replacement and Alternative Lipid Sources in Aquaculture Feeds. CPC Press, Taylor and Francis, Boca Raton, pp. 61–89. Howell III, G., Deng, X., Yellaturu, C., Park, E.A., Wilcox, H.G., Raghow, R., Elam, M.B., 2009. N − 3 polyunsaturated fatty acids suppress insulin-induced SREBP-1c transcription via reduced trans-activating capacity of LXRα. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 1791, 1190–1196. Izquierdo, M.S., Obach, A., Arantzamendi, L., Montero, D., Rabaina, L., Rosenlund, G., 2003. Dietary lipid sources for seabream and seabass: growth performance, tissue composition and flesh quality. Aquac. Nutr. 9, 397–407. Izquierdo, M.S., Montero, D., Robaina, L., Caballero, M.J., Rosenlund, G., Gines, R., 2005. Alterations in fillet fatty acid profile and flesh quality in gilthead seabream (Sparus aurata) fed vegetable oils for a long term period. Recovery of fatty acid profiles by fish oil feeding. Aquaculture 250, 431–444.

36

H.A. Yılmaz et al. / Aquaculture 464 (2016) 28–36

Kortner, T.M., Gu, J., Krogdahl, A., Bakke, A.M., 2012. Transcriptional regulation of cholesterol and bile acid metabolism after dietary soyabean meal treatment in Atlantic salmon (Salmo salar L.). Br. J. Nutr. 30, 1–12. Köse, I., Yıldız, M., 2013. Effect of diets containing sesame oil on growth and fatty acid composition of rainbow trout (Oncorhynchus mykiss). J. Appl. Ichthyol. 29, 1318–1324. Martínez-Llorens, S., Moñino, A.V., Tomás, A., Moya, V.J., Pla, M., Jover, M., 2007. Soybean meal as a protein source in gilthead sea bream (Sparus aurata L.) diets: effects on growth and nutrient utilization. Aquac. Res. 38, 82–90. Metcalfe, L., Schmitz, A., 1961. The lipid preparation of fatty acid esters for gas chromatographic analysis. Anal. Chem. 33, 363–364. Montero, D., Robaina, L., Caballero, M.J., Gine, S.R., Izquierdo, M.S., 2005. Growth, feed utilization and flesh quality of European sea bass (Dicentrarchus labrax) fed diets containing vegetable oils: a time-course study on the effect of a re-feeding period with a 100% fish oil diet. Aquaculture 148, 121–134. Montero, D., Grasso, V., Izquierdo, M.S., Ganga, R., Real, F., Tort, L., 2008. Total substitution of fish oil by vegetable oils in gilthead seabream (Sparus aurata) diets: effects on hepatic Mx expression and some immune parameters. Fish Shellfish Immunol. 24, 147–155. Morais, S., Pratoomyot, J., Taggart, J.B., Bron, J.E., Guy, D.R., Bell, J.G., Tocher, D.R., 2011. Genotype-specific responses in Atlantic salmon (Salmo salar) subject to dietary fish oil replacement by vegetable oil: a liver transcriptomic analysis. BMC Genom. 12, 255. Morais, S., Edvardsen, R.B., Tocher, D.R., Bell, J.G., 2012. Transcriptomic analyses of intestinal gene expression of juvenile Atlantic cod (Gadus morhua) fed diets with Camelina oil as replacement for fish oil. Comp. Biochem. Physiol. B. Biochem. Mol. Biol. 161, 283–293. Morton, J.D., Shimomura, L., 1999. Sterol regulatory element-binding proteins: activators of cholesterol and fatty acid biosynthesis. Curr. Opin. Lipidol. 10 (2), 143–150. Mourente, G., Bell, J.G., 2006. Partial replacement of dietary fish oil with blends of vegetable oils (rapeseed, linseed and palm oils) in diets for European sea bass (Dicentrarchus labrax L.) over a long term growth study: effects on muscle and liver fatty acid composition and effectiveness of a fish oil finishing diet. Comp. Biochem. Physiol. 145, 389–399. Mourente, G., Dick, J.R., 2002. Influence of partial substitution of dietary fish oil by vegetable oils on the metabolism of [1-14C]18:3n−3 in isolated hepatocytes of European sea bass (Dicentrarchus labrax L.). Fish Physiol. Biochem. 26, 297–308. Mourente, G., Good, J.E., Bell, J.G., 2005. Partial substitution of fish oil with rapeseed, linseed and olive oils in diets for European sea bass (Dicentrarchus labrax L.): effects on flesh fatty acid composition, plasma prostaglandins E2 and F2a, immune function and effectiveness of a fish oil finishing diet. Aquac. Nutr. 11, 25–40. Mullen, E., Brown, R.M., Osborne, T.F., Shay, N.F., 2004. Soy isoflavones affect sterol regulatory element binding proteins (SREBPs) and SREBP-regulated genes in HepG2 cells. J. Nutr. 134, 2942–2947. Mumoğullarında, P., 2012. The effect of alternative phases of canola oil and fish oil level on the growth performance and fatty acid profile of juvenile European sea bass (Dicentrarchus labrax). An MS Thesis Submitted to the Department of Aquaculture. Cukurova University, Adana, Turkey (63 pp.). Nakamura, M.T., Nara, T.Y., 2002. Gene regulation of mammalian desaturases. Biochem. Soc. Trans. 30, 1076–1079. Nakamura, M., Nara, T., 2003. Essential fatty acid synthesis and its regulation in mammals. Prostaglandins Leukot. Essent. Fat. Acids 68, 145–150. Nakamura, M.T., Cheon, Y., Li, Y., Nara, T.Y., 2004. Mechanisms of regulation of gene expression by fatty acids. Lipids 39, 1077–1083. Nakatani, T., Kim, H.-J., Kaburagi, Y., Yasuda, K., Ezaki, O., 2003. A low fish oil inhibits SREBP-1 proteolytic cascade, while a high-fish-oil feeding decreases SREBP-1 mRNA in mice liver relationship to anti-obesity. J. Lipid Res. 44, 369–379. Ng, W.K., Chong, C.Y., 2004. An overview of lipid nutrition with emphasis on alternative lipid sources in tilapia feeds. In: Bolivar, R.B., Mair, G.C., Fitzsimmons, K. (Eds.), New Dimensions in Farmed Tilapia. Proceedings Sixth International Symposium on Tilapia in Aquaculture (Philippines), pp. 241–248. Ng, W.K., Gibon, V., 2010. Palm oil and saturated fatty acid-rich vegetable oils. In: Turchini, G.M., Ng, W.K., Tocher, D.R. (Eds.), Fish Oil Replacement and Alternative Lipid Sources in Aquaculture Feeds. CRC Press, Taylor & Francis Group, Boca Raton, FL, USA, pp. 99–132. Nikzad, H.M., Khara, H., Yazdani Sadati, M.A., Parandavar, H., 2012. Effects of dietary fish oil substitution with mixed vegetable oils on growth and fillet fatty acid composition of juvenile Caspian great sturgeon (Huso huso). Aquac. Int. 21, 143–155. Özşahinoğlu, I., Eroldoğan, T., Mumoğullarında, P., Dikel, S., Engin, K., Yılmaz, A.H., Arslan, M., Sirkecioğlu, A.N., 2013. Partial replacement of fish oil with vegetable oil in diets for European seabass (Dicentrarchus labrax): effects on growth performance and fatty acids profile. Turk. J. Fish. Aquat. Sci. 13, 819–825. Panserat, S., Kolditz, C., Richard, N., Plagnes-Juan, E., Piumi, F., Esquerré, D., Kaushik, S., 2008. Hepatic gene expression profiles in juvenile rainbow trout (Oncorhynchus mykiss) fed fishmeal or fish oil-free diets. Br. J. Nutr. 100 (05), 953–967. Panserat, S., Hortopan, G.A., Plagnes-Juan, E., Kolditz, C., Lansard, M., Skiba-Cassy, S., Esquerre, D., Geurden, I., Médale, F., Kaushik, S., Corraze, G., 2009. Differential gene

expression after total replacement of dietary fish meal and fish oil by plant products in rainbow trout (Oncorhynchus mykiss) liver. Aquaculture 294, 123–131. Poulsen, L., Siersbaek, M., Mandrup, S., 2012. PPARs: fatty acid sensors controlling metabolism. Semin. Cell Dev. Biol. 23, 631–639. Price, P.T., Nelson, C.M., Clarke, S.D., 2000. Omega-3 polyunsaturated fatty acid regulation of gene expression. Curr. Opin. Lipidol. 11, 3–7. Regost, C., Arzel, J., Cardinal, M., Rosenlund, G., Kaushik, S.J., 2003. Total replacement of fish oil by soybean or linseed oil with a return to fish oil in turbot (Psetta maxima) 2. Flesh quality parameters. Aquaculture 217, 737–747. Robin, J.H., Regost, C., Arzel, J., Kaushik, S.J., 2003. Fatty acid profile of fish following a change in dietary fatty acid source: model of fatty acid composition with a dilution hypothesis. Aquaculture 225, 283–293. Santigosa, E., Geay, F., Tonon, T., Le, D.H., Kuhl, H., Reinhardt, R., Corcos, L., Cahu, C., Zambonino-Infante, J.L., Mazurais, D., 2011. Cloning, tissue expression analysis, and functional characterization of two D6-desaturase variants of sea bass (Dicentrarchus labrax L.). Mar. Biotechnol. 13, 22–31. Segner, H., Böhm, R., 1994. Enzymes of lipogenesis. In: Hochachka, P.W., Mommsen, T.P. (Eds.), Analytical Techniques. Elsevier, Amsterdam, pp. 313–325. Stubhaug, I., Tocher, D.R., Bell, J.G., Dick, J.R., Torstensen, B.E., 2005. Fatty acid metabolism in Atlantic salmon (Salmo salar L.) hepatocytes, and influence of dietary vegetable oil. Biochim. Biophys. Acta 1734, 277–288. Tocher, D.R., Bell, J.G., Dick, J.R., Sargent, J.R., 1997. Fatty acyl desaturation in isolated hepatocytes from Atlantic salmon (Salmo salar): stimulation by dietary borage oil containing α-linolenic acid. Lipids 32, 1237–1247. Tocher, D.R., Bell, J.G., Henderson, R.J., Mc Ghee, F., Mitchell, D., Morris, P.C., 2000. Polyunsaturated fatty acid metabolism in Atlantic salmon (Salmo salar) undergoing parrsmolt transformation and the effects of dietary linseed and rapeseed oils. Fish Physiol. Biochem. 23, 59–73. Tocher, D.R., Fonseca-Madrigal, J., Bell, J.G., Dick, J.R., Henderson, R.J., Sargent, J.R., 2002a. Effects of diets containing linseed oil on fatty acid desaturation and oxidation in hepatocytes and intestinal enterocytes in Atlantic salmon (Salmo salar). Fish Physiol. Biochem. 26, 157–170. Tocher, D.R., Zheng, X., Schlechtriem, C., Hastings, N., Dick, J.R., Teale, A.J., 2006. Highly unsaturated fatty acid synthesis in marine fish: cloning, functional characterization, and nutritional regulation of fatty acyl Δ6 desaturase of Atlantic cod (Gadus morhua L.). Lipids 41 (11), 1003–1016. Torstensen, B.E., Lie, O., Froyland, L., 2000. Lipid metabolism and tissue composition in Atlantic salmon (Salmo salar L.): effects of capelin oil, palm oil and oleic acid oil, palm, sunflower oil as dietary lipid sources. Lipids 35, 653–664. Torstensen, B.E., Froyland, L., Lie, O., 2004. Replacing dietary fish oil with increasing levels of rapeseed oil and olive oil: effects on Atlantic salmon (Salmo salar L.) tissue and lipoprotein composition and lipogenic enzyme activities. Aquac. Nutr. 10, 175–192. Turchini, G.M., Mailer, R.J., 2010. Rapeseed (canola) oil and other monounsaturated fatty acid-rich vegetable oils. In: Turchini, G.M., Ng, W.K., Tocher, D.R. (Eds.), Fish Oil Replacement and Alternative Lipid Sources in Aquaculture Feeds Vols. 161–209. CRC Press; Taylor & Francis group, Boca Raton, FL, USA. Turchini, G.M., Francis, D.S., De Silva, S.S., 2007. Finishing diets stimulate compensatory growth: results of a study on Murray cod, Maccullochella peelii peelii. Aquac. Nutr. 13, 351–360. Turchini, G.M., Torstensen, B.E., Ng, W.K., 2009. Fish oil replacement in finfish nutrition. Rev. Aquac. 1, 10–57. Turchini, G.M., Francis, D.S., Russell, S.J.K., Andrew, J.S., 2011. Transforming salmonid aquaculture from a consumer to a producer of long chain omega-3 fatty acids. Foods Chem. 124, 609–614. Whelan, J.A., Russell, N.B., Whelan, M.A., 2003. A method for absolute quantification of cDNA using real-time PCR. J. Immunol. Methods 278, 261–269. Xu, S., Wang, S., Zhang, L., You, C., Li, Y., 2012. Effects of replacement of dietary fish oil with soybean oil on growth performance and tissue fatty acid composition in marine herbivorous teleost Siganus canaliculatus. Aquac. Res. 43, 1276–1286. Yıldız, M., Şener, E., 1997. Effect of dietary supplementation with soyabean oil, sunflower oil or fish oil on the growth of seabass (Dicentrarchus labrax L. 1758). Cah. Mediterr. 22, 225–234. Yılmaz, H.A., Eroldoğan, O.T., 2015. Effects of fish oil substitution with two different vegetable oil classes on fatty acid digestibility in juvenile European Sea bass, Dicentrarchus labrax. Turk. J. Fish. Aquat. Sci. 15, 1–12. http://dx.doi.org/10.4194/ 1303-2712-v15-1-01. Zheng, X., Seiliez, I., Hastings, N., Tocher, D.R., Panserat, S., Dickson, C.A., Bergot, P., Teale, A.J., 2004. Characterization and comparison of fatty acyl D6S desaturase cDNAs from freshwater and marine teleost fish species. Comp. Biochem. Physiol. 139B, 69–279. Zheng, X., Torstensen, B.E., Tocher, D.R., Dick, J.R., Henderson, R.J., Bell, J.G., 2005. Environmental and dietary influences on highly unsaturated fatty acid biosynthesis and expression of fatty acyl desaturase and elongase genes in liver of Atlantic salmon (Salmo salar). Biochim. Biophys. Acta 1734, 13–24.