- Email: [email protected]
Effects of biochars and MWNTs on biodegradation behavior of atrazine by Acinetobacter lwoffii DNS32
STOTEN-21115; No of Pages 7 Science of the Total Environment xxx (2016) xxx–xxx
Contents lists available at ScienceDirect
Science of the Total Environment journal homepage: www.elsevier.com/locate/scitotenv
Effects of biochars and MWNTs on biodegradation behavior of atrazine by Acinetobacter lwoffii DNS32 Fan Yang a,b, Qun Jiang a, Moran Zhu a, Lulu Zhao a, Ying Zhang a,⁎ a b
School of Resources & Environment, Northeast Agricultural University, Harbin, 150030, China College of Science, Northeast Agricultural University, Harbin 150030, China
H I G H L I G H T S
G R A P H I C A L
A B S T R A C T
• BCs and CNTs have different effects on the biodegradation of atrazine. • BCs enhance bacteria viability and expressions of degradation gene than CNTs. • Cell membrane damage is a major factor reducing the degradation behavior of strain.
a r t i c l e
i n f o
Article history: Received 27 July 2016 Received in revised form 7 October 2016 Accepted 8 October 2016 Available online xxxx Keywords: Atrazine Carbon materials Biodegradation Viability Gene expression
a b s t r a c t Whether the biodegradation of atrazine by Acinetobacter lwoffii DNS32 can have a difference in the presence of two representative carbon materials (CMs), namely, biochars (BCs) and carbon nanotubes (CNTs) is explored, through investigating the influence of CMs on the biodegradation rate, the viability of bacteria and the expression of atrazine genes in aqueous medium. Multi-walled carbon nanotubes (MWNTs), biochars resulted from corn straws (C-BCs) and that made from banana peels (B-BCs) were chosen as the examples. Compared to the control in the absence of C-BCs, BBCs and MWNTs, the biodegradation efficiencies decrease from 95.3%, 101.8% and 94.8% to 82.6%, 41.8% and 31.1% as the concentrations of these materials increase from 10 to 100 mg/L, indicating that BCs have relatively lower toxicity on the biodegradation of atrazine than CNTs, which are agreement with the results of bacterial viability. Transmission electron microscope (TEM) images of Acinetobacter lwoffii DNS32 cells exposure to CMs at 50 mg/L show that the cell membrane can be destroyed at different levels after being exposed to various CMs, suggesting that the damage to the cell membrane induced by CMs is a substantial factor leading to the inactivation of bacteria, further decreasing the degradation rate and efficiency of bacteria. The enhanced bacterial growth and the up-regulation of degradation genes can stimulate the degradation rate to pre-adsorbed atrazine on the CMs. This study suggests that biodegradation of atrazine associated with CMs may depend on the carbon composition, structure and CM concentrations. The innovation point of this report is to compare the effects of biochars and CNTs on the degradation rate and activity of Acinetobacter lwoffii DNS32 and may help to further understand the environment effects of CMs. © 2016 Elsevier B.V. All rights reserved.
⁎ Corresponding author. E-mail address: [email protected] (Y. Zhang).
http://dx.doi.org/10.1016/j.scitotenv.2016.10.053 0048-9697/© 2016 Elsevier B.V. All rights reserved.
Please cite this article as: Yang, F., et al., Effects of biochars and MWNTs on biodegradation behavior of atrazine by Acinetobacter lwoffii DNS32, Sci Total Environ (2016), http://dx.doi.org/10.1016/j.scitotenv.2016.10.053
2
F. Yang et al. / Science of the Total Environment xxx (2016) xxx–xxx
1. Introduction As a novel soil amendment, biochar has received special attention for its great potential of soil remediation (Lehmann, 2007; Spokas et al., 2009). Biochar, produced from biomass pyrolysis under the partial or total absence of oxygen (Antal and M., 2003), has been suggested as a prospective “carbon-sink” material (Zavalloni et al., 2011). Biochar is widely used as soil amendment or adsorbent because of its high cation exchange capacity, high surface area (Liang et al., 2006), and aromatic and condensed structure (Kramer et al., 2004; Titirici et al., 2007), which makes it omnipresent in the environment. Carbon nanotubes (CNTs) are some of the most attractive nanomaterials due to their excellent performance (Tasis et al., 2006). CNTs can sorb organic matter in environment as same as biochars, resulting in reducing bioavailability (Towell et al., 2011) higher environmental risk they are. So it is necessary to know the cytotoxicity and environmental impacts of carbon materials for their future application. Biochar is a type of the most of stable carbon in the environment. It can exist in the environment for thousands of years due to the low biodegradation rate and oxidation rate. It can attribute to the abilities of improving the pH value of acidic soil since that the biochar could improve the soil quality (Van et al., 2010; Jeong et al., 2016) and absorbing nutrients from soil (Thies and Rilling, 2009; Kloss et al., 2012). In addition, the biochar can also alter biological community (Cui et al., 2016), which may affect the cycle of nutrients and soil structure, and thus raise crop yield indirectly. It could be degraded by microbes after a long-term in the environment. Hydrophobic organic molecules, formed by the bio-degradation of plant cell wall, may be involved in the protection of fresh biochar (Karhu et al., 2011). Plant roots are attracted towards biochar, and meanwhile take up phosphorus from degraded biochar particles. Biochars not only could provide a better condition for microbial growth and reproduction, but also could improve crop yields by affecting the microbial activity, structure of community and diversity of microbes. It has been reported that biochar can change the microbial biomass, but the change has different influence for different species. Meanwhile, the biochar can alter the soil condition, such as nutrition composition, pH value, moisture and so on, leading to the change of dominant species of soil microbes, and then change the community composition and structure (Novak et al., 2009; Steiner et al., 2007). The quantity of bacteria and species has been reported to increase significance than that without biochar (Simone et al., 2009; Robertso and Thorbum, 2006). In the other hand, the addition of biochar makes a significant reduction for diversity of paleozoic bacterial and fungus. So biochar may cause controversial effects on the ecological system, and further studies are needed for its potential environmental risk. CNTs are another one of important carbon materials. There have few studies to discuss the effects of biochar on degradation of functional microbes but some about the cytotoxicity of CNTs. CNTs cytotoxicity in environments is a complicated process connected with nanomaterial physicochemical properties and system ecology (Kang et al., 2009). And they may inhibit biodegradation activity by reducing bacterial activity. Kang et al. (Kang et al., 2008) reported that single-wall carbon nanotubes (SWNTs) display the highest cytotoxicity towards all types of bacteria tested in the study. MWNTs exhibit a milder toxicity in the early studies compared with SWNTs. Longer contact time increases cytotoxicity of CNTs. Cytotoxicity is contingent upon direct contact with the cell membrane. Shvedova and co-workers (Shvedova et al., 2003) have proved that different concentrations of no-purified SWNTs can cause different effects on human epidermal keratinocytes, such as strengthening the oxidation of free radicals in cells, making lower cell survival rate and changing cell morphological. The group of Xia (Xia et al., 2010) has revealed that the mineralization efficiencies of phenanthrene associated with MWNTs were significantly lower than those cultured with biochar, which implied that MWNTs with excellent adsorption capacity may lead to a greater decrease of bioavailability in the environment.
Biochars and CNTs are frequently available to adsorbing atrazine, which is a ubiquitous pollutant found everywhere, or used as immobilized carriers for bio-degradation of atrazine. It is believed that the strong interaction between atrazine, biochars or CNTs can greatly reduce the mobility, bioavailability and environmental risk of atrazine in environment (Vinturella et al., 2004; Ferguson et al., 2008). However, the effects of biochars on the biodegradation of organic contaminants and the difference of effects between CNTs and biochars on Acinetobacter lwoffii DNS32 degrading atrazine are still unclear. Therefore, the present study contributes to an understanding of the impacts of biochars and CNTs on the biodegradation of atrazine in water, and discussions of the potential environmental risk of biochars. Two kinds of typical biochars have been prepared, and named as C-BCs and BBCs, respectively. C-BCs are derived from corn straw and B-BCs are made from banana peels, and the preparation process can be introduced in detail later. The main objectives of this study are to examine the difference of biochars and CNTs on the biodegradation of atrazine, giving new insights into the related mechanisms. 2. Materials and methods 2.1. Materials Corn straws and banana peels were cleaned and air-dried before use. Corn straws after the pretreatment were directly placed in the center of an alumina tube inside a horizontal tube furnace. The reactor was purged with N2 several times to remove residual oxygen and/or moisture before being heated to 850 °C under N2 for 2 h. Banana peels were immersed with Zn(NO3)2·6H2O solution firstly and then crosslinked with furfuraldehyde and 2,6-Dichlorophenol before the pyrolysis (Lv et al., 2012). The conditions of pyrolysis was at 850 °C under N2 atmosphere with a heating rate of 10 °C/min and held for 2 h. MWNTs were purchased from Shenzhen Nanotech Port Co., Ltd., China. The morphology and structure of CMs were observed by using a scanning electron microscope (SEM, ZEISS SUPRA 40, Germany). Acinetobacter lwoffii DNS32 used in this study was provided by our laboratory (HuoSheng et al., 2012). The bacteria were cultured in inorganic medium containing 1.6 g/L K2HPO4, 0.4 g/L KH2PO4, 0.2 g/L MgSO4, 0.1 g/L NaCl, 3 g/L glucose and 100 mg/L atrazine, or in the Luria-Bertani (LB) medium containing 10 g/L tryptone, yeast powder 5 g/L, NaCl 10 g/L. Atrazine (99.7%) was purchased from Jiangsu Repont Pesticide Factory Co., Ltd., China. Other chemicals were of analytical grade or higher. 2.2. Preparation of the material stock solution Inoculums of 30 mg C-BCs, B-BCs and MWNTs were suspended in 30 mL of inorganic medium and were sonicated for 60 min. The suspension of materials was prepared to obtain the appropriate CM concentrations by diluting the solution, in order to avoid the change of the physical and chemical properties of materials. 2.3. Biodegradation of atrazine by Acinetobacter lwoffii DNS32 in the presence of various materials CMs were added to 50 mL of the mineral solution, in which the initial atrazine concentration was 100 mg/L, at crude CM concentrations of 10, 25, 50 and 100 mg/L. The test concentrations of these CMs were quoted from the reference reported some inhibitory effects on bacteria within the concentration range (Zhu et al., 2014). After 6 h vibrating, atrazine in the inorganic mediums had been reached the adsorption equilibrium (Xindecao, 2009). Then degradation was initiated by inoculating the flasks with 1% of the cell suspension at the initial cell density of approximately 105–106 cell/mL. The culturing conditions were at 30 °C by shaking at 125 rpm. All flasks were incubated in the dark to avoid photo-transformation of atrazine. Then, 5 mL of sample was withdrawn
Please cite this article as: Yang, F., et al., Effects of biochars and MWNTs on biodegradation behavior of atrazine by Acinetobacter lwoffii DNS32, Sci Total Environ (2016), http://dx.doi.org/10.1016/j.scitotenv.2016.10.053
F. Yang et al. / Science of the Total Environment xxx (2016) xxx–xxx
in every 6 h. Atrazine in the samples extracted with chloroform at a 1:1 (v/v) ratio after 5 min shaking in a separating funnel and then 1 μL of extracts was injected to a gas chromatograph (GC-14C, Shimadzu, JAPAN) to determine the concentration of atrazine, equipped with a fused silica chromatographic column (30 m × 0.53 mm) packed with 14% OV-1701 and a flame ionization detector (FID) with N2 being carrier gas. The atrazine concentration of the samples was calculated by comparing the recorded peak value which represented atrazine with those of standards. A set of systems without any materials were used as controls. All experiments were conducted in triplicate.
2.4. The bacterial viability cultured with various materials The medium containing C-BCs, B-BCs and MWNTs with the concentrations of 10, 25, 50 and 100 mg/L were autoclaved at 121 °C for 20 min. Then 1% of the cell suspension (same as above) was transferred to the conical flasks, and the bacteria were incubated with various materials in the LB medium 30 °C. Each experiment set was conducted in triplicate. After 12 h (in the LB medium) when cells were at the mid-exponential growth phase of the growth, the mixed liquids containing bacteria and CMs were vortexed for 1 min, and 1 mL of the mixed liquids were collected for the determination of the viability. The viability of the bacteria was determined by spread plate method. The samples were serially diluted with isotonic saline solution and spread with 100 μL of appropriate dilution onto the LB agar plate. Colonies were counted after 24 h incubation at 30 °C. The viability of Acinetobacter lwoffii DNS32 was defined as the percentage proportion of colony count of bacteria grown with CMs to that of the control without CMs.
2.5. Effects of materials on the expression of atrazine catabolism genes The catabolic activity of the cells was high during the early log phase. Therefore, after 24 h of incubation in minimal medium, 5 mL of the cells treated with various CMs at different concentration were harvested by centrifugation at 10,000 ×g for 5 min and immediately frozen in liquid nitrogen prior to storage at −80 °C until use for qPCR. The cDNA was got using AMV First Strand cDNA Synthesis Kit (SK2445). DNA traces were removed by treating the RNA with 2.5 U of RNase-free RQI DNase in the presence of 20 U/L of RNase inhibitor at 37 °C for 1 h. The RNA quality was checked on a 1% denative agarose gel, and the RNA quantity was calculated from absorption values that were measured at 260 nm using a Biophotometer (Eppendorf, Hamburg, Germany). Each RNA extract was diluted to 25 ng/μL using RNase-free water (0.5% DEPC, Sigma, Germany). Reverse transcription that was specific for target mRNA was performed according to the manufacturer's instructions (TransGen Biotech Co., China) using a random primer (Table 1). Real-time PCRs were conducted using an ABI Stepone plus Real-Time PCR System (ABI Co., USA). Detailed information is provided in the Table 1. The conditions of qPCR were 300 s at 95 °C for enzyme activation followed by 40 cycles of 30 s at 95 °C, 15 s at the optimal hybridization temperature (Table 1) and 15 s at 72 °C.
2.6. Characterization of CMs and bacteria The morphologies of CMs were characterized by a scanning electron microscope (SEM, JEOL JSM-6480). The images of bacterial cells are obtained by a transmission electron microscope (TEM, FEI Teccai G2STwin, Philips). The bacterial cells mixed with 50 mg/L suspensions of three different carbon materials were firstly dispersed in Luria-Berta medium for 12 h. Next, the as-prepared samples are placed on the copper micro grid drop by drop, and then are dyed using phosphotungstic acid for 40 s. After that, the cell can be applied to observe.
3
Table 1 Conditions of determinations of degradation gene expression. Primer 16S-F341:CCTACGGGAGGCAGCAG trzN-F: GTCCTCCTCCAGTCGCTCC atzB-F: CCCATCACCATTTTTTTCAGG atzC-F: GGGCAAGACGATTTATCGAA
16S-R518: ATTACCGCGGCTGCTGG 177bp trzN-R:AGAAGCCACCTTCGCTCTTG 178bp atzB-R: CATGGACACCACTGTGCTGTG 149bp atzC-R:TGGGCTGTGATTTAGTTGGG 165bp
Reaction component
Concentration
Volume(μL)
SybrGreen qPCR Master Mix Primer F (10 uM) Primer R (10 uM) ddH20 Template (cDNA) Total
2X 10 μM 10 μM
10 0.4 0.4 7.2 2 20 μL
Times and temperatures Thermal cycler
Each of 40 cycles Initial steps Melt
ABI Stepone plus Real-time PCR system
HOLD
Anneal
Extend Stepts of melt curve
CYCLE 15 s
3 min 95 °C
7s 95 °C
10 s 57 °C 72 °C
2.7. Data analysis Statistical analysis was performed using the OriginPro 8.5 and SPSS 19.0 including the significance analysis using the t-test. Difference was considered significant when the significance level was smaller than 0.05 (p b 0.05).
3. Results and discussion 3.1. Biodegradation of atrazine in the presence of CMs Fig. 1 shows the adsorption of atrazine by various carbon materials and the biodegradation by Acinetobacter lwoffii DNS32. The biodegradation rates are listed in Table 2 using first-order kinetics. The results implied that the adsorption had a few effects on biodegradation. Because the removal representation was linear (as showed in Table 1, R2 N 0.97). The atrazine biodegradation rate in the control without CMs was quite constant along the time regardless the atrazine concentration remaining (Fig. 1). If atrazine biodegradation rate significantly diminished at lower concentration (for instance, b 50 mg/L), the removal rate would not be constant and the removal representation should not be linear. Biodegradation of atrazine by Acinetobacter lwoffii DNS32 in the presence of CMs revealed the magnitude of the effects was limited by CM concentrations and types (Fig. 1, Table 2). Interestingly, there had significant differences between C-BCs, B-BCs and MWNTs towards the degradation behavior of atrazine. The biodegradation rates at various concentrations of C-BCs showed almost no obvious change, however, the rates of atrazine degradation were no less than the control when B-BCs and MMWNTs were added at a concentration of 10 mg/L and 25 mg/L, while when 50 mg/L and 100 mg/L of CNTs were added, atrazine was degraded much slower than the control. The same concentrations fitted at 50 and 100 mg/L, it can be observed that C-BCs had little effect on the degradation rate (i.e. 85.0% and 82.6%), while B-BCs and MWNTs decreased the biodegradation of atrazine by 35.9%, 58.2% for 50 mg/L and 47.6%, 68.9% for 100 mg/L, respectively (Fig. 1, Table 2). The results implied that biochar showed the milder effect on
Please cite this article as: Yang, F., et al., Effects of biochars and MWNTs on biodegradation behavior of atrazine by Acinetobacter lwoffii DNS32, Sci Total Environ (2016), http://dx.doi.org/10.1016/j.scitotenv.2016.10.053
4
F. Yang et al. / Science of the Total Environment xxx (2016) xxx–xxx
Fig. 1. Biodegradation of atrazine in the presence of various CM concentrations: C-BCs (A), B-BCs (B), MWNTs (C). The error bars represent the standard deviations from triplicate measurements.
biodegradation rates and efficiency of atrazine by microorganism, and the influence also determined the structure of biochars. Three materials (C-BCs, B-BCs and MWNTs) were selected because they had different carbon composition and structure. Generally, biochar is under the condition of limited oxygen pyrolysis of carbon-rich solid mixture, and usually contains a certain amount of black carbon, ash content, graphite and charcoal. A large number of aliphatic carbons transform into aromatic carbon, and the polymerization of aromatic carbon is usually formed by six carbon atoms during the carbonization process of biomass (Peng et al., 2016). While CNTs are belong to the fullerene that is made of graphite, with the diameter of 10–100 nm and the length of hundreds of micrometers. Some report has demonstrated that the viability of the common model bacteria would decrease when CNT concentration increased from 10 to 50 mg/L (Zhu et al., 2014), indicating that CNTs maybe reduce the microbial activity to control the biodegradation efficiency. Therefore, the viability of Acinetobacter lwoffii DNS32 will be measured later.
almost no toxicity to cell compared with B-BCs and MWNTs, even at high concentrations, implying that application of C-BCs have a lower environmental risk. The viability exposure to B-BCs after acid treatment was also evaluated in order to eliminate the effect of metal impurities introduced during the preparation progress. The result showed that BBCs after acid treatment reduce the viability of DNS32 by 21.8%, which was similar as B-BCs without treatment, indicating that metal impurities were not the major factor inhibiting the viability of DNS32 and the degradation behavior of atrazine in this experiment. Similar results have been reported by Song et al. (Zhu et al., 2016). To sum up, we conjecture that CMs with different carbon structures may have a remarkable effect on the microbial activity. The viability of microbe in the presence of CMs was also related to the species itself. Acinetobacter lwoffii DNS32 is a Gram-negative bacteria. Generally, Gram-negative bacteria are more resistant to nanoparticles than Gram-positive ones because of the complex outer membrane, which, in part, excludes the nanoparticles from attacking the bacteria (Hajipour et al., 2012).
3.2. The viability of Acinetobacter lwoffii DNS32 in the presence of CMs As seen from Fig. 2, the results of the bacterial viability in the presence of various CM concentrations have proved that the CM concentration had an obvious impact on the viability of Acinetobacter lwoffii DNS32. C-BCs, B-BCs and MWNTs at the concentration of 10 mg/L enhanced the bacterial viability by 14.5%, 6.6% and 12.3%, respectively, and at the concentration of 100 mg/L, C-BCs, B-BCs and MWNTs inhibited the microbial activity by 5.7%, 23.4% and 30.2%, respectively. These results indicated that low CM concentrations could enhance the growth of bacteria even higher. High concentrations of B-BC and MWNTs showed toxicity to microbial cells, which was consistent with that biodegradation of atrazine in Fig. 1. In addition, C-BCs exhibited
3.3. Characterization of CMs and Acinetobacter lwoffii DNS32 exposed to CMs In order to further explore the influence of CM structures on the degradation behavior, the morphology of CMs (Fig. 3) and degrading strain DNS32 cells after exposure to CMs (Fig. 4) were observed using SEM and TEM techniques, respectively. As shown in Fig. 3, C-BCs are consisted of
Table 2 Summary of the biodegradation rates of atrazine in the presence of different CMs.
C-BCs
B-BCs
MWNTS Control
c (mg/L)
k/k
10 25 50 100 10 25 50 100 10 25 50 100 0
0.953 0.961 0.850 0.826 1.018 0.863 0.641 0.418 0.948 0.801 0.524 0.311 1.000
control
R2 0.993 0.989 0.984 0.975 0.983 0.993 0.981 0.985 0.992 0.976 0.978 0.9744 0.995
Fig. 2. The viability of DNS32 contact with C-BCs, B-BCs and MWNTs. The cells suspension at the midexponential growth phase of the growth were spread with 100 μL of appropriate dilution onto the LB agar plate. Colonies were counted after 24 h incubation at 30 °C. The error bars represent the standard deviations from triplicate measurements.
Please cite this article as: Yang, F., et al., Effects of biochars and MWNTs on biodegradation behavior of atrazine by Acinetobacter lwoffii DNS32, Sci Total Environ (2016), http://dx.doi.org/10.1016/j.scitotenv.2016.10.053
F. Yang et al. / Science of the Total Environment xxx (2016) xxx–xxx
5
notably, tiny holes and rough edges distributed in the B-BCs can also increase the risk of damaging cell membranes and then reduce the biodegradation rate. The morphology of degrading strain DNS32 cells was shown in Fig. 4, which are exposed to 50 mg/L C-BCs (A), B-BCs (B) and MWNTs (C) for 12 h. TEM images (Fig. 4B and C) show that B-BCs and MWNTs can cause the cell membrane disruption, while C-BCs (Fig. 4A) do not. Moreover, the cell membrane damage by MWNTs was more severe than that by B-BCs. Therefore, BCs showed the milder or no cytotoxicity. Effects of materials on the cell membrane may be a major factor for materials reducing the cell activity. 3.4. Effects of CMs on degradation gene expression
Fig. 3. SEM images of C-BCs (A and B) and B-BCs (C and D).
Fig. 4. TEM images of Acinetobacter lwoffii DNS32 exposed to 50 mg/L C-BCs (A), B-BCs (B) and MWNTs (C) for 12 h. Cells mixed with CMs were dispersed in LB medium.
many channels with the diameter of several microns, keeping the natural morphology during the carbonization process under the condition of limited oxygen (Fig. 3A and B). Allowing for the size and structure of CBCs, atrazine molecules (0.72 nm) and DNS32 strain can easily pass through the inner and outer, enhancing the adsorption behavior and the growth of degrading bacteria. From Fig. 3C, B-BCs have the texture of the macroporous structures, and the sizes of most pores are larger than 20 μm, also keeping the structure in nature. Obviously, the details (Fig. 3D) has an open structure with interconnected porous with the size of down to dozens of nanometers, resulting from the carbonization of biopolymers of banana peel. Because of their well-developed porosity and high surface area, B-BCs have good adsorption performance (Fig. 1),
In essence, the degradation rate and efficiency of functional bacteria depend on gene expression (Zhang et al., 2015). The degradation pathway of Acinetobacter lwoffii DNS32 is in accordance with Arthrobacter aurescens TC1, which decompose atrazine to cyanuric acid with the catabolic enzymes of these three type genes trzN, atzB and atzC (Lv et al., 2012; Li et al., 2008). So the study has also further determined the upregulation of genes involved in the degradation of atrazine, including trzN, atzB, and atzC (Fig. 5). In general, the relative mRNA expression in the CM-treated cells at a concentration of 10 mg/L was similar to that in the control (Fig. 5A), while that at a concentration of 50 mg/L was much less than that in the control (Fig. 5C), implying CMs can impact the expression of degrading genes. Interestingly, the expression of trzN, atzB, and atzC genes was significantly greater in the cells exposed to the C-BCs and MWNTs with the concentration of 25 mg/L relative to the control cells, and there has no significant change for B-BCs (Fig. 5B). The expression of the atrazine degradation genes may be concerned with the bacterial viability that was exposed to the CMs because atrazine was used as the sole nitrogen source. As the CM concentrations changed from 10 to 25 mg/L, the expression of trzN was increased from 113%, 92% and 77% to 115%, 109% and 117% in C-BCs, B-BCs and MWNTs treatments and then decreased to 85%, 57% and 64% when further increased to 50 mg/L, respectively. Such results reveal that various properties and structures of carbon can alter the expression of genes to some extent. M.V. Khodakovskaya et al. (Khodakovskaya et al., 2012) and Yan et al. (Yan et al., 2013) also demonstrated a correlation between the activation of growth in cells that were exposed to CNTs and the upregulation of genes involved in cell division/cell wall formation and water transport. 3.5. The ways of CMs influencing biodegradation processes Fig. 6 shows the possible ways of CMs influencing biodegradation processes. Obviously, the size and structure of various CMs are different from Fig. 3. BCs may give degrading bacterium a better environment than the control, contributing to the increase of biodegradation rates
Fig. 5. Effects of C-BCs, B-BCs and MWNTs on the degradation gene expression at 10 mg/L (A), 25 mg/L (B) and 50 mg/L (C). For analysis of degradation genes expression, the bacteria were incubated with different concentration CMs for 24 h in mineral medium. The error bars represent the standard deviations of triplicate measurements.
Please cite this article as: Yang, F., et al., Effects of biochars and MWNTs on biodegradation behavior of atrazine by Acinetobacter lwoffii DNS32, Sci Total Environ (2016), http://dx.doi.org/10.1016/j.scitotenv.2016.10.053
6
F. Yang et al. / Science of the Total Environment xxx (2016) xxx–xxx
concentrations of C-BCs show almost no obvious change, however, when concentration fitted at 100 mg/L, B-BCs and MWNTs decreased the biodegradation of atrazine by 47.6% and 68.9%, implying that the effects depended not only on the type of CMs but also on the CM concentrations. Biochars can also provide a better environment for degrading bacterium and strengthen the bacteria viability and the expression of functional gene, further revealing the essence of the enhanced degradation efficiency. It can be believed that the cell damage may be a major factor for MWNTs reducing the degradation behavior of DNS32 strain. This study implied that application of the biochars would have a lower environmental risk than CNTs. Real-Time PCR System Acknowledgments
Fig. 6. The possible schematic diagram of ways of CMs influencing biodegradation processes.
and efficiency, bacterial activity and gene expression. On the other hand, high concentration of three different CMs all inhibits the cell viability and decrease expressions of degradation gene, besides, the inhibition of C-BCs is significantly less than that of MWNTs. The inhibition of MWNTs may be due to the ecotoxicity towards bacteria, namely, they can make the cell membrane damage, leading to the cell death (Fig. 6C). Apparently, the damage of membrane exposure to C-BCs can be neglected from TEM images (Fig. 4A), even at high concentration (50 mg/L). It may be because that high concentration of C-BCs result in the strong adsorption of atrazine, which make the atrazine and degrading bacteria not fully contact (Fig. 6A), thus reducing the biological availability, and decreasing the viability and expressions of degradation gene. Up to now, the exact toxic mechanism of BCs and CNTs in functional strains (i.e. degrading bacteria) is still unclear. It is important to emphasize that MWNTs in low concentration (10 mg/L and 25 mg/L) were not found to be toxic to the strain, but were instead able to stimulate the degradation ability of degrading bacteria (Fig. 1). However, our findings have also highlighted negative effects of MWNTs in high concentration (50 mg/L and 100 mg/L). Literature has demonstrated the suggested toxicity mechanisms including oxidative stress (Manna et al., 2005), cutting off intracellular metabolic routes (Nel et al., 2006) and rupture of cell membrane (Kang et al., 2007). Kang et al. showed that the main CNT-cytotoxicity mechanism explaining inactivation of E. coli is direct contact interaction of the bacteria with highly purified CNTs (Kang et al., 2008). Generally, CNTs can fuse with the plasma membrane, and then cause cell damage through lipid peroxidation and oxidative stress, completing their life cycle (Chui et al., 2005). In Fig. 4C, it can be obviously observed that the cell membrane damage by MWNTs was much severe, and B-BCs (Figs. 4B and 6B) with high concentrations, to some extent, exhibit the similar effect as MWNTs, suggesting that the tiny holes and rough edges distributed in B-BCs can also increase the risk of damaging cell membranes and then reduce the biodegradation rate. Based on our above results, it can be believed that the cell damage may be a major factor for B-BCs and MWNTs reducing the degradation behavior of DNS32 strain. Further study of the ecotoxicological effects of biochars or CNTs on the typical black soil microorganisms is in progress. 4. Conclusions This study presents that the difference of effects on atrazine biodegradation by Acinetobacter lwoffii DNS32 was associated with C-BCs, BBCs and MWNTs. Interestingly, the biodegradation rates at various
This study was supported by the National Natural Science Fund for Distinguished Young Scholars (41625002), the Application Technology Research and Development Projects of Heilongjiang Province (GA14B105), National Natural Science Fund for Young Scholars (31600413), the China Postdoctoral Science Foundation (2015M581417) and the Heilongjiang Postdoctoral Fund (LBH-Z15012). References Antal, M.J., M., G., 2003. The art, science and technology of charcoal. Ind. Eng. Chem. 42, 1619–1640. Chui, D.X., Tian, F.R., Ozkan, C.S., Wang, M., Gao, H.J., 2005. Effect of single-wall carbon nanotubes on human HEK293 cells. Toxicol. Lett. 155, 73–85. Cui, E., Wu, Y., Zuo, Y., Chen, H., 2016. Effect of different biochars on antibiotic resistance genes and bacterial community during chicken manure composting. Bioresour. Technol. 203, 11–17. Ferguson, P.L., Chandler, G.T., Templeton, R.C., DeMarco, A., Scrivens, W.A., Englehart, B.A., 2008. Influence of sediment -amendment with single-walled carbon nanotubes and diesel soot on bioaccumulation of hydrophobic organic contaminants by benthic invertebrates. Environ. Sci. Technol. 42, 3879–3885. Hajipour, M.J., Fromm, K.M., Ashkarran, A.A., de Aberasturi, D.J., de Larramendi, I.R., Rojo, T., Serpooshan, V., Parak, W.J., Mahmoudi, M., 2012. Antibacterial properties of nanoparticles. Trends Biotechnol. 30, 499–511. HuoSheng, G., Zhigang, W., QingYuan, z., Dongfang, M., Yang, W., Ying, Z., 2012. Degradation characteristics and identification and the degradation pathway of the atrazine —degrading strain DNS32. Microbiol. China 39, 1234–1241. Jeong, C.Y., Dodla, S.K., Wang, J.J., 2016. Fundamental and molecular composition characteristics of biochars produced from sugarcane and rice crop residues and by-products. Chemosphere 142, 4–13. Kang, S., Pinault, M., Pfefferle, L., Elimelech, M., 2007. Single-walled carbon nanotubes exhibit strong antimicrobial activity. Langmuir 23, 8670–8673. Kang, S., Herzberg, M., Rodrigues, D.F., Elimelech, M., 2008. Antibacterial effects of carbon nanotubes: size does matter. Langmuir 24, 6409–6413. Kang, S., Mauter, M., Elimelech, D., 2009. Microbial cytotoxicity of carbon-based nanomaterials: implications for river water and wastewater effluent. Environ. Sci. Technol. 43, 2648–2653. Karhu, K., Mattila, T., Bergström, I., Regina, K., 2011. Biochar addition to agricultural soil increased CH4 uptake and water holding capacity-results from a shortterm pilot field study. Agric. Ecosyst. Environ. 140, 309–313. Khodakovskaya, M.V., de Silva, K., Biris, A.S., Dervishi, E., Villagarcia, H., 2012. Carbonnanotubes induce growth enhancement of tobacco cells. ACS Nano 6, 2128–2135. Kloss, S., Zehetner, F., Dellantonio, A., Hamid, R., Ottner, F., Liedtke, V., Schwanninger, M., Gerzabek, M.H., Soja, G., 2012. Characterization of slow pyrolysis biochars: effects of feedstocks and pyrolysis temperature on biochar properties. J. Environ. Qual. 41, 990–1000. Kramer, R.W., Kujawinski, E.B., Hatcher, P.G., 2004. Identification of black carbon derived structures in a volcanic ash soil humic acid by Fourier transform ion cyclotron resonance mass spectrometry. Environ. Sci. Technol. 38, 3387–3395. Lehmann, J., 2007. A handful of carbon. Nature 447, 143–144. Li, Q., Li, Y., Zhu, X., Cai, B., 2008. Isolation and characterization of atrazine-degrading Arthrobacter sp. AD26 and use of this strain in bioremediation of contaminated soil. J. Environ. Sci. 20, 1226–1230. Liang, B., Lehmann, J., Solomon, D., Kinyang, J., Grossman, J., O'Neill, B., Skjemstad, J.O., Thies, J., Luizão, F.J., Petersen, J., Neves, E.G., 2006. Black carbon increases cation exchange capacity in soils. Soil Sci. Soc. Am. J. 70, 1719–1730. Lv, Y., Gan, L., Liu, M., Xiong, W., Xu, Z., Zhu, D., Wright, D., 2012. A Self-Template Synthesis of Hierarchical Porous Carbon Foams Based on Banana Peel for Supercapacitor Electrodes 209 pp. 152–157. Manna, S.K., Sarkar, S., Barr, J., Wise, K., Barrera, E.V., Jejelowo, O., Rice-Ficht, A.C., Ramesh, G.T., 2005. Single-walled carbon nanotube induces oxidative stress and activates nuclear transcription factor-КB in human keratinocytes. Nano Lett. 5, 1676–1684.
Please cite this article as: Yang, F., et al., Effects of biochars and MWNTs on biodegradation behavior of atrazine by Acinetobacter lwoffii DNS32, Sci Total Environ (2016), http://dx.doi.org/10.1016/j.scitotenv.2016.10.053
F. Yang et al. / Science of the Total Environment xxx (2016) xxx–xxx Nel, A., Xia, T., Madler, L., Li, N., 2006. Toxic potential of materials at the nanolevel. Science 311, 622–627. Novak, J.M., Busscher, W.J., Laird, D.L., et al., 2009. Impact of biochar amendment on fertility of a southeastern coastal plain soil. Soil Sci. 174, 105–112. Peng, L., Ptacek, C.J., Blowes, D.W., Landis, R.C., 2016. Mechanisms of mercury removal by biochars produced from different feedstocks determined using X-ray absorption spectroscopy. J. Hazard. Mater. 308, 233–242. Robertso, F.A., Thorbum, P.J., 2006. Management of sugarcane harvest residues: consequences for soil carbon and nitrogen. Aust. J. Soil Res. 45, 13–23. Shvedova, A., Castranova, V., Kisin, E., Schwegler-Berry, D., Murry, A., Gandelsman, V., et al., 2003. Exposure to carbon nanotube material: assessment of nanotube cytotoxicity using human keratinocyte cells. J. Toxic. Environ. Health A 66, 1909–1926. Simone, E., KolbKevin, J., Fcrmanich, M.E., et al., 2009. Effect of charcoal quantity on microbial biomass and activity in temperate soils. Soil Sci. Soc. Am. J. 73, 1173–1181. Spokas, K.A., Koskinen, W.C., Baker, J.M., Reicosky, D.C., 2009. Impacts of woodchip biochar additions on greenhouse gas production and sorption/degradation of two herbicides in Minnesota soil. Chemosphere 77, 574–581. Steiner, C., Glaser, B., Teixeira, W.G., et al., 2007. Nitrogen retention and plant uptake on a highly weathered central Amazonian Ferralsol amended with compost and areola. Soil Sci. Plant Nutr. 171, 893–899. Tasis, D., Tagmatarchis, N., Bianco, A., Prato, M., 2006. Chemistry of carbon nanotubes. Chem. Rev. 106, 1105–1136. Thies, J.E., Rilling, M.C., 2009. Characteristics of biochar: biological properties. In: Lehmann, J., Joseph, S. (Eds.), Biochar for Environmental Management: Science and Technology. Earthscan, Washington D.C., pp. 85–106. Titirici, M.M., Thomas, A., Yu, S., Yu, S.H., Müller, J.O., Antonietti, M., 2007. A direct synthesis of mesoporous carbons with bicontinuous poremorphology from crude plant material by hydrothermal carbonization. Chem. Mater. 19, 4205–4212.
7
Towell, M.G., Browne, L.A., Paton, G.I., Semple, K.T., 2011. Impact of carbon nanomaterials on the behaviour of 14C-phenanthrene and 14C-benzo-[a] pyrene in soil. Environ. Pollut. 159, 706–715. Van, Z.L., Kimber, S., Morris, S., et al., 2010. Effects of biochar from slow pyrolysis of papermill waste on agronomic performance and soil fertility. Plant Soil 327, 235–246. Vinturella, A.E., Burgess, R.M., Coull, B.A., Thompson, K.M., Shine, J.P., 2004. Importance of black carbon in distribution and bioaccumulation models of polycyclic aromatic hydrocarbons in contaminated marine sediments. Environ. Toxicol. Chem. 23, 2578–2586. Xia, X., Li, Y., Zhou, Z., Feng, C., 2010. Bioavailability of adsorbed phenanthrene by black carbon and multi-walled carbon nanotubes to Agrobacterium. Chemosphere 78, 1329–1336. Xindecao, L., 2009. Bingao and Andwillieharris, dairy-manure derived biochar effectively sorbs lead and atrazine. Environ. Sci. Technol. 43, 3285–3291. Yan, S., Zhao, L., Li, H., Zhang, Q., Tan, J., Huang, M., He, S., Li, L., 2013. Single-walled carbon nanotubes selectively influence maize root tissue development accompanied by the change in the related gene expression. J. Hazard. Mater. 246-247, 110–118. Zavalloni, C., Alberti, G., Biasiol, S., Vedove, D., Fornasier, F., Liu, J., Peressotti, A., 2011. Microbial mineralization of biochar and wheat straw mixture in soil: a short-term study. Appl. Soil Ecol. 50, 45–51. Zhang, C., Mingzhu Li, X.X., Liu, N., 2015. Effects of carbon nanotubes on atrazine biodegradation by Arthrobacter sp. J. Hazard. Mater. 287, 1–6. Zhu, B., Xia, X., Xia, N., Zhang, S., Guo, X., 2014. Modification of fatty acids in membranes of bacteria: implication for an adaptive mechanism to the toxicity of carbon nanotubes. Environ. Sci. Technol. 48, 4086–4095. Zhu, S., Zhu, B., Huang, A., et al., 2016. Toxicological effects of multi-walled carbon nanotubes on Saccharomyces cerevisiae: the uptake kinetics and mechanisms and the toxic responses. J. Hazard. Mater. 318, 650–662.
Please cite this article as: Yang, F., et al., Effects of biochars and MWNTs on biodegradation behavior of atrazine by Acinetobacter lwoffii DNS32, Sci Total Environ (2016), http://dx.doi.org/10.1016/j.scitotenv.2016.10.053
Contents lists available at ScienceDirect
Science of the Total Environment journal homepage: www.elsevier.com/locate/scitotenv
Effects of biochars and MWNTs on biodegradation behavior of atrazine by Acinetobacter lwoffii DNS32 Fan Yang a,b, Qun Jiang a, Moran Zhu a, Lulu Zhao a, Ying Zhang a,⁎ a b
School of Resources & Environment, Northeast Agricultural University, Harbin, 150030, China College of Science, Northeast Agricultural University, Harbin 150030, China
H I G H L I G H T S
G R A P H I C A L
A B S T R A C T
• BCs and CNTs have different effects on the biodegradation of atrazine. • BCs enhance bacteria viability and expressions of degradation gene than CNTs. • Cell membrane damage is a major factor reducing the degradation behavior of strain.
a r t i c l e
i n f o
Article history: Received 27 July 2016 Received in revised form 7 October 2016 Accepted 8 October 2016 Available online xxxx Keywords: Atrazine Carbon materials Biodegradation Viability Gene expression
a b s t r a c t Whether the biodegradation of atrazine by Acinetobacter lwoffii DNS32 can have a difference in the presence of two representative carbon materials (CMs), namely, biochars (BCs) and carbon nanotubes (CNTs) is explored, through investigating the influence of CMs on the biodegradation rate, the viability of bacteria and the expression of atrazine genes in aqueous medium. Multi-walled carbon nanotubes (MWNTs), biochars resulted from corn straws (C-BCs) and that made from banana peels (B-BCs) were chosen as the examples. Compared to the control in the absence of C-BCs, BBCs and MWNTs, the biodegradation efficiencies decrease from 95.3%, 101.8% and 94.8% to 82.6%, 41.8% and 31.1% as the concentrations of these materials increase from 10 to 100 mg/L, indicating that BCs have relatively lower toxicity on the biodegradation of atrazine than CNTs, which are agreement with the results of bacterial viability. Transmission electron microscope (TEM) images of Acinetobacter lwoffii DNS32 cells exposure to CMs at 50 mg/L show that the cell membrane can be destroyed at different levels after being exposed to various CMs, suggesting that the damage to the cell membrane induced by CMs is a substantial factor leading to the inactivation of bacteria, further decreasing the degradation rate and efficiency of bacteria. The enhanced bacterial growth and the up-regulation of degradation genes can stimulate the degradation rate to pre-adsorbed atrazine on the CMs. This study suggests that biodegradation of atrazine associated with CMs may depend on the carbon composition, structure and CM concentrations. The innovation point of this report is to compare the effects of biochars and CNTs on the degradation rate and activity of Acinetobacter lwoffii DNS32 and may help to further understand the environment effects of CMs. © 2016 Elsevier B.V. All rights reserved.
⁎ Corresponding author. E-mail address: [email protected] (Y. Zhang).
http://dx.doi.org/10.1016/j.scitotenv.2016.10.053 0048-9697/© 2016 Elsevier B.V. All rights reserved.
Please cite this article as: Yang, F., et al., Effects of biochars and MWNTs on biodegradation behavior of atrazine by Acinetobacter lwoffii DNS32, Sci Total Environ (2016), http://dx.doi.org/10.1016/j.scitotenv.2016.10.053
2
F. Yang et al. / Science of the Total Environment xxx (2016) xxx–xxx
1. Introduction As a novel soil amendment, biochar has received special attention for its great potential of soil remediation (Lehmann, 2007; Spokas et al., 2009). Biochar, produced from biomass pyrolysis under the partial or total absence of oxygen (Antal and M., 2003), has been suggested as a prospective “carbon-sink” material (Zavalloni et al., 2011). Biochar is widely used as soil amendment or adsorbent because of its high cation exchange capacity, high surface area (Liang et al., 2006), and aromatic and condensed structure (Kramer et al., 2004; Titirici et al., 2007), which makes it omnipresent in the environment. Carbon nanotubes (CNTs) are some of the most attractive nanomaterials due to their excellent performance (Tasis et al., 2006). CNTs can sorb organic matter in environment as same as biochars, resulting in reducing bioavailability (Towell et al., 2011) higher environmental risk they are. So it is necessary to know the cytotoxicity and environmental impacts of carbon materials for their future application. Biochar is a type of the most of stable carbon in the environment. It can exist in the environment for thousands of years due to the low biodegradation rate and oxidation rate. It can attribute to the abilities of improving the pH value of acidic soil since that the biochar could improve the soil quality (Van et al., 2010; Jeong et al., 2016) and absorbing nutrients from soil (Thies and Rilling, 2009; Kloss et al., 2012). In addition, the biochar can also alter biological community (Cui et al., 2016), which may affect the cycle of nutrients and soil structure, and thus raise crop yield indirectly. It could be degraded by microbes after a long-term in the environment. Hydrophobic organic molecules, formed by the bio-degradation of plant cell wall, may be involved in the protection of fresh biochar (Karhu et al., 2011). Plant roots are attracted towards biochar, and meanwhile take up phosphorus from degraded biochar particles. Biochars not only could provide a better condition for microbial growth and reproduction, but also could improve crop yields by affecting the microbial activity, structure of community and diversity of microbes. It has been reported that biochar can change the microbial biomass, but the change has different influence for different species. Meanwhile, the biochar can alter the soil condition, such as nutrition composition, pH value, moisture and so on, leading to the change of dominant species of soil microbes, and then change the community composition and structure (Novak et al., 2009; Steiner et al., 2007). The quantity of bacteria and species has been reported to increase significance than that without biochar (Simone et al., 2009; Robertso and Thorbum, 2006). In the other hand, the addition of biochar makes a significant reduction for diversity of paleozoic bacterial and fungus. So biochar may cause controversial effects on the ecological system, and further studies are needed for its potential environmental risk. CNTs are another one of important carbon materials. There have few studies to discuss the effects of biochar on degradation of functional microbes but some about the cytotoxicity of CNTs. CNTs cytotoxicity in environments is a complicated process connected with nanomaterial physicochemical properties and system ecology (Kang et al., 2009). And they may inhibit biodegradation activity by reducing bacterial activity. Kang et al. (Kang et al., 2008) reported that single-wall carbon nanotubes (SWNTs) display the highest cytotoxicity towards all types of bacteria tested in the study. MWNTs exhibit a milder toxicity in the early studies compared with SWNTs. Longer contact time increases cytotoxicity of CNTs. Cytotoxicity is contingent upon direct contact with the cell membrane. Shvedova and co-workers (Shvedova et al., 2003) have proved that different concentrations of no-purified SWNTs can cause different effects on human epidermal keratinocytes, such as strengthening the oxidation of free radicals in cells, making lower cell survival rate and changing cell morphological. The group of Xia (Xia et al., 2010) has revealed that the mineralization efficiencies of phenanthrene associated with MWNTs were significantly lower than those cultured with biochar, which implied that MWNTs with excellent adsorption capacity may lead to a greater decrease of bioavailability in the environment.
Biochars and CNTs are frequently available to adsorbing atrazine, which is a ubiquitous pollutant found everywhere, or used as immobilized carriers for bio-degradation of atrazine. It is believed that the strong interaction between atrazine, biochars or CNTs can greatly reduce the mobility, bioavailability and environmental risk of atrazine in environment (Vinturella et al., 2004; Ferguson et al., 2008). However, the effects of biochars on the biodegradation of organic contaminants and the difference of effects between CNTs and biochars on Acinetobacter lwoffii DNS32 degrading atrazine are still unclear. Therefore, the present study contributes to an understanding of the impacts of biochars and CNTs on the biodegradation of atrazine in water, and discussions of the potential environmental risk of biochars. Two kinds of typical biochars have been prepared, and named as C-BCs and BBCs, respectively. C-BCs are derived from corn straw and B-BCs are made from banana peels, and the preparation process can be introduced in detail later. The main objectives of this study are to examine the difference of biochars and CNTs on the biodegradation of atrazine, giving new insights into the related mechanisms. 2. Materials and methods 2.1. Materials Corn straws and banana peels were cleaned and air-dried before use. Corn straws after the pretreatment were directly placed in the center of an alumina tube inside a horizontal tube furnace. The reactor was purged with N2 several times to remove residual oxygen and/or moisture before being heated to 850 °C under N2 for 2 h. Banana peels were immersed with Zn(NO3)2·6H2O solution firstly and then crosslinked with furfuraldehyde and 2,6-Dichlorophenol before the pyrolysis (Lv et al., 2012). The conditions of pyrolysis was at 850 °C under N2 atmosphere with a heating rate of 10 °C/min and held for 2 h. MWNTs were purchased from Shenzhen Nanotech Port Co., Ltd., China. The morphology and structure of CMs were observed by using a scanning electron microscope (SEM, ZEISS SUPRA 40, Germany). Acinetobacter lwoffii DNS32 used in this study was provided by our laboratory (HuoSheng et al., 2012). The bacteria were cultured in inorganic medium containing 1.6 g/L K2HPO4, 0.4 g/L KH2PO4, 0.2 g/L MgSO4, 0.1 g/L NaCl, 3 g/L glucose and 100 mg/L atrazine, or in the Luria-Bertani (LB) medium containing 10 g/L tryptone, yeast powder 5 g/L, NaCl 10 g/L. Atrazine (99.7%) was purchased from Jiangsu Repont Pesticide Factory Co., Ltd., China. Other chemicals were of analytical grade or higher. 2.2. Preparation of the material stock solution Inoculums of 30 mg C-BCs, B-BCs and MWNTs were suspended in 30 mL of inorganic medium and were sonicated for 60 min. The suspension of materials was prepared to obtain the appropriate CM concentrations by diluting the solution, in order to avoid the change of the physical and chemical properties of materials. 2.3. Biodegradation of atrazine by Acinetobacter lwoffii DNS32 in the presence of various materials CMs were added to 50 mL of the mineral solution, in which the initial atrazine concentration was 100 mg/L, at crude CM concentrations of 10, 25, 50 and 100 mg/L. The test concentrations of these CMs were quoted from the reference reported some inhibitory effects on bacteria within the concentration range (Zhu et al., 2014). After 6 h vibrating, atrazine in the inorganic mediums had been reached the adsorption equilibrium (Xindecao, 2009). Then degradation was initiated by inoculating the flasks with 1% of the cell suspension at the initial cell density of approximately 105–106 cell/mL. The culturing conditions were at 30 °C by shaking at 125 rpm. All flasks were incubated in the dark to avoid photo-transformation of atrazine. Then, 5 mL of sample was withdrawn
Please cite this article as: Yang, F., et al., Effects of biochars and MWNTs on biodegradation behavior of atrazine by Acinetobacter lwoffii DNS32, Sci Total Environ (2016), http://dx.doi.org/10.1016/j.scitotenv.2016.10.053
F. Yang et al. / Science of the Total Environment xxx (2016) xxx–xxx
in every 6 h. Atrazine in the samples extracted with chloroform at a 1:1 (v/v) ratio after 5 min shaking in a separating funnel and then 1 μL of extracts was injected to a gas chromatograph (GC-14C, Shimadzu, JAPAN) to determine the concentration of atrazine, equipped with a fused silica chromatographic column (30 m × 0.53 mm) packed with 14% OV-1701 and a flame ionization detector (FID) with N2 being carrier gas. The atrazine concentration of the samples was calculated by comparing the recorded peak value which represented atrazine with those of standards. A set of systems without any materials were used as controls. All experiments were conducted in triplicate.
2.4. The bacterial viability cultured with various materials The medium containing C-BCs, B-BCs and MWNTs with the concentrations of 10, 25, 50 and 100 mg/L were autoclaved at 121 °C for 20 min. Then 1% of the cell suspension (same as above) was transferred to the conical flasks, and the bacteria were incubated with various materials in the LB medium 30 °C. Each experiment set was conducted in triplicate. After 12 h (in the LB medium) when cells were at the mid-exponential growth phase of the growth, the mixed liquids containing bacteria and CMs were vortexed for 1 min, and 1 mL of the mixed liquids were collected for the determination of the viability. The viability of the bacteria was determined by spread plate method. The samples were serially diluted with isotonic saline solution and spread with 100 μL of appropriate dilution onto the LB agar plate. Colonies were counted after 24 h incubation at 30 °C. The viability of Acinetobacter lwoffii DNS32 was defined as the percentage proportion of colony count of bacteria grown with CMs to that of the control without CMs.
2.5. Effects of materials on the expression of atrazine catabolism genes The catabolic activity of the cells was high during the early log phase. Therefore, after 24 h of incubation in minimal medium, 5 mL of the cells treated with various CMs at different concentration were harvested by centrifugation at 10,000 ×g for 5 min and immediately frozen in liquid nitrogen prior to storage at −80 °C until use for qPCR. The cDNA was got using AMV First Strand cDNA Synthesis Kit (SK2445). DNA traces were removed by treating the RNA with 2.5 U of RNase-free RQI DNase in the presence of 20 U/L of RNase inhibitor at 37 °C for 1 h. The RNA quality was checked on a 1% denative agarose gel, and the RNA quantity was calculated from absorption values that were measured at 260 nm using a Biophotometer (Eppendorf, Hamburg, Germany). Each RNA extract was diluted to 25 ng/μL using RNase-free water (0.5% DEPC, Sigma, Germany). Reverse transcription that was specific for target mRNA was performed according to the manufacturer's instructions (TransGen Biotech Co., China) using a random primer (Table 1). Real-time PCRs were conducted using an ABI Stepone plus Real-Time PCR System (ABI Co., USA). Detailed information is provided in the Table 1. The conditions of qPCR were 300 s at 95 °C for enzyme activation followed by 40 cycles of 30 s at 95 °C, 15 s at the optimal hybridization temperature (Table 1) and 15 s at 72 °C.
2.6. Characterization of CMs and bacteria The morphologies of CMs were characterized by a scanning electron microscope (SEM, JEOL JSM-6480). The images of bacterial cells are obtained by a transmission electron microscope (TEM, FEI Teccai G2STwin, Philips). The bacterial cells mixed with 50 mg/L suspensions of three different carbon materials were firstly dispersed in Luria-Berta medium for 12 h. Next, the as-prepared samples are placed on the copper micro grid drop by drop, and then are dyed using phosphotungstic acid for 40 s. After that, the cell can be applied to observe.
3
Table 1 Conditions of determinations of degradation gene expression. Primer 16S-F341:CCTACGGGAGGCAGCAG trzN-F: GTCCTCCTCCAGTCGCTCC atzB-F: CCCATCACCATTTTTTTCAGG atzC-F: GGGCAAGACGATTTATCGAA
16S-R518: ATTACCGCGGCTGCTGG 177bp trzN-R:AGAAGCCACCTTCGCTCTTG 178bp atzB-R: CATGGACACCACTGTGCTGTG 149bp atzC-R:TGGGCTGTGATTTAGTTGGG 165bp
Reaction component
Concentration
Volume(μL)
SybrGreen qPCR Master Mix Primer F (10 uM) Primer R (10 uM) ddH20 Template (cDNA) Total
2X 10 μM 10 μM
10 0.4 0.4 7.2 2 20 μL
Times and temperatures Thermal cycler
Each of 40 cycles Initial steps Melt
ABI Stepone plus Real-time PCR system
HOLD
Anneal
Extend Stepts of melt curve
CYCLE 15 s
3 min 95 °C
7s 95 °C
10 s 57 °C 72 °C
2.7. Data analysis Statistical analysis was performed using the OriginPro 8.5 and SPSS 19.0 including the significance analysis using the t-test. Difference was considered significant when the significance level was smaller than 0.05 (p b 0.05).
3. Results and discussion 3.1. Biodegradation of atrazine in the presence of CMs Fig. 1 shows the adsorption of atrazine by various carbon materials and the biodegradation by Acinetobacter lwoffii DNS32. The biodegradation rates are listed in Table 2 using first-order kinetics. The results implied that the adsorption had a few effects on biodegradation. Because the removal representation was linear (as showed in Table 1, R2 N 0.97). The atrazine biodegradation rate in the control without CMs was quite constant along the time regardless the atrazine concentration remaining (Fig. 1). If atrazine biodegradation rate significantly diminished at lower concentration (for instance, b 50 mg/L), the removal rate would not be constant and the removal representation should not be linear. Biodegradation of atrazine by Acinetobacter lwoffii DNS32 in the presence of CMs revealed the magnitude of the effects was limited by CM concentrations and types (Fig. 1, Table 2). Interestingly, there had significant differences between C-BCs, B-BCs and MWNTs towards the degradation behavior of atrazine. The biodegradation rates at various concentrations of C-BCs showed almost no obvious change, however, the rates of atrazine degradation were no less than the control when B-BCs and MMWNTs were added at a concentration of 10 mg/L and 25 mg/L, while when 50 mg/L and 100 mg/L of CNTs were added, atrazine was degraded much slower than the control. The same concentrations fitted at 50 and 100 mg/L, it can be observed that C-BCs had little effect on the degradation rate (i.e. 85.0% and 82.6%), while B-BCs and MWNTs decreased the biodegradation of atrazine by 35.9%, 58.2% for 50 mg/L and 47.6%, 68.9% for 100 mg/L, respectively (Fig. 1, Table 2). The results implied that biochar showed the milder effect on
Please cite this article as: Yang, F., et al., Effects of biochars and MWNTs on biodegradation behavior of atrazine by Acinetobacter lwoffii DNS32, Sci Total Environ (2016), http://dx.doi.org/10.1016/j.scitotenv.2016.10.053
4
F. Yang et al. / Science of the Total Environment xxx (2016) xxx–xxx
Fig. 1. Biodegradation of atrazine in the presence of various CM concentrations: C-BCs (A), B-BCs (B), MWNTs (C). The error bars represent the standard deviations from triplicate measurements.
biodegradation rates and efficiency of atrazine by microorganism, and the influence also determined the structure of biochars. Three materials (C-BCs, B-BCs and MWNTs) were selected because they had different carbon composition and structure. Generally, biochar is under the condition of limited oxygen pyrolysis of carbon-rich solid mixture, and usually contains a certain amount of black carbon, ash content, graphite and charcoal. A large number of aliphatic carbons transform into aromatic carbon, and the polymerization of aromatic carbon is usually formed by six carbon atoms during the carbonization process of biomass (Peng et al., 2016). While CNTs are belong to the fullerene that is made of graphite, with the diameter of 10–100 nm and the length of hundreds of micrometers. Some report has demonstrated that the viability of the common model bacteria would decrease when CNT concentration increased from 10 to 50 mg/L (Zhu et al., 2014), indicating that CNTs maybe reduce the microbial activity to control the biodegradation efficiency. Therefore, the viability of Acinetobacter lwoffii DNS32 will be measured later.
almost no toxicity to cell compared with B-BCs and MWNTs, even at high concentrations, implying that application of C-BCs have a lower environmental risk. The viability exposure to B-BCs after acid treatment was also evaluated in order to eliminate the effect of metal impurities introduced during the preparation progress. The result showed that BBCs after acid treatment reduce the viability of DNS32 by 21.8%, which was similar as B-BCs without treatment, indicating that metal impurities were not the major factor inhibiting the viability of DNS32 and the degradation behavior of atrazine in this experiment. Similar results have been reported by Song et al. (Zhu et al., 2016). To sum up, we conjecture that CMs with different carbon structures may have a remarkable effect on the microbial activity. The viability of microbe in the presence of CMs was also related to the species itself. Acinetobacter lwoffii DNS32 is a Gram-negative bacteria. Generally, Gram-negative bacteria are more resistant to nanoparticles than Gram-positive ones because of the complex outer membrane, which, in part, excludes the nanoparticles from attacking the bacteria (Hajipour et al., 2012).
3.2. The viability of Acinetobacter lwoffii DNS32 in the presence of CMs As seen from Fig. 2, the results of the bacterial viability in the presence of various CM concentrations have proved that the CM concentration had an obvious impact on the viability of Acinetobacter lwoffii DNS32. C-BCs, B-BCs and MWNTs at the concentration of 10 mg/L enhanced the bacterial viability by 14.5%, 6.6% and 12.3%, respectively, and at the concentration of 100 mg/L, C-BCs, B-BCs and MWNTs inhibited the microbial activity by 5.7%, 23.4% and 30.2%, respectively. These results indicated that low CM concentrations could enhance the growth of bacteria even higher. High concentrations of B-BC and MWNTs showed toxicity to microbial cells, which was consistent with that biodegradation of atrazine in Fig. 1. In addition, C-BCs exhibited
3.3. Characterization of CMs and Acinetobacter lwoffii DNS32 exposed to CMs In order to further explore the influence of CM structures on the degradation behavior, the morphology of CMs (Fig. 3) and degrading strain DNS32 cells after exposure to CMs (Fig. 4) were observed using SEM and TEM techniques, respectively. As shown in Fig. 3, C-BCs are consisted of
Table 2 Summary of the biodegradation rates of atrazine in the presence of different CMs.
C-BCs
B-BCs
MWNTS Control
c (mg/L)
k/k
10 25 50 100 10 25 50 100 10 25 50 100 0
0.953 0.961 0.850 0.826 1.018 0.863 0.641 0.418 0.948 0.801 0.524 0.311 1.000
control
R2 0.993 0.989 0.984 0.975 0.983 0.993 0.981 0.985 0.992 0.976 0.978 0.9744 0.995
Fig. 2. The viability of DNS32 contact with C-BCs, B-BCs and MWNTs. The cells suspension at the midexponential growth phase of the growth were spread with 100 μL of appropriate dilution onto the LB agar plate. Colonies were counted after 24 h incubation at 30 °C. The error bars represent the standard deviations from triplicate measurements.
Please cite this article as: Yang, F., et al., Effects of biochars and MWNTs on biodegradation behavior of atrazine by Acinetobacter lwoffii DNS32, Sci Total Environ (2016), http://dx.doi.org/10.1016/j.scitotenv.2016.10.053
F. Yang et al. / Science of the Total Environment xxx (2016) xxx–xxx
5
notably, tiny holes and rough edges distributed in the B-BCs can also increase the risk of damaging cell membranes and then reduce the biodegradation rate. The morphology of degrading strain DNS32 cells was shown in Fig. 4, which are exposed to 50 mg/L C-BCs (A), B-BCs (B) and MWNTs (C) for 12 h. TEM images (Fig. 4B and C) show that B-BCs and MWNTs can cause the cell membrane disruption, while C-BCs (Fig. 4A) do not. Moreover, the cell membrane damage by MWNTs was more severe than that by B-BCs. Therefore, BCs showed the milder or no cytotoxicity. Effects of materials on the cell membrane may be a major factor for materials reducing the cell activity. 3.4. Effects of CMs on degradation gene expression
Fig. 3. SEM images of C-BCs (A and B) and B-BCs (C and D).
Fig. 4. TEM images of Acinetobacter lwoffii DNS32 exposed to 50 mg/L C-BCs (A), B-BCs (B) and MWNTs (C) for 12 h. Cells mixed with CMs were dispersed in LB medium.
many channels with the diameter of several microns, keeping the natural morphology during the carbonization process under the condition of limited oxygen (Fig. 3A and B). Allowing for the size and structure of CBCs, atrazine molecules (0.72 nm) and DNS32 strain can easily pass through the inner and outer, enhancing the adsorption behavior and the growth of degrading bacteria. From Fig. 3C, B-BCs have the texture of the macroporous structures, and the sizes of most pores are larger than 20 μm, also keeping the structure in nature. Obviously, the details (Fig. 3D) has an open structure with interconnected porous with the size of down to dozens of nanometers, resulting from the carbonization of biopolymers of banana peel. Because of their well-developed porosity and high surface area, B-BCs have good adsorption performance (Fig. 1),
In essence, the degradation rate and efficiency of functional bacteria depend on gene expression (Zhang et al., 2015). The degradation pathway of Acinetobacter lwoffii DNS32 is in accordance with Arthrobacter aurescens TC1, which decompose atrazine to cyanuric acid with the catabolic enzymes of these three type genes trzN, atzB and atzC (Lv et al., 2012; Li et al., 2008). So the study has also further determined the upregulation of genes involved in the degradation of atrazine, including trzN, atzB, and atzC (Fig. 5). In general, the relative mRNA expression in the CM-treated cells at a concentration of 10 mg/L was similar to that in the control (Fig. 5A), while that at a concentration of 50 mg/L was much less than that in the control (Fig. 5C), implying CMs can impact the expression of degrading genes. Interestingly, the expression of trzN, atzB, and atzC genes was significantly greater in the cells exposed to the C-BCs and MWNTs with the concentration of 25 mg/L relative to the control cells, and there has no significant change for B-BCs (Fig. 5B). The expression of the atrazine degradation genes may be concerned with the bacterial viability that was exposed to the CMs because atrazine was used as the sole nitrogen source. As the CM concentrations changed from 10 to 25 mg/L, the expression of trzN was increased from 113%, 92% and 77% to 115%, 109% and 117% in C-BCs, B-BCs and MWNTs treatments and then decreased to 85%, 57% and 64% when further increased to 50 mg/L, respectively. Such results reveal that various properties and structures of carbon can alter the expression of genes to some extent. M.V. Khodakovskaya et al. (Khodakovskaya et al., 2012) and Yan et al. (Yan et al., 2013) also demonstrated a correlation between the activation of growth in cells that were exposed to CNTs and the upregulation of genes involved in cell division/cell wall formation and water transport. 3.5. The ways of CMs influencing biodegradation processes Fig. 6 shows the possible ways of CMs influencing biodegradation processes. Obviously, the size and structure of various CMs are different from Fig. 3. BCs may give degrading bacterium a better environment than the control, contributing to the increase of biodegradation rates
Fig. 5. Effects of C-BCs, B-BCs and MWNTs on the degradation gene expression at 10 mg/L (A), 25 mg/L (B) and 50 mg/L (C). For analysis of degradation genes expression, the bacteria were incubated with different concentration CMs for 24 h in mineral medium. The error bars represent the standard deviations of triplicate measurements.
Please cite this article as: Yang, F., et al., Effects of biochars and MWNTs on biodegradation behavior of atrazine by Acinetobacter lwoffii DNS32, Sci Total Environ (2016), http://dx.doi.org/10.1016/j.scitotenv.2016.10.053
6
F. Yang et al. / Science of the Total Environment xxx (2016) xxx–xxx
concentrations of C-BCs show almost no obvious change, however, when concentration fitted at 100 mg/L, B-BCs and MWNTs decreased the biodegradation of atrazine by 47.6% and 68.9%, implying that the effects depended not only on the type of CMs but also on the CM concentrations. Biochars can also provide a better environment for degrading bacterium and strengthen the bacteria viability and the expression of functional gene, further revealing the essence of the enhanced degradation efficiency. It can be believed that the cell damage may be a major factor for MWNTs reducing the degradation behavior of DNS32 strain. This study implied that application of the biochars would have a lower environmental risk than CNTs. Real-Time PCR System Acknowledgments
Fig. 6. The possible schematic diagram of ways of CMs influencing biodegradation processes.
and efficiency, bacterial activity and gene expression. On the other hand, high concentration of three different CMs all inhibits the cell viability and decrease expressions of degradation gene, besides, the inhibition of C-BCs is significantly less than that of MWNTs. The inhibition of MWNTs may be due to the ecotoxicity towards bacteria, namely, they can make the cell membrane damage, leading to the cell death (Fig. 6C). Apparently, the damage of membrane exposure to C-BCs can be neglected from TEM images (Fig. 4A), even at high concentration (50 mg/L). It may be because that high concentration of C-BCs result in the strong adsorption of atrazine, which make the atrazine and degrading bacteria not fully contact (Fig. 6A), thus reducing the biological availability, and decreasing the viability and expressions of degradation gene. Up to now, the exact toxic mechanism of BCs and CNTs in functional strains (i.e. degrading bacteria) is still unclear. It is important to emphasize that MWNTs in low concentration (10 mg/L and 25 mg/L) were not found to be toxic to the strain, but were instead able to stimulate the degradation ability of degrading bacteria (Fig. 1). However, our findings have also highlighted negative effects of MWNTs in high concentration (50 mg/L and 100 mg/L). Literature has demonstrated the suggested toxicity mechanisms including oxidative stress (Manna et al., 2005), cutting off intracellular metabolic routes (Nel et al., 2006) and rupture of cell membrane (Kang et al., 2007). Kang et al. showed that the main CNT-cytotoxicity mechanism explaining inactivation of E. coli is direct contact interaction of the bacteria with highly purified CNTs (Kang et al., 2008). Generally, CNTs can fuse with the plasma membrane, and then cause cell damage through lipid peroxidation and oxidative stress, completing their life cycle (Chui et al., 2005). In Fig. 4C, it can be obviously observed that the cell membrane damage by MWNTs was much severe, and B-BCs (Figs. 4B and 6B) with high concentrations, to some extent, exhibit the similar effect as MWNTs, suggesting that the tiny holes and rough edges distributed in B-BCs can also increase the risk of damaging cell membranes and then reduce the biodegradation rate. Based on our above results, it can be believed that the cell damage may be a major factor for B-BCs and MWNTs reducing the degradation behavior of DNS32 strain. Further study of the ecotoxicological effects of biochars or CNTs on the typical black soil microorganisms is in progress. 4. Conclusions This study presents that the difference of effects on atrazine biodegradation by Acinetobacter lwoffii DNS32 was associated with C-BCs, BBCs and MWNTs. Interestingly, the biodegradation rates at various
This study was supported by the National Natural Science Fund for Distinguished Young Scholars (41625002), the Application Technology Research and Development Projects of Heilongjiang Province (GA14B105), National Natural Science Fund for Young Scholars (31600413), the China Postdoctoral Science Foundation (2015M581417) and the Heilongjiang Postdoctoral Fund (LBH-Z15012). References Antal, M.J., M., G., 2003. The art, science and technology of charcoal. Ind. Eng. Chem. 42, 1619–1640. Chui, D.X., Tian, F.R., Ozkan, C.S., Wang, M., Gao, H.J., 2005. Effect of single-wall carbon nanotubes on human HEK293 cells. Toxicol. Lett. 155, 73–85. Cui, E., Wu, Y., Zuo, Y., Chen, H., 2016. Effect of different biochars on antibiotic resistance genes and bacterial community during chicken manure composting. Bioresour. Technol. 203, 11–17. Ferguson, P.L., Chandler, G.T., Templeton, R.C., DeMarco, A., Scrivens, W.A., Englehart, B.A., 2008. Influence of sediment -amendment with single-walled carbon nanotubes and diesel soot on bioaccumulation of hydrophobic organic contaminants by benthic invertebrates. Environ. Sci. Technol. 42, 3879–3885. Hajipour, M.J., Fromm, K.M., Ashkarran, A.A., de Aberasturi, D.J., de Larramendi, I.R., Rojo, T., Serpooshan, V., Parak, W.J., Mahmoudi, M., 2012. Antibacterial properties of nanoparticles. Trends Biotechnol. 30, 499–511. HuoSheng, G., Zhigang, W., QingYuan, z., Dongfang, M., Yang, W., Ying, Z., 2012. Degradation characteristics and identification and the degradation pathway of the atrazine —degrading strain DNS32. Microbiol. China 39, 1234–1241. Jeong, C.Y., Dodla, S.K., Wang, J.J., 2016. Fundamental and molecular composition characteristics of biochars produced from sugarcane and rice crop residues and by-products. Chemosphere 142, 4–13. Kang, S., Pinault, M., Pfefferle, L., Elimelech, M., 2007. Single-walled carbon nanotubes exhibit strong antimicrobial activity. Langmuir 23, 8670–8673. Kang, S., Herzberg, M., Rodrigues, D.F., Elimelech, M., 2008. Antibacterial effects of carbon nanotubes: size does matter. Langmuir 24, 6409–6413. Kang, S., Mauter, M., Elimelech, D., 2009. Microbial cytotoxicity of carbon-based nanomaterials: implications for river water and wastewater effluent. Environ. Sci. Technol. 43, 2648–2653. Karhu, K., Mattila, T., Bergström, I., Regina, K., 2011. Biochar addition to agricultural soil increased CH4 uptake and water holding capacity-results from a shortterm pilot field study. Agric. Ecosyst. Environ. 140, 309–313. Khodakovskaya, M.V., de Silva, K., Biris, A.S., Dervishi, E., Villagarcia, H., 2012. Carbonnanotubes induce growth enhancement of tobacco cells. ACS Nano 6, 2128–2135. Kloss, S., Zehetner, F., Dellantonio, A., Hamid, R., Ottner, F., Liedtke, V., Schwanninger, M., Gerzabek, M.H., Soja, G., 2012. Characterization of slow pyrolysis biochars: effects of feedstocks and pyrolysis temperature on biochar properties. J. Environ. Qual. 41, 990–1000. Kramer, R.W., Kujawinski, E.B., Hatcher, P.G., 2004. Identification of black carbon derived structures in a volcanic ash soil humic acid by Fourier transform ion cyclotron resonance mass spectrometry. Environ. Sci. Technol. 38, 3387–3395. Lehmann, J., 2007. A handful of carbon. Nature 447, 143–144. Li, Q., Li, Y., Zhu, X., Cai, B., 2008. Isolation and characterization of atrazine-degrading Arthrobacter sp. AD26 and use of this strain in bioremediation of contaminated soil. J. Environ. Sci. 20, 1226–1230. Liang, B., Lehmann, J., Solomon, D., Kinyang, J., Grossman, J., O'Neill, B., Skjemstad, J.O., Thies, J., Luizão, F.J., Petersen, J., Neves, E.G., 2006. Black carbon increases cation exchange capacity in soils. Soil Sci. Soc. Am. J. 70, 1719–1730. Lv, Y., Gan, L., Liu, M., Xiong, W., Xu, Z., Zhu, D., Wright, D., 2012. A Self-Template Synthesis of Hierarchical Porous Carbon Foams Based on Banana Peel for Supercapacitor Electrodes 209 pp. 152–157. Manna, S.K., Sarkar, S., Barr, J., Wise, K., Barrera, E.V., Jejelowo, O., Rice-Ficht, A.C., Ramesh, G.T., 2005. Single-walled carbon nanotube induces oxidative stress and activates nuclear transcription factor-КB in human keratinocytes. Nano Lett. 5, 1676–1684.
Please cite this article as: Yang, F., et al., Effects of biochars and MWNTs on biodegradation behavior of atrazine by Acinetobacter lwoffii DNS32, Sci Total Environ (2016), http://dx.doi.org/10.1016/j.scitotenv.2016.10.053
F. Yang et al. / Science of the Total Environment xxx (2016) xxx–xxx Nel, A., Xia, T., Madler, L., Li, N., 2006. Toxic potential of materials at the nanolevel. Science 311, 622–627. Novak, J.M., Busscher, W.J., Laird, D.L., et al., 2009. Impact of biochar amendment on fertility of a southeastern coastal plain soil. Soil Sci. 174, 105–112. Peng, L., Ptacek, C.J., Blowes, D.W., Landis, R.C., 2016. Mechanisms of mercury removal by biochars produced from different feedstocks determined using X-ray absorption spectroscopy. J. Hazard. Mater. 308, 233–242. Robertso, F.A., Thorbum, P.J., 2006. Management of sugarcane harvest residues: consequences for soil carbon and nitrogen. Aust. J. Soil Res. 45, 13–23. Shvedova, A., Castranova, V., Kisin, E., Schwegler-Berry, D., Murry, A., Gandelsman, V., et al., 2003. Exposure to carbon nanotube material: assessment of nanotube cytotoxicity using human keratinocyte cells. J. Toxic. Environ. Health A 66, 1909–1926. Simone, E., KolbKevin, J., Fcrmanich, M.E., et al., 2009. Effect of charcoal quantity on microbial biomass and activity in temperate soils. Soil Sci. Soc. Am. J. 73, 1173–1181. Spokas, K.A., Koskinen, W.C., Baker, J.M., Reicosky, D.C., 2009. Impacts of woodchip biochar additions on greenhouse gas production and sorption/degradation of two herbicides in Minnesota soil. Chemosphere 77, 574–581. Steiner, C., Glaser, B., Teixeira, W.G., et al., 2007. Nitrogen retention and plant uptake on a highly weathered central Amazonian Ferralsol amended with compost and areola. Soil Sci. Plant Nutr. 171, 893–899. Tasis, D., Tagmatarchis, N., Bianco, A., Prato, M., 2006. Chemistry of carbon nanotubes. Chem. Rev. 106, 1105–1136. Thies, J.E., Rilling, M.C., 2009. Characteristics of biochar: biological properties. In: Lehmann, J., Joseph, S. (Eds.), Biochar for Environmental Management: Science and Technology. Earthscan, Washington D.C., pp. 85–106. Titirici, M.M., Thomas, A., Yu, S., Yu, S.H., Müller, J.O., Antonietti, M., 2007. A direct synthesis of mesoporous carbons with bicontinuous poremorphology from crude plant material by hydrothermal carbonization. Chem. Mater. 19, 4205–4212.
7
Towell, M.G., Browne, L.A., Paton, G.I., Semple, K.T., 2011. Impact of carbon nanomaterials on the behaviour of 14C-phenanthrene and 14C-benzo-[a] pyrene in soil. Environ. Pollut. 159, 706–715. Van, Z.L., Kimber, S., Morris, S., et al., 2010. Effects of biochar from slow pyrolysis of papermill waste on agronomic performance and soil fertility. Plant Soil 327, 235–246. Vinturella, A.E., Burgess, R.M., Coull, B.A., Thompson, K.M., Shine, J.P., 2004. Importance of black carbon in distribution and bioaccumulation models of polycyclic aromatic hydrocarbons in contaminated marine sediments. Environ. Toxicol. Chem. 23, 2578–2586. Xia, X., Li, Y., Zhou, Z., Feng, C., 2010. Bioavailability of adsorbed phenanthrene by black carbon and multi-walled carbon nanotubes to Agrobacterium. Chemosphere 78, 1329–1336. Xindecao, L., 2009. Bingao and Andwillieharris, dairy-manure derived biochar effectively sorbs lead and atrazine. Environ. Sci. Technol. 43, 3285–3291. Yan, S., Zhao, L., Li, H., Zhang, Q., Tan, J., Huang, M., He, S., Li, L., 2013. Single-walled carbon nanotubes selectively influence maize root tissue development accompanied by the change in the related gene expression. J. Hazard. Mater. 246-247, 110–118. Zavalloni, C., Alberti, G., Biasiol, S., Vedove, D., Fornasier, F., Liu, J., Peressotti, A., 2011. Microbial mineralization of biochar and wheat straw mixture in soil: a short-term study. Appl. Soil Ecol. 50, 45–51. Zhang, C., Mingzhu Li, X.X., Liu, N., 2015. Effects of carbon nanotubes on atrazine biodegradation by Arthrobacter sp. J. Hazard. Mater. 287, 1–6. Zhu, B., Xia, X., Xia, N., Zhang, S., Guo, X., 2014. Modification of fatty acids in membranes of bacteria: implication for an adaptive mechanism to the toxicity of carbon nanotubes. Environ. Sci. Technol. 48, 4086–4095. Zhu, S., Zhu, B., Huang, A., et al., 2016. Toxicological effects of multi-walled carbon nanotubes on Saccharomyces cerevisiae: the uptake kinetics and mechanisms and the toxic responses. J. Hazard. Mater. 318, 650–662.
Please cite this article as: Yang, F., et al., Effects of biochars and MWNTs on biodegradation behavior of atrazine by Acinetobacter lwoffii DNS32, Sci Total Environ (2016), http://dx.doi.org/10.1016/j.scitotenv.2016.10.053