Effects of brevetoxin exposure on the immune system of loggerhead sea turtles

Aquatic Toxicology 97 (2010) 293–303

Contents lists available at ScienceDirect

Aquatic Toxicology journal homepage: www.elsevier.com/locate/aquatox

Effects of brevetoxin exposure on the immune system of loggerhead sea turtles Catherine J. Walsh a,∗ , Stephanie R. Leggett a , Barbara J. Carter b , Clarence Colle a a b

Mote Marine Laboratory, 1600 Ken Thompson Parkway, Sarasota, FL 34236, United States EcoArray, Inc., Interstate Office Park, Suite 50, 4949 SW 41st Blvd, Gainesville, FL 32608, United States

a r t i c l e

i n f o

Article history: Received 16 September 2009 Received in revised form 4 December 2009 Accepted 12 December 2009 Keywords: Loggerhead sea turtle Red tide Brevetoxin Immune function Suppression subtractive hybridization

a b s t r a c t Blooms of the toxic dinoflagellate, Karenia brevis, occur almost annually off the Florida coast. These blooms, commonly called “red tides”, produce a group of neurotoxins collectively termed brevetoxins. Many species of sealife, including sea turtles, are severely impacted by brevetoxin exposure. Effects of brevetoxins on immune cells were investigated in rescued loggerhead sea turtles, Caretta caretta, as well as through in vitro experiments using peripheral blood leukocytes (PBL) collected from captive sea turtles. In rescued animals, plasma brevetoxin concentrations were measured using a competitive ELISA. Plasma lysozyme activity was measured using a turbidity assay. Lysozyme activity correlated positively with plasma brevetoxin concentrations. Differential expression of genes affected by brevetoxin exposure was determined using two separate suppression subtractive hybridization experiments. In one experiment, genes from PBL collected from sea turtles rescued from red tide toxin exposure were compared to genes from PBL collected from healthy captive loggerhead sea turtles. In the second experiment, PBL from healthy captive loggerhead sea turtles were exposed to brevetoxin (500 ng PbTx-2/ml) in vitro for 18 h and compared to unexposed PBL. Results from the subtraction hybridization experiment conducted with red tide rescued sea turtle PBL indicated that genes involved in oxidative stress or xenobiotic metabolism were up-regulated. Using quantitative real-time PCR, a greater than 2-fold increase in superoxide dismutase and thioredoxin and greater than 10-fold increase in expression of thiopurine S-methyltransferase were observed. Results from the in vitro subtraction hybridization experiment indicated that genes coding for cytochrome c oxidases were the major up-regulated genes. Using quantitative real-time PCR, a greater than 8-fold increase in expression of ␤-tubulin and greater than 3-fold increase in expression of ubiquinol were observed. Brevetoxin exposure may have significant implications for immune function in loggerhead sea turtles. © 2009 Elsevier B.V. All rights reserved.

1. Introduction

Abbreviations: AP-1, activator protein-1; AU, absorbance unit; BSA, bovine serum albumin; cDNA, complementary deoxyribonucleic acid; ELISA, enzymelinked immunosorbent assay; FFWCC, Florida Fish and Wildlife Conservation Committee; GSH, reduced glutathione; HC, healthy captive; HEL, hen egg white lysozyme; IACUC, Institutional Animal Care and Use Committee; IgG, immunoglobulin G; IUCN, International Union for Conservation of Nature; MAPK, mitogen-activated protein kinase; MML, Mote Marine Laboratory; NF-␬B, nuclear factor kappaB; Non-RTX-PR, non-red tide rescued pre-release; PBL, peripheral blood leukocytes; PBS, phosphate buffered saline; PBS-T, phosphate buffered saline, 0.1% Tween-20; PbTx-KLH, brevetoxin conjugated to key limpet hemacyanin; PbTx-2, brevetoxin congener 2; PbTx-3, brevetoxin congener 3; PCR, polymerase chain reaction; PGT, phosphate buffered saline, 0.1% Tween-20, 0.5% gelatin; Q-PCR, quantitative real-time polymerase chain reaction; RNA, ribonucleic acid; ROS, reactive oxygen species; RT, reverse transcriptase; RTX, red tide rescued; RTX-PR, red tide rescued rehabilitated pre-release; SOD, superoxide dismutase; SSH, suppression subtraction hybridization; STRH, Sea Turtle Rehabilitation Hospital; Thio-RD, thioredoxin; TMB, 3,3 5,5 -tetramethylbenzidine; TSM, thiopurine S-methyltransferase. ∗ Corresponding author. Tel.: +1 941 388 4441x302; fax: +1 941 388 4312. E-mail address: [email protected] (C.J. Walsh). 0166-445X/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.aquatox.2009.12.014

The loggerhead sea turtle, Caretta caretta, is protected as a threatened species under the U.S. Endangered Species Act (Pritchard, 1997). These marine turtles inhabit waters off the southwestern coast of Florida, with over 90% of loggerhead sea turtles in the U.S. nesting on Florida beaches (Florida Fish and Wildlife Research Institute, 2008). In general, sea turtles are exposed to many threats in their habitat, including loss of habitat from coastal development, disorientation of hatchlings by beachfront lighting, nest predation, watercraft strikes, incidental take from commercial fishing activities, and marine pollution and debris (U.S. Fish and Wildlife Service, 2009). One of the major threats to the sea turtle population off the southwestern coast of Florida is the frequent, almost annual, occurrence of blooms of the toxic dinoflagellate, Karenia brevis. These blooms are often referred to as “red tide” and produce a suite of cyclic polyether neurotoxins, collectively termed brevetoxins, that result in massive fish kills, large numbers of mortalities in sea turtles and marine mammals, contamination of shellfish, and severe respiratory effects in humans.

294

C.J. Walsh et al. / Aquatic Toxicology 97 (2010) 293–303

Beyond mortality, the effects of brevetoxins on sea turtle health are not well-characterized. Although sea turtles are physically robust and able to accommodate severe physical damage, they appear to be surprisingly susceptible to biological and chemical insults (Lutcavage and Lutz, 1997). The effects of many stressors, such as the long-term effects of toxin exposure, are unknown. Sea turtles are exposed to brevetoxins through both inhalation of aerosolized toxins and ingestion of prey items that contain accumulated toxin (Flewelling et al., 2005). It is important to understand the risk that brevetoxin exposure poses to immune function in loggerhead sea turtles as these effects have the potential to affect sea turtle population survival. Mortality associated with red tide toxin exposure has been documented in many species of sea life inhabiting the southwestern coast of Florida, including marine mammals, sea turtles, fish, and aquatic birds. Although mortality often results, it is frequently not observed until weeks or months after exposure, indicating a sublethal component associated with red tide toxin. Brevetoxin exposure was implicated in the deaths of over 150 manatees during an epizootic in 1996 (Bossart et al., 1998). The death of 107 bottlenose dolphins along the Florida Panhandle in 2004 was attributed to red tide toxin exposure through ingestion of contaminated prey (Flewelling et al., 2005). Loggerhead sea turtles have been impacted by red tide blooms as well, with at least 109 loggerhead sea turtle mortalities attributed to red tide toxins during 2005 (A. Foley, pers. comm.) and at least 70 during 2006 (D. Fauquier, pers. comm.). Other than mortality and general symptoms of lethargy and muscle weakness characteristic of brevetoxicosis, effects of red tide toxin exposure on sea turtle health are not well understood. A major concern is that brevetoxins can impact immune function in species naturally exposed in their habitat. Effects of red tide toxin exposure on immune function in sea life have been reported (Bossart et al., 1998; Benson et al., 1999, 2004, 2005; Walsh et al., 2005, 2007, 2009). Brevetoxins have been found within immune cells from a variety of species, including manatees (Bossart et al., 1998), cormorants (Kreuder et al., 2002), and following experimental exposure in laboratory animals (Benson et al., 1999, 2004, 2005). Additional reports indicated a potential inflammatory component associated with brevetoxin exposure in other species (Bossart et al., 1998; Walsh et al., 2007). In other systems, it was also documented that oxidative stress or xenobiotic metabolic pathways were activated in response to brevetoxin (Radwan and Ramsdell, 2006; Walsh et al., 2009). Based on these reports, we hypothesized that brevetoxin exposure may result in inflamma-

Table 1 Blood samples collected from loggerhead sea turtles. HC, healthy captive; RTX, red tide rescue; RTX-PR, red tide pre-release; Non-RTX-PR, non-red tide pre-release. Date

Turtle

Status

Time in captivity or days post-rescue

Various 11/06–2/07 Various 11/06–2/07 Various 11/06–2/07 8/29/06 8/29/06 9/12/06 9/12/06 9/20/06 9/20/06 10/4/06 10/24/06 10/25/06 11/7/06 11/7/06 11/7/06 10/3/07 11/6/07 12/5/07

Shelley Montego Edgar Crumpet O’Hana Zachary Joey Kimmy Rip Bruno Ramona Amber Bruno Joey Zachary Uri Troy Astro

HC HC HC RTX RTX RTX RTX RTX RTX RTX RTX RTX RTX-PR RTX-PR RTX-PR Non-RTX-PR Non-RTX-PR Non-RTX-PR

31 years 31 years 16 years 1d 4d 1d 8d 2d 2d 4d 2d 2d 42 d 68 d 71 d 282 d 92 d 170 d

tory responses and up-regulation of pathways related to oxidative stress or xenobiotic metabolism in peripheral blood leukocytes of loggerhead sea turtles. In the study presented here, immune system effects of brevetoxin exposure were examined in both rescued animals and following in vitro treatment of sea turtle PBL from healthy captive animals. To document level of exposure, concentrations of brevetoxins in rescued sea turtle plasma were measured. To identify potential immune system factors affected by brevetoxins in sea turtles, plasma lysozyme activity was assessed in combination with a genomic approach to identify genes differentially regulated by brevetoxins. Using suppressive subtractive hybridization, genes differentially expressed by environmental exposure to brevetoxin in PBL from rescued sea turtles and in vitro exposure of PBL from healthy captive sea turtles to brevetoxin (PbTx-2) were identified. The effects of brevetoxins on loggerhead sea turtle immune function have not yet been addressed in any published study. 2. Materials and methods 2.1. Animals Blood samples from 18 adult loggerhead sea turtles (Caretta caretta) were utilized in various parts of this study (Table 1). All turtles sampled in this study were treated humanely in accordance with protocols approved by Mote Marine Laboratory Institutional Animal Care and Use Committee (MML IACUC Protocol #CW-2) and with required state and federal permits (FFWCC Marine Turtle Permit TP #126). The loggerhead sea turtles were divided into four categories (Table 1): healthy captive (HC; N = 3), red tide rescued (RTX; N = 9), red tide pre-release (RTX-PR; N = 3), and non-red tide pre-release (Non-RTX-PR; N = 3). Healthy loggerhead sea turtles included three long-term captive sea turtles in residence at Mote Marine Laboratory’s (MML’s) Sea Turtle Rehabilitation Hospital (STRH) and three loggerhead sea turtles that were scheduled for release due to non-red tide related rehabilitation at MML’s STRH. The red tide rescued sea turtles included loggerhead sea turtles that were brought into MML’s STRH for symptoms of brevetoxicosis. The red tide pre-release turtles included sea turtles that were rescued from red tide toxin exposure, successfully rehabilitated, and considered healthy enough for return to the wild. All red tide rescued sea turtles were collected off the southwestern coast of Florida during the months of August through October of 2006 during a large K. brevis bloom event. Rescue sites are shown in Fig. 1. Blood samples collected from healthy captive loggerhead sea turtles, number of days post-rescue that blood was collected from red tide rescued sea turtles, and the number of days post-rescue that blood was collected from turtles scheduled for release after successful rehabilitation (pre-release), are indicated in Table 1. 2.2. Blood collection Blood was collected from the jugular vein using a 21-gauge needle to draw blood into 10 ml sodium heparin Vacutainer® (Becton Dickinson, Franklin Lakes, NJ) tubes and kept cool until processing. Peripheral blood leukocytes (PBL) were collected from the buffy layer within 24 h of blood collection using a slow-spin technique (50 × g for 20 min) modified from Keller et al. (2006). Currently, there are no density gradient methods available for isolation of sea turtle lymphocytes (Harms et al., 2000). PBL were transferred to a sterile 15-ml conical centrifuge tube and centrifuged at 300 × g for 10 min to pellet PBL and separate plasma. Plasma was transferred to cryovials and frozen at −80 ◦ C for lysozyme and brevetoxin analyses. PBL were washed with 10 ml sterile PBS, pelleted, and counted. Depending on the experiment, PBL were either placed directly into

C.J. Walsh et al. / Aquatic Toxicology 97 (2010) 293–303

295

of hen egg white lysozyme (HEL; Sigma, St. Louis, MO) was prepared in 0.1 M phosphate buffer (pH 5.9), and aliquots frozen until use. A solution of Micrococcus lysodeikticus (Sigma) was prepared fresh daily by dissolving 50 mg of lyophilized cells in 100 ml of 0.1 M phosphate buffer (pH 5.9). HEL was serially diluted in phosphate buffer to produce a standard curve of 0–40 ␮g/ml. Aliquots of each concentration (25 ␮l/well) were added to a 96-well plate in triplicate. For each sample, 25 ␮l of test plasma was added in quadruplicate to the plate. The solution of M. lysodeikticus (175 ␮l/well) was quickly added to three sample wells and to each of the standard wells. The fourth well containing plasma received 175 ␮l phosphate buffer and served as a blank. Absorbance at 450 nm was measured using a microplate reader (BioTek, ELx800). Readings were conducted immediately (T = 0) and after 5 min (T = 5). Absorbance unit (AU) values at T = 5 were subtracted from AU values at T = 0 to determine the change in absorbance. The AU value for the blank sample well was subtracted from the average of the triplicate sample wells to compensate for any hemolysis in the samples. The resulting AU value was converted to HEL concentration (␮g/ml) by linear regression of the standard curve. 2.5. Suppression subtraction hybridization

Fig. 1. Locations of rescue sites of red tide toxin exposed loggerhead sea turtles whose blood was available for this study. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of the article.)

1 ml RNA-Bee (Tel-Test, Friendswood, TX) for RNA extraction or placed into cell culture for in vitro brevetoxin exposure of PBL.

Two separate suppression subtraction hybridization (SSH) experiments were conducted in forward and reverse directions to obtain both up- and down-regulated genes in sea turtle PBL as a result of exposure to brevetoxin. One SSH experiment was conducted with PBL collected from loggerhead sea turtles that were rescued due to symptoms of red tide toxin exposure (brevetoxicosis) and brought into Mote Marine Laboratory’s Sea Turtle Rehabilitation Hospital (MML STRH) for treatment. Genes in these PBL were compared to genes isolated from PBL collected from healthy captive loggerhead sea turtles maintained at MML. The second SSH experiment was an in vitro exposure of loggerhead sea turtle PBL to brevetoxin. Blood from three captive loggerhead sea turtles was collected and divided into two separate cultures. One culture was treated with brevetoxin while the second culture was the control.

2.3. Brevetoxin analysis 2.6. SSH experiment with PBL from rescued loggerhead sea turtles Plasma brevetoxin concentrations were analyzed using modifications of a competitive ELISA described by Naar et al. (2002). A brevetoxin ELISA kit was purchased from World Ocean Solutions (Wilmington, NC). This kit uses anti-brevetoxin goat polyclonal antibodies with PbTx-KLH constructs as described (Trainer and Baden, 1991). Briefly, plates were coated with BSA-linked PbTx3. Samples and standards (PbTx-3) were added in serial dilution, with a minimum of eight dilutions for each curve. All dilutions were diluted in PGT (PBS, 0.1% Tween and 0.5% gelatin). Sample dilutions were added in 100 ␮l volume to each well, including standards and a blank. Goat anti-PbTx-3 was added in 100 ␮l volume and plates incubated at room temperature for 1 h using an orbital shaker. After several washes in PBS-T (PBS, 0.1% Tween), a secondary antibody, rabbit anti-goat biotinylated IgG, was added and incubated for 1 h at room temperature. After washing again with PBS-T, TMB (3,3 ,5,5 -tetramethylbenzidine) substrate was added for 1–1.5 min. The reactions were stopped by adding 100 ␮l of 0.5 M sulfuric acid. Absorbance was read at 450 nm using a microplate reader (BioTek ELx800, Winooski, VT). The concentrations of brevetoxins in plasma were determined using a standard curve. 2.4. Lysozyme activity Lysozyme activity was measured in plasma samples using modifications of standard turbidity assays performed by Demers and Bayne (1997) and Keller et al. (2006). A 1 mg/ml stock solution

For this experiment, PBL were isolated from two rescued loggerhead sea turtles (O’Hana and Crumpet) and three healthy captive (Shelly, Montego, and Edgar) loggerhead sea turtles (see Table 1). Approximately 15 × 106 PBL from each turtle were isolated, pelleted, and resuspended in RNA-Bee (Tel-Test, Friendswood, TX). After cell pellets were completely dissolved, samples were stored at −80 ◦ C. Total RNA was isolated using protocols recommended by the manufacturer. Briefly 200 ␮l chloroform was added to thawed samples and vortexed for 30 s. Samples were centrifuged at 12,000 × g for 15 min at 4 ◦ C. The aqueous phase was aspirated into an RNase-free microfuge tube. Isopropanol, 500 ␮l, was added, samples vortexed and incubated at room temperature for 8 min. Samples were centrifuged at 12,000 × g for 5 min at 4 ◦ C, and the supernatant removed. Pellets were washed twice with 1 ml 75% ethanol. After the second wash, the supernatant was removed and the pellet allowed to air dry for 5 min. The pellet was resuspended in RNase-free water. RNA concentration and quality were measured by absorbance at 260/280 nm using a NanoDrop Spectrophotometer (NanoDrop Technologies, Model ND-1000, Wilmington, DE). Equal quantities of total RNA from exposed or non-exposed sea turtle PBL were pooled. One pooled sample (2 ␮g) was comprised of 1 ␮g total RNA from each of two red tide exposed turtles (O’Hana and Crumpet). A second pooled sample (3 ␮g) was comprised of 1 ␮g total RNA from three control animals (Shelly, Montego, and Edgar).

296

C.J. Walsh et al. / Aquatic Toxicology 97 (2010) 293–303

2.7. In vitro SSH experiment with exposure of loggerhead sea turtle PBL to brevetoxin Blood was collected from three captive loggerhead sea turtles (Shelly, Montego, Sy). PBL were isolated as described. PBL from each turtle were divided into two separate cultures. One culture was treated with 500 ng PbTx-2/ml (brevetoxin-treated). The second culture was treated with ethanol (0.04%, v/v) as vehicle control. Cells were cultured at 2.5 × 106 cells/ml for a total of 5 × 106 cells used per treatment. Cell culture medium was RPMI 1640 (Sigma Chemical Co., St. Louis, MO) adjusted to pH 7.4 and containing 10% fetal bovine serum (FBS, Hyclone Laboratories, Logan, UT). Cultures were incubated for 18 h at 29 ◦ C, 5% CO2 , and then harvested by centrifugation. RNA was isolated as described above. RNA was pooled separately for control and treatment cultures. The subtraction experiment was performed using a pooled sample of 1 ␮g total RNA for each population (control and treatment). Subtractive hybridizations were constructed using Clontech’s (Palo Alto, CA) kits following manufacturer’s recommendations as outlined below. The Super SMART PCR cDNA synthesis kit (Clontech, Mountain View, CA) was used to generate full-length single-stranded cDNA from 1 ␮g starting material. Following first strand synthesis, cDNA was purified using Chroma Spin 1000 DEPCH2 O columns, digested with Rsa I, and then purified (NucleoTrap PCR Kit, Clontechn, Moutain View, CA). After purification, a standard SSH protocol was followed. Tester and driver cDNAs were separated into two portions, each of which was ligated with different cDNA adapter sequences. Two sequential hybridizations were performed. For the first hybridization, excess driver was added to each tester pool, the samples were heat denatured and then allowed to anneal, resulting in generation of several different hybrid cDNA sequences. For the second hybridization, the two different tester pools were combined in the presence of an excess of driver without denaturing and new hybrids formed. The ends of the differentially expressed cDNA sequences were filled in using DNA polymerase and two rounds of PCR. cDNA clones resulting from PCR reactions were shotgun ligated into pGEM T-Easy cloning vector (Promega, Madison, WI), transformed into DH5␣ cells, and plated onto Luria–Bertani (LB) agar plates containing ampicillin and oxacillin (100 ␮g/ml each). Recombinant colonies were picked from plates and sequenced in 96-well high-throughput format using standard methods (ICBR Sequencing Core Facility, University of Florida). Sequences with base calls of Q20 or higher were kept, and cloning vec-

tor removed. Each sequence was annotated by comparing it to known sequences in publicly available databases. Searches were performed against the SwissProt and the non-redundant protein sequence databases at the National Center for Biotechnology Information (NCBI) using the Basic Local Alignment Search Tool (BLASTX: translated nucleotide query to search the protein database) (http://www.ncbi.nlm.nih.gov/BLAST) to provide gene annotation (Altschul et al., 1997). An expectation (E) value of 1E−4 or lower was used to signify a positive match to a gene or protein in one of these databases. Functional categories of up- and down-regulated genes were assigned according to the AmiGO Gene Ontology website (http://amigo.geneontology.org/). 2.8. Quantitative real-time PCR of up-regulated gene sequences Based on results from the SSH, we selected a few genes that were up-regulated in each experiment for further testing by Q-PCR. Expression levels of 18S ribosomal RNA were used to normalize gene expression. For each of these selected genes, multiple primer sets were designed using Primer Express software (Applied Biosystems, Foster City, CA). Each primer set was synthesized (MWG Biotech Inc., High Point, NC) and tested for optimum efficiency. For initial testing of primers, a single pooled sample of total RNA from the exposed and control sea turtles was reverse transcribed to single-strand cDNA using random primers and Multiscribe reverse transcriptase according to manufacturer’s instructions (Applied Biosystems, #4322171). An additional 0.5 ␮g of pooled total RNA was added to an identical cocktail, but no RT enzyme was added (“No RT”, negative control). The following cycle parameters were used for this reaction: 25 ◦ C for 10 min, 37 ◦ C for 120 min, and hold at 4 ◦ C. Initial testing of primers was accomplished in duplicate using a 2-fold serial dilution (200, 100, 50, 25, 12.5, and 6.25 ng) of pooled loggerhead sea turtle cDNA plus no template controls and no RT control reactions to generate standard curves. Q-PCR reactions were identical for all genes and consisted of cDNA, SYBR Green Master Mix (Applied Biosystems, #4309155), forward and reverse primers, and nuclease-free water. An Applied Biosystems 7500 thermocycler was used with the following cycle parameters: one cycle of 50 ◦ C for 2 min, one cycle of 95 ◦ C for 10 min, and 40 cycles of 95 ◦ C for 15 s and 60 ◦ C for 60 s, followed by a dissociation run. PCR conditions and primers were evaluated for optimum efficiency (data not shown). Sequences of the final primers selected for use in real-time experiments are shown in Table 4.

Fig. 2. Brevetoxin concentration and lysozyme activity in plasma of loggerhead sea turtles. Non-RTX, N = 3; Pre-R, N = 3; RTX, N = 9. *RTX is significantly (P < 0.05) greater than non-RTX. +RTX is significantly (P < 0.05) greater than Pre-R. Statistical significance was determined using one-way ANOVA. Data are presented as means ± standard error of the mean.

C.J. Walsh et al. / Aquatic Toxicology 97 (2010) 293–303

297

2.9. Q-PCR of genes in PBL collected from red tide rescued loggerhead sea turtles Q-PCR was conducted on three genes that were up-regulated. These genes included copper–zinc superoxide dismutase (SOD), thioredoxin (Thio RD), and thiopurine S-methyltransferase (TSM). For experimental Q-PCR, five sea turtle samples (two exposed and three control) were run against three primer sets and 18S. For each sample, 1 ␮g of total RNA from exposed and control sea turtles was reverse transcribed to single-strand cDNA as described above. 2.10. Q-PCR of genes in sea turtle PBL exposed to brevetoxin in vitro Based on results from the SSH conducted using PBL exposed to brevetoxin in vitro, two genes were identified for Q-PCR analysis: ubiquinol–cytochrome c oxidase subunit 3 complex III subunit VI and ␤-tubulin, both of which were putatively up-regulated in the treatment group. For experimental Q-PCR, six sea turtle samples were run with two primer sets and 18S. For each sample, 1.7 ␮g total RNA from exposed and control sea turtles was reverse transcribed to single-strand cDNA as described above. 2.11. Data analysis and statistics Statistical analyses were conducted using SigmaStat, Version 3.1. All data were checked for normality. Nonparametric analyses were conducted when data did not pass normality tests. Statistical significance was determined using Student’s t-test or one-way ANOVA, as appropriate. In Fig. 2, data are reported as mean ± standard error of the mean. Q-PCR gene expression data for sea turtle PBL were normalized to 18S ribosomal RNA expression. Analysis of normalized gene expression was evaluated by t-test. Duplicate samples were averaged and normalized using a Ct method of analysis. Mean control was subtracted from mean treated to determine fold-change in treated cells. Amplification curves were examined individually to ensure replication and outliers were removed. 3. Results 3.1. Animals Rescued sea turtles were identified as suffering from red tide toxicity (brevetoxicosis) by experienced veterinarians at MML’s STRH. On rescue, sea turtles displayed symptoms characteristic of brevetoxicosis, such as lethargy and muscle weakness (D. Fauquier, pers. comm.). Suspected red tide toxicity was confirmed by determining levels of red tide toxin in blood (D. Fauquier, pers. comm.). 3.2. Plasma brevetoxin levels Concentrations of brevetoxins in the plasma of rescued, prerelease, and non-red tide exposed loggerhead sea turtles are shown in Fig. 2. Using one-way ANOVA, brevetoxin concentrations in RTX turtles were determined to be significantly greater (P < 0.05) than non-RTX and RTX-PR (P = 0.017 and 0.025, respectively). 3.3. Plasma lysozyme activity Lysozyme activity in plasma of rescued, pre-release, and nonred tide exposed loggerhead sea turtles is shown in Fig. 2. Using one-way ANOVA, lysozyme activity was determined to be significantly greater (P < 0.05) in RTX turtles than non-RTX, but not RTX-PR.

Fig. 3. Scatterplot of lysozyme activity vs. brevetoxin concentration (r2 = 0.64, P = 0.009) in plasma of loggerhead sea turtles. Lysozyme activity was measured using a standard turbidity assay and total brevetoxins were measured using ELISA. Linear trend line demonstrates the positive relationship determined using the Spearman rank correlation.

3.4. Correlation of plasma lysozyme activity and brevetoxin levels Lysozyme activity in plasma samples from the 15 animals assessed for brevetoxin concentrations were measured. Plasma lysozyme activity correlated positively with plasma brevetoxin concentrations, r2 = 0.64, P = 0.009. These data are shown in Fig. 3. 3.5. Results of the suppression subtractive hybridization conducted using PBL from red tide rescued loggerhead sea turtles A suppression subtractive hybridization experiment was conducted to determine differential expression of genes in PBL of rescued loggerhead sea turtles compared with genes in PBL of healthy captive loggerhead sea turtles. In both up- and downregulated genes, there were 59 ‘no hit’ and 133 identifiable sequences. Only 37 sequences had an E value of less than 1 × 10−4 . After eliminating redundant sequences, only 20 gene sequences remained that were putatively up-regulated and one that was putatively down-regulated. These genes, and the species that the sequences are most closely homologous with, are listed Table 2. None of the sequences identified were in both up- and downregulated gene populations. Functional categories were assigned based on definitions obtained from the AmiGO Gene ontology website (http://amigo.geneontology.org/) and are shown in Table 3. In PBL collected from rescued sea turtles, the primary functional categories included oxidoreductase activity, signaling, translational elongation, metabolic processes, cytoskeletal, cell differentiation, cell respiration, protein degradation and methyltransferase activity. Two gene sequences, nucleolar protein 9 and hypothetical protein C28F2.02 in chromosome II, could not be assigned functions. The functional category with the most identified gene sequences was oxidoreductase activity and included superoxide dismutase [Cu–Zn], thioredoxin, thioredoxin 1, NADH–ubiquinone oxidoreductase chain 4 and ferritin heavy chain. Genes involved in cell signaling were another major category and included cdc42interacting protein 4, BMP and activin-bound inhibitor homolog, and predicted: similar to zinc finger CCCH-type containing15. Translational elongation was also predominantly affected and included genes coding for 40S ribosomal protein S3a, 60S ribosomal protein L23a, eukaryotic translation initiation factor 3 subunit, and small nuclear ribonucleoprotein E. Other categories included metabolic processes, cytoskeletal, cell differentiation,

298

C.J. Walsh et al. / Aquatic Toxicology 97 (2010) 293–303

Table 2 Genes differentially expressed in PBL isolated from loggerhead sea turtles. Gene title

E value

Homologous species

BLAST database

Rescued from red tide exposure Increased expression 40S ribosomal protein S3a 60S ribosomal protein L23a BMP and activin membrane-bound inhibitor homolog precursor Cdc42-interacting protein 4 Coiled-coil-helix-coiled-coil-helix domain-containing protein 2 Eukaryotic translation initiation factor 3 subunit 5 (eIF-3 epsilon) Ferritin heavy chain Myogenesis-related and NCAM-associated protein NADH–ubiquinone oxidoreductase chain 4 Nucleolar protein 9 Predicted: similar to nucleolar protein 9 Predicted: similar to zinc finger CCCh-type containing 15 Proactivator polypeptide precursor Proteasome subunit beta type 1 Ribulose-phosphate 3-epimerase (ribulose-5-phosphate-3-epimerase) Small nuclear ribonucleoprotein Superoxide dismutase [Cu–Zn] Thiopurine S-methyltransferase Thioredoxin Thioredoxin 1 Vimentin

2.85E−130 3.93E−68 8.10E−78 6.91E−71 2.76E−12 4.74E−28 2.42E−75 601E−31 5.81E−33 3.69E−09 6.11E−15 1.16E−57 1.45E−37 4.06E−16 3.19E−73 1.82E−33 5.83E−47 1.31E−41 2.10E−40 1.16E−37 4.51E−45

Mus musculus Homo sapiens Homo sapiens Homo sapiens Macaca fascicularis Mus musculus Gallus gallus Coturnix japonica Caretta caretta Homo sapiens Monodelphis domestica Ornithorhynuchus anatinus Gallus gallus Homo sapiens Homo sapiens Homo sapiens Caretta caretta Canis familiaris Gallus gallus Melopsittacus undulatus Homo sapiens

SwissProt SwissProt SwissProt SwissProt SwissProt SwissProt SwissProt Non-redundant SwissProt SwissProt Non-redundant Non-redundant SwissProt SwissProt SwissProt SwissProt SwissProt SwissProt SwissProt Non-redundant SwissProt

1.46E−45

Homo sapiens

SwissProt

3.36E−106 5.06E−56 9.29E−05 2.02E−32 5.08E−26 4.52E−36

Paracentrotus lividus Chelonia mydas Platemys spixii Paracentrotus livideus Bos taurus Gallus gallus

SwissProt SwissProt Non-redundant SwissProt SwissProt SwissProt

7.49E−14 2.00E−07 1.60E−14 3.45E−39 2.26E−05 1.99E−05

Homo sapiens Danio rerio Xenopus laevis Gallus gallus Rattus norvegicus Gallus gallus

SwissProt Non-redundant Non-redundant Non-redundant Non-redundant Non-redundant

Decreased expression Tripeptidyl peptidase In vitro brevetoxin exposure Increased expression Cytochrome c oxidase subunit 1 Cytochrome c oxidase subunit 3 ORF1 Tubulin beta chain Ubiquinol–cytochrome c reductase Zinc finger CCCH 11A Decreased expression Hypothetical protein C2orf12 (cervical cancer oncogene 4) (HCC-4) Hypothetical protein LOC552941 LOC733342 protein Predicted: hypothetical protein Predicted: similar to trophonin isoform 1 Unknown

protein degradation. There was only one down-regulated gene, tripeptidyl peptidase 2, which is involved in proteolysis. 3.6. Results from suppression subtractive hybridization conducted with in vitro brevetoxin-exposed loggerhead sea turtle PBL A suppression subtractive hybridization experiment was conducted to determine differential expression of genes in loggerhead sea turtle PBL following in vitro exposure to brevetoxin (PbTx-2). In up-regulated genes, there were 93 ‘no hit’ and 31 identifiable sequences, while in down-regulated genes, there were 75 ‘no hit’, with three identifiable and 46 hypothetical or unknown sequences. After eliminating redundant genes and using an expectation value of 1 × 10−4 , six genes were found to be up-regulated in loggerhead sea turtle exposed to 500 ng PbTx-2/ml and six genes were found to be down-regulated. These results are shown in Table 2 and include E value and species to which the obtained sequence is most closely homologous. Following in vitro exposure of sea turtle PBL to PbTx-2, main categories of genes affected included oxidoreductase activity, cytoskeletal, protein or nucleic acid binding or cell adhesion. The functional category with the largest number of genes was related to oxidoreductase activity. Genes in this category included cytochrome c oxidases I and III, and ubiquinol–cytochrome c reductase complex 14 kDa protein. Other genes that were up-regulated included those with cytoskeletal (␤-tubulin) or protein or nucleic

acid binding (zinc finger CCCH-type domain-containing protein 11). Based on definitions obtained from AmiGO Gene Ontology website (http://amigo.geneontology.org/), cytochrome c oxidase is the component of the respiratory chain that catalyzes the reduction of oxygen to water. Subunits 1–3 form the functional core of the enzyme complex, with cytochrome c oxidase I the catalytic subunit of the enzyme. Ubiquinol–cytochrome c reductase complex III subunit VI is associated with the mitochondrial membrane. In humans, tubulin beta chain is involved in cell motility or natural killer cell mediated cytotoxicity. ORF-1 assembles actin filament bundles. Six genes were down-regulated, with assigned functions in RNA processing or cell adhesion and four genes that could not be assigned a function. One of the down-regulated genes included a gene similar to trophinin isoform 1. Trophinin functions in cell adhesion. 3.7. Quantitative real-time PCR (Q-PCR) with PBL from rescued sea turtles Three of the up-regulated genes, with functions related to oxidoreductase activity or methyltransferase activity, were selected for further analysis using real-time Q-PCR. The three genes selected include thioredoxin (Thio RD), Cu–Zn superoxide dismutase (SOD), and thiopurine S-methyltransferase (TSM). The primers used to conduct Q-PCR are shown in Table 4. The results of Q-PCR analysis of expression of these genes are shown in Table 5. The control group for these experiments was PBL isolated from non-red tide

C.J. Walsh et al. / Aquatic Toxicology 97 (2010) 293–303

299

Table 5 Fold-changes in gene expression, as measured by Q-PCR in PBL from sea turtles rescued from red tide toxin exposure and in sea turtle PBL exposed to red tide toxin in vitro. Gene expression data is normalized to 18S gene expression.

Table 3 Functional categories of up- and down-regulated genes from SSH. PBL from rescued sea turtles Up-regulated Oxidoreductase activity Ferritin heavy chain, NADH–ubiquinone oxidoreductase chain 4, superoxide dismutase [Cu–Zn], thioredoxin, thioredoxin 1 Signaling Cdc42-interacting protein 4, BMP and activin membrane-bound inhibitor homolog precursor, PREDICTED: similar to ZN finger CCCH-type containing 15

Gene

Fold-change

P value

Rescued Copper–zinc superoxide dismutase Thioredoxin Thiopurine S-methyltransferase

2.38 2.65 10.12

0.22 0.14 0.07

8.58 3.11

0.08 0.28

In vitro ␤-Tubulin Ubiquinol

Translational elongation 40S ribosomal protein S3a, 60S ribosomal protein L23a, eukaryotic translation initiation factor 3 subunit, small nuclear ribonucleoprotein E Metabolic processes Proactivator polypeptide precursor, ribulose-phosphate 3-epimerase

(Non-RTX) sea turtles. Although expression of SOD and Thio RD genes is more than 2-fold greater and expression of TSM gene is 10-fold greater, these differences are not significant, with P values of 0.22, 0.14, and 0.07 respectively. This lack of significance is likely the result of small sample size (two vs. three animals) and inherent biological variability in each individual.

Methyltransferase activity Thiopurine S-methyltransferase Cytoskeletal, cell motion Vimentin Cell respiration Coiled-coil-helix-coiled-coil-helix domain-containing protein 2

3.8. Q-PCR following in vitro subtraction

Protein degradation Proteasome (prosome, macropain) subunit, beta type 1 Cell differentiation FAM65B Unknown Nucleolar protein 9, hypothetical protein C28F2.02 in chromosome II Down-regulated Proteolysis Tripeptidyl peptidase 2 In vitro exposure of PBL to brevetoxin Up-regulated Oxidoreductase activity Cytochrome c oxidase I, cytochrome c oxidase III, ubiquinol–cytochrome c reductase complex 14 kDA protein Cytoskeletal, cell motion ␤-Tubulin Protein or nucleic acid binding Zn finger 11A Unassigned ORF1 Down-regulated RNA processing Hypothetical protein C2orf12 (RNA-binding motif, single-stranded-interacting protein 1) Cell adhesion Predicted: similar to trophinin isoform 1

Primers designed to sequences of two genes that were observed to up-regulated in the in vitro suppression subtractive hybridization experiment are shown in Table 4. These genes were ␤-tubulin and ubiquinol–cytochrome c oxidase subunit 3 complex III subunit VI. Q-PCR gene expression analysis was normalized to the ribosomal protein 18S gene expression. Two t-tests (1-tailed distribution, unequal variance and 2-tailed distribution, unequal variance) were performed on exposed and control samples for each primer. The control group for these experiments was PBL isolated from nonred tide (Non-RTX) sea turtles treated with ethanol in place of brevetoxin for 18 h. Expression of ␤-tubulin was increased more than 8-fold after red tide exposure, although this difference was not statistically significant (P = 0.085). Expression of ubiquinol was approximately 3-fold greater after red tide exposure, although this difference was also not statistically significant (P = 0.277). These results are summarized in Table 5. The variability among the six samples was greater between animals than between groups, which may explain why significant differences in gene expression were not observed. These animals may not be similar enough to overcome biological variability due to sex, age, reproductive status, and health status. Since this was an in vitro exposure, the amount and duration of red tide toxin exposure was consistent among animals. 4. Discussion

Unassigned Hypothetical protein LOC552941, LOC733342 protein, predicted: hypothetical protein, Unknown Table 4 Primers used in Q-PCR to analyze up-regulation of selected gene sequences in loggerhead sea turtle PBL. 18S ribosomal RNA expression was used to normalize gene expression. Primer name

Primer sequence

Tm

Length

%GC

SOD F1 SOD R1 Thio RD F2 Thio RD R2 TSM F1 TSM R1 ␤-Tubulin F1 ␤-Tubulin R1 Ubiquinol F1 Ubiquinol R1

TCAATCCTAATGGCAAAAACCA CAGCAATCACATTGCCAAGATC AGTTGTTGACTTCTCAGCCAAATG TGGGAACCTCTCACAAAGACTATG GTAGCCATTAACCCATGTGATAGAGA AACACTAACCAAGAGATAACAACAGCTT TGTTCAAGAGAATCTCTGAGCAGTTC CCAGTGCAAGAAAGCCTTACG AGAGAAGAGTGGGACAGGAAGTAACT TGTTAGAAAGAAATGCAGCAGCTT

57 61 61 63 63 62 59 68 58 58

22 22 24 24 26 28 26 21 26 24

36 45 42 46 42 36 42 52 46 38

Loggerhead sea turtles are classified as a threatened species (IUCN, 2008) and inhabit areas where frequent harmful algal blooms occur. Therefore, it is important to understand how marine toxins, specifically brevetoxins, potentially impact the health of loggerhead sea turtles. Sea turtles are long-lived animals, with a comparatively slow metabolic rate (Milton and Lutz, 2003); consequently, the cumulative effect of exposure to stressors such as brevetoxins may result in considerable impact. Moreover, in addition to brevetoxin exposure through normal inhalation, the pre-dive breathing pattern of these animals, with large tidal volume and rapid inhalation, may result in increased exposure to marine biotoxin aerosols produced by dinoflagellate blooms. In this study, we examined effects of brevetoxin exposure on loggerhead sea turtle immune responses using plasma lysozyme activity and by conducting two suppression subtractive hybridization experiments. Suppression subtractive hybridization experiments were followed by Q-PCR analysis.

300

C.J. Walsh et al. / Aquatic Toxicology 97 (2010) 293–303

4.1. Lysozyme Many contaminants have been reported to alter lysozyme activity in marine species, including PCBs in fish (Burton et al., 2002; Hutchinson et al., 2003) and organochlorine contaminants in sea turtles (Keller et al., 2006). Circulating lysozyme is a measure of innate immunity, has antibacterial properties, and is a marker for pro-inflammatory responses (Burton et al., 2002; Weeks et al., 1992). Lysozyme has been reported to play a role in oxidative stress as well (Liu et al., 2006). Elevated lysozyme in plasma collected from rescued sea turtles exhibiting signs of brevetoxicosis, suggests that the immune system of loggerhead sea turtles is modulated by environmentally relevant concentrations of brevetoxins. 4.2. Suppression subtractive hybridization Genomic techniques allow for simultaneous and sensitive assessment of multiple biochemical pathways and potentially lead to tools valuable in investigating cellular mechanisms affected by toxicant exposure (Klaper and Thomas, 2004). Suppression subtractive hybridization (Diatchenko et al., 1996) can identify genes and proteins differentially regulated by various treatments. A similar approach was recently used to study gene expression profiles in bottlenose dolphin skin cells following exposure to methylmercury or perfluorooctane sulfonate (Mollenhauer et al., 2009). In the present study, we used this genomic approach to determine if gene expression patterns might provide insight into the mechanisms by which brevetoxins affect immune function in loggerhead sea turtles. Overall, observed changes in gene expression profiles suggest that brevetoxins alter normal gene expression patterns in sea turtle PBL following both natural and in vitro exposure, with a predominance of up-regulated genes in brevetoxin-exposed cells. Following brevetoxin exposure, changes in expression of genes associated with oxidative stress response, cell signaling, and protein translation were observed. Such changes in gene expression profiles indicate that brevetoxin exposure to loggerhead sea turtle PBL can significantly alter normal cellular functioning. With regard to down-regulated genes, only a gene involved in proteolysis (rescued) and a few involved in RNA processing or cell adhesion (in vitro), were identified. 4.3. Oxidoreductase activity Genes with roles in oxidative stress were up-regulated following brevetoxin exposure. These included NADH–ubiquinone oxidoreductase, superoxide dismutase, thioredoxin, and ferritin heavy chain in PBL from rescued turtles and cytochrome c oxidases I and III and ubiquinol–cytochrome c reductase complex following in vitro exposure of sea turtle PBL to brevetoxin. Oxidoreductases catalyze redox reactions and are involved in redox balance and oxidative stress. NADH–ubiquinone oxidoreductase plays a role in oxidative signaling (Kaminski, 2007). Superoxide dismutases are a class of enzymes that catalyze dismutation of superoxide into oxygen and hydrogen peroxide and function as important antioxidant defense molecules. Thioredoxin encodes a member of a family of pyridine nucleotide oxidoreductases involved in oxidation/reduction. Thioredoxin is a protein thiol involved in one of the two major systems, involving either thioredoxin or glutathione, which function in maintaining cellular redox status (Holmgren, 1989). Ferritin heavy chain serves a cytoprotective role by sequestering iron molecules and preventing them from acting as catalysts in free oxygen radical formation (Pietsch et al., 2003). Induction of ferritin has been linked to enhanced cellular protection against oxidant and xenobiotic induced injury (Orino et al., 2001; Cozzi et al., 2000). Cytochrome c oxidases I and III and ubiquinol–cytochrome c reductase complex

encode components of the respiratory chain and are involved in oxidative signaling (Dröse and Brandt, 2008). Up-regulation of genes involved in oxidoreductase activity indicates brevetoxins may be eliciting an oxidative stress response. The suggestion of oxidative stress occurring in loggerhead sea turtles exposed to brevetoxins is supported by previous studies with mammalian immune cells in which depletion of intracellular glutathione was observed in response to brevetoxin treatment (Walsh et al., 2009). Potential oxidative stress effects observed with brevetoxins in the present study are also similar to those observed with another neurotoxin produced by algal blooms, domoic acid. The toxic mechanism of domoic acid is believed to be mediated at the level of the mitochondria, where uncoupling of oxidative phosphorylation decreases membrane permeability, causing cell swelling and ultimately, lysis (Pinto-Silva et al., 2008). Since cellular redox states potentially affect many cellular functions, the observation that brevetoxin may potentially elicit oxidative stress in immune cell targets has important implications for the health of loggerhead sea turtles. In addition, oxidative stress itself can lead to or result from certain inflammatory conditions. 4.4. Cytoskeletal components Two genes coding for proteins that comprises components of the cytoskeleton, vimentin (rescued) and ␤-tubulin, were upregulated following in vitro brevetoxin exposure. Cytoskeletal elements are involved in many cellular functions, including cell motility and proliferation, and cell adhesion. Vimentin encodes a member of the intermediate filament family which, together with microtubules and actin microfilaments, comprise the cytoskeleton (Strelkov et al., 2002). In addition to many cytoskeletal roles, vimentin also participates in many cellular functions, including the immune response, cell attachment, migration and signaling processes (Strelkov et al., 2002; Mor-Vaknin et al., 2003). Activated macrophages have been reported to secrete vimentin in response to the pro-inflammatory cytokine TNF-␣ (Mor-Vaknin et al., 2003). Secreted vimentin is involved in bacterial killing and production of oxidative metabolites (Mor-Vaknin et al., 2003). ␤-Tubulin, a protein component of microtubules, is involved in a wide variety of cell processes including mitosis, cell motility, and natural killer cell mediated cytotoxicity (Tarazona et al., 2000; Banerjee et al., 2007). The integrity of microtubules is essential for segregation of chromosomes during cell division, maintenance of cell shape, cell motility, and intracellular trafficking of macromolecules and organelles (Dutcher, 2001). Many proteins that interact with tubulins are involved in oxidative stress (Cicchillitti et al., 2008) and cytoskeleton remodeling is a redox-dependent process linked to glutathionylation (Fiaschi et al., 2006). 4.5. Cell signaling Genes coding for signaling proteins, including some involved in cellular proliferation, were also up-regulated. These included cdc42-interacting protein 4, BMP and activin membrane-bound inhibitor homolog precursor (BAMBI), and a gene predicted to be similar to zinc finger CCCH-type containing 15. In humans, cdc42-interacting protein is a member of the Rho-subfamily which regulates signaling pathways, including mitogen-activated protein kinase (MAPK) signaling (Szczur et al., 2006), and controls diverse cellular functions including cell morphology, migration, endocytosis, and cell cycle progression. Cytoskeletal elements, i.e., vimentin and cdc42-interacting protein 4 (Banerjee et al., 2007), also participate in intracellular signal transduction (Janmey, 1998). BAMBI is a gene which encodes transmembrane glycoproteins which are related to receptors of the TGF-family, whose members play important roles in many signal pathways. Activin also plays a role in

C.J. Walsh et al. / Aquatic Toxicology 97 (2010) 293–303

inflammatory processes (Phillips et al., 2009). Similar genes are also known to activate serine/threonine kinase pathways (Balemans and Van Hul, 2002). 4.6. Other up-regulated genes Other genes that were putatively up-regulated in brevetoxinexposed sea turtle PBL include genes that code for the enzyme thiopurine S-methyltransferase, several genes involved in protein translational processes, and a few genes that could not be assigned sequences through the AmiGO Gene Ontology website. Thiopurine S-methyltransferase encodes an enzyme that participates in drug metabolism (Honchel et al., 1993), and up-regulation of this gene in brevetoxin-exposed animals may potentially indicate an activation of important drug metabolic processes. Thiopurine S-methyltransferase activity generates metabolites which are transported by certain transporter proteins (Wielinga et al., 2002). Other research has shown that genes coding for transporter proteins were activated in in vitro experiments with shark immune cells in response to brevetoxin (Walsh et al., unpublished data). Effects of brevetoxin exposure on genes involved in protein translation suggest that brevetoxin exposure may impact these important cellular processes as well. Proactivator polypeptide precursor encodes prosaposin, the precursor of saposins A, B, C, and D, which activate lysosomal hydrolysis of sphingolipids (Hiraiwa et al., 1992). Prosaposin has been shown to induce extracellular signal-regulated kinase phosphorylation (Sorice et al., 2008). Genes involved in cell respiration, cell differentiation, and protein degradation were also putatively up-regulated.

301

loggerhead sea turtles, and previous data existed utilizing this measurement as a measure of stress response in sea turtles (Keller et al., 2006). Since the capacity to assess other immune function indicators in sea turtle blood was extremely limited, we chose to analyze lysozyme activity as a measure of general impact of brevetoxin exposure on the immune system. SSH experiments were conducted to further identify molecular pathways that might be impacted by brevetoxin exposure and to direct future studies, particularly since this was the first investigation into brevetoxin impact on the loggerhead sea turtle immune system. Lysozyme is a member of a well-characterized and widely distributed family of native, highly conserved host-defense proteins, called defensins, which have antibacterial activity (Chipman and Sharon, 1969). Lysozyme is released from neutrophils and macrophages and is considered an inflammatory mediator (Hansen et al., 1972). Liu et al. (2006) also suggest a role for lysozyme in protecting against oxidative stress. Although an increase in lysozyme activity in rescued loggerhead sea turtles was observed, up-regulation of a gene coding for lysozyme was not detected. However, putative up-regulation of genes with functions similar to that of lysozyme, i.e., related to inflammatory processes (BAMBI, proactivator polypeptide precursor, ferritin H chain), bactericidal activity (vimetin), and oxidative stress (superoxide dismutase, NADH–ubiquinone oxidoreductase, thioredoxin, etc.), was observed. 4.10. Rescued vs. in vitro SSH

In an attempt to confirm up-regulation of genes from the SSH conducted on red tide rescued sea turtle PBL, relative quantitative expression of three genes – thiopurine S-methyltransferase, thioredoxin, and Cu–Zn superoxide dismutase – was measured compared to PBL from healthy captive sea turtles. Although the differences were not statistically significant, all three genes were up-regulated by at least 2-fold. The absence of statistical significance may have been a reflection of the low number of animals available for investigation, as well as animal-to-animal variability with regard to gender, age, and extent of brevetoxin exposure. QPCR was also conducted in an attempt to confirm up-regulation of genes, ␤-tubulin and ubiquinol–cytochrome c oxidase, resulting from the in vitro SSH. As with the SSH conducted with PBL from rescued animals, up-regulation of these genes compared to control was observed, however, these differences were not statistically significant. Again, low animal number and animal variability with regard to gender and age may have been important in absence of statistical significance.

In the study presented here, we examined gene expression profiles in PBL from rescued sea turtles and in PBL exposed to brevetoxin in vitro. The status of loggerhead sea turtles as a threatened species complicates the ability to directly assess effects of brevetoxin exposure, and the unpredictable nature of red tide blooms and sample collection from rescued animals limits the number of samples that are ultimately available for analysis. Therefore, we included in vitro cell culture experiments as a necessary and valuable alternative to aid in identification of genes and proteins responsive to brevetoxin exposure and to investigate potential immune modulation by brevetoxins. Many recent studies have utilized in vitro exposure experiments to generate important insight into assessing contaminant susceptibility of various aquatic species (Keller et al., 2006; De Guise et al., 1998; Levin et al., 2007a,b; Mori et al., 2006). Although none of the genes that were up- or down-regulated in the in vitro SSH experiment were the same as those from red tide rescued sea turtle SSH, overlap in general functional categories was observed. For example, genes related to oxidoreductase activity and structural elements were up-regulated in both rescued and in vitro SSH. Although the exact gene sequences that were upregulated were not the same, an overall theme of oxidative stress and cytoskeletal components was observed. There are a number of reasons to expect differences in SSH results in PBL from rescued animals compared to PBL following in vitro toxin exposure. First, rescued animals are exposed to unquantifiable amounts of toxins over a period of time. They are also exposed to a mixture of toxin congeners (Cheng et al., 2005), rather than one toxin utilized in in vitro experiments. Since turtles are exposed through both ingestion and inhalation (Flewelling et al., 2005), brevetoxins likely pass through many other biological processes before reaching the bloodstream. Gene targets are likely to vary with exposure dosage and duration of exposure. These factors contribute to variability in observed responses between in vitro and rescued animals.

4.9. Lysozyme activity and suppression subtractive hybridization

4.11. Limited number of sequences

Lysozyme activity is one component of the immune system that can readily be measured in serum samples collected from rescued

The identification of gene sequences in response to red tide toxin exposure in loggerhead sea turtle PBL was limited by the number of

4.7. Down-regulated genes Only two identifiable genes were down-regulated – tripeptidyl peptidase in PBL from rescued sea turtles and a gene encoding a protein with predicted similarity to trophinin in the in vitro PBL exposure. Tripeptidyl peptidase II is involved in proteolytic degradation cascade (Geier et al., 1999) and has a specialized function essential for some MHC class I antigen presentation (York et al., 2006). Trophinin is a protein which functions in cell adhesion or mucin production (Aplin, 1997). 4.8. Quantitative real-time PCR

302

C.J. Walsh et al. / Aquatic Toxicology 97 (2010) 293–303

publicly available sequences for this, or related species, currently referenced in available databases. A large number of unidentified genes were affected by brevetoxin exposure in this study, and it is highly possible that this pool of unidentified genes contains several genetic markers of brevetoxin exposure that currently cannot be identified. These observations underscore the need to expand our molecular knowledge in loggerhead sea turtles. 4.12. Summary Lysozyme activity is positively correlated with brevetoxin concentrations measured in blood of loggerhead sea turtles rescued from red tide toxin exposure. Observed genomic patterns in sea turtle PBL exposed to red tide toxins (natural or in vitro) indicate an increase in genes coding for proteins involved in oxidative stress, signaling mechanisms and cell functions that involve the cytoskeleton. Overall, the observations reported here suggest the sea turtle immune system is modulated by environmentally relevant concentrations of brevetoxins. 5. Conclusion The effects of brevetoxin exposure on functional aspects of sea turtle immunity have not yet been addressed in any published study. It is important to understand how harmful algal blooms affect marine life, particularly threatened or endangered species. In the study presented here, even the moderate correlations that were observed with brevetoxin and immune function parameters suggest that loggerhead sea turtles may be sensitive to immunomodulatory effects of brevetoxins. Such alterations in normal cellular biology may lead to changes in health of loggerhead sea turtles exposed to brevetoxins. Future studies should include other immune function parameters as well to more completely assess the effects of brevetoxin exposure on the immune system of loggerhead sea turtles. Conflict of interest None. Roles of authors Catherine J. Walsh is the primary author of this manuscript. She was responsible for project idea, designing experimentation, and overseeing all components of the research presented in this paper. She was also responsible for writing the paper. Stephanie R. Leggett is a staff biologist working in the laboratory of Dr. Catherine Walsh. She was responsible for conducting brevetoxin ELISA on turtle plasma samples, archiving all samples, isolating sea turtle PBL, isolating RNA, and conducting in vitro brevetoxin experiments with sea turtle PBL. Barbara J. Carter is employed by EcoArray Inc. and was responsible for conducting suppression subtractive hybridizations and quantitative real-time PCR described in this paper. Clarence Colle is an adjunct scientist at Mote Marine Laboratory and conducted sea turtle plasma lysozyme analyses. Acknowledgments This project was funded by Florida Fish and Wildlife Conservation Commission, Extended Red Tide Monitoring (FWC Agreement No. 06125). FWC played no role in study design or in the collection analysis and interpretation of data nor in writing this paper. FWC also played no role in the decision to submit this paper for publication. The authors would like to thank MML Sea Turtle Reha-

bilitation Hospital staff including C. Manire, E. Anderson, L. Byrd, and D. Fauquier. The authors would also like to thank M. Henry, R. Pierce, and S. Osborn for help with various parts of the project. L. Flewelling was very helpful in conducting ELISA measurements and we are grateful for this. We also thank M. Peden-Adams and J. Keller for helpful suggestions regarding lysozyme activity assays. References Altschul, S.F., Madden, T.L., Schaffer, R.A., Zhang, J., Zhang, Z., Miller, W., Lipman, C.J., 1997. Gapped blast and psi-blast: a new generation of protein database search programs. Nucleic Acid Res. 25, 3389–3402. Aplin, J.D., 1997. Adhesion molecules in implantation. Rev. Reprod. 2 (2), 84–93. Balemans, W., Van Hul, W., 2002. Extracellular regulation of BMP signaling in vertebrates: a cocktail of modulators. Dev. Biol. 250 (2), 231–250. Banerjee, P.P., Pandy, R., Zheng, R., Suhoski, M.M., Monaco-Shawver, L., Orange, J.S., 2007. Cdc42-interacting protein-4 functionally links actin and microtubule networks at the cytolytic NK cell immunological synapse. J. Exp. Med. 204 (10), 2305–2320. Benson, J.M., Tischler, D.L., Baden, D.G., 1999. Uptake and tissue distribution and excretion of brevetoxin 3 administered to rats by intratracheal instillation. J. Toxicol. Environ. Health A 56, 345–355. Benson, J., Hahn, F., March, T., McDonald, J., Sopori, M., Seagrave, J., Gomez, A., Bourdelais, A., Naar, J., Zaias, J., Bossart, G., Baden, D., 2004. Inhalation toxicity of brevetoxin 3 in rats exposed for 5 days. J. Toxicol. Environ. Health A 67 (18), 1443–1456. Benson, J.M., Hahn, F.F., March, T.H., McDonald, J.D., Gomez, A.P., Sopori, M.J., Bourdelais, A.J., Naar, J., Zaias, J., Bossart, G.D., Baden, D.G., 2005. Inhalation toxicity of brevetoxin 3 in rats exposed for twenty-two days. Environ. Health Perspect. 113, 626–631. Bossart, G.D., Baden, D.G., Ewing, R.Y., Roberts, B., Wright, S., 1998. Brevetoxicosis in manatees (Trichechus manatus latirostris) from the 1996 epizootic: gross, histologic, and immunohistochemical features. Toxicol. Pathol. 26 (2), 276–282. Burton, J.E., Dorociak, I.R., Schwedler, T.E., Rice, C.D., 2002. Circulating lysozyme and hepatic CYP1A activities during a chronic dietary exposure to tributyltin (TBT) and 3,3 ,4,4 ,5-pentachlorobiphenyl (PCB-126) mixtures in channel catfish, Ictalurus punctatus. J. Toxicol. Environ. Health A 65, 589–602. Cheng, Y.S., Zhou, Y., Irvin, C.M., Pierce, R.H., Naar, J., Backer, L.C., Fleming, L.E., Kirkpatrick, B., Baden, D.G., 2005. Characterization of marine aerosol for assessment of human exposure to brevetoxins. Environ. Health Perspect. 113 (5), 638–643. Chipman, D.M., Sharon, N., 1969. Mechanism of lysozyme action. Science 165, 454–465. Cicchillitti, L., Penci, R., Di Michele, M., Filippetti, F., Rotilio, D., Donati, M.B., Scambia, G., Ferlini, C., 2008. Proteomic characterization of cytoskeletal and mitochondrial class III ␤-tubulin. Mol. Cancer Ther. 7, 2070–2079. Cozzi, A., Corsi, B., Levi, S., Santambrogio, P., Albertini, A., Arosio, P., 2000. Overexpression of wild type and mutated human ferritin H-chain in HeLa cells. J. Biol. Chem. 275 (33), 25122–25129. De Guise, S., Marineau, D., Béland, P., Fournier, M., 1998. Effects of in vitro exposure of beluga whale leukocytes to selected organochlorines. J. Toxicol. Environ. Health A 55 (7), 479–493. Demers, N.E., Bayne, C.J., 1997. The immediate effects of stress on hormones and plasma lysozyme in rainbow trout. Dev. Comp. Immunol. 21, 363–373. Diatchenko, L., Lau, Y.F.C., Campbell, A.P., Chenchik, A., Moqadam, F., Huang, B., Lukyanov, S., Lukyanov, K., Gurskaya, N., Sverdlov, E.D., Siebert, P.D., 1996. Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries. Proc. Natl. Acad. Sci. U.S.A. 93, 6025–6030. Dröse, S., Brandt, U., 2008. The mechanism of mitochondrial superoxide production by the cytochrome bc1 complex. J. Biol. Chem. 283 (31), 21640–21654. Dutcher, S.K., 2001. The tubulin fraternity: alpha to eta. Curr. Opin. Cell Biol. 13 (1), 49–54. Fiaschi, T., Cozzi, G., Raugei, G., Formigli, L., Ramponi, G., Chiarugi, P., 2006. Redox regulation of beta-actin during integrin-mediated cell adhesion. J. Biol. Chem. 281, 22983–22991. Flewelling, L.J., Naar, J.P., Abbott, J.P., Baden, D.G., Barros, N.B., Bossart, G.D., Bottein, M.D., Hammond, D.G., Haubold, E.M., Heil, C.A., Henry, M.S., Jacocks, H.M., Leighfield, T.A., Pierce, R.H., Pitchford, T.D., Rommel, S.A., Scott, P.S., Steidinger, K.A., Truby, E.W., Van Dolah, F.M., Landsberg, J.H., 2005. Red tides and marine mammal mortalities. Nature 435 (9), 755–756. Florida Fish and Wildlife Research Institute, (accessed 24.08.09), http://research.myfwc.com/features/view article.asp?id=27537, 2008. Geier, E., Pfeifer, G., Wilm, M., Lucchiari-Hartz, M., Baumeister, W., Eichmann, K., Niedermann, G., 1999. A giant protease with potential to substitute for some functions of the proteasome. Science 283 (5404), 978–981. Hansen, N.E., Karle, H., Andersen, V., Olgaard, K., 1972. Lysozyme turnover in man. J. Clin. Invest. 51 (5), 1146–1155. Harms, C.A., Keller, J.M., Kennedy-Stoskopf, S., 2000. Use of a two-step Percoll gradient for separation of loggerhead sea turtle peripheral blood mononuclear cells. J. Wildl. Dis. 36, 535–540. Hiraiwa, M., Soeda, S., Kishimoto, Y., O’Brien, J.S., 1992. Binding and transport of gangliosides by prosaposin. PNAS USA 89 (23), 11254–11258.

C.J. Walsh et al. / Aquatic Toxicology 97 (2010) 293–303 Honchel, R., Aksoy, I.A., Szumlanski, C., Wood, T.C., Otterness, D.M., Wieben, E.D., Weinshilboum, R.M., 1993. Human thiopurine methyltransferas: molecular cloning and expression of T84 colon carcinoma cell cDNA. Mol. Pharmacol. 43 (6), 878–887. Holmgren, A., 1989. Thioredoxin and glutaredoxin systems. J. Biol. Chem. 264 (4), 13963–13996. Hutchinson, T.H., Field, M.D., Manning, M.J., 2003. Evaluation of non-specific immune functions in dab, Limanda limanda L., following short-term exposure to sediements contaminated with polyaromatic hydrocarbons and/or polychlorinated biphenyls. Mar. Environ. Res. 55 (3), 193–202. IUCN, 2008. 2008 IUCN Red List of Threatened Species, vol. 2008. Janmey, P.A., 1998. The cytoskeleton and cell signaling: component localization and mechanical coupling. Physiol. Rev. 78, 763–781. Kaminski, M., 2007. Novel role for mitochondria: protein kinase Ctheta-dependent oxidative signaling organelles in activation-induced T-cell death. Mol. Cell Biol. 27 (10), 3625–3639. Keller, J.M., McClellan-Green, P.D., Kucklick, J.R., Keil, D.E., Peden-Adams, M.M., 2006. Effects of organochlorine contaminants on loggerhead sea turtle immunity: comparison of a correlative field study and in vitro exposure experiments. Environ. Health Perspect. 114 (1), 70–76. Klaper, R., Thomas, M., 2004. At the crossroads of genomics and ecology: the promise of a canary on a chip. Bioscience 54, 403–412. Kreuder, C., Mazet, J.A.K., Bossart, G.D., Carpenter, T.E., Holyoak, M., Elie, M.S., Wright, S.D., 2002. Clinicopathologic features of suspected brevetoxicosis in doublecrested cormorants (Phalacrocorax auritus) along the Florida Gulf Coast. J. Zoo Wildl. Med. 33, 8–15. Levin, M., Leibrecht, H., Mori, C., Jessup, D., De Guise, S., 2007a. Immunomodulatory effects of organochlorine mixtures upon in vitro exposure of peripheral blood leukocytes differ between free-ranging and captive southern sea otters (Enhydra lutris). Vet. Immunol. Immunopathol. 119 (3–4), 269–277. Levin, M., Morsey, B., De Guise, S., 2007b. Non-coplanar PCBs induce calcium mobilization in bottlenose dolphin and beluga whale, but not in mouse leukocytes. J. Toxicol. Environ. Health A 70 (14), 1220–1231. Liu, H., Zheng, F., Cao, Q., Ren, B., Zhu, L., Striker, G., Vlassara, H., 2006. Amelioration of oxidant stress by the defensin lysoyzme. Am. J. Physiol. Endocrinol. Metabol. 290 (5), E824–E832. Lutcavage, M., Lutz, P.L., 1997. The diving physiology of sea turtles. In: Lutz, P.L., Musick, J. (Eds.), The Biology of Sea Turtles. CRC Press, Boca Raton, pp. 287–296. Milton, S.L., Lutz, P.L., 2003. Physiological and genetic responses to environmental stress. In: Lutz, P.L., Musick, J.A., Wyneken, J. (Eds.), The Biology of Sea Turtles, vol. II. CRC Press, Boca Raton, pp. 163–197. Mollenhauer, M.A.M., Carter, B.J., Peden-Adams, M.M., Bossart, G.D., Fair, P.A., 2009. Gene expression changes in bottlenose dolphin, Tursiops truncatus, skin cells following exposure to methylmercury (MeHg) or perfluorooctane sulfonate (PFOS). Aquat. Toxicol. 91, 10–18. Mori, C., Morsey, B., Levin, M., Nambiar, P.R., De Guise, S., 2006. Immunomodulatory effects of in vitro exposure to organochlorines on T-cell proliferation in marine mammals and mice. J. Toxicol. Environ. Health A 69, 283–302. Mor-Vaknin, N., Punturieri, A., Sitwala, K., Markovitz, D.M., 2003. Vimentin is secreted by activated macrophages. Nat. Cell Biol. 5 (1), 59–63. Naar, J., Bourdelais, A., Tomas, C., Kubanek, J., Whitney, P.L., Flewelling, L., Steidinger, K., Lancaster, J., Baden, D.G., 2002. A competitive ELISA to detect brevetoxins from Karenia brevis (formerly Gymnodinium breve) in seawater, shellfish, and mammalian body fluid. Environ. Health Perspect. 110 (2), 179–185. Orino, K., Lehman, L., Tsuji, Y., Ayaki, H., Torti, S.V., Torti, F.M., 2001. Ferritin and the response to oxidative stress. Biochem. J. 357, 241–247.

303

Phillips, D.J., de Kretser, D.M., Hedger, M.P., 2009. Activin and related proteins in inflammation: not just interested bystanders. Cytokine Growth Factor Rev. 20 (2), 153–164. Pietsch, E.C., Chan, J.Y., Torti, F.M., Torti, S.V., 2003. Nrf2 mediates the induction of ferritin H in response to xenobiotics and cancer chemopreventive dithiolethiones. J. Biol. Chem. 278 (4), 2361–2369. Pinto-Silva, C.R., Moukha, S., Matias, W.G., Creppy, E.E., 2008. Domoic acid induces direct DNA damage and apoptosis in Caco-2 cells: recent advances. Environ. Toxicol. 23 (6), 657–663. Pritchard, P.C.H., 1997. Evolution, phylogeny, and current status. In: Lutz, P.L., Musick, J.A. (Eds.), The Biology of Sea Turtles. CRC Press, Boca Raton, pp. 1–28. Radwan, F.F.Y., Ramsdell, J.S., 2006. Characterization of in vitro oxidative and conjugative metabolic pathways for brevetoxins (PbTx-2). Toxicol. Sci. 89 (1), 57–65. Sorice, M., Molinari, S., Di Marzio, L., Mattei, V., Tasciotti, V., Ciarlo, L., Hiraiwa, M., Garofalo, T., Misasi, R., 2008. Neurotrophic signaling pathway triggered by prosaposin in PC12 cells occurs through lipid rafts. FEBS J. 275 (19), 4903–4912. Strelkov, S.V., Herrmann, H., Geisler, N., Wedig, T., Zimbelmann, R., Aebi, U., Burkhard, P., 2002. Conserved segments 1A and 2B of the intermediate filament dimmer: their atomic structures and role in filament assembly. EMBO J. 21 (6), 1255–1266. Szczur, K., Xu, H., Atkinson, S., Zheng, Y., Filippi, M.-D., 2006. Rho GTPase CDC42 regulates directionality and random movement via distinct MAPK pathways in neutrophils. Blood 108, 4205–4213. ˜ Tarazona, R., López-Lluch, G., Galiani, M.D., Aguado, E., Garahona, F., Solana, R., Pena, J., 2000. HLA B2702 (77-83/83-77) peptide binds to beta-tubulin on human NK cells and blocks their cytotoxic capacity. J. Immunol. 165 (12), 6776–6782. Trainer, V.L., Baden, D.G., 1991. An enzyme immunoassay for the detection of Florida red tide brevetoxins. Toxicon 29 (11), 1387–1394. U.S. Fish and Wildlife Service, (accessed 25.08.09), http://www.fws.gov/ northflorida/SeaTurtles/Turtle Factsheets/loggerhead-sea-turtle.htm, 2009. Walsh, C.J., Luer, C.A., Noyes, D.R., 2005. Effects of environmental stressors on lymphocyte proliferation in the Florida manatee, Trichechus manatus latirostris. Vet. Immunol. Immunopathol. 103 (3–4), 255–264. Walsh, C.J., Stuckey, J.E., Cox, H., Smith, B., Funke, C., Stott, J., Colle, C., Gaspard, J., Manire, C.A., 2007. Production of nitric oxide by peripheral blood mononuclear cells from the Florida manatee, Trichechus manatus latirostris. Vet. Immunol. Immunopathol. 118 (3–4), 199–209. Walsh, C.J., Leggett, S.R., Henry, M.S., Blum, P.C., Osborn, S., Pierce, R.H., 2009. Cellular metabolism of brevetoxin (PbTx-2) by a monocyte cell line (U-937). Toxicon 53, 135–145. Weeks, B.A., Anderson, D.P., DuFour, A.P., Fairbrother, A., Goven, A.J., Lahvis, G.P., et al., 1992. Immunological biomarkers to assess environmental stress. In: Huggett, R.J., Kimerle, R.A., Mehrle Jr., P.M., Bergman, H.L. (Eds.), Biomarkers: Biochemical, Physiological, and Histological Markers of Anthropogenic Stress. Lewis Publishers, Boca Raton, pp. 211–234. Wielinga, P.R., Reid, G., Challa, E.E., van der Heijden, I., van Deemter, L., de Haas, M., Mol, C., Kuil, A.J., Groeneveld, E., Schuetz, J.D., Brouwer, C., De Abreu, R.A., Wijnholds, J., Beijnen, J.H., Borst, P., 2002. Thiopurine metabolism and identification of the thiopurine metabolites transported by MRP4 and MRP5 overexpressed in human embryonic kidney cells. Mol. Pharmacol. 62 (6), 1321–1331. York, I.A., Bhutani, N., Zendzian, S., Goldberg, A.L., Rock, K.L., 2006. Tripeptidyl peptidase II is the major peptidase needed to trim long antigenic precursors, but is not required for most MHC class I antigen presentation. J. Immunol. 177 (3), 1434–1443.