Effects of anoxia on survival and gene expression in Bactrocera dorsalis

Accepted Manuscript Effects of anoxia on survival and gene expression in Bactrocera dorsalis Yufang Deng, Fan Hu, Lili Ren, Xiwu Gao, Yuejin Wang PII: DOI: Reference:

S0022-1910(17)30447-X https://doi.org/10.1016/j.jinsphys.2018.04.004 IP 3774

To appear in:

Journal of Insect Physiology

Received Date: Revised Date: Accepted Date:

23 November 2017 28 March 2018 5 April 2018

Please cite this article as: Deng, Y., Hu, F., Ren, L., Gao, X., Wang, Y., Effects of anoxia on survival and gene expression in Bactrocera dorsalis, Journal of Insect Physiology (2018), doi: https://doi.org/10.1016/j.jinsphys. 2018.04.004

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Effects of anoxia on survival and gene expression in Bactrocera dorsalis

Yufang Deng a, Fan Hu a, Lili Ren b, Xiwu Gao a, Yuejin Wang a, b*

a

College of Plant Protection, China Agricultural University, Beijing, 100193, China.

b

Chinese Academy of Inspection and Quarantine, Beijing, 100029, China.

*Corresponding author: No.11 RongHua south road, Chinese Academy of Inspection and Quarantine, Beijing, 100029, China. Telephone number: 86-10-53897662 (O), 86-10-53897662 (FAX) Email: [email protected], [email protected]

Abstract The oriental fruit fly (Bactrocera dorsalis) larvae may commonly experience a hypoxia microenvironment and have evolved the ability to survive in the low oxygen condition with some physiological and biochemical mechanisms. However, little is known about the response of B. dorsalis to hypoxia or anoxia. In this study, the effect of anoxia on the survival of B. dorsalis was investigated. The results showed that the B. dorsalis larvae were quite tolerant to anoxia conditions and can tolerate up to 24h of anoxia exposure without a significant reduction in survival, 100% mortality was reached after 84h of anoxia exposure. The cDNA of hypoxia inducible factor (HIF) 1α and HIF-1β is 2912 and 3618 bp in length, encoding 766 and 648 amino acid residues, respectively. Both HIF-1α and HIF-1β contain conserved basic helix-loop-helix (bHLH) domain and Per-Arnt-Sim (PAS) domain. HIF-1α can be induced by hypoxia, whereas HIF-1β expression was not significantly changed with the oxygen concentration. Three major heat shock proteins (Hsps) expression increased significantly during anoxia and recovery and Hsp70 was the most responsive to anoxia. Four superoxide dismutase (SOD) genes expression were also up-regulated during anoxia exposure. These data suggest that B. dorsalis has a strategy to induce HIF-1α and HIF-1-responsive genes to survive in the low oxygen condition. Keywords: anoxia; hypoxia inducible factor 1α; hypoxia inducible factor 1β; Heat shock protein; Superoxide dismutase

1. Introduction O2 is vital for terrestrial insects to survive because it is essential for catabolic ATP generation (Ahn et al., 2013; Harrison et al., 2006). However, many insect species that live in low oxygen habitats such as high altitudes, aquatic ecosystems, ground burrows, and decaying organic matter during their life cycles are very tolerant to low level of oxygen and can recover from hours to days of hypoxia or anoxia (Basson and Terblanche, 2010; Cavallaro and Hoback, 2014; Hoback and Stanley, 2001; Michaud et al., 2011; Zhao et al., 2013). As one of the major insect pests in the Asia and the Pacific, the oriental fruit fly (Bactrocera dorsalis) which has high reproductive capacity, broad host range and wide climatic tolerance causes huge damage in fruit production every year (Clarke et al., 2005; Geib et al., 2014; Shen et al., 2011). The adults oviposit within the host tissues which the larvae can feed on after hatching. The larvae live in the fermenting fruits and thus need to compete with microorganisms for limited amounts of oxygen until pupation(Shen et al., 2011). As the larvae may commonly experience a hypoxia microenvironment, it raises the possibility that they have evolved the ability to survive in the low oxygen condition with some physiological and biochemical mechanisms. Insects have compensatory changes in spiracular opening and ventilation to keep the internal oxygen concentration in response to a short-term hypoxic condition (Harrison et al., 2006). But if this low oxygen condition lasts longer, insects would activate a vertebrate-like hypoxia-inducible factor pathway (Harrison et al., 2006; Solaini et al., 2010). Hypoxia inducible factor 1 (HIF-1), which consists of HIF-1α and HIF-1β subunits, is the major transcription factor that regulates the molecular response to low oxygen. Both HIF-1α and HIF-1β subunits belong to the basic helix-loop-helix/Per-Arnt-Sim (bHLH/PAS) protein family (Wang et al., 1995). The HIF-1α subunit is regulated by cellular O2 tension. Under normoxic conditions, the HIF-1α subunit can be hydroxylated by prolyl hydroxylases PHD2 and then bound by the von Hippel–Lindau (VHL) protein, which leads to the subsequent ubiquitination and degradation of HIF-1α (Semenza, 2012; Solaini et al., 2010). Under hypoxia condition, the PHD2 activity is inhibited, HIF-1α accumulates and forms a heterodimeric DNA-binding complex with HIF-1β, then binds to the hypoxia response element (HRE) on the promoter region of target genes and eventually activates HIF-1-responsive genes (Majmundar et al., 2010; Suzuki et al., 2017).

Many HIF-1-responsive genes in mammalian cells have been reported, including erythropoietin, vascular endothelial growth factor, glycolytic enzymes and glucose transporters (Agani et al., 2000; Forsythe et al., 1996; Semenza et al., 1994). However, the HIF-1-responsive genes in insects are poorly understood. There is evidence that HIF-1 can up-regulate Hsf transcription to induce genes encoding heat shock proteins (Hsps) in Drosophila melanogaster (Baird et al., 2006). Hsps act as molecular chaperones to ensure the proper folding of nascent polypeptides under unstressed conditions and also prevent aggregation or mediate targeted unfolding, disassembly under stressed conditions (Saibil, 2013). And they can be induced by several stresses, such as heat, cold, desiccation, anoxia and starvation (King and MacRae, 2015). According to the molecular weight of amino acid sequence and function, Hsps can be divided into Hsp60, Hsp70, Hsp90 family and the small heat shock proteins (King and MacRae, 2015; Saibil, 2013). In response to stresses, the up-regulation of Hsps is very important for cells to keep healthy. Low oxygen conditions can also induce several physiological and biochemical processes, including metabolic suppression, ionic and pH disturbances and oxidative damage during reoxygenation. To avoid oxidative damage during reoxygenation is the most significant issue in the tolerance of low oxygen (Bickler and Buck, 2007). The formation and removal of O2 are in balance under normal physiological conditions. But under stress conditions, the increased production of ROS cannot be scavenged by antioxidant systems, eventually resulting in oxidative damage to DNA, protein and lipid. Anoxia-tolerant animals have two general adaptive strategies: one is to constitutively express high levels of antioxidant defenses (Bickler and Buck, 2007); the other is to enhance the antioxidant capacity during anoxia to get ready for the ensuing oxidative stress during reoxygenation (Hermes-Lima et al., 2015). There are a variety of antioxidant enzymes involved in the antioxidant defenses, including superoxide dismutase (SOD), catalase (CAT), peroxidase (POX), and glutathione S-transferases (GST) (Hermes-Lima et al., 2015). Among these antioxidant enzymes, SOD is the first and most important parts of antioxidant defenses against ROS, which converts superoxide to H2O2 and O2。Three distinct classes of SOD have been found in the eukaryotes, including cytoplasmic Cu-ZnSOD, extracellular Cu-ZnSOD and mitochondrial MnSOD (Feng et al., 2015; Gao et al., 2013). They differ in their metal binding, cellular localization, structure, and primary function (Zelko et al., 2002). Genetic and transgenic

studies about SOD in model systems such as Saccharomyces cerevisiae, mouse and Drosophila melanogaster prove that SOD enzymes play a central role in regulating oxidative stress resistance (Landis and Tower, 2005). In this study, we investigated the effect of anoxia on the survival rate of the oriental fruit fly. To facilitate understanding of the molecular mechanisms in response to anoxia, two key regulatory genes (HIF-1α and HIF-1β) were cloned and the transcriptional expression level of these two genes, as well as three major Hsps and four SODs during anoxia and recovery were measured. 2. Materials and methods 2.1 Insect culture The B. dorsalis strain used in this study was collected originally from an orchard in Guangdong Province. Prior to this experiment, the flies had been maintained in the laboratory for approximately 10 generations to eliminate plastic traits derived from local environment heterogeneity and adaptation (Hu et al., 2014). Cultures of B. dorsalis were kept in an artificial climate chamber at 26±1°C and 60±5% RH, under a photoperiod of 14:10 (L:D) h. The method described by Tanaka was used for rearing larvae and adults (Tanaka et al., 1969). The third instar larvae (5 days old) were used in the following experiment. 2.2 Anoxic treatment To obtain anoxic conditions, a small ventilated cage was fabricated by replacing the top of a plastic cylinder (6 cm diameter × 5.5 cm high) with stiff metallic mesh (1 mm × 1 mm spacing). The mesh at the top allowed for free exchange of gas and a filter paper wetted with water was placed in the bottom to hold humidity when containing the larva. Batches of larvae (5 days old) were transferred to the small ventilated cage. Every three small ventilated cages were placed inside one plastic bag (Tedlar TD-401-3; 250 × 280mm, 0.05mm) that had barrier properties to O2 and CO2. Before sealing, the bags were filled with pure N2 (Wong-Corral et al., 2013). The levels of CO2 and O2 inside the plastic bags were monitored by a gas analyzer (Checkmate 3, Mocon, America). The oxygen content of the plastic bag was 0.213±0.062% (mean±SD), indicating that our treatment resulted in a severely anoxic environment. At this O2 level, 100% of larvae went into a coma after 6h. The larvae were exposed for 6, 9, 12, 15, 18 and 21h, respectively. After treatment,

the larvae were transferred to normoxia to record their recovery time. To assess the effect of anoxia on survival, the larvae were exposed for 24, 36, 42, 48, 60 and 72h, respectively. After the designated amount of time, the larvae were transferred to normoxia and allowed to develop to emergency. The individuals that failed to emerge were considered dead. For exposure time longer than 24h, gases in the plastic bags were replenished every 24h. Each treatment was replicated three times. 2.3 Total RNA extraction According to the results of recovery time after anoxia exposure, the 15h anoxia exposure treatment was selected for the following mechanism research. The control that collected prior to anoxia exposure, five samples of larvae that had been exposed for 3, 6, 9, 12 and 15h respectively, five samples of larvae that had been exposed for 15h and then allowed to recover in normoxic conditions for 15, 30, 45, 60 and 90min respectively were immediately frozen in the liquid nitrogen after treatment. Total RNA was extracted using a Trizol-based method (Invitrogen, Carlsbad, CA) according to the manufacturer’s instruction. RNA quantity and quality were confirmed by Nanodrop 2000 Spectrophotometer and RNA integrity was confirmed by electrophoresis. Total RNA was stored at −80°C until use. 2.4 Cloning of HIF-1α, HIF-1β from B. dorsalis The first-strand cDNA was synthesized using a PrimeScript® RT reagent Kit with gDNA Eraser (Perfect Real Time) (Takara, Dalian, China). To obtain the internal fragment of HIF-1α, HIF-1β from B. dorsalis, primers 1 and 2 for HIF-1α and primers 3 and 4 for HIF-1β were designed based on the transcriptome data of B. dorsalis. The PCR products were sequenced and verified. To obtain the full length of HIF-1α, HIF-1β from B. dorsalis, SMARTer RACE 5’/3’ Kit was used to perform both 5’- and 3’-rapid amplification of cDNA ends (RACE). For 5’ RACE, primers 5 and 6 were used for primary PCR respectively for HIF-1α and HIF-1β, and primers 7 and 8 were used for nested PCR. Similarly, for 3’ RACE, primers 9 and 10 for primary PCR and primers 11 and 12 for nested PCR respectively for HIF-1α and HIF-1β were used. All the PCR primers and reaction conditions are shown in Table 1 and Table 2, respectively. The RACE PCR products

were cloned into the linearized pRACE vector and sequenced. After obtaining the sequence information, the complete open reading frames were confirmed by long distance PCR using

primers 13 and 14 for HIF-1α, and primers 15 and 16 for HIF-1β. Table 1. Primers used for PCR Primer

Abbreviation

Primer sequences (5’-3’)

1

HIF-1α-F

TCTGTTTATAGTCGTCAG

2

HIF-1α-R

CATGAAAGATGATCGTG

3

HIF-1β-F

AACAARATGACNGCCTAYATC

4

HIF-1β-R

CCYTCYTTYTTBACWGT

5

HIF-1α-5’GSP

GATTACGCCAAGCTTCACCTTGGCCCTTGCTCAACACGGT

6

HIF-1β-5’GSP

GATTACGCCAAGCTTCTCGCGATCGTCAGGATGAATGTGT

7

HIF-1α-5’NGSP

GATTACGCCAAGCTTTCCTGTTCGAATCACCACCA

8

HIF-1β-5’NGSP

GATTACGCCAAGCTTACACGACCAGAATCACAAGACACCA

9

HIF-1α-3’GSP

GATTACGCCAAGCTTCGCCATCGGTCGCCCAATACCGC

10

HIF-1β-3’GSP

GATTACGCCAAGCTTCCCACCTGCAGTGCTTTAGCCCG

11

HIF-1α-3’NGSP

GATTACGCCAAGCTTTCTCTTCGGTTACAAGGCTGA

12

HIF-1β-3’NGSP

GATTACGCCAAGCTTACGTGGCACAGGAAATACAAGCA

13

HIF-1α-F-1

CGCTATCAACGCTCGCTCAA

14

HIF-1α-R-1

TTGCTTTGATCGCTTTCGCTG

15

HIF-1β-F-1

TCATTCTGGTCCGCACTACAC

16

HIF-1β-R-1

CGAAAGTGTATCCTGCGATGGT

Table 2. PCR amplification conditions Primer

Amplification conditions

1,2,3,4

94°C 3min; 94°C 30s, 44°C 30s, 72°C 1min 35cycles; 72°C 5min.

5,6,9,10

94°C 30, 72°C 3min 5cycles; 94°C 30s, 70°C 30s, 72°C 3min 5cycles; 94°C 30s, 68°C 30s, 72°C 3min, 20cycles.

7,8,11,12

94°C 30s, 60°C 30s, 72°C 3min, 25cycles; 72°C 5min.

13,14

94°C 1min; 98°C 10s, 60°C 15s, 68°C 3min 30cycles.

15,16

94°C 1min; 98°C 10s, 60°C 15s, 68°C 4min 30cycles.

2.5 Bioinformatics analysis and phylogenetic tree construction

The amino acid sequences of B. dorsalis HIF-1α and HIF-1β cDNAs were analyzed using a translator program which is available at the open reading frame finder on NCBI. The conserved domain was identified by an InterProScan sequence search. BLASTP was used to search for homologous sequences of B. dorsalis HIF-1α and HIF-1β. The phylogenetic tree was constructed by MEGA 7 using the neighbour-joining method. All of the positions that contained gaps and missing data were eliminated before phylogenetic analysis. 2.6 Quantitative real-time PCR All samples were tested for expression of mRNAs encoding HIF-1α, HIF-1β, Hsp60, Hsp70, Hsp90, SOD1-1, SOD1-2, SOD1-3, SOD2-1, with actin gene used as the reference gene. Primers for HIF-1α and HIF-1β were designed using the NCBI Primer-BLAST tool and all the other primers were obtained from the literature (Gao et al., 2013; Hu et al., 2014) (Table 3). Quantitative real-time PCR was performed with a ABI Prism 7900HT Sequence Detection System (Applied Biosystems, America) using the One Step SYBR® PrimeScript™ RT-PCR kit (Perfect Real Time) (Takara, Dalian, China) according to the protocol provided by the manufacturer. Each reaction was run in a 20uL volume containing 2uL of total RNA, 10uL of 2 × One Step SYBR RT-PCR Buffer 4, 0.8uL of PrimeScript 1 Step Enzyme Mix 2, 0.8uL of PCR Forward Primer, 0.8uL of PCR Reverse Primer, 0.4uL of ROX Reference Dye and 5.2uL of RNase Free dH 2O. The reaction conditions were as follows: 42°C for 5min, 95°C for 10s, followed by 40 cycles of 95°C for 5s, 60°C for 34s (collecting fluorescent signal). The 2-△△CT method was used to calculate the relative expression levels. Differences in expression levels were analyzed using analysis of variance.

Table 3. Primers used for qRT-PCR Gene

Primer sequences (5’-3’)

PCR efficiency (%)

R2

97.80

0.9957

97.65

1.0000

98.61

0.9999

101.02

0.9991

104.62

0.9982

97.14

0.9999

95.47

0.9990

108.98

0.9975

88.74

0.9990

91.69

0.9997

CTATTTCTGCGAATGGGGACC Hsp60 CAAGTGCGGGGATAATGGTTT ACCAGCATACTTCAATGATT Hsp70 TTCGTTAATGATTCGTAGCA CCCAGTTCGGTTGGTCAG Hsp90 TCGTTCTTGTCGGCTTCA CAAGGGCCAAGGTGAGACTT HIF-1α AGCTTGCTTGCCTCGTATTG GCCTATATCACTGAGCTTTCCGA HIF-1β GCTTGTATTTCCTGTGCCACG TCACCCGTAATAGTCACCGG SOD1-1 GCTGGCTTCAATATTGCCCA GTCAGTACTGGCGCACATTT SOD1-2 GCCCAAATCGTCGGTCAATT GCGGGTGATTTGGGCAATAT SOD1-3 CATCAATGCGGCTCTGTTCA GGCGGTCACATCAATCACTC SOD2-1 TGTAACCTAACCAGCCCCAG GTGTGATGGTTGGTATGGGA ACTIN GGCTGGGGAGTTGAAGGTTT 3. Results 3.1 Effect of anoxia on the survival of B. dorsalis To obtain detailed information about the impact of anoxia on the oriental fruit fly, the recovery time and the survival after anoxia exposure were investigated. All the larvae went into coma after 6h and could recover within 16min 37s ± 0:57s when transferred to normoxia. As anoxia exposure time became longer, it also took longer for larvae to recover. All the larvae gradually recovered

within 90min without injury after 15h anoxia exposure (Fig. 1A). The recovery rate at 15, 30, 45, 60 and 90min after 15h anoxia exposure was 0%, 13%, 57%, 97% and 100% respectively. Almost all the larvae recovered at 60min after 15h anoxia exposure. There is no significant difference between recovery rate at 60min and 90min. In order to set more observe time point with a modest pressure, the 15h anoxia exposure treatment was chosen for the following mechanism research. 120 anoxia 15h

Recovery (%)

100

80 60 40 20 0 15

30 45 60 Time to recovery (mins)

90

Fig. 1A The recovery rate of B. dorsalis after 15h anoxia exposure Each cage contained 10 third instar larvae, which were placed into the plastic bag and the air inside was displaced by nitrogen before sealing. After 15h anoxia exposure, the larvae were transferred to normoxia to recover. Recovery means the larvae wake up and start to move. The number of larvae that had recovered was recorded at 15, 30, 45, 60 and 90min after anoxia exposure. This experiment was repeated three times. All time points are shown as mean ± SE.

The survival rates of B. dorsalis after different durations of anoxia exposure were also investigated. As shown in Fig.1B, almost all the larvae can recover after 24h anoxia exposure. The survival rates significantly decreased along with the increase of anoxia exposure time. In the treatment groups of 42h and 48h anoxia exposure, the survival rates of larvae were 62% and 61% respectively. After longer anoxia exposure, the survival rates of 60h and 72h treatment groups were only 4% and 5% respectively. Finally, no individuals can survive after 84h anoxia exposure.

120

Survival (%)

100

a b

80

c

c

60 40 20

d

d

0 24

36 42 48 60 72 Anoxia exposure (hours)

84

Fig. 1B The survival of B. dorsalis after different durations of anoxia exposure Each cage contained 30 third instar larvae, which were placed into the plastic bag and the air inside was displaced by nitrogen before sealing. After the designated amount of time, the larvae were transferred to normoxia and allowed to develop to emergency. The individuals that failed to emerge were considered dead. The bars represent the means of survival rate. Different letters above the bars represent significant differences at P < 0.05, as determined by one-way analysis of variance.

3.2 Characterizations of HIF-1α, HIF-1β and sequence analysis Given that the HIF-1 is important in regulating cellular and systemic response to low oxygen, we cloned putative HIF-1α and HIF-1β subunits using RT-PCR and RACE techniques. The cDNA of B. dorsalis HIF-1α is 2912 bp in length (GenBank Accession No.: MG552486), which contains a 5’-untranslated region (5’UTR, 360bp), an open reading frame (ORF, 2301bp) encoding a polypeptide of 766 amino acid residues, and a 3’-untranslated region (3’UTR, 251bp) including a poly(A) signal sequence. The theoretical molecular weight and isoelectric point of B. dorsalis HIF-1α is approximately 87.8 KDa and 5.98, respectively. As expected, B. dorsalis HIF-1α contains one bHLH (aa 409 to 469) and two PAS domains (aa 515 to 581, 655-765). The deduced amino acid sequence of B. dorsalis HIF-1α was 43%, 42%, 41%, 72%, 63% homologous to that of Homo sapiens, Mus musculus, Danio rerio, Drosophila melanogaster, Ceratitis capitata. The cDNA of B. dorsalis HIF-1β is 3618 bp in length (GenBank Accession No.: MG552487), which contains a 5’UTR (388bp), an ORF (1947bp) encoding a polypeptide of 648 amino acid residues, and a 3’UTR (1283bp) including a common (AATAAA) polyadenylation signal upstream of the poly(A) tail.. The theoretical molecular weight and isoelectric point of B. dorsalis

HIF-1β is approximately 71.6 KDa and 6.56, respectively. As expected, B. dorsalis HIF-1β contains one bHLH (aa 13 to 72) and two PAS domains (aa 85 to 192 and aa 275-381). The deduced amino acid sequence of B. dorsalis HIF-1β was 45%, 43%, 63%, 74%, 93% homologous to that of Homo sapiens, Mus musculus, Danio rerio, Drosophila melanogaster, Ceratitis capitata. The phylogenetic tree demonstrates that HIF-1α and HIF-1β proteins from B. dorsalis grouped respectively with high bootstrap support in the lineage of other fruit flies. It suggests the high evolutionary conservation in their coding sequences.

Fig.2A Nucleic acid and deduced protein sequences of HIF-1α and HIF-1β from B. dorsalis A. Nucleic acid and deduced protein sequences of HIF-1α from B. dorsalis. B. Nucleic acid and deduced protein sequences of HIF-1β from B. dorsalis. The initiation codon (ATG) and termination codon (TAA) was bolded, the putative polyadenylation specification sequence (AATAAA) was boxed before the poly(A) stretch at the 3’ end. Both the bHLH domain and PAS domain were underlined.

Fig. 2B Phylogenetic analysis of HIF-1α and HIF-1β amino acid sequences from various species A. Phylogenetic analysis of HIF-1α amino acid sequences from various species. The reference sequences used for comparison and their GenBank accession numbers were as following: Mus musculus (NP_034561.2), Homo sapiens (NP_851397.1), Danio rerio (NP_001296971.1), Drosophila melanogaster (NP_001138129.1), Ceratitis capitata (XP_004534352.1). B. Phylogenetic analysis of HIF-1β amino acid sequences from various species. The reference sequences used for comparison and their GenBank accession numbers were as following: Mus musculus (XP_011238300.1), Homo sapiens (XP_016856784.1), Danio rerio (XP_009301213.1), Drosophila melanogaster (NP_731308.1), Ceratitis capitata (XP_004519805.1). The phylogenetic tree was constructed by MEGA 7 using the neighbour-joining method. Numbers at tree nodes refer to percentage bootstrap values after 1000 replicates.

3.3 Expression of HIF-1α and HIF-1β during anoxia and anoxia recovery

In order to explore the roles of anoxia-responsive gene, we measured expression patterns of these genes during anoxia and anoxia recovery. Changes in HIF-1α and HIF-1β mRNA expression levels in B. dorsalis larvae during anoxia and anoxia recovery are shown in the Fig.3. The results showed that HIF-1α mRNA level increased significantly after 3h of anoxia exposure and soon declined to the level seen in the control. After return to normoxia, HIF-1α mRNA level increased immediately and maintained this level for 30min. These data indicate that HIF-1α is inducible at the early stage of anoxia and anoxia recovery. Compared to HIF-1α, HIF-1β mRNA level was not significantly changed at most time of anoxia and anoxia recovery. It is worth noting that both HIF-1α and HIF-1β mRNA levels reduced to about 0.50-fold of the control at the late stage of recovery.

Fig.3 Expression of HIF-1α and HIF-1β during anoxia and anoxia recovery CK means the control, h means hours of anoxia, min means mins of recovery. A. Changes in HIF-1α mRNA expression levels in B. dorsalis larvae during anoxia and anoxia recovery. B. Changes in HIF-1β mRNA expression levels in B. dorsalis larvae during anoxia and anoxia recovery. Vertical value represents the relative expression fold of the gene compared with the control. Different letters above the bars represent significant differences at P < 0.05, as determined by one-way analysis of variance.

3.4 Expression of genes encoding Hsps during anoxia and anoxia recovery Expression levels of three major Hsps mRNA during anoxia and anoxia recovery are shown in

the Fig.4, including Hsp60, Hsp70 and Hsp90. The expression of Hsp60, Hsp70 and Hsp90 increased significantly during anoxia and anoxia recovery. These results indicate that Hsp60, Hsp70 and Hsp90 were induced during anoxia and anoxia recovery. Hsp70 was the most responsive to anoxia, which increased constantly during anoxia and anoxia recovery. The highest expression level reached 735.89-fold of the control at 90min after recovery. Compared to Hsp70, Hsp60 and Hsp90 showed little response to anoxia. The highest expression level of Hsp60 reached after 3h of anoxia exposure (2.33-fold) and then declined to 1.50-fold of control. After return to normoxia, the expression level of Hsp60 was little changed. The Hsp90 expression pattern during anoxia was very similar to that of Hsp60. Upon return to normoxia, the expression level of Hsp90 decreased to the level seen in the control immediately and then increased. The highest expression level of Hsp90 reached 3.55-fold at 90min after recovery.

Fig.4 Expression of genes encoding Hsps during anoxia and anoxia recovery CK means the control, h means hours of anoxia, min means mins of recovery. A. Changes in Hsp60 mRNA

expression levels in B. dorsalis larvae during anoxia and anoxia recovery. B. Changes in Hsp70 mRNA expression levels in B. dorsalis larvae during anoxia and anoxia recovery. C. Changes in Hsp90 mRNA expression levels in B. dorsalis larvae during anoxia and anoxia recovery. Vertical value represents the relative expression fold of the gene compared with the control. Different letters above the bars represent significant differences at P < 0.05, as determined by one-way analysis of variance.

3.5 Expression of genes encoding SODs during anoxia and anoxia recovery There are four SODs gene measured in this study, including SOD1-1, SOD1-2, SOD1-3 and SOD2-1. SOD1-1, SOD1-2 and SOD1-3 belong to the Cu-ZnSOD family. SOD2-1 belongs to the Mn-SOD family (Gao et al., 2013). The expression patterns of these four SODs during anoxia were very similar (Fig.5). The expression level decreased to the level observed in the control after an initial increase and then increased significantly. The highest expression level all occurred after 15h anoxia exposure and increased by about 1.09-fold, 0.62-fold, 0.78-fold, 1.70-fold respectively. After return to normoxia, only SOD1-2 maintained this high level of expression and other SODs gene reverted to the level observed in the control immediately. In the rest time of recovery, SOD1-1 and SOD2-1 expression didn’t changed significantly whereas SOD1-3 expression increased significantly.

Fig.5 Expression of genes encoding SODs during anoxia and anoxia recovery CK means the control, h means hours of anoxia, min means mins of recovery. A. Changes in SOD1-1 mRNA expression levels in B. dorsalis larvae during anoxia and anoxia recovery. B. Changes in SOD1-2 mRNA expression levels in B. dorsalis larvae during anoxia and anoxia recovery. C. Changes in SOD1-3 mRNA expression levels in B. dorsalis larvae during anoxia and anoxia recovery. D. Changes in SOD2-1 mRNA expression levels in B. dorsalis larvae during anoxia and anoxia recovery. Vertical value represents the relative expression fold of the gene compared with the control. Different letters above the bars represent significant differences at P < 0.05, as determined by one-way analysis of variance.

4. Discussion

In this study, we investigate the effect of anoxia on the survival rate of B. dorsalis. The larvae can tolerate up to 24h of anoxia exposure without a significant reduction in survival, 100% mortality was reached after 84h of anoxia exposure. Compare to other hypoxia-tolerant insects, the larvae of B. dorsalis are quite tolerant of anoxia. Daphnia magna and Drosophila melanogaster are hypoxia-tolerant invertebrate models for the study of oxygen-responsive genes and genomes (Gorr, 2004). D. magna adults can endure anoxia for a few hours without any damages and survive up to 24 h of anoxia, while D. melanogaster adults can survive up to 12 h and larvae survive up to 4 h of anoxia (Callier et al., 2015; Krishnan et al., 1997; Paul et al., 1998). Obviously, the larvae of B. dorsalis appear to have stronger adaptability and tolerance to low oxygen conditions. Previous studies showed that both D. magna and D. melanogaster can express HIF and make use of vertebrate-like oxygen sensing pathway to survive in hypoxia (Gorr, 2004). Different from mammalian, they have a regulated and reversible metabolic depression to balance ATP synthesis and demand. For example, the adults of D. melanogaster can reduce ATP need and enhance survival through immediate development of anoxic stupor (Callier et al., 2015). Similarily, this phenomenon was also observed in the larvae of B. dorsalis. The larvae of B. dorsalis become immobile after 6 h anoxia exposure and have a developmental delay equal to the duration of the exposure. Although the hypoxia-tolerant mechanism is unknown, the larvae of B. dorsalis may have same vertebrate-like oxygen sensing pathway in responds to low oxygen condition. We also first report the molecular cloning and characterization of HIF-1α and HIF-1β cDNAs from B. dorsalis. Both HIF-1α and HIF-1β have conserved bHLH domain and PAS domain. It is known that the bHLH region is responsible for DNA binding and dimerization, and the PAS domains are involved in interactions with other proteins and dimerization specificity (Fribourgh and Partch, 2017). It is suggested that B. dorsalis HIF-1α and HIF-1β may have similar functions in adaptation to hypoxia as in other vertebrate species. The bHLH region of B. dorsalis HIF-1β is near the N terminus, a feature common to all bHLH-PAS proteins (Wu and Rastinejad, 2017), followed closely by the PAS domain, and then glutamine-rich C-terminal domains. Interestingly, the bHLH region of B. dorsalis HIF-1α is near the C terminus and followed closely by the PAS domain. The N terminus of B. dorsalis HIF-1α contains numerous glutamine-rich sequences. It is postulated that glutamine-rich sequences function as transcriptional activation domains (Gemayel

et al., 2015). This suggesting HIF-1α of B. dorsalis may be different from vertebrate in sensitivity to hypoxia. The regulation of the HIF-1α is generally considered to be mainly controlled by oxygen at a post-translational level (Agani et al., 2000; Jiang et al., 1996). It seems that the HIF-1α mRNA is constitutively synthesized and not affected by hypoxia. Since the identification of human HIF-1, more and more homologous genes have been characterized in nematodes, insects, crustaceans, fishes, and mammals (Ahn et al., 2013; Chen et al., 2012; Jiang et al., 2001; Li and Brouwer, 2007; Nambu et al., 1996; Terova et al., 2008; Wang et al., 1995). There are some reports suggesting that HIF-1α can be induced by hypoxia. In Micropogonias undulatus, a hypoxia-tolerant teleost fish, the expression of HIF-1α mRNA was significantly increased after 3 days, 1 week, and 3 weeks of hypoxia (Rahman and Thomas, 2007). In Crassostrea gigas, the expression of HIF-1α mRNA was induced by anoxia exposure and HIF-1α mRNA was also up-regulated after recovery from hypoxia (Kawabe and Yokoyama, 2012). In Eurosta solidaginis, the expression of HIF-1α mRNA increased by 3-fold under a nitrogen gas atmosphere (Morin et al., 2005). In the present study, we presented the first detailed descriptions of expression profile of HIF-1α mRNA during anoxia and anoxia recovery in B. dorsalis. The present results demonstrate that the expression of HIF-1α mRNA was up-regulated at the early stage of anoxia and anoxia recovery. Current view of how changes in oxygen availability during anoxia and reoxygenation propose that as oxygen concentration declines from normoxia to anoxia or rises from anoxia to normoxia, cell experience hypoxia at the early stage (Hermes-Lima et al., 2015). Under hypoxic or anoxia conditions, the global translation rates decrease to 50% of those observed under normoxic conditions (Spriggs et al., 2010). Despite an overall suppression of the rates of transcription and translation, the translation of mammalian HIF-1α increased during hypoxia (Spriggs et al., 2010). It has been proposed that HIF-1α mRNA contains an Internal Ribosome Entry Site (IRES) in the large size of 5’UTR which allows HIF-1α continue expression in a low oxygen condition (Lang et al., 2002). Presumably, HIF-1α mRNA of B. dorsalis also contains IRES in the 5’UTR. Thus, the transcription and translation of HIF-1α increased at the early stage of anoxia and recovery. In addition, HIF-1β mRNA is not affected by hypoxia. This study showed that HIF-1β expression was not significantly changed according to the oxygen concentration at most time during anoxia

and recovery, which is in compliance with previous studies (Guo et al., 2008). Up-regulation of Hsps is critical for adaptation to low oxygen levels and enduring the oxidative stress of reoxygenation (Baird et al., 2006). The protective role of Hsps under hypoxic conditions has been studied extensively in vivo as well as in vitro models (Azad et al., 2011; Giffard et al., 2004; Williamson et al., 2008; Yeh et al., 2010). The present study provides the first detailed descriptions of expression profiles of three major Hsps mRNA during anoxia and anoxia recovery in B. dorsalis. The present results demonstrate that expression of three major Hsps mRNA significantly increased during anoxia and anoxia recovery. Hsps are known to be regulated by heat shock factor (Hsf), which is in a monomeric state when cells are unstressed. Cellular stress can induce trimerization of Hsf and thus eventually activates transcription of Hsps (Westwood et al., 1991). However, accumulating experimental evidence demonstrate that there is an unexpected regulatory link between the oxygen-sensing and heat shock pathways. In a recent research, a new HIF-1 pathway was reported in D. melanogaster. Two HREs were found in the second intron of the Hsf gene and HIF-1 could activate transcription of Hsps through the binding of these two HREs in the Hsf intron (Baird et al., 2006). Although the underlying mechanism during anoxia and anoxia recovery in B. dorsalis is unclear, it is possible a similar mechanism that the transcriptional levels of Hsps be regulated by HIF-1 may also exist in B. dorsalis. Among these three major Hsps, Hsp70 was the most responsive one, the expression of which increased several hundred fold during anoxia and anoxia recovery. By contrast, Hsp60 and Hsp90 showed little response. Hsp70 is an important component of the organelle translocation system on both sides of the membrane, which help translocate the substrate proteins through a “trapping” and “pulling” mechanism (Saibil, 2013; Williamson et al., 2008). The cytoprotective effect of Hsp70 during low oxygen conditions has been reported in many researches. In mammal, induction of Hsp70 protects renal and brain cells from ischemic injuries (Giffard et al., 2004; Lu et al., 2002). In D. melanogaster, overexpression of Hsp70 in hemocytes remarkably improves survival of flies under severe hypoxia (Azad et al., 2011). Although the exact mechanism of the protection is not fully understood, Hsp70 plays quite an important role in hypoxia tolerance. Accumulating evidence has suggested that the cytoprotective effect of Hsp70 is related to the reduction of intracellular ROS (Chong et al., 1998; Guo et al., 2007; Xu et al., 2009). In a recent research,

overexpression of Hsp70 can enhance import of antioxidant defense constituents into the mitochondrion, for example MnSOD (Williamson et al., 2008). This finding suggest that enhanced expression of Hsp70 may be related to the increase of activities of antioxidant enzymes, thus provide a survival advantage when exposed to hypoxia. In the present study, we also determined expression patterns of four SODs during anoxia and anoxia recovery. The results indicate that all four SODs were upregulated during anoxia and SOD1-2 and SOD1-3 increased significantly during recovery. Our findings are consistent with the hypothesis that Hsp70 is involved in increasing activities of antioxidant enzymes. Although the effects of hypoxia on metabolism are not addressed in this study, metabolic versatility is required for insect to adapt to limiting oxygen (Li et al., 2013). When O2 supply is insufficient, oxidative metabolism can not meet ATP demand. Insects switch at least partially to anaerobic pathways for ATP production (Harrison et al., 2018). For example, the metabolic rate of Drosophila melanogaster at a PO2 of 0.1kPa was reduced 10-fold relative to normoxic levels (Van Voorhies, 2009). Many insect species yield lactate and alanine as anaerobic end products, but other species produce various kinds of other products during hypoxia (Feala et al., 2007). The high rate of anaerobic end products accumulation would cause changes in intracellular pH, which affect protein structure and compromise homeostasis, eventually leading to rapid death (Callier et al., 2015). So the ability to tolerate hypoxia also strongly depends on the ability to balance pH, while maintaining ATP production (Callier et al., 2015; Feala et al., 2007). The wide diversity of insect biochemistry suggests that exotic pathways for anaerobic energy production may also exist in B. dorsalis. The metabolic basis for hypoxia tolerance in B. dorsalis probably would be a focus of future research. In summary, HIF-1α can be induced by hypoxia, whereas HIF-1β expression was not significantly changed with the oxygen concentration. The expression patterns of HIF-1-responsive genes reveal that the expression of three major Hsps increased significantly during anoxia and anoxia recovery, Hsp70 was the most responsive to anoxia. Four SOD genes expression were also up-regulated during anoxia exposure. These data suggest that B. dorsalis has a strategy to induce HIF-1α and HIF-1-responsive genes to survive in the low oxygen condition. B. dorsalis may be a good model for studing molecular responses to hypoxia. The molecular cloning and

characterization of HIF-1α and HIF-1β also provide new insights into the genetic basis of differences in hypoxia tolerances. Acknowledge This work was supported by the National Key Research and Development Program (2015BAD08B02). Abbreviations HIF, hypoxia inducible factor; bHLH, basic helix-loop-helix; PAS, Per-Arnt-Sim; Hsp, heat shock protein; SOD, superoxide dismutase; HIF-1, Hypoxia inducible factor 1; VHL, von Hippel–Lindau; HRE, hypoxia response element; SOD, superoxide dismutase; CAT, catalase; POX, peroxidase; GST, glutathione S-transferases; RACE, rapid amplification of cDNA ends; ORF, open reading frame; 3’UTR, 3’-untranslated region; 5’UTR, 5’-untranslated region; IRES Internal Ribosome Entry Site; Hsf ,heat shock factor. Reference Agani, F.H., Pichiule, P., Chavez, J.C., LaManna, J.C., 2000. The role of mitochondria in the regulation of hypoxia-inducible factor 1 expression during hypoxia. Journal of Biological Chemistry 275, 35863-35867. Ahn, J.-E., Zhou, X., Dowd, S.E., Chapkin, R.S., Zhu-Salzman, K., 2013. Insight into hypoxia tolerance in cowpea bruchid: metabolic repression and heat shock protein regulation via hypoxia-inducible factor 1. PloS One 8, e57267. Azad, P., Ryu, J., Haddad, G.G., 2011. Distinct role of Hsp70 in Drosophila hemocytes during severe hypoxia. Free Radical Biology and Medicine 51, 530-538. Baird, N.A., Turnbull, D.W., Johnson, E.A., 2006. Induction of the heat shock pathway during hypoxia requires regulation of heat shock factor by hypoxia-inducible factor-1. Journal of Biological Chemistry 281, 38675-38681. Basson, C.H., Terblanche, J.S., 2010. Metabolic responses of Glossina pallidipes (Diptera: Glossinidae) puparia exposed to oxygen and temperature variation: implications for population dynamics and subterranean life. Journal of Insect Physiology 56, 1789-1797. Bickler, P.E., Buck, L.T., 2007. Hypoxia tolerance in reptiles, amphibians, and fishes: life with variable oxygen availability. Annual Review of Physiology 69, 145-170.

Callier, V., Hand, S.C., Campbell, J.B., Biddulph, T., Harrison, J.F., 2015. Developmental changes in hypoxic exposure and responses to anoxia in Drosophila melanogaster. Journal of Experimental Biology 218, 2927-2934. Cavallaro, M., Hoback, W., 2014. Hypoxia tolerance of larvae and pupae of the semi-terrestrial caddisfly (Trichoptera: Limnephilidae). Annals of the Entomological Society of America 107, 1081-1085. Chen, N., Chen, L.P., Zhang, J., Chen, C., Wei, X.L., Gul, Y., Wang, W.M., Wang, H.L., 2012. Molecular characterization and expression analysis of three hypoxia-inducible factor alpha subunits, HIF-1α/2α/3α of the hypoxia-sensitive freshwater species, Chinese sucker. Gene 498, 81-90. Chong, K.-Y., Lai, C.-C., Lille, S., Chang, C., Su, C.-Y., 1998. Stable overexpression of the constitutive form of heat shock protein 70 confers oxidative protection. Journal of Molecular and Cellular Cardiology 30, 599-608. Clarke, A.R., Armstrong, K.F., Carmichael, A.E., Milne, J.R., Raghu, S., Roderick, G.K., Yeates, D.K., 2005. Invasive phytophagous pests arising through a recent tropical evolutionary radiation: the Bactrocera dorsalis complex of fruit flies. Annual Review of Entomology 50, 293-319. Feala, J.D., Coquin, L., McCulloch, A.D., Paternostro, G., 2007. Flexibility in energy metabolism supports hypoxia tolerance in Drosophila flight muscle: metabolomic and computational systems analysis. Molecular Systems Biology 3, 99-99. Feng, Y.-C., Liao, C.-Y., Xia, W.-K., Jiang, X.-Z., Shang, F., Yuan, G.-R., Wang, J.-J., 2015. Regulation of three isoforms of SOD gene by environmental stresses in citrus red mite, Panonychus citri. Experimental and Applied Acarology 67, 49-63. Forsythe, J.A., Jiang, B.-H., Iyer, N.V., Agani, F., Leung, S.W., Koos, R.D., Semenza, G.L., 1996. Activation of vascular endothelial growth factor gene transcription by hypoxia-inducible factor 1. Molecular and Cellular Biology 16, 4604-4613. Fribourgh, J.L., Partch, C.L., 2017. Assembly and function of bHLH–PAS complexes. Proceedings of the National Academy of Sciences 114, 5330-5332. Gao, X.M., Jia, F.X., Shen, G.M., Jiang, H.Q., Dou, W., Wang, J.J., 2013. Involvement of superoxide dismutase in oxidative stress in the oriental fruit fly, Bactrocera dorsalis: molecular

cloning and expression profiles. Pest Management Science 69, 1315-1325. Geib, S.M., Calla, B., Hall, B., Hou, S., Manoukis, N.C., 2014. Characterizing the developmental transcriptome of the oriental fruit fly, Bactrocera dorsalis (Diptera: Tephritidae) through comparative genomic analysis with Drosophila melanogaster utilizing modENCODE datasets. BMC Genomics 15, 942. Gemayel, R., Chavali, S., Pougach, K., Legendre, M., Zhu, B., Boeynaems, S., van der Zande, E., Gevaert, K., Rousseau, F., Schymkowitz, J., Babu, M.M., Verstrepen, Kevin J., 2015. Variable Glutamine-Rich Repeats Modulate Transcription Factor Activity. Molecular Cell 59, 615-627. Giffard, R.G., Xu, L., Zhao, H., Carrico, W., Ouyang, Y., Qiao, Y., Sapolsky, R., Steinberg, G., Hu, B., Yenari, M.A., 2004. Chaperones, protein aggregation, and brain protection from hypoxic/ischemic injury. Journal of Experimental Biology 207, 3213-3220. Gorr, T.A., 2004. Daphnia and Drosophila: two invertebrate models for O2 responsive and HIF-mediated regulation of genes and genomes, International Congress Series. Elsevier, pp. 55-62. Guo, S., Bragina, O., Xu, Y., Cao, Z., Chen, H., Zhou, B., Morgan, M., Lin, Y., Jiang, B.H., Liu, K.J., 2008. Glucose up-regulates HIF-1α expression in primary cortical neurons in response to hypoxia through maintaining cellular redox status. Journal of Neurochemistry 105, 1849-1860. Guo, S., Wharton, W., Moseley, P., Shi, H., 2007. Heat shock protein 70 regulates cellular redox status by modulating glutathione-related enzyme activities. Cell Stress & Chaperones 12, 245-254. Harrison, J., Frazier, M.R., Henry, J.R., Kaiser, A., Klok, C., Rascón, B., 2006. Responses of terrestrial insects to hypoxia or hyperoxia. Respiratory Physiology & Neurobiology 154, 4-17. Harrison, J.F., Greenlee, K.J., Verberk, W.C., 2018. Functional hypoxia in insects: definition, assessment, and consequences for physiology, ecology, and evolution. Annual Review of Entomology 63. Hermes-Lima, M., Moreira, D.C., Rivera-Ingraham, G.A., Giraud-Billoud, M., Genaro-Mattos, T.C., Campos, É.G., 2015. Preparation for oxidative stress under hypoxia and metabolic depression: revisiting the proposal two decades later. Free Radical Biology and Medicine 89, 1122-1143. Hoback, W.W., Stanley, D.W., 2001. Insects in hypoxia. Journal of Insect Physiology 47, 533-542.

Hu, J.-t., Chen, B., Li, Z.-h., 2014. Thermal plasticity is related to the hardening response of heat shock protein expression in two Bactrocera fruit flies. Journal of Insect Physiology 67, 105-113. Jiang, B.-H., Semenza, G.L., Bauer, C., Marti, H.H., 1996. Hypoxia-inducible factor 1 levels vary exponentially over a physiologically relevant range of O2 tension. American Journal of Physiology-Cell Physiology 271, C1172-C1180. Jiang, H., Guo, R., Powell-Coffman, J.A., 2001. The Caenorhabditis elegans hif-1 gene encodes a bHLH-PAS protein that is required for adaptation to hypoxia. Proceedings of the National Academy of Sciences 98, 7916-7921. Kawabe, S., Yokoyama, Y., 2012. Role of hypoxia-inducible factor α in response to hypoxia and heat shock in the Pacific oyster Crassostrea gigas. Marine Biotechnology 14, 106-119. King, A.M., MacRae, T.H., 2015. Insect heat shock proteins during stress and diapause. Annual Review of Entomology 60, 59-75. Krishnan, S.N., Sun, Y.-a., Mohsenin, A., Wyman, R.J., Haddad, G.G., 1997. Behavioral and electrophysiologic responses of Drosophila melanogaster to prolonged periods of anoxia. Journal of Insect Physiology 43, 203-210. Landis, G.N., Tower, J., 2005. Superoxide dismutase evolution and life span regulation. Mechanisms of Ageing and Development 126, 365-379. Lang, K.J., Kappel, A., Goodall, G.J., 2002. Hypoxia-inducible factor-1α mRNA contains an internal ribosome entry site that allows efficient translation during normoxia and hypoxia. Molecular Biology of the Cell 13, 1792-1801. Li, T., Brouwer, M., 2007. Hypoxia-inducible factor, gsHIF, of the grass shrimp Palaemonetes pugio: molecular characterization and response to hypoxia. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology 147, 11-19. Li, Y., Padmanabha, D., Gentile, L.B., Dumur, C.I., Beckstead, R.B., Baker, K.D., 2013. HIF- and Non-HIF-Regulated Hypoxic Responses Require the Estrogen-Related Receptor in Drosophila melanogaster. PLoS Genetics 9, e1003230. Lu, A., Ran, R., Parmentier‐Batteur, S., Nee, A., Sharp, F.R., 2002. Geldanamycin induces heat Functional Hypoxia in Insects shock proteins in brain and protects against focal cerebral ischemia. Journal of Neurochemistry 81, 355-364.

Majmundar, A.J., Wong, W.J., Simon, M.C., 2010. Hypoxia-Inducible Factors and the Response to Hypoxic Stress. Molecular Cell 40, 294-309. Michaud, M.R., Teets, N.M., Peyton, J.T., Blobner, B.M., Denlinger, D.L., 2011. Heat shock response to hypoxia and its attenuation during recovery in the flesh fly, Sarcophaga crassipalpis. Journal of Insect Physiology 57, 203-210. Morin, P., McMullen, D.C., Storey, K.B., 2005. HIF-1α involvement in low temperature and anoxia survival by a freeze tolerant insect. Molecular and Cellular Biochemistry 280, 99-106. Nambu, J.R., Chen, W., Hu, S., Crews, S.T., 1996. The Drosophila melanogaster similar bHLH-PAS gene encodes a protein related to human hypoxia-inducible factor 1α and Drosophila single-minded. Gene 172, 249-254. Paul, R.J., Colmorgen, M., Pirow, R., Chen, Y.-H., Tsai, M.-C., 1998. Systemic and metabolic responses in Daphnia magna to anoxia. Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology 120, 519-530. Rahman, M.S., Thomas, P., 2007. Molecular cloning, characterization and expression of two hypoxia-inducible factor alpha subunits, HIF-1α and HIF-2α, in a hypoxia-tolerant marine teleost, Atlantic croaker (Micropogonias undulatus). Gene 396, 273-282. Saibil, H., 2013. Chaperone machines for protein folding, unfolding and disaggregation. Nature reviews Molecular cell biology 14, 630-642. Semenza, G.L., 2012. Hypoxia-inducible factors in physiology and medicine. Cell 148, 399-408. Semenza, G.L., Roth, P.H., Fang, H.-M., Wang, G.L., 1994. Transcriptional regulation of genes encoding glycolytic enzymes by hypoxia-inducible factor 1. Journal of Biological Chemistry 269, 23757-23763. Shen, G.-M., Dou, W., Niu, J.-Z., Jiang, H.-B., Yang, W.-J., Jia, F.-X., Hu, F., Cong, L., Wang, J.-J., 2011. Transcriptome analysis of the oriental fruit fly (Bactrocera dorsalis). PloS One 6, e29127. Solaini, G., Baracca, A., Lenaz, G., Sgarbi, G., 2010. Hypoxia and mitochondrial oxidative metabolism. Biochimica et Biophysica Acta (BBA)-Bioenergetics 1797, 1171-1177. Spriggs, K.A., Bushell, M., Willis, A.E., 2010. Translational regulation of gene expression during conditions of cell stress. Molecular Cell 40, 228-237. Suzuki, N., Gradin, K., Poellinger, L., Yamamoto, M., 2017. Regulation of hypoxia-inducible gene

expression after HIF activation. Experimental Cell Research 356, 182-186. Tanaka, N., Steiner, L., Ohinata, K., Okamoto, R., 1969. Low-Cost Larval Rearing Medium for Mass Production of Oriental and Mediterranean Fruit Flies 1 2. Journal of Economic Entomology 62, 967-968. Terova, G., Rimoldi, S., Corà, S., Bernardini, G., Gornati, R., Saroglia, M., 2008. Acute and chronic hypoxia affects HIF-1α mRNA levels in sea bass (Dicentrarchus labrax). Aquaculture 279, 150-159. Van Voorhies, W.A., 2009. Metabolic function in Drosophila melanogaster in response to hypoxia and pure oxygen. Journal of Experimental Biology 212, 3132-3141. Wang, G.L., Jiang, B.-H., Rue, E.A., Semenza, G.L., 1995. Hypoxia-inducible factor 1 is a basic-helix-loop-helix-PAS heterodimer regulated by cellular O2 tension. Proceedings of the National Academy of Sciences 92, 5510-5514. Westwood, J.T., Clos, J., Wu, C., 1991. Stress-induced oligomerization and chromosomal relocalization of heat-shock factor. Nature 353, 822-827. Williamson, C.L., Dabkowski, E.R., Dillmann, W.H., Hollander, J.M., 2008. Mitochondria protection from hypoxia/reoxygenation injury with mitochondria heat shock protein 70 overexpression. American Journal of Physiology-Heart and Circulatory Physiology 294, H249-H256. Wong-Corral, F.J., Castañé, C., Riudavets, J., 2013. Lethal effects of CO 2-modified atmospheres for the control of three Bruchidae species. Journal of Stored Products Research 55, 62-67. Wu, D., Rastinejad, F., 2017. Structural characterization of mammalian bHLH-PAS transcription factors. Current Opinion in Structural Biology 43, 1-9. Xu, L., Voloboueva, L.A., Ouyang, Y., Giffard, R.G., 2009. Overexpression of mitochondrial Hsp70/Hsp75 in rat brain protects mitochondria, reduces oxidative stress, and protects from focal ischemia. Journal of Cerebral Blood Flow and Metabolism 29, 365-374. Yeh, C.-H., Hsu, S.-P., Yang, C.-C., Chien, C.-T., Wang, N.-P., 2010. Hypoxic preconditioning reinforces HIF-alpha-dependent HSP70 signaling to reduce ischemic renal failure-induced renal tubular apoptosis and autophagy. Life Sciences 86, 115-123. Zelko, I.N., Mariani, T.J., Folz, R.J., 2002. Superoxide dismutase multigene family: a comparison

of the CuZn-SOD (SOD1), Mn-SOD (SOD2), and EC-SOD (SOD3) gene structures, evolution, and expression. Free Radical Biology and Medicine 33, 337-349. Zhao, D., Zhang, Z., Cease, A., Harrison, J., Kang, L., 2013. Efficient utilization of aerobic metabolism helps Tibetan locusts conquer hypoxia. BMC Genomics 14, 631.

Highlights 

The B. dorsalis larvae were quite tolerant to anoxia conditions.



HIF-1α and HIF-1β were firstly cloned and characterizated in B. dorsalis.



HIF-1α can be induced by hypoxia, whereas HIF-1β expression was not changed.



Three major Hsps expression increased significantly during anoxia and recovery.



B. dorsalis has a strategy to survive in the low oxygen condition.