Effects of cadmium on cell proliferation, apoptosis, and proto-oncogene expression in zebrafish liver cells

Aquatic Toxicology 157 (2014) 196–206

Contents lists available at ScienceDirect

Aquatic Toxicology journal homepage: www.elsevier.com/locate/aquatox

Effects of cadmium on cell proliferation, apoptosis, and proto-oncogene expression in zebrafish liver cells Ying Ying Chen 1 , Jin Yong Zhu 1,2 , King Ming Chan ∗ School of Life Sciences, Chinese University, Sha Tin, N.T., Hong Kong SAR, China

a r t i c l e

i n f o

Article history: Received 13 August 2014 Received in revised form 20 October 2014 Accepted 21 October 2014 Available online 31 October 2014 Keywords: Carcinogenesis Oncogene Apoptosis Cell proliferation

a b s t r a c t Cadmium (Cd) is one of the major transitional metal that has toxic effects in aquatic organisms and their associated ecosystem; however, its hepatic toxicity and carcinogenicity are not very well characterized. We used a zebrafish liver (ZFL) cell line as a model to investigate the mechanism of Cd-induced toxicity on hepatocytes. Our results showed that Cd can be effectively accumulated in ZFL cells in our exposure experiments. Cell cytotoxicity assays and flow cytometer measurements revealed that Cd2+ stimulated ZFL cell proliferation with decreasing apoptotic cell numbers indicating potentially tumorigenic effects of Cd in ZFL cells. Gene expression profiles also indicated that Cd downregulated oncogenes p53 and rad51 and upregulated immediate response oncogenes, growth arrest and DNA damage-inducible (gadd45) genes, and growth factors. We also found dramatic changes in the gene expression of c-jun and igf1rb at different exposure time points, supporting the notion that potentially tumorigenic of Cd-is involved in the activation of immediate early genes or genes related to apoptosis in cancer promotion. © 2014 Elsevier B.V. All rights reserved.

1. Introduction Cadmium (Cd) is a non-essential, ubiquitous, and toxic transition element. Large quantities of Cd compounds are discharged into the environment from industrial activities and fossil fuels, and they can be accumulated through water into aquatic organisms, which can have harmful effects on humans via food chains from irrigation areas or wastewater (Han et al., 2009; Jarup and Akesson, 2009; Nordberg, 2004, 2009). Cd accumulates primarily in the liver and kidneys, causing kidney and bone problems (Aitio and Tritscher, 2004; Han et al., 2009; Zhang et al., 2014), neurological defects in children (Ciesielski et al., 2012), and other health risks that have not been formally studied (Satarug et al., 2010) including cancer mortality (Nawrot et al., 2006) and cardiovascular diseases (TellezPlaza et al., 2013). Also well noted is the limited capacity to respond to Cd exposure. Because Cd cannot undergo metabolic degradation and is only poorly excreted due to binding with thiol-containing proteins, e.g. metallothionein, long-term “storage” is a viable option for dealing with this toxic element (Bernard, 2008; Waalkes, 2003).

∗ Corresponding author. E-mail address: [email protected] (K.M. Chan). 1 Co-authors with equal contribution. 2 Current Affiliation: Biomedical Research Institute, Shenzhen Peking University – The Hong Kong University of Science and Technology Medical Center, Shenzhen, Guangdong, China. http://dx.doi.org/10.1016/j.aquatox.2014.10.018 0166-445X/© 2014 Elsevier B.V. All rights reserved.

However, the retention of Cd in internal organs is thus problematic in that it has chronic negative effects on health in general, and wildlife in particular. Cd exerts multiple toxic effects and has been classified as a human carcinogen by the International Agency for Research on Cancer (IARC, 1993). This classification is supported by strong evidence from animal experiments. For instance, rodent studies have shown that following various routes of exposure to Cd, experimental animals produced tumors in multiple organs including the lungs, prostate, testes, and hematopoietic system (Waalkes, 2000, 2003; Waalkes and Klaassen, 1985; Waalkes and Rehm, 1994). Although numerous studies have investigated the toxic effects of Cd, there are definite species and strain-related differences in sensitivity to Cd-induced carcinogenicity (Joseph, 2009; Liu et al., 2009; Waisberg et al., 2003). The molecular mechanism of Cdinduced carcinogenesis remains obscure and the extant data are fragmented, despite the proposal of various mechanisms of Cdinduced carcinogenicity: (1) disruption of the cellular antioxidant system and induction of reactive oxygen species (Basha and Rani, 2003; Deng et al., 2010; Shaikh et al., 1999), (2) inhibition of DNA repair and alternation of DNA methylation (Giaginis et al., 2006; Pierron et al., 2014), disruption of cell adhesion (Doi et al., 2010), (3) disruption in cellular signal transduction and involvement of apoptosis (Thevenod, 2009), and (4) promotion of cell proliferation (Templeton and Liu, 2010). Because Cd is not a strong redox active metal ion, its carcinogenic effects are mainly due to epigenetic, non-, or indirect

Y.Y. Chen et al. / Aquatic Toxicology 157 (2014) 196–206

geno-toxic mechanisms, which cause aberrant gene expression that stimulates cell proliferation or blocks apoptosis. It has been reported that Cd can activate some proto-oncogenes or genes associated with cell proliferation, such as c-myc or c-jun, to enhance proliferation in a cell population and, assuming a basal level of cells with chemically or spontaneously damaged DNA, to enhance the clonal expansion of such damaged cells (Waalkes, 2000). The zebrafish (Danio rerio) is an excellent model used in various toxicological studies with a mass of genetic information (Alestrom et al., 2006; Amanuma et al., 2000). The liver has been identified as a major target organ for Cd intoxication. Previous studies have found Cd accumulation in the livers of fish, and such accumulation could be eliminated over time in zebrafish liver (ZFL) cells cultured in vitro (Gonzalez et al., 2006; Shen et al., 1998). Zebrafish have also emerged as an attractive animal system for modeling human cancers because the biology of cancer in zebrafish is very similar to that of cancer in humans (Shive, 2013), both histologically and genetically. In addition, a comparison of the human zebrafish genome sequences demonstrates the conservation of cellcycle genes, tumor suppressors, and oncogenes (Etchin et al., 2011). Multiple zebrafish cancer models have been successfully developed, including hepatic neoplasia (Shive, 2013; Lu et al., 2011), it has been shown that the zebrafish liver cancer models share molecular signatures with subsets of human hepatocellular carcinoma (Zheng et al., 2014; Li et al., 2013). The zebrafish has been increasingly employed to model human cancer, around 50 articles have been published since year 2000 in which zebrafish were used as a cancer model (Feitsma and Cuppen, 2008). Therefore, a ZFL cell line was selected in this study to investigate the molecular mechanisms of cells responding to Cd-induced cytotoxicity or tumorigenic effects. The ZFL cells used in this study were derived from adult liver cells and show a general hepatocyte characteristic with parenchymal cell morphology that makes them useful in toxicological studies with low background levels of gene expressions and in detoxification studies (Eide et al., 2014). We previously reported the use of a proteomic approach to analyze how Cd caused hepatic toxicity using a ZFL cell line (Zhu and Chan, 2012). In those studies, we characterized the metal-affected genes in ZFL (Cheuk et al., 2008; Wan et al., 2009; Chen and Chan, 2011; Chen et al., 2011) and found that Cd2+ did not induce the production of reactive oxygen species (ROS) in the ZFL cell line (Zhu and Chan, 2012). However, Cd accumulation and further induction of metallothionein-2 (MT2) gene expression, cell viability and apoptosis were noticeable. The deregulation of gene expression is regarded as a major factor in a multi-stage model of chemical carcinogenesis. Therefore, the expression levels with oncogenes including immediate early response genes (c-fos, c-jun, c-myc), apoptosis-related genes (c-jun, p53, bax), DNA repair related genes (gadd45, rad51), and growth factors (igf, egf) as well as their receptors (igf–1rb, egfr)were investigated in ZFL cells following the administration of Cd2+ at sub-lethal concentrations.

2. Materials and methods 2.1. Cell cultures The zebrafish (Danio rerio) liver cell line (ZFL) was obtained from ATCC (American Type Culture Collection, ATCC, CRL-2643). ZFL cell s are an adherent tissue hepatocyte cell line derived from the adult zebrafish (Danio rerio) liver that were cultured according to our previous study (Cheuk et al., 2008; Zhu and Chan, 2012), and ZFL cells kept normal morphology and characteristics as described by ATCC. Briefly, the ZFL cells were grown in a standard culture medium comprising 50% L-15 medium, 35% DMEM and 15% Hams F12 and supplemented with 0.15 g/L sodium bicarbonate, 15 mM

197

HEPES, 0.01 mg/mL insulin, 50 ng/mL EGF, 5% heat-inactivated fetal bovine serum, and 1% penicillin/streptomycin, all purchased from Invitrogen-Gibco and maintained at 28 ◦ C as recommended by ATCC without carbon dioxide. 2.2. Determination of Cd uptake in ZFL cells ZFL cells were exposed to 5, 15, 30 ␮M CdCl2 for 3, 6, 12, 24 h, harvested, weighed, and digested with concentrated nitric acid (Merck) at 60 ◦ C for 4 h. Cd concentrations were determined by using Atomic Absorption Spectrophotometry (Hitachi Z2700 Graphite Furnace) and the results were expressed as mg Cd/kg cells. Each treatment was performed in triplicate. 2.3. Cytotoxicity assays All of the cytotoxicity assays were determined using the AlamarBlueTM assay (Invitrogen, USA) (Ahmed et al., 1994) as previously described (Chen et al., 2011). Briefly, the ZFL cells were seeded on 96 well plates with a density of 1 × 105 per well and pre-incubated in standard culture medium overnight before exposure. The 10 mM stock solution of cadmium chloride hydrate (Sigma–Aldrich, USA) was made in Milli-Q water and filtered with Millipore Filters (0.45 ␮m). After pre-incubation, Cell monolayers were washed with phosphate buffered saline (PBS) and the addition of cadmium chloride diluted in media (without FBS) followed. Cells were exposed to media with different Cd concentrations (5, 15, 30 ␮M) for 24 h. After pre-incubation, the medium was removed and the cells were exposed to media with different Cd concentrations (5, 15, and 30 ␮M) for 24 h. Six replicates were performed on the same plate for each dose. The medium with Cd was replaced by 100 ␮L of fresh medium containing 10% AlamarBlueTM (Invitrogen, USA) and incubated for 2 h. The fluorescent signal was measured using a fluorescent microplate reader (Polarion, Tecan, Switzerland) with an excitation wavelength of 535 nm and an emission wavelength of 595 nm. The fluorescent readings of each well with cells were corrected by blank readings without cells. 2.4. Annexin-V/PI assays The ZFL cells were treated with 5, 15, and 30 ␮M of Cd for 24 h. The apoptotic rates were determined with an Annexin-VFluos staining kit (BioSource International Inc., USA) as previously described (Chen et al., 2011). The cells were incubated in AnnexinV-FITC and a PI labeling solution for 30 min after staining and were then washed and analyzed using a BD FACSVerseTM Flow Cytometer (BD Bioscience, NJ, USA). Each treatment was performed in triplicate. 2.5. Housekeeping gene analysis Many common reference genes, such as 18s, GAPDH, B2 M, YBX1, EF1a, and ␤-actin, have been characterized for qPCR analyses in previous studies. To identify and validate the housekeeping genes with the greatest expression stability under different concentrations of Cd treatment, the expression profiles of 18S, ␤-actin, B2 M, EF1a, GAPDH, and YBX1 were determined using qPCR. The primer sequences and accession numbers for these reference genes are listed in Table 1. The expressions of these six housekeeping genes were determined using cDNA samples isolated from ZFL cells treated with different dosages of Cd (0, 15, and 30 ␮M). The normalized expression levels for these genes were evaluated with an online tool—RefFinder (http://www.leonxie.com/ referencegene.php)—to evaluate the expression levels of the reference genes after Cd2+ exposure.

198

Y.Y. Chen et al. / Aquatic Toxicology 157 (2014) 196–206

Table 1 Nucleotide sequences of primers used in the gene expression analysis using realtime quantitative PCR assay. Gene (accession number)

Primer

Nucleotide sequence (5 –3 )

gapdh (NM 213094)

Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse

CGACCTCACCTGCCGCCTTACA GTCATTGAGGGAGATGCCAGCG CATGGCCGTTCTTAGTTGGT CGGACATCTAAGGGCATCAC GCTCAAACATGGGCTGGTTC AGGGCATCAAGAAGAGTAGTACCG ATGGAGCGATGGATTCGTG ACAGGCCTTAATTGGACTCAGTAG CCGGCCGGTTTTGTCA TTATTGCTCAGATGTTGGATGTTGT CGAGCAGGAGATGGGAACC CAACGGAAACGCTCATTGC AACCATACATGCCTGCCACA CACACGTTCAGAAATCCACCG TGAACACGTTCAACCCTGCT CCAGTTTCCTCTTCCGGCAT GACGCCACTTATGCTGCAAG TTATTCGAGCGCACATCCGA CAGGGATGCTGAAGTGACCC ACAAGGCGACAGGCAAAGTA AGATGGCGTCCCAGGTAGAT GAAGGCATCCCAACCTCCAT ATGGAATCACGGCTGCTCTCTGGGA GCATTCACAAACCCACCGGCCTGGA ATCTATGCGGAGCGGTGTTC GGCATGTCTTGATGCACGTC GCTTGTTCGTGTCTTCTGTGG CTTCCCGCATTCAGCGAT CAACGACACACAGGTCTTCCCAGG TCGGCTGTCCAACGGTTTCTCTT TGCCATGGAGAAATCTGTGGT GTTCGGAAAGAGGGTGCTGA CCTCACAATCATCACTCTGG TTCTTGAAGTTGCTCTCCTC TGCTGCGTCTCGCTGA GCCTCGGCCTCTGGTAA

18s (NM 001098396) ef1a (XM 005173784) b2m (NM 131163) ybx1 (NM 001126457) ˇ-actin (NM 131031) c-fos (NM 205569) c-jun (NM 199987) c-myc (NM 131412) bax (NM 131562) bcl-2 (NM 001030253) egf (XM 005157315) egfr (NM 194424) gadd45 (NM 213031) igf1 (NM 131825) igfr1b (NM 152969) p53 (XM 005165104) rad51 (NM 213206)

2.6. RNA extraction, cDNA synthesis, and real-time polymerase chain reaction The ZFL cells were divided into 4 groups in triplicate: a control group without the addition of Cd and 3 exposure groups with 5, 15, and 30 ␮M Cd, respectively. After 3, 6, 12, and 24 h of exposure to Cd, total RNAs were extracted using the Trizol reagent (Takara Biotechnology, Japan) from the 1 × 108 ZFL cells with or without treatment. Reverse transcriptions (RTs) were performed using the PrimerScript TM RT reagent kit (Takara Biotechnology, Japan) according to the manufacturer’s instructions. One microgram RNA template from each sample was converted into cDNA in a volume of 20 ␮L. The reverse transcription products were quantified using NANODROP 2000 (Thermo Fisher Scientific, USA). SYBR® Green PCR Master Mix (Takara Biotechnology, Japan) was used in the realtime PCR reaction as previously described (Chen and Chan, 2009; Zhu and Chan, 2012). Real-time PCR was conducted on an ABI RealTime PCR Fast System 7500 (Applied Biosystems, USA). All of the gene sequences used in this study were obtained from NCBI Genbank and the latest zebrafish genome databases (Zv9 and Vega49). The primer sets were designed using an NCBI PCR Primer Design online tool—Primer-BLAST (http://www.ncbi.nlm.nih.gov/tools/ primer-blast). The nucleotide sequences of the forward and reverse primers for the genes selected and their accession numbers are also listed in Table 1. The amplification condition of the real-time quantitative PCR for the target genes was optimized before further investigation and analysis. To determine the reaction efficiency, standard curves consisting of 10-fold serial dilutions of cDNA from a mix of all samples were calculated in each run (reaction efficiency close to 100% for

Fig. 1. Cadmium accumulation in ZFL cells exposed to Cd (5, 15, 30 ␮M) for 3, 6, 12 and 24 h. Values are means ± S.D. Bars with different lettering indicate significantly different (p < 0.05, n = 3, One-way ANOVA, Tukey’s test).

all reactions). The Ct value was the number of PCR cycles required to be higher than the predetermined threshold value of 0.05 for SYBR® Green intensity. The Ct value of gapdh for each sample was subtracted from the corresponding Ct value of each gene as Ct, and the value was normalized against the respective control treatment as Ct. The relative expression of each gene was calculated as the equation: relative fluorescence = 2Ct . 2.7. Statistical analyses All of the results are presented as mean ± standard deviation (S.D.), in triplicate at least. The normalized gene expression levels were compared by one-way ANOVA and Tukey’s Multiple Comparison Test using Prism5 software on a personal computer (GraphPad, USA). A probability value of p < 0.05 was considered significant.

3. Results 3.1. Cd stimulates cell growth and apoptosis The Cd concentrations in ZFL cells were found increased in a dose and time dependent manner (Fig. 1) with the control group shown undetectable or below the detection limit of the graphite furnace in the Atomic Absorption spectrophotometer used. Cd2+ has no known physiological function, and its cytotoxicity has been well demonstrated. However, previous studies have also reported that very low cadmium concentrations stimulate DNA synthesis and cell growth in three mammalian cell lines (Vonzglinicki et al., 1992). Similar to their results, we also found that Cd2+ could stimulate ZFL cells at the three concentrations used (5, 15, and 30 ␮M) (Fig. S1), which were quite close to the concentrations of Cd in some polluted surface water (Liang et al., 2011). Supplementary Fig. S1 related to this article can be found, in the online version, at http://dx.doi.org/10.1016/j.aquatox.2014.10.018. The expansion of a tumor cell population is determined not only by the rate of cell proliferation but also by the rate of cell apoptosis. Tumor growth thus depends on the balance between cell proliferation and apoptosis. Therefore, acquired resistance to apoptosis could have important implications in both tumor initiation and progression. As Fig. 2 shows, after incubation with different concentrations (5, 15, and 30 ␮M) of Cd for 24 h, the percentages of both Annexin-V+/PI+ and Annexin-V+/PI-cells (apoptosis) decreased. These results further confirmed that Cd could

Y.Y. Chen et al. / Aquatic Toxicology 157 (2014) 196–206

199

Fig. 2. The effects of Cd2+ on the inhibition of ZFL cell apoptosis with Annexin-V-FITC and PI staining. ZFL cells were treated with a various concentrations (5, 15, 30 ␮M) of Cd for 24 h. LL: Annexin-V-/PI-cells (normal); LR: Annexin-V+/PI-cells (early apoptosis); UR: Annexin-V+/PI+ cells (late apoptosis); UL: Annexin-V-/PI+ cells (necrosis). The data shown are representative of three independent experiments. The statistical analysis of the apoptosis and late apoptosis cells among the total population is shown in the bar graph (% of cells in each phase relative to the total population). Asterisk marks values significantly different from the control, *p < 0.05.

stimulate ZFL cell growth, indicating that apoptosis inhibition is a critical factor in increased cell proliferation. 3.2. Housekeeping gene analysis and positive control biomarker gene To compare and rank the tested candidate reference genes, the housekeeping gene analysis tool RefFinder integrates the four currently available major computational programs: geNorm (Vandesompele et al., 2002), Normfinder (Andersen et al., 2004), BestKeeper (Pfaffl et al., 2004), and the comparative Ct method (Silver et al., 2006). Based on the rankings from each program, it can assign an appropriate weight to an individual candidate gene and calculate the geometric mean of their weights for the overall final ranking. Based on the RefFinder comprehensive analysis, we found that EF1a exhibited the highest expression stability in most programs, and ␤-actin was the most variably expressed housekeeping gene (Fig. S2). However, in the BestKeeper program test, GAPDH was the most stable (Fig. S2), and in the previous proteomics study we found that the elongation factor 2b expressions was upregulated (Zhu and Chan, 2012). Some studies have reported that EF1a is sensitive in response to Cd2+ exposure (Nordberg, 2004). Therefore, GAPDH was finally selected as the best constitutively expressed housekeeping gene for subsequent real-time PCR analysis. Supplementary Fig. S2 related to this article can be found, in the online version, at http://dx.doi.org/10.1016/j.aquatox.2014.10.018. The mRNA expression levels of MT2, which serves as a positive control, in ZFL cells under different time and dose of Cd exposure were detected. Our results showed that MT2 mRNA expression levels were induced by Cd in a dose and time dependent manner (Fig. 3). The MT2 levels are in line with the uptake of Cd, since the expression of MT is often increased in tumors (Woo et al., 1997) and high MT expression has been considered a useful prognostic tool for several types of cancer (Barnes et al., 2000), the upregulation of MT by Cd indicated that cytotoxic or tumorigenic potential of Cd in ZFL cells.

(Vartanian et al., 2011). Because mRNA expression is rapid and transient in nature, the expression files of these genes were measured at various time points (3, 6, 12, and 24 h) to better understand the kinetics of their mRNA in response to Cd. As Fig. 4 shows, exposing cultured ZFL to various concentrations of Cd induced different time profiles for c-fos, c-jun, and c-myc mRNA expression. For all of the concentrations of Cd used, a transient expression profile was observed with an increase in c-fos mRNA expression levels over the control during 3–6 h; that is, the upregulation reached the highest level of induction by 6 h and returned to the basal level by 12–24 h. A similar change in the expression profile was found for c-jun mRNA expression, but the time for the maximal expression levels of c-jun was 3 h. In addition, unlike c-fos, inhibition effects for c-jun were found after 12 and 24 h of exposure. For c-myc, Cd2+ could induce its’ mRNA expression level in a time dependent manner. 3.4. Effects of Cd on apoptosis regulators Apoptosis is a form of cell suicide that plays an important role in the development and maintenance of tissue homeostasis in multi-cellular organisms, and its disruption influences tumor formation and malignant progression (Lowe and Lin, 2000). In this study, the role of several apoptosis regulators (p53, bax, and

3.3. Effects of Cd on immediate response genes Among the different types of proto-oncogenes, c-fos, c-jun, and c-myc are the most widely studied immediate early response genes (IEGs) that undergo early transcriptional activation when quiescent cells are exposed to mitogenic substances such as Cd (Waisberg et al., 2003). IEGs play an important role in many cellular functions and have been found to be overexpressed in a variety of cancers

Fig. 3. Fold induction of MT2 expression in ZFL cells after the administrations of Cd (5, 15, 30 ␮M) for 3, 6, 12 and 24 h. The gene induction folds of each treatment were compared to control group according to 2Ct method, and the Y-axis represents the fold regulation of these genes. Bars with different letters indicate significantly different (p < 0.05, n = 3, One-way ANOVA, Tukey’s test).

200

Y.Y. Chen et al. / Aquatic Toxicology 157 (2014) 196–206

Fig. 4. Fold induction of IEGs ((A) c-fos; (B) c-jun; (C) c-myc) expression in ZFL cells after the administration of Cd (5, 15, 30 ␮M) for 3, 6, 12 and 24 h. The gene induction folds of each treatment were compared to control group according to 2Ct method, and the Y-axis represents the fold regulation of these genes. Bars with different letters indicate significantly different (p < 0.05, n = 3, One-way ANOVA, Tukey’s test).

Fig. 5. Inhibitions of apoptosis regulators ((A) p53; (B) bax; (C) bcl-2) gene expression in ZFL cells after the administrations of Cd (5, 15, 30 ␮M) for 3, 6, 12 and 24 h. The gene induction folds of each treatment were compared to control group according to 2Ct method, The and the Y-axis represents the fold regulation of these genes. Bars with different letters indicate significant difference (p < 0.05, n = 3, One-way ANOVA, Tukey’s test).

inhibition of p53-induced apoptosis by Cdwas not mediated by a general inhibition p53-regulated gene (e.g. bax). bcl-2) in Cd-induced carcinogenesis were investigated. The tumor suppressor gene p53, which is involved in arresting the cell cycle after DNA damage, was significantly downregulated after cadmium exposure in both a time- and dose-dependent manner. Bcl-2 and bax produce mitochondrial-related proteins with antagonistic effects, with the former (latter) exhibiting anti-apoptotic (proapoptotic) activity. Bcl-2 was slightly downregulated, compared to p53, and the expression levels of bax remained at the basal level with some tiny variations (Fig. 5). These results indicated that the

3.5. Effects of Cd2+ on growth factors Epidermal growth factors (EGFs) and insulin-like growth factors (IGFs) are part of a complex network of growth factors and receptors that work together to modulate cell growth. Many aggressive types of cancer feature overactive signaling through growth factor systems by creating excess amounts of the growth factors. As Fig. 6 shows, after exposure to Cd, the level of egf mRNA increased and

Y.Y. Chen et al. / Aquatic Toxicology 157 (2014) 196–206

201

peaked at 6 h, and then returned to the control level by 12 h and 24 h. Similar to egf, the levels of egfr also peaked at 6 h and then decreased. In contrast to egf, the level of igf1 stayed at the basic level initially (6 h), but increased at 12 h and remained elevated up to 24 h. In contrast to igf1, igf1rb increased immediately after low concentration of Cd exposure and decreased at the subsequent time points. The different time points at which these two growth factors reached their maximum expression levels suggested that EGF and IGF might respond to early- and late-stage cell growth stimulation after Cd treatment, respectively. 3.6. Effects of Cd on DNA repair genes Numerous studies have shown that Cd can cause genotoxicity, which is associated with increased DNA damage, enhanced mutagenesis, and functional impairment in DNA. These events potentially add to the population of cells with damaged DNA and promote Cd-induced carcinogenesis. Aberrant expressions of critical DNA repair genes are key factors in genetic instability. In this study, DNA repair protein RAD51, a critical mediator of homologous recombination (HR), was downregulated by Cd, especially over a long period and under high-dose Cd treatment (Fig. 7A). In contrast to rad51, the expression of growth arrest and gadd45 was slightly increased by Cd after 3, 6, and 12 h of exposure, when the gadd45 induction folds were significantly elevated by 2–5 folds at 24 h. However, the gadd45 induction folds after 24 h of treatment were not dose-dependent, with the highest gadd45 expression level measured at 15 ␮M and declining to 30 ␮M (Fig. 7B). These results suggested that the DNA damage generated by Cd could be effectively repaired when exposure concentrations were low, but the repair ability decreased when the concentration was increased. 4. Discussion 4.1. Cd-induced hepatotoxicity and carinogenicity Cd is a non-essential metal that is retained in the liver with a half-life exceeding 20 years in humans, and thus has been shown to have serious effects on health (Godt et al., 2006). The tissues targeted by Cd-induced carcinogenesis include the liver, kidneys, lungs, testes, brain, and bone (Badisa et al., 2008). Cd carcinogenesis can be associated with various diseases in these organs, including non-alcoholic fatty liver disease, hepatic necroinflammation, kidney damage (itai-itai disease), bone disorder, respiratory disease, motor neuron disease, etc. (Hyder et al., 2013; Kjellstrom, 1992; Pamphlett et al., 2001; Verougstraete et al., 2003). Because the liver is one of the major organs susceptible to Cd toxicity, in the present study, we used a normal ZFL cell line as a model system to evaluate cell viability, apoptosis, and the response of various oncogenes genes after Cd administration. Although Cd-induced toxicity has been widely studied, the role of Cd-induced cell growth in carcinogenesis is still under debate. A number of reports have demonstrated that at concentrations above 1 ␮M, Cd inhibits cell growth and DNA synthesis in a wide variety of cell types (Cifone et al., 1989; Kang and Enger, 1991). However, in the present study we demonstrated that Cd can stimulate ZFL cell proliferation at 5–30 ␮M. One of the reasons for this significant variation in cytotoxicity effects may be the differences in species (mammal as compared to fish), temperature (37 ◦ C versus 28 ◦ C), and the nature of cell cultures (normal or cancerous) used for cytotoxic studies. Cd has been observed to play a similar role in cell Fig. 6. Fold induction of the mRNA levels of growth factors examined ((A) egf; (B) egfr; (C) igf1; (D) igf1rb) expression in ZFL cells after the administrations of Cd (5, 15, 30 ␮M) for 3, 6, 12 and 24 h. The gene induction folds of each treatment were

compared to control group according to 2Ct method, and the Y-axis shows the fold regulation of these genes. Bars with different letters indicate significant difference (p < 0.05, n = 3, One-way ANOVA, Tukey’s test).

202

Y.Y. Chen et al. / Aquatic Toxicology 157 (2014) 196–206

Fig. 7. Fold induction of IEGs ((A) rad51; (B) gadd45) expression in ZFL cells after the administrations of Cd (5, 15, 30 ␮M) for 3, 6, 12 and 24 h. The gene induction fold of each treatment was compared to control group according to 2Ct method, and the Y-axis represents the fold regulation of these genes. Bars with different letters indicate significant difference (p < 0.05, n = 3, One-way ANOVA, Tukey’s test).

growth promotion in many other studies. There have been reports showing that Cd acted as a transforming growth factor in kidney cell lines (Barham et al., 1985) and that it might transform fibroblasts, via various steps, into tumorigenic cells (Chibber and Ord, 1990). Because accelerated cell proliferation is a key step in tumor promotion, the stimulation of ZFL cell proliferation by Cd indicates the potentially tumorigenic effects of Cd in ZFL cells. Apoptotic cell death is perhaps best viewed as an ongoing, normal process in the control of cell populations, and acts to eliminate cells with damaged genetic material. Using rainbow trout cell lines, Krumschnabel et al. (2010) demonstrated that concentrations of Cd that caused >50% cell death did so with a morphology similar to that of apoptosis. Our studies of Cd exposures were conducted at levels of <50% cell death, and hence apoptosis was not observed. Apoptosis blockage is another important mechanism that can result in carcinogenic transformation. We observed that Cd treatment decreased the percentage of apoptotic ZFL cells, and while Cd-induced apoptosis has been reported by many studies (Habeebu et al., 1998; Ye et al., 2007), other research has found that Cd can be anti-apoptotic in some cell lines (Achanzar et al., 2002; Yuan et al., 2000). Interestingly, it has been shown that dysplastic foci induced by cadmium exposure in the rat prostate

show diminished apoptosis (Martin et al., 2001). In this fashion, the survival of pre-neoplastic or early neoplastic cells induced by cadmium could be favored, triggering the expansion of this cell population, which could ultimately result in tumor development. Apoptotic cell death can also be regulated by MT, which is one of the most important markers that has been used in biomonitoring programs to characterize metal contamination in the environment (Knapen et al., 2007). An increased level of MT was found to prevent apoptosis in cell cultures (Krizkova et al., 2009). In addition, immunohistochemical demonstration of high MT expression has been considered a useful prognostic tool for several types of cancer (Barnes et al., 2000). Recently, emerging data suggest that MTs have close relationship with tumors, some of them have shown an increased expression of MT in liver cancers (Cherian et al., 2003). In the present study, we also found an induction of MT mRNA expression levels by Cd, which suggest the potentional tumorigenic effects of Cd in ZFL cell and a useful biomarker of early stage carcinogenesis in the liver. However, a decrease of MT2 induction after exposure higher concentration of Cd (30 ␮M) have been observed in the other study (Tang et al., 2013), which may due to the different source of Cd, as Cd SO4 was used and a different reference gene, 18s RNA, were used. MT2 is always a sensitive positive control in our experiments with zebrafish (Chen et al., 2011; Cheuk et al., 2008; Wan et al., 2009). Cd has been designated a human carcinogen and is clearly a potent multi-tissue animal carcinogen (Waalkes, 2000). Several studies have indicated that Cd plays a role in human prostatic and renal cancers, and others have associated Cd exposure with human cancer of the liver, hematopoietic system, urinary bladder, and stomach (Waalkes, 2003). Our present work also showed that Cd can induce malignant transformation of the ZFL cell line and that these cadmium-transformed ZFL cells acquire apoptotic resistance. However, the exact mechanism by which Cd induces malignant transformation is unclear. The possible mechanisms in Cd carcinogenesis could be associated with aberrant gene expression, resulting in the stimulation of cell proliferation or apoptosis blockage. Therefore, the expression levels of several genes involved in cell proliferation, apoptosis regulation, and gene repair were investigated to illustrate Cd-induced carcinogenesis at the molecular level.

4.2. Immediate early genes (IEGs) and apoptotic regulators in tumor development The lEGs such as c-fos, c-jun, and c-myc are considered important in the control of cellular proliferation and differentiation based on their early transcriptional activation when quiescent cells are exposed to mitogenic substances, in addition to information about their roles as transcription factors (Matsuoka and Call, 1995). In our study, we found that Cd can induce the expression of c-fos and cjun as early as 3–6 h post-exposure, and the level of c-myc mRNA exhibited induction by 12–24 h. Our results are consistent with previous findings, which have shown that Cd induced the accumulation of IEGs mRNA in other cell types (c-fos and c-jun in rat liver cells (Yu et al., 2000), c-myc and c-jun in human prostate epithelial cells (Achanzar et al., 2000), and c-fos, c-jun, and c-myc in human proximal tubule cells (Garrett et al., 2002). The only notable difference between our findings and those of these studies was that the expression of c-jun was downregulated under 12 and 24 h of treatment, whereas they just returned to control values in other studies. Although both C-FOS and C-JUN are critical components of the nuclear activator protein-1 (AP-1) transcription factors, of the two, only C-JUN could induce apoptosis (Ding and Templeton, 2000). Therefore, the decreased expression of c-jun after late-stage Cd exposure might play a role in apoptosis blockage.

Y.Y. Chen et al. / Aquatic Toxicology 157 (2014) 196–206

Although the c-fos, c-jun, and c-myc genes are expressed constitutively in certain tissues, they are considered IEGs because their expression is usually low but rapidly inducible and, most often, transient in response to a wide array of stimuli to allow cells to adapt to environmental changes. The products of the IEGs constitute mitogenic growth signals stimulating cell proliferation, and they are regarded as major players in the promotion stage of a multi-stage carcinogenesis model (Waisberg et al., 2003). These factors amplify the proliferation of cells that have been initiated by mutations in critical genes. Many studies have shown Cd’s ability to activate IEF genes, and this activation is believed to be responsible for its carcinogenic potential, mainly because IEGs are frequently found to be overexpressed in tumors and in cells undergoing proliferation and differentiation (Joseph, 2009). Our results also showed that Cd could inhibit cell apoptosis due mainly to the downregulation of the p53 gene. p53 was the first tumor suppressor gene linked to apoptosis. p53 mutations occur in the majority of tumors and are often associated with advanced tumor stage (Lowe and Lin, 2000). Although induction of the p53 response upon stress occurs largely through alterations in the p53 protein expression and stability (Oren, 1999), this does not imply that the regulation of p53 gene transcription is totally irrelevant. An increasing number of studies have reported that the levels of p53 mRNA can be induced substantially under different stimulation (Reisman et al., 2012). Cd has been known and shown to enhance p53 expression to induce cell apoptosis in mammalian cells (Achanzar et al., 2000; Lag et al., 2002; Yu et al., 2011). In fact, Cd has been shown to disrupt p53 conformation, resulting in the inhibition of its function (Meplan et al., 1999). However, tumorigenic effects (as part of a multistep process) frequently involves the shedding of p53’s function, thus preventing p53triggered apoptotic responses to genetic damage and providing survival advantages to incipient mutated cancer cells at a number of subsequent steps in tumor progression. Cd is also known to be associated with p53 inactivation to cause renal cancer, and in p53deficient kidney proximal tubule cells, Cd-induced ROS production, and DNA damage (Bork et al., 2010). It has also been reported that Cd promoted the development of malignant cells in p53-inactivated kidney cells (Bork et al., 2010). Therefore, the inhibition of the expression level of p53 by Cd in this study indicated the involvement of this tumor suppressor gene in Cd-induced carcinogenesis. Wild-type p53 can act as a transcriptional activator or repressor of many genes, including those that regulate apoptosis. Previous studies have shown that the overexpression of wild type p53 can decrease bcl-2 gene expression but upregulate bax mRNA (Basu and Haldar, 1998). Thus, tumors with loss of p53 function are expected to contain increasing levels of bcl-2 and relatively low levels of bax mRNA. However, in the present study, although the levels of p53 were significantly decreased, the levels of bax were not affected and conversely, the levels of bcl-2 were downregulated. These results are supported by previous studies in which the inhibition of p53induced apoptosis did not affect the expression of p53 downstream genes’ expression, such as bax (Lotem et al., 2003). Because p53mediated bax induction may not be the only pathway by which p53 can induce cell death (Canman et al., 1995), the unresponsiveness of bax to p53 inhibition suggested that there might be other pathways that transfer the role of p53 affected by Cd-induced carcinogenesis. In addition to p53, recent studies have reported a novel mechanism that transcriptionally regulates the expression of bcl-2, suggesting that estrogen receptors (ERs) could control the transcription of bcl-2 via direct binding to the incomplete estrogen response element ERE in c-Jun or through protein–protein interaction with c-Jun (Li et al., 2014). In our study, we observed decreased levels of c-jun and ER␤ (data not shown) expression after 12–24 h of Cd exposure, which partly explains the p53-independent downregulation of bcl-2, but the role of decreased bcl-2 and the other

203

possible p53-dependent pathway in Cd-induced carcinogenesis requires further investigation. 4.3. Growth factors involved in Cd-induced carcinogenesis Growth factors and their receptors are also key regulators of cell proliferation, differentiation, survival, motility, and apoptosis. Among different families of growth factors and growth factor receptors, EGF and IGF and related receptors play a central role in chemical induced carcinogenesis (Niu et al., 2008). The overexpression of growth factors is involved in both tumor initiation and promotion. In this study, we observed the upregulation of egf and egfr in the early stages of Cd exposure, which is consistent with a previous study in which the Cd-induced elevated expression of egfr resulting in proliferative responses in a human lung adenocarcinoma cell line (Kundu et al., 2011). EGFR is expressed at high levels in a number of tumor types and in cells under trace metal exposure (Carpenter and Jiang, 2013), and the fact that the overexpression of EGFR activates the MAPK pathway is well known to be associated with cell proliferation and survival. However, we also observed a downregulation of EGFR after extended Cd2+ exposure, which might be due to the “self-downregulation”, in which case EGF could specifically and rapidly accelerate the degradation of EGFR protein and mRNA (Stoscheck and Carpenter, 1984). Unlike egf, the increased expression level of igf-1 occurred in the late stages of Cd treatment. The effects of Cd on the levels of igf-1 expression have not been well investigated, with only two studies showing that Cd decreased the levels of plasma IGF-I in rats (Turgut et al., 2005) and mRNA expression in the livers of yellow perch (Pierron et al., 2009). In this study, we first found that the upregulation of igf-1 is involved in Cd-induced ZFL proliferation. Similar to egf, igf-1 could also active the MAPK pathway after binding to IGF receptors, which regulated cell proliferation and apoptosis (Choi et al., 2008). Interestingly, opposite to igf-1, we observed the transient upregulation of igf-1rb by 3 h, and then the levels of igf-1rb decreased to a level less than the control. In zebrafish, there are two distinct IGF-IR mRNAs and proteins, which may play different roles in the regulation growth and development of zebrafish (Maures et al., 2002). Thus, the downregulation of igf-1rb suggested that IGF signals might be mediated through the IGF-Ia rather than the IGF-1Rb receptor. 4.4. Cd-induced DNA damages The genotoxic potential of Cd in certain systems has been well established (Coogan et al., 1992), and it has been shown to induce DNA damage in cultured cells. The available evidence has suggested that this DNA damage is the result of DNA repair inhibition (Hartwig, 1998). DNA repair interference is an important factor that contributes to Cd induced carcinogenicity (Filipic, 2012). It is well known that Cd can induce of DNA damage in various cell line and animal tissues (Sarkar et al., 2013), however, the molecular mechanism underlying this process is still poorly understand. DNA damage by Cd is linked to DNA damage by ROS and inhibition of DNA repair mechanism, but previous study have showed that ROS was not induced by Cd in ZFL cell line (Zhu and Chan, 2012). Therefore interference with DNA repair would be important factor that contributes to Cd genotoxicity in ZFL cell line. Zhou has reported that Cd can decrease DNA repair capacity and induce DNA damage in human bronchial epithelial cells (Zhou et al., 2013). In this study, rad51, a DNA repair protein or homolog of bacterial Rec A gene or yeast rad51, that mediates homologous recombination, was specifically downregulated by Cd at the mRNA level. The attenuation of rad51, expression has been observed in many tumor cells (Bindra et al., 2004; Collis et al., 2001), but the Cd-induction of rad51, has

204

Y.Y. Chen et al. / Aquatic Toxicology 157 (2014) 196–206

Fig. 8. Proposed mechanism for Cd2+ -induced carcinogenesis in the ZFL cells. Depicted are the genes and pathways immediately affected by Cd2+ or mediated by interlinked steps. Genes known to be upregulated by Cd2+ are marked with a circular shape while those downregulated by cadmium are marked with a rectangular shape. Genes with no significant response to Cd2+ induction are marked with a dotted line. Genes with question marks represent an unclear role in cadmium carcinogenesis. Abbreviations: divalent metal transporter 1 (dmt1), epidermal growth factor (egf), epidermal growth factor receptor (egfr), growth-arrest-DNA-damage (gadd45), insulin-like growth factor 1 (igf-1), insulin-like growth factor 1 receptor b (igf-1rb), mitogen-activated protein kinase (MAPK), and multiple drug resistance protein 1 (mdr1), metallothionein 2 (mt2).

also been noted in the livers of zebrafish exposed to Cd (Gonzalez et al., 2006). In contrast to rad51, other DNA repair genes, such as gadd45, were upregulated by Cd. A similar result found that Cdinduced gadd45 expression in zebrafish livers (Gonzalez et al., 2006). The transcriptional of gadd45 has been reported to be activated by AP1 (Oh-Hashi et al., 2004), thus, the increased levels of gadd45 in this study might reflect a downstream response to c-fos and c-jun induction. The gadd45 gene is activated when cells are subjected to agents that induce DNA damage (Scott et al., 2005), thus, its upregulation in this study suggested that Cd might have induced severe DNA damage, which is a key factor in tumor initiation. Therefore, these results indicate that both rad51 and gadd45 were associated with the mechanism for Cd carcinogenesis. However, gadd45 also functions in blood cell differentiation, cell homeostasis, and stress response, and it may play an important role in growth control, cell cycle arrest, and apoptosis, or even be a hallmark of malignancy (Liebermann and Hoffman, 2002). 5. Conclusions This study provides evidence that Cd increases the cell proliferation associated with apoptosis blockage and the aberrant expression of IEGs, p53, growth factors and DNA repair genes. Combined with our previous studies, a possible mechanism of toxic response to Cd2+ and Cd-induced carcinogenesis is summarized in Fig. 8. The observed cell growth stimulation, coupled with the inhibition of apoptosis and the deregulation of genes expression after Cd exposure, created a microenvironment for genomic instability that led to malignant transformation. This study therefore provides

novel insight into the mechanisms underlying cadmium-induced carcinogenesis in ZFL cells. Further research into the mechanisms of cadmium-induced cancers of the liver system is needed. Conflict of interest statement The authors declare no conflict of interest. Acknowledgments We thank the School of Life Sciences for its provision of a core facility and research allowance to conduct this research. Chen YY and Zhu JY were the recipients of post-graduate studentships. References Achanzar, W.E., Achanzar, K.B., Lewis, J.G., Webber, M.M., Waalkes, M.P., 2000. Cadmium induces c-myc, p53, and c-jun expression in normal human prostate epithelial cells as a prelude to apoptosis. Toxicol. Appl. Pharmacol. 164, 291–300. Achanzar, W.E., Webber, M.M., Waalkes, M.P., 2002. Altered apoptotic gene expression and acquired apoptotic resistance in cadmium-transformed human prostate epithelial cells. Prostate 52, 236–244. Ahmed, S.A., Gogal Jr., R.M., Walsh, J.E., 1994. A new rapid and simple non-radiaive assay to monitor and determine the proliferation of lymphocytes: an alternative to [3 H]thymidine incoporation assay. J. Immunol. Methods 170, 211–224. Aitio, A., Tritscher, A., 2004. Effects on health of cadmium—WHO approaches and conclusions. Biometals 17, 491. Alestrom, P., Holter, J.L., Nourizadeh-Lillabadi, R., 2006. Zebrafish in functional genomics and aquatic biomedicine. Trends Biotechnol. 24, 15–21. Amanuma, K., Takeda, H., Amanuma, H., Aoki, Y., 2000. Transgenic zebrafish for detecting mutations caused by compounds in aquatic environments. Nat. Biotechnol. 18, 62–65. Andersen, C.L., Jensen, J.L., Orntoft, T.F., 2004. Normalization of real-time quantitative reverse transcription-PCR data: a model-based variance estimation

Y.Y. Chen et al. / Aquatic Toxicology 157 (2014) 196–206 approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 64, 5245–5250. Badisa, V.L.D., Latinwo, L.M., Odewumi, C.O., Ikediobi, C.O., Badisa, R.B., BrooksWalter, A., Lambert, A.T.T., Nwoga, J., 2008. Cytotoxicity and stress gene microarray analysis in cadmium-exposed CRL-1439 normal rat liver cells. Int. J. Mol. Med. 22, 213–219. Barham, S.S., Tarara, J.E., Enger, M.D., 1985. Cadmium as a transforming growthfactor. Fed. Proc. 44, 520. Barnes, N.L., Ackland, M.L., Cornish, E.J., 2000. Metallothionein isoform expression by breast cancer cells. Int. J. Biochem. Cell Biol. 32, 895–903. Basha, P.S., Rani, A.U., 2003. Cadmium-induced antioxidant defense mechanism in freshwater teleost Oreochromis mossambicus (Tilapia). Ecotoxicol. Environ. Saf. 56, 218–221. Basu, A., Haldar, S., 1998. The relationship between Bcl2, Bax and p53: consequences for cell cycle progression and cell death. Mol. Hum. Reprod. 4, 1099–1109. Bernard, A., 2008. Cadmium and its adverse effects on human health. Indian J. Med. Res. 128, 557–564. Bindra, R.S., Schaffer, P.J., Meng, A., Woo, J., Maseide, K., Roth, M.E., Lizardi, P., Hedley, D.W., Bristow, R.G., Glazer, P.M., 2004. Down-regulation of Rad51 and decreased homologous recombination in hypoxic cancer cells. Mol. Cell. Biol. 24, 8504–8518. Bork, U., Lee, W.K., Kuchler, A., Dittmar, T., Thevenod, F., 2010. Cadmium-induced DNA damage triggers G(2)/M arrest via chk1/2 and cdc2 in p53-deficient kidney proximal tubule cells. Am. J. Physiol. Ren. Physiol. 298, F255–F265. Canman, C.E., Gilmer, T.M., Coutts, S.B., Kastan, M.B., 1995. Growth-factor modulation of P53-mediated growth arrest versus apoptosis. Genes Dev. 9, 600–611. Carpenter, R.L., Jiang, B.H., 2013. Roles of EGFR, PI3K, AKT, and mTOR in heavy metalinduced cancer. Curr. Cancer Drug Targets 13, 252–266. Chen, D.S., Chan, K.M., 2009. Changes in the protein expression profiles of the HepaT1 cell line when exposed to Cu2+ . Aquat. Toxicol. 94, 163–176. Chen, D.S., Chan, K.M., 2011. Differentially expressed proteins in zebrafish liver cells exposed to copper. Aquat.Toxicol. 104, 270–277. Chen, D.S., Zhang, D.Q., Yu, J.C., Chan, K.M., 2011. Effects of Cu2 O nanoparticle and CuCl2 on zebrafish larvae and a liver cell-line. Aquat. Toxicol. 105, 344–354. Cherian, M.G., Jayasurya, A., Bay, B.H., 2003. Metallothioneins in human tumors and potential roles in carcinogenesis. Mutat. Res.-Fund Mol. M 533, 201–209. Cheuk, W.K., Chan, P.C.Y., Chan, K.M., 2008. Cytotoxicities and induction of metallothionein (MT) and metal regulatory element (MRE)-binding transcription factor-1 (MTF-1) messenger RNA levels in the zebrafish (Danio rerio) ZFL and SJD cell lines after exposure to various metal ions. Aquat. Toxicol. 89, 103–112. Chibber, R., Ord, M., 1990. Cadmium-induced multistep transformation of cultured Indian muntjac skin fibroblasts. Biol. Met. 3, 213–221. Choi, Y.S., Cho, H.Y., Hoyt, K.R., Naegele, J.R., Obrietan, K., 2008. IGF-1 receptormediated ERK/MAPK signaling couples status epilepticus to progenitor cell proliferation in the subgranular layer of the dentate gyrus. Glia 56, 791–800. Ciesielski, T., Weuve, J., Bellinger, D.C., Schwartz, J., Lanphear, B., Wright, R.O., 2012. Cadmium exposurre and neurodevelopmental outcomes in U.S. children. Environ. Health Perspect. 120, 758–763. Cifone, M.G., Alesse, E., Procopio, A., Paolini, R., Morrone, S., Dieugenio, R., Santoni, G., Santoni, A., 1989. Effects of cadmium on lymphocyte-activation. Biochim. Biophys. Acta 1011, 25–32. Collis, S.J., Tighe, A., Scott, S.D., Roberts, S.A., Hendry, J.H., Margison, G.P., 2001. Ribozyme minigene-mediated RAD51 down-regulation increases radiosensitivity of human prostate cancer cells. Nucleic Acids Res. 29, 1534–1538. Coogan, T.P., Bare, R.M., Waalkes, M.P., 1992. Cadmium-induced DNA strand damage in cultured liver-cells: reduction in cadmium genotoxicity following zinc pretreatment. Toxicol. Appl. Pharmacol. 113, 227–233. Deng, X.P., Xia, Y., Hu, W., Zhang, H.X., Shen, Z.G., 2010. Cadmium-induced oxidative damage and protective effects of N-acetyl-l-cysteine against cadmium toxicity in Solanum nigrum L. J. Hazard. Mater. 180, 722–729. Ding, W., Templeton, D.M., 2000. Activation of parallel mitogen-activated protein kinase cascades and induction of c-fos by cadmium. Toxicol. Appl. Pharmacol. 162, 93–99. Doi, T., Puri, P., Bannigan, J., Thompson, J., 2010. Disruption of calreticulin-mediated cellular adhesion signaling in the cadmium-induced omphalocele in the chick model. Pediatr. Surg. Int. 26, 91–95. Eide, M., Rusten, M., Male, R., Jensen, K.H.M., Goksoyr, A., 2014. A characterization of the ZFL cell line and primary hepatocytes as in vitro liver cell models for the zebrafish (Danio rerio). Aquat. Toxicol. 147, 7–17. Etchin, J., Kanki, J.P., Look, A.T., 2011. Zebrafish as a model for the study of human cancer. Methods Cell Biol. 105, 309–337. Feitsma, H., Cuppen, E., 2008. Zebrafish as a cancer model. Mol. Cancer Res. 6, 685–694. Garrett, S.H., Phillips, V., Somji, S., Sens, M.A., Dutta, R., Park, S., Kim, D., Sens, D.A., 2002. Transient induction of metallothionein isoform 3 (MT-3), c-fos, c-jun and c-myc in human proximal tubule cells exposed to cadmium. Toxicol. Lett. 126, 69–80. Giaginis, C., Gatzidou, E., Theocharis, S., 2006. DNA repair systems as targets of cadmium toxicity. Toxicol. Appl. Pharmacol. 213, 282–290. Godt, J., Scheidig, F., Grosse-Siestrup, C., Esche, V., Brandenburg, P., Reich, A., Groneberg, D.A., 2006. The toxicity of cadmium and resulting hazards for human health. J. Occup. Med. Toxicol. 1, 22. Gonzalez, P., Baudrimont, M., Boudou, A., Bourdineaud, J.P., 2006. Comparative effects of direct cadmium contamination on gene expression in gills, liver, skeletal muscles and brain of the zebrafish (Danio rerio). Biometals 19, 225–235.

205

Habeebu, S.S.M., Liu, J., Klaassen, C.D., 1998. Cadmium-induced apoptosis in mouse liver. Toxicol. Appl. Pharmacol. 149, 203–209. Han, J.X., Shang, Q., Du, Y., 2009. Review: effect of environment cadmium pollution on human health. Health (N. Y.) 1, 159–166. Hartwig, A., 1998. Carcinogenicity of metal compounds: possible role of DNA repair inhibition. Toxicol. Lett. 103, 235–239. Hyder, O., Chung, M., Cosgrove, D., Herman, J.M., Li, Z.P., Firoozmand, A., Gurakar, A., Koteish, A., Pawlik, T.M., 2013. Cadmium exposure and liver disease among US adults. J. Gastrointest. Surg. 17, 1265–1273. IARC, 1993. International Agency for Research on Cancer Monographs on the Evaluation of Carcinogenic Risks to Humans. IARC Scientific Publications, Lyon, pp. 119–237. Jarup, L., Akesson, A., 2009. Current status of cadmium as an enironmental health problem. Toxicol. Appl. Pharmacol. 238, 201–208. Joseph, P., 2009. Mechanisms of cadmium carcinogenesis. Toxicol. Appl. Pharmacol. 238, 272–279. Kang, Y.J., Enger, M.D., 1991. Cadmium inhibits Egf-induced DNA-synthesis but increases cellular glutathione levels in Nrk-49f cells. Toxicology 66, 325–333. Kjellstrom, T., 1992. Mechanism and epidemiology of bone effects of cadmium. IARC Sci. Publ. 118, 301–310. Knapen, D., Reynders, H., Bervoets, L., Verheyen, E., Blust, R., 2007. Metallothionein gene and protein expression as a biomarker for metal pollution in natural gudgeon populations. Aquat. Toxicol. 82, 163–172. Krizkova, S., Fabrik, I., Adam, V., Hrabeta, P., Eckschlager, T., Kizek, R., 2009. Metallothionein—a promising tool for cancer diagnostics. Bratisl. Med. J. 110, 93–97. Krumschnabel, G., Ebner, H.L., Hess, M.W., Villunger, A., 2010. Apoptosis and necroptosis are induced in rainbow trout cell lines exposed to cadmium. Aquat. Toxicol. 99, 73–85. Kundu, S., Sengupta, S., Bhattacharyya, A., 2011. EGFR upregulates inflammatory and proliferative responses in human lung adenocarcinoma cell line (A549), induced by lower dose of cadmium chloride. Inhal. Toxicol. 23, 339–348. Lag, M., Westly, S., Lerstad, T., Bjornsrud, C., Refsnes, M., Schwarze, P.E., 2002. Cadmium-induced apoptosis of primary epithelial lung cells: involvement of Bax and p53, but not of oxidative stress. Cell Biol. Toxicol. 18, 29–42. Li, Z., Zheng, W., Wang, Z.Y., Zeng, Z., Zhan, H., Li, C., Zhou, L., Yan, C., Spitsbergen, J.M., Gong, Z., 2013. A transgenic zebrafish liver tumor model with inducible Myc expression reveals conserved Myc signatures with mammalian liver tumors. Dis. Models Mech. 6, 414–423. Li, Z.L., Ueki, K., Kumagai, K., Araki, R., Otsuki, Y., 2014. Regulation of bcl-2 transcription by estrogen receptor-alpha and c-Jun in human endometrium. Med. Mol. Morphol. 47, 43–53. Liang, N., Yang, L.Y., Dai, J.R., Pang, X.G., 2011. Heavy metal pollution in surface water of Linglong gold mining area, China. Procedia Environ. Sci. 10, 914–917. Liebermann, D.A., Hoffman, B., 2002. Myeloid differentiation (MyD)/growth arrest DNA damage (GADD) genes in tumor suppression, immunity and inflammation. Leukemia 16, 52. Liu, J., Qu, W., Kadiiska, M.B., 2009. Role of oxidative stress in cadmium toxicity and carcinogenesis. Toxicol. Appl. Pharmacol. 238, 209–214. Lotem, J., Gal, H., Kama, R., Amariglio, N., Rechavi, G., Domany, E., Sachs, L., Givol, D., 2003. Inhibition of p53-induced apoptosis without affecting expression of p53-regulated genes. Proc. Natl. Acad. Sci. U. S. A. 100, 6718–6723. Lowe, S.W., Lin, A.W., 2000. Apoptosis in cancer. Carcinogenesis 21, 485–495. Lu, J.W., Hsia, Y., Tu, H.C., Hsiao, Y.C., Yang, W.Y., Wang, H.D., Yuh, C.H., 2011. Liver development and cancer formation in zebrafish. Birth Defects Res. C 93, 157–172. Martin, J.J., Martin, R., Codesal, J., Fraile, B., Paniagua, R., Santamaria, L., 2001. Cadmium chloride-induced dysplastic changes in the ventral rat prostate: an immunohistochemical and quantitative study. Prostate 46, 11–20. Matsuoka, M., Call, K.M., 1995. Cadmium-induced expression of immediate early genes in LLC-PK1 cells. Kidney Int. 48, 383–389. Maures, T., Chan, S.J., Xu, B., Sun, H., Ding, J., Duan, C.M., 2002. Structural, biochemical, and expression analysis of two distinct insulin-like growth factor I receptors and their ligands in zebrafish. Endocrinology 143, 1858–1871. Meplan, C., Mann, K., Hainaut, P., 1999. Cadmium induces conformational modifications of wild-type p53 and suppresses p53 response to DNA damage in cultured cells. J. Biol. Chem. 274, 31663–31670. Nawrot, T., Plusquin, M., Hogervorst, J., Roels, H.A., Celis, H., Vangronsveld, J., Van Hecke, E., Staessen, J.A., 2006. Environmental exposure to cadmium and risk of cancer: a prospective population-based study. Lancet Oncol. 7, 119–126. Niu, J., Li, X.N., Qian, H.X., Han, Z.G., 2008. siRNA mediated the type 1 insulin-like growth factor receptor and epidermal growth factor receptor silencing induces chemosensitization of liver cancer cells. J. Cancer Res. Clin. Oncol. 134, 503–513. Nordberg, G.F., 2004. Cadmium and health in the 21st century: historical remarks and trends for the future. Biometals 17, 485–489. Nordberg, G.F., 2009. Historical perspectives on cadmium toxicology. Toxicol. Appl. Pharmacol. 238, 192–200. Oh-Hashi, K., Maehara, K., Isobe, K., 2004. Hydrogen peroxide induces GADD153 in Jurkat cells through the protein kinase C-dependent pathway. Redox Rep. 9, 173–178. Oren, M., 1999. Regulation of the p53 tumor suppressor protein. J. Biol. Chem. 274, 36031–36034. Pamphlett, R., McQuilty, R., Zarkos, K., 2001. Blood levels of toxic and essential metals in motor neuron disease. Neurotoxicology 22, 401–410. Pfaffl, M.W., Tichopad, A., Prgomet, C., Neuvians, T.P., 2004. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity:

206

Y.Y. Chen et al. / Aquatic Toxicology 157 (2014) 196–206

BestKeeper—Excel-based tool using pair-wise correlations. Biotechnol. Lett. 26, 509–515. Pierron, F., Bourret, V., St-Cyr, J., Campbell, P.G.C., Bernatchez, L., Couture, P., 2009. Transcriptional responses to environmental metal exposure in wild yellow perch (Perca flavescens) collected in lakes with differing environmental metal concentrations (Cd, Cu, Ni). Ecotoxicology 18, 620–631. Pierron, F., Baillon, L., Sow, M., Gotreau, S., Gonzalez, P., 2014. Effect of low-dose cadmium exposure on DNA methylation in the endangered European eel. Environ. Sci. Technol. 48, 797–803. Reisman, D., Takahashi, P., Polson, A., Boggs, K., 2012. Transcriptional regulation of the p53 tumor suppressor gene in S-phase of the cell-cycle and the cellular response to DNA damage. Biochem. Res. Int. 2012, 808934. Sarkar, A., Bhagat, J., Ingole, B.S., Rao, D.P., Markad, V.L., 2013. Genotoxicity of cadmium chloride in the marine gastropod Nerita chamaeleon using comet assay and alkaline unwinding assay. Environ. Toxicol., http://dx.doi.org/10.1002/tox.21883. Scott, D.W., Mutamba, S., Hopkins, R.G., Loo, G., 2005. Increased GADD gene expression in human colon epithelial cells exposed to deoxycholate. J. Cell. Physiol. 202, 295–303. Satarug, S., Grrett, S.H., Sens, M.A., Sens, D.A., 2010. Cadmium, environmental exposure, and health outcomes. Environ. Health Perspect. 118, 182–190. Shaikh, Z.A., Vu, T.T., Zaman, K., 1999. Oxidative stress as a mechanism of chronic cadmium-induced hepatotoxicity and renal toxicity and protection by antioxidants. Toxicol. Appl. Pharmacol. 154, 256–263. Shen, L.H., Lam, K.L., Ko, P.W., Chan, K.M., 1998. Metal concentrations and analysis of metal binding protein fractions from the liver of Tilapia collected from Shing Mun River. Mar. Environ. Res. 46, 597–600. Shive, H.R., 2013. Zebrafish models for human cancer. Vet. Pathol. 50, 468–482. Silver, N., Best, S., Jiang, J., Thein, S.L., 2006. Selection of housekeeping genes for gene expression studies in human reticulocytes using real-time PCR. BMC Mol. Biol. 7, 1471–2199. Stoscheck, C.M., Carpenter, G., 1984. Down regulation of epidermal growth factor receptors: direct demonstration of receptor degradation in human fibroblasts. J. Cell Biol. 98, 1048–1053. Tang, S., Allagadda, V., Chibli, H., Nadeau, J.L., Mayer, G.D., 2013. Comparison of cytotoxicity and expression of metal regulatory genes in zebrafish (Danio rerio) liver cells exposed to cadmium sulfate, zinc sulfate and quantum dots. Metallomics 5, 1411–1422. Tellez-Plaza, M., Guallar, E., Howard, B.V., Umans, J.G., Francesconi, K.A., Goessler, W., Silbergeld, E.K., Devereux, R.B., Navas-Acien, A., 2013. Cadmium exposure and incident cardiovascular disease. Epidemiology 24, 421–429. Templeton, D.M., Liu, Y., 2010. Multiple roles of cadmium in cell death and survival. Chem. Biol. Interact. 188, 267–275. Thevenod, F., 2009. Cadmium and cellular signaling cascades: to be or not to be? Toxicol. Appl. Pharmacol. 238, 221–239. Turgut, S., Kaptanoglu, B., Turgut, G., Emmungil, G., Genc, O., 2005. Effects of cadmium and zinc on plasma levels of growth hormone, insulin-like growth factor I, and insulin-like growth factor-binding protein 3. Biol. Trace Elem. Res. 108, 197–204. Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A., Speleman, F., 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3, 0034.

Vartanian, R., Masri, J., Martin, J., Cloninger, C., Holmes, B., Artinian, N., Funk, A., Ruegg, T., Gera, J., 2011. AP-1 regulates cyclin D1 and c-MYC transcription in an AKT-dependent manner in response to mTOR inhibition: role of AIP4/Itchmediated JUNB degradation. Mol. Cancer Res. 9, 115–130. Verougstraete, V., Lison, D., Hotz, P., 2003. Cadmium, lung and prostate cancer: a systematic review of recent epidemiological data. J. Toxicol. Environ. Health B: Crit. Rev. 6, 227–255. Vonzglinicki, T., Edwall, C., Ostlund, E., Lind, B., Nordberg, M., Ringertz, N.R., Wroblewski, J., 1992. Very low cadmium concentrations stimulate DNA-synthesis and cell-growth. J. Cell Sci. 103, 1073–1081. Waalkes, M.P., 2000. Cadmium carcinogenesis in review. J. Inorg. Biochem. 79, 241–244. Waalkes, M.P., 2003. Cadmium carcinogenesis. Mutat. Res. 533, 107–120. Waalkes, M.P., Klaassen, C.D., 1985. Concentration of metallothionein in major organs of rats after administration of various metals. Fundam. Appl. Toxicol. 5, 473–477. Waalkes, M.P., Rehm, S., 1994. Cadmium and prostate-cancer. J. Toxicol. Environ. Health 43, 251–269. Waisberg, M., Joseph, P., Hale, B., Beyersmann, D., 2003. Molecular and cellular mechanisms of cadmium carcinogenesis. Toxicology 192, 95–117. Wan, G., Cheuk, W.K., Chan, K.M., 2009. Differential regulation of zebrafish metallothionein-II (zMT-II) gene transcription in ZFL and SJD cell lines by metal ions. Aquat. Toxicol. 91, 33–43. Woo, E.S., Monks, A., Watkins, S.C., Wang, A.S., Lazo, J.S., 1997. Diversity of metallothionein content and subcellular localization in the National Cancer Institute tumor panel. Cancer Chemother. Pharmacol. 41, 61–68. Ye, J.L., Mao, W.P., Wu, A.L., Zhang, N.N., Zhang, C., Yu, Y.J., Zhou, L., Wei, C.J., 2007. Cadmium-induced apoptosis in human normal liver L-02 cells by acting on mitochondria and regulating Ca2+ signals. Environ. Toxicol. Pharmacol. 24, 45–54. Yu, R., Chen, X., Lu, W., 2000. Effects of cadmium on the expression of proto-oncogene c-fos and c-jun of liver cell in rats. Wei sheng yan jiu 29, 364–365. Yu, X., Sidhu, J.S., Hong, S., Robinson, J.F., Ponce, R.A., Faustman, E.M., 2011. Cadmium induced p53 dependent activation of stress signling, accumulation of ubiquitinated proteins, and apoptosis in mouse embryonic fibroblast cells. Toxicol. Sci. 120, 403–412. Yuan, C., Kadiiska, M., Achanzar, W.E., Mason, R.P., Waalkes, M.P., 2000. Possible role of caspase-3 inhibition in cadmium-induced blockage of apoptosis. Toxicol. Appl. Pharmacol. 164, 321–329. Zhang, W.-L., Du, Y., Zhai, M.-M., Shang, Q., 2014. Cadmium exposure and its health effects: a 19 year follow-up study of a polluted area in China. Sci. Total Environ. 470–471, 224–228. Zheng, W.L., Li, Z., Nguyen, A.T., Li, C.X., Emelyanov, A., Gong, Z.Y., 2014. Xmrk, Kras and Myc transgenic zebrafish liver cancer models share molecular signatures with subsets of human hepatocellular carcinoma. PLoS ONE 9, e91179. Zhou, Z., Wang, C., Liu, H., Huang, Q., Wang, M., Lei, Y., 2013. Cadmium induced cell apoptosis, DNA damage, decreased DNA repair capacity, and genomic instability during malignant transformation of human bronchial epithelial cells. Int. J. Med. Sci. 10, 1485–1496. Zhu, J.Y., Chan, K.M., 2012. Mechanism of cadmium-induced cytotoxicity on the ZFL zebrafish liver cell line. Metallomics 4, 1064–1076.