Effects of carbon tetrachloride on oxidative stress, inflammatory response and hepatocyte apoptosis in common carp (Cyprinus carpio)

Accepted Manuscript Title: Effects of carbon tetrachloride on oxidative stress, inflammatory response and hepatocyteapoptosisincommon carp (Cyprinus carpio) Author: Rui Jia Li-Ping Cao Jin-Liang Du Jia-Hao Wang Ying-Juan Liu Galina Jeney Pao Xu Guo-Jun Yin PII: DOI: Reference:

S0166-445X(14)00064-2 http://dx.doi.org/doi:10.1016/j.aquatox.2014.02.014 AQTOX 3771

To appear in:

Aquatic Toxicology

Received date: Revised date: Accepted date:

28-11-2013 19-2-2014 21-2-2014

Please cite this article as: Jia, R., Cao, L.-P., Du, J.-L., Wang, J.-H., Liu, Y.-J., Jeney, G., Xu, P., Yin, G.-J.,Effects of carbon tetrachloride on oxidative stress, inflammatory response and hepatocyteapoptosisincommon carp (Cyprinus carpio), Aquatic Toxicology (2014), http://dx.doi.org/10.1016/j.aquatox.2014.02.014 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

*Manuscript

1

Effects of carbon tetrachloride on oxidative stress, inflammatory response and hepatocyteapoptosisincommon carp (Cyprinus carpio) Rui Jiaa, b, Li-Ping Caob, c, Jin-Liang Dub, c, Jia-Hao Wanga, Ying-Juan Liua, Galina Jeneyd, Pao Xua,b, *, Guo-Jun Yina,b, c, * Wuxi Fisheries College, Nanjing Agricultural University, Wuxi 214081, China

ip t

a

b

cr

Key Laboratory of Freshwater Fisheries and Germplasm Resources Utilization, Ministry of

Agriculture, Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences,

International Joint Research Laboratory for Fish Immunopharmacology, Freshwater

an

c

us

Wuxi 214081，China

Fisheries Research Center, Chinese Academy of Fishery Sciences, Wuxi 214081，China National Agricultural Research Center, Research Institute for Fisherie and, Aquaculture,

ce pt

ed

Anna Light 8, Szarvas 5440, Hungary

M

d

Corresponding author. Wuxi Fisheries College, Nanjing Agricultural University, Wuxi 214081, China. Tel.: 86 510 85551442; Fax: +86 510 85551442

Ac

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

E-mail address: [email protected] (GJ Yin), [email protected] (P Xu)

Page 1 of 27

2

Abstract: In the present study, the cellular and molecular mechanism of carbon tetrachloride (CCl4)-induced hepatotoxicity in fish was investigated by studying the effects of CCl4 on the oxidative stress, inflammatory response and hepatocyte apoptosis. Common carp were given an intraperitoneal injection of 30% CCl4 in arachis oil (0.5 ml/kg body weight). At 72 h post-injection, blood were collected to measure glutamate pyruvate transaminase (GPT),

ip t

glutamate oxalate transaminase (GOT), superoxide dismutase (SOD), glutathione peroxidase (GPx), catalase (CAT), glutathione (GSH), total antioxidant capacity (T-AOC) and

cr

malondialdehyde (MDA), liver samples were taken to analyze toll-like receptor 4 (TLR4),

us

cytochrome P450 2E1 (CYP2E1) and gene expressions of inflammatory cytokines and nuclear factor-κB (NF-κB/cREL). Cell viability and apoptosis were analyzed after treatment of the primary hepatocytes with CCl4 at 8 mM. The results showed that CCl4 significantly increased the

an

levels of GPT, GOT, MDA,TLR4 and CYP2E1, reduced the levels of SOD, GPx, CAT, GSH and T-AOC, and up-regulated the gene expressions of NF-κB/cREL and inflammatory cytokines

M

including tumor necrosis factor-ɑ (TNF-ɑ ), inducible nitric oxide synthase (iNOS), IL-1ß, IL-6 and IL-12. In vitro, CCl4 caused a dramatic loss in cell viability and induced hepatocyte apoptosis.

ed

Overall results suggest that oxidative stress lipid peroxidation, and TNF-ɑ /NF-κB and TRL4/NF-κB signaling pathways play important roles in CCl4-induced hepatotoxicity in fish.

ce pt

Key word: Carbon tetrachloride; inflammatory cytokines; nuclear translocation factor; apoptosis; Cyprinus carpio

Ac

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

Page 2 of 27

3

1. Introduction Carbon tetrachloride (CCl4) once was widely used as a solvent, degrader, and cleaner for both home and industrial uses, until its pronounced hepatotoxicity and carcinogenicity was discovered when exposed to human (Clawson, 1989). It is commonly found in fresh water, which results in

ip t

both the contamination of aquatic environment and the accumulation of toxicants in aquatic organisms (Statham et al., 1978). Today, CCl4 is extensively used as a model chemical in the

cr

study of acute liver injury (Weber et al., 2003; Zhang et al., 2011).

Liver is prone to xenobiotic-induced injury because of its central role in xenobiotics

us

metabolism, its portal location within the circulation, and its anatomic and physiologic structure (Allis et al., 1996). Fish liver is as sensitive as mammal in the response to CCl4 (Statham et al.,

an

1978). CCl4 has been shown to enhance the hepatocarcinogenicity of aflatoxin B1 in rainbow trout (Kotsanis and Metcalfe, 1991). In vitro, CCl4 caused a dose- and time- dependent lactate

M

dehydrogenase (LDH) release and glutathione (GSH) depletion in the primary hepatocytes of rainbow trout (Råbergh and Lipsky, 1997). Our previous studies also confirmed that CCl4 induced

2012; Yin et al., 2011).

ed

lipid peroxidation and altered hepatocyte membrane permeability in common carp (Jia et al.,

ce pt

The common carp (Cyprinus carpioL.) is the most extensively cultured freshwater fish in China. It is an internationally accepted test organism for aquatic effect assessments (OECD, 1994). The in vitro carp hepatocyte culture system has been constantly used as a tool for xenobiotic metabolism and toxicity studies (Pesonen and Andersson, 1997), and recently it has been employed for the screening of the hepatoprotective agents in fish (Yin et al., 2011).

Ac

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

The susceptibility of fish to CCl4 varies with fish species. We have previously demonstrated that CCl4 caused severe damage to carp hepatocytes at the concentration of 8 mM and liver tissue at the dose of 0.15 ml/kg body weight (Jia et al., 2012). In English sole, injection of CCl4 at the dose of 0.19 ml/kg caused few histopathological changes in the liver, while at the dose of 3ml/kg, subcapsular hepatocellular coagulation necrosis with sinusoidal congestion, coagulation necrosis of centrally located hepatocytes and hepatocellular fatty change were noticed (Casillas et al., 1983). In Nile tilapia, intraperitoneal injection of CCl4 at the dose of 1.12 ml/kg resulted in

Page 3 of 27

4

serious liver damage and the death of fish between 48 and 72 h post injection (Chen et al., 2004). In rainbow trout, CCl4 (1 ml/kg, ip) produced 5- to 10-fold increases in serum GOT and GPT (Statham et al., 1978). This susceptibility difference was also confirmed by the different 96-hour median lethal concentration (LC50) for different fish species, which was 10 μl/l for brown trout (Krasnov et al., 2007), 20 μl/l for rainbow trout (Krasnov et al., 2005), 14.94 μl/l for rosy barbs

ip t

and 11.8 μl/l for amphioxus (Bhattacharya et al., 2008). Although the toxicity of CCl4 has been investigated in various fish species by means of measuring blood biochemical parameters and

cr

histopathological examination, the molecular and cellular mechanism of CCl4 toxicity remains

us

unclear. Therefore, the present study aimed to explore the cellular and molecular mechanism of CCl4 toxicity by studying its effect on oxidative stress, inflammatory response and hepatocyte

an

apoptosis in common carp. 2. Materials and methods

M

2.1. Chemicals

L-15 medium, dimethyl sulfoxide (DMSO), trypan blue, ethylene diamine tetraacetic acid

ed

(EDTA), dulbecco’s phosphate-buffered saline (D-PBS), 0.25% trypsin, streptomycin/penicillin and heparin were purchased from Sigma Company (St. Louis, MO, USA). Fetal bovine

ce pt

serum(FBS) and cell culture plates were ordered from Gibco Company (USA). Carbon tetrachloride (CCl4) and acetic acid were commercial products obtained from National Pharmaceutical Group Chemical Reagent Co., Ltd. (Shanghai, China). All other reagents used in the experiment were of analytical grade.

Ac

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

2.2.Fish and treatment. Common carp (Cyprinus carpioL.), with an initial body weight (BW) of 51.0 ± 1.1 g, were kept in a recirculation system at the Freshwater Fish Research Center of Chinese Academy of Fishery Sciences. They were acclimated to the experimental conditions (water temperature, 26±2°C; pH, 6.8-7.6; dissolved oxygen, >5 mg/L; NH3, <0.05 mg/L; H2S, <0.01 mg/L; 20% water exchange rate per day) for 5 days and fed with a basal diet (40% crude protein, 10% crude lipid,

Page 4 of 27

5

10% ash, and an energy content of 21 kJ/g dry matter) at 2% of their body weight twice a day prior to the experiment. Fish were randomly divided into control group and CCl4 treatment group, each containing 15 animals. Control group was intraperitoneally (ip) injected with arachis oil (LuHua Co., Ltd.,

ip t

Yantai, China), while CCl4 treatment group was ipinjected with 30% (v/v) CCl4 in arachis oilat a volume of 0.5 ml/kg BW. 72 h after injection, blood and liver samples were collected for assays of

cr

biochemical parameters, genes expression and histopathological examination.

us

2.3.Determination of serum biochemical parameters

The serum levels of glutamate pyruvate transaminase (GPT), glutamate oxalate transaminase

an

(GOT), superoxide dismutase (SOD), glutathione peroxidase (GPx), catalase (CAT), glutathione (GSH), total antioxidant capacity (T-AOC) and malondialdehyde (MDA) were measured using

M

commercially available kits (Jiancheng Institute of Biotechnology, Nanjing, China). GPT and GOT were expressed as IU/l. The GSH content was estimated by a colorimetric method as described by Lora et al (2004) and expressed as milligrams per milliliter. For the estimation of

ed

MDA, the TBARS assay was used, and the final concentration of MDA was expressed as nanomoles per milliliter (Ohkawa et al., 1979). The activities of antioxidative enzymes (SOD,

ce pt

GPx and CAT) were determined as previously described by Peskin and Winterbourn (2000), Rotruck et al (1999) and Cakmak and Horst (1991), respectively, and the results were expressed as units per milliliter.

2.4.Determination of CYP2E1 and TLR4 protein levels

Ac

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

CYP2E1 and TLR4 protein levels in liver tissue were quantified with a commercial ELISA kit for fish (BD Biosciences, USA) according to the manufacturer’s instructions. 2.5.Gene expression analysis of NF-κB/cREL and inflammatory cytokines Total RNA was extracted from liver tissues using a fast pure RNA kit (Dalian Takara, China) according to the manufacturer’s instructions. The RNA concentration was determined using GeneQuant 1300 (GE Healthcare Biosciences, Piscataway, NJ), and normalized to a common concentration with DEPC treated water (Invitrogen, China) before proceeding to cDNA synthesis.

Page 5 of 27

6

Reverse transcription reaction (40 µl) consisted of the following: 10 µg of total RNA, 2 µl of OligodT (50 µM), 8 µl of 5 × reverse transcriptase buffer, 4 µl of deoxynucleoside triphosphate (10 mM), 1 µL of RNase inhibitor (40 U/µl), 1 µl of Moloney murine leukemia virus reverse transcriptase (200 U/µl), 4µl of dithiothreitol (0.1 M), and RNase free dH2O, up to a final volume of 40 µl. The procedure of the reverse transcription was according to the instructions of the

ip t

manufacturer (Invitrogen, China) (Wang et al., 2013), and the products (cDNA) were then stored

cr

at -20℃ for qRT-PCR.

Real-time quantitative PCR (qRT-PCR) was performed to detect the gene expression of

us

NF-κB/cREL and inflammatory cytokines in the liver tissue using SYBR Premix Ex Taq (Dalian Takara, China), and the reaction was performed on an ABI PRISM 7500 Detection System

an

(Applied Biosystems, USA). The program was set to run for one cycle at 95℃ for 30 s, 40 cycles at 95℃ for 5 s and at 56-58℃ for 34 s. The specificity of PCR amplification was confirmed by

M

agarose gel electrophoresis and melting curve analysis. ß-actin was used as an internal control for qRT-PCR. The primers used in this study were listed in Table 1. Results of geneexpression were

ed

analyzed using the 2-ΔΔCt method (Livak and Schmittgen, 2001). The data were expressed as the mean fold changes ± standard deviation for four independent individuals, and each one was

ce pt

performed in quadruplicate.

2.6.Histopathological examination

Liver tissue specimens were fixed in 10% (v/v) paraformaldehyde and embedded in paraffin, sectioned to 4 µm thickness, deparaffinized, rehydrated using standard procedure, stained with hematoxylin and eosin (H&E). The extent of CC14-induced liver necrosis was evaluated by

Ac

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

assessing morphological changes in liver sections.

2.7.Isolation and culture of hepatocytes. Carp hepatocytes were prepared according to the method of Jia et al. (2012). The isolated cells were adjusted to a density of 5×104 viable cells per milliliter and seeded in 96-well microplates at 100µl/well for viability assay, or 2.5×106 viable cells per milliliter and seeded in 24-well microplates at 1ml/well for apoptosis assays. Cells were cultured with L-15 culture medium

Page 6 of 27

7

supplemented with 1% streptomycin/penicillin and 5% FBS and kept for 24 h at 27℃ under 5% CO2 before the following experiments were conducted.

2.8. Cytotoxicity

ip t

The cytotoxicity of CCl4 was determined by a colorimetric WST-1 [4-[3-(4-iodophenyl)-2(4-nitrophenyl)-2H-5-tetrazolio]-1,3-benzene disulfonate] (Beyotime, Haimen, China) assay

cr

according to the method of Jia et al (2012). Isolated hepatocytes (5×103cells/well) were plated in

quadruplicate in a 96-well culture plate overnight, then treated with CCl4 at the concentration of

us

8mM for 0, 1 , 2 , 4, 8 and 16 h. Following this, 10 µl WST-1 was added to each well and the cells were incubated for an additional 2 h. The absorbance of samples was measured under a

an

wavelength of 450 nm using a microplate reader (Bio-Rad, USA), and the results were expressed as percentages of the control group (0 h).

M

2.9.Activities of caspase-3, caspase-8 and caspase-9

Activities of caspase-3, caspase-8 and caspase-9 were measured using commercial kits (Beyotime, Haimen, China) according to the method of Chen et al (2008) In brief, hepatocytes

ed

were treated with CCl4 at the concentration of 8mM for 0, 1, 2, 4, 8 and 16 h, collected by trypsinization and rinsed twice with PBS, and then homogenized in lysis buffer. The lysates were

ce pt

centrifuged at 20,000 g for 10 min at 4 °C, and the supernatants were incubated for 2 h at 37 °C with 10 µl Ac-DEVD-pNA, Ac-IETD-pNA, and Ac-LEHD-pNA as the substrates for caspase-3, caspase-8, and caspase-9, respectively. The absorbances at 405 nm were read using a microplate reader (Bio-Rad, USA).

Ac

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

2.10. Statistical analysis The data was expressed as mean ± standard deviation (SD). The differences between different groups were analyzed using one-way analysis of variance (ANOVA) with Student’s t test. P<0.05 was taken as statistically significant. Statistical analyses were carried out using SPSS version 18.0 software. 3. Result 3.1.Effects of CCl4 on hepatic damage and necrosis

Page 7 of 27

8

Carps treated with CCl4 for 72 h showed significantly higher serum activities of GPT and GOT (Fig.1A). Histological assessment showed the appearances of cytoplasmatic vacuolation, fuzzy cell outline and lysis of nucleolus, which served as evidence of CCl4 induced severe necrosis in liver (Fig. 1B).

ip t

3.2.Effects of CCl4 on antioxidant activities and lipid peroxidation The changes of antioxidant capacity and lipid peroxidationare shown in Fig.2. Compared to

cr

the control, CCl4 treatment caused significant decreases in the levels of T-AOC, SOD, GPx, CAT

3.3.Effects of CCl4 on protein levels of CYP 2E1 and TLR4

us

and GSH , and significant increase of MDA formation.

an

CYP2E1 is a key enzyme for metabolizing xenobiotics such as CCl4 that produces toxic radicals, causing liver injury. Therefore, a certain concentration of CCl4 could induce generation

M

of CYP2E1. As shown in Fig.3, compared to the control, the level of hepatomicrosomal CYP2E1was considerably enhanced (by 40 %, P<0.05) after 72 h of intoxication. The level of

ed

TLR4 protein in carp liver was also significantly increased (by 72.3 %, P<0.01). 3.4. Effect of CCl4 on gene expressions of NF-κB/cREL and inflammatorycytokines

ce pt

To determine the effect of CCl4 on transcriptional regulation, the genes expression of NF-κB/cREL and inflammatory cytokines (TNF-ɑ , iNOS, IL-1ß, IL-6 and IL-12) were measured by qRT-PCR. As shown in Fig.4, the genes expression of NF-κB/cREL and five inflammatory cytokines were upregulated in liver at 72 h after CCl4 treatment.

Ac

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

3.5.Effect of CCl4 on hepatocyteviability CCl4 induced a time-dependent viability loss in carp hepatocyte (Fig. 5A). After 4, 8 and 16h treatment, the number of cells was markedly decreased, and the hepatocytes were critically damaged (Fig.5B). 3.6.The effect of CCl4 on hepatocyte apoptosis Apoptosis was evaluated by caspase-3, caspase-8 andcaspase-9 proteolytic activities and the results were shown in Fig. 6. After CCl4 treatment, significant increases in caspase-3, caspase-8

Page 8 of 27

9

and caspase-9 activities were noticed starting at 2 h and peaking at 4 h. With the prolongation of CCl4 treatment, the activities of caspase proteases showed a declining tendency and were even lower than its control at 16 h. 4. Discussion

ip t

The goal of this study was to clarify the possible mechanism of CCl4 toxicity in fish. In the present study, CCl4-induced hepatotoxicity was confirmed by the significant elevation of serum

cr

marker enzymes (GPT and GOT) and histological changes in the liver.

us

In mammals, CYP 2E1, the major cytochrome isozyme to execute biotransformation of CCl4, plays a major role in the pathogeneses of liver injury, since the derivatives generated during CCl4

an

metabolism are hepatotoxic (Ikatsu et al., 1998). Many hepatotoxicants including CCl4 require metabolic activation by CYP450 enzymes, to form reactive toxic metabolites, which in turn cause liver injury in experimental animals and humans (Allis et al., 1996). In the current study, an

M

increase of CYP2E1 protein level in carp liver upon CCl4 treatment suggested the involvement of CYP2E1in the metabolism of CCl4 in fish.CYP2E1induction by CCl4 was also observed in mice

ed

(Jiang et al., 2012). However, down-regulated CYP 2E1 activity was reported in rat liver following CCl4 administration and it was thought to be an adaptive mechanism that limits toxicity

ce pt

(Shim et al., 2010).

Generally, oxidative stress and lipid peroxidation are two major mechanisms of CCl4 induced toxicity. Metabolism of CCl4 by liver microsomal CYP450 creates the trichloromethyl free radical (CCl3˙) and trichloromethylperoxy radical (CCl3OO˙) (Vajdovich et al., 1995). CCl3OO˙, which

Ac

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

attacks and destroys polyunsaturated fatty acids, initiates the chain reaction of lipid peroxidation (Forni et al., 1983). The effects result in adverse alterations on the structure and function of cell membrane system, contributing to subsequent cell damage (Recknagel et al., 1989). Moreover, these free radicals also attack antioxidant defense system, leading to the loss of antioxidant components such as SOD, CAT, GPx and GSH (Cheshchevik et al., 2012). In the present study, the significant decreases of SOD, CAT, GPx, GSH and T-AOC upon CCl4 treatment indicated that CCl4 destroyed antioxidant defense system in fish. MDA, a decomposition product of lipid

Page 9 of 27

10

hydroperoxides, is widely used as marker of lipid peroxidation (Ohkawa et al., 1979), its elevated levels could reflect the degrees of lipid peroxidation injury in liver (Yan et al., 2009).

CCl4-induced reactive oxygen species（ROS）not only cause direct tissue damage, but also initiate inflammation (Kim et al., 2011). In liver, the inflammatory responses were mostly

ip t

mediated by nonparenchymal cells, following activation by CCl4 they released large amounts of inflammatory-associated cytokines (Domitrović et al., 2011). TLR4 is recently shown to recognize

cr

multiple pathogen-associated molecular patterns (PRRs) and other products of inflamed tissue

(Schwabe et al., 2006). It plays a pivotal role in the regulation of the innate immune system in the

us

infectious and inflammatory diseases, Up-regulated TLR4 could augment inflammation in liver by TLR-ligand interaction (Hua et al., 2007). Kim et al (2011) reported that the liver inflammation

an

might be related to changes of toll-like receptors signaling pathways, and the mRNA and protein expression levels of TLR4 were up-regulated by CCl4. Shi et al (2012) also reported that CCl4

M

administration elevated the mRNA levels of TLR4, leading to activation of NF-κB and thus increasing the expression of proinflammatory cytokines. In the present study, we also observed

ed

that CCl4 significantly increased TLR4 protein level in carp liver. NF-κB, a heterodimeric transcription factor, regulates expression of multiple genes associated

ce pt

with inflammation and infection responses (Ghosh et al., 1998). Oxidative stress is one of activators of NF-κB, and ROS can cause prolonged NF-κB DNA binding activity (Son et al., 2007). NF-κB is targeted as an integral messenger in the enhancement of the response to environmental perturbation, which activates a series of cellular genes related to proinflammatory and cytotoxic cytokines including iNOS, IL-1ß, IL-6, IL-12 and TNF-ɑ (Liu et al., 1995;

Ac

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

Reyes-Gordillo et al., 2007). Activation of NF-κB induced the production of proinflammatory cytokines in liver, resulting in dysfunction of liver (Muller et al., 2000). Our research exhibited similar result that CCl4 increased DNA-binding activity of translocation factors of the c-REL subunit in fish liver. TNF-ɑ , a pleiotropic cytokine, mediates CCl4-induced hepatotoxicity by inflammatory signaling pathways and stimulates inflammation and fibrosis (Domitrović et al., 2011).When protein synthesis is repressed, TNF-ɑ turns into a death factor causing cells apoptosis, as occurs

Page 10 of 27

11

with CCl4 exposure in rat (Miller et al., 2009). Our results were consistent with the previous findings on rats (Lin et al., 2012) that CCl4 promoted the expression of proinflammatory cytokines, including TNF-ɑ . INOS, induced by NF-κB activation, stimulates the production of nitric oxide (NO) (Aldridge

ip t

et al., 2009). Although NO and iNOS play an ambiguous role in liver damage/recovery, the both overexpresion has been seen in different types of liver injury (Tanaka et al., 2012). It is speculated

cr

that NO, which can react with O2- to form highly aggressive peroxynitrite radical in CCl4-induced

hepatotoxicity. INOS-derived NO could regulates proinflammatory genes expression, thereby

us

contributing to inflammatory liver injury (Anand et al., 2011). In this study, following CCl4 treatment, iNOS expression was significantly increased in the CCl4-intoxicated liver, the mRNA

an

levels of IL-1ß, -6 and -12 were also heightened in carp liver. These cytokines are acute phase response factors that are rapidly produced by macrophages in response to tissue damage (Hao et

M

al., 2012). The upregulations of these cytokines in various liver injuries have revealed a direct association between cytokines and inflammatory response in liver injury (Kavitha et al., 2011;

ed

Kim et al., 2011; Weber et al., 2003).

To further clarify the mechanism of CCl4-induced hepatotoxicity, we monitored the effects of

ce pt

CCl4 on the hepatocyte viability and apoptosis. Results showed that exposure of primary hepatocytes to CCl4 induced apoptosis and loss of viability. Cell death is thought to take place by at least two distinct processes, apoptosis and necrosis (Malhi and Gores, 2008). Apoptosis is a highly genetically controlled type of cell death which is accompanied by the activation of a large number of intracellular proteases and endonucleases (Guicciardi and Gores, 2005). Although

Ac

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

apoptosis can be triggered by different stimuli, apoptotic pathways are mainly classified into two groups: the intrinsic pathway and the extrinsic pathway (Kumar, 2006). The common event in the end point of both the intrinsic and extrinsic is the activation of a set of cysteine proteases (caspases) (Liu et al., 2005). In general, caspase-3 is the major executioner caspase in both the mitochondria-initiated intrinsic pathway and the death receptor-triggered extrinsic pathway. The caspase-9 and caspase-8 are the major initiator caspases implicated in the two pathways (Larsen et al., 2010; Li and Yuan, 2008). Hepatocytes are the most numerous cell type in the liver, and their apoptosis is prominent in liver injury (Wieckowska et al., 2006). Many investigations have

Page 11 of 27

12

demonstrated that CCl4 could induce apoptosis via caspase-dependent pathway (Manuelpillai et al., 2010). Yen et al (2009) observed that caspase-3, -8, and -9 levels were elevated in CCl4-intoxicated rat hepatocytes, indicating that CCl4 participated in the activation of the caspases to induce hepatocyte apoptosis. Tao et al (2012) estimated the caspase-3, -8, -9 and -12 protein levels in CCl4-treated HSC-T6 and BRL-3A cells, and found that CCl4 led to the activation of

ip t

caspases and initiation of cell apoptosis. In vivo study also showed that acute CCl4 administration

induced increases in the activities of caspase-8, -9, and -3 in rat liver (Marucci et al., 2003). This

cr

was supported by recent studies showing that CCl4 induced upregulation of caspases and

us

occurrence of apoptosis in mammalian liver (Guo et al., 2013; Parajuli et al., 2013; Roychowdhury et al., 2012). In the present study, we also discovered the ascension of activities of caspase-3, -8 and -9 upon CCl4 treatment from 2 h to 8 h, suggesting that CCl4 could induce

an

caspase-dependent apoptosis in carp hepatocyte. Moreover, the activities of the three caspases were decreased at 16 h of CCl4 treatment due to massive necrosis of liver cells. Therefore, it

M

seemed that apoptosis and necrosis occurred simultaneously in carp hepatocytes damage induced

5. Conclusion

ed

by CCl4.

ce pt

The present study demonstrated that the CYP2E1 was involved in the metabolism of CCl4 and formation of reactive free radicals (Fig.7). These radicals induced oxidative stress, activated TNF-ɑ /NF-κB and TRL4/NF-κB signaling and promoted hepatocyte apoptosis, leading to cellular inflammation and necrosis, and finally, a severe hepatotoxic damage to the fish. It is speculated TNF-ɑ /NF-κB and TRL4/NF-κB signaling play important roles in the course of CCl4

Ac

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

intoxication.

Acknowledgments

This work was supported by Jiangsu Science and Technology Department (BK2012535), Central Public-interest Scientific Institution Basal Research Fund of China (2013JBFM11,12) and National Natural Science Foundation of China (31202002、31200918).

Page 12 of 27

13

References Aldridge, J.R., Moseley, C.E., Boltz, D.A., Negovetich, N.J., Reynolds, C., Franks, J., Brown, S.A., Doherty, P.C., Webster, R.G., Thomas, P.G., 2009. TNF/iNOS-producing dendritic cells are the necessary evil of lethal influenza virus infection. Proceedings of the National Academy of Sciences 106, 5306-5311.

ip t

Allis, J.W., Brown, B.L., Simmons, J.E., Hatch, G.E., McDonald, A., House, D.E., 1996. Methanol

potentiation of carbon tetrachloride hepatotoxicity: the central role of cytochrome P450. Toxicology 112, 131-140.

cr

Anand, K.V., Anandhi, R., Pakkiyaraj, M., Geraldine, P., 2011. Protective effect of chrysin on carbon

tetrachloride (CCl4)—induced tissue injury in male Wistar rats. Toxicology and Industrial Health 27, 923-933.

us

Bhattacharya, H., Zhang, S., Xiao, Q., 2008. Comparison of histopathological alterations due to sublethal CCl4 on rosy barb (Puntius conchonius) and amphioxus (Branchiostoma belcheri) with implications of liver ontogeny. Toxicology Mechanisms and Methods 18, 627-633.

an

Brigelius-Flohé, R., 1999. Tissue-specific functions of individual glutathione peroxidases. Free Radical Biology and Medicine 27, 951-965.

Cakmak, I., Horst, W.J., 1991. Effect of aluminium on lipid peroxidation, superoxide dismutase,

M

catalase, and peroxidase activities in root tips of soybean (Glycine max). Physiologia Plantarum 83, 463-468.

Casillas, E., Myers, M., Ames, W.E., 1983. Relationship of serum chemistry values to liver and kidney

ed

histopathology in English sole (< i> Parophrys vetulus) after acute exposure to carbon tetrachloride. Aquatic Toxicology 3, 61-78.

Chen, C.-Y., Wooster, G.A., Bowser, P.R., 2004. Comparative blood chemistry and histopathology of tilapia infected with< i> Vibrio vulnificus or< i> Streptococcus iniae or exposed to carbon

ce pt

tetrachloride, gentamicin, or copper sulfate. Aquaculture 239, 421-443. Chen, H., Xing, B., Liu, X., Zhan, B., Zhou, J., Zhu, H., Chen, Z., 2008. Ozone oxidative preconditioning inhibits inflammation and apoptosis in a rat model of renal ischemia/reperfusion injury. European journal of pharmacology 581, 306-314.

Cheshchevik, V., Lapshina, E., Dremza, I., Zabrodskaya, S., Reiter, R., Prokopchik, N., Zavodnik, I., 2012. Rat liver mitochondrial damage under acute or chronic carbon tetrachloride-induced intoxication:

Ac

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

Protection by melatonin and cranberry flavonoids. Toxicology and applied pharmacology 261, 271-279.

Clawson, G., 1989. Mechanisms of carbon tetrachloride hepatotoxicity. Pathology and immunopathology Research 8, 104-112. Domitrovid, R., Jakovac, H., Blagojevid, G., 2011. Hepatoprotective activity of berberine is mediated by inhibition of TNF-α, COX-2, and iNOS expression in CCl< sub> 4-intoxicated mice. Toxicology 280, 33-43. Forni, L., Packer, J., Slater, T., Willson, R., 1983. Reaction of the trichloromethyl and halothane-derived peroxy radicals with unsaturated fatty acids: a pulse radiolysis study. Chemico-biological interactions 45, 171-177. Ghosh, S., May, M.J., Kopp, E.B., 1998. NF-{kappa} B and Rel proteins: evolutionarily conserved mediators of immune responses. Science Signaling 16, 225.

Page 13 of 27

14

Guicciardi, M., Gores, G., 2005. Apoptosis: a mechanism of acute and chronic liver injury. Gut 54, 1024-1033. Guo, X.-L., Liang, B., Wang, X.-W., Fan, F.-G., Jin, J., Lan, R., Yang, J.-H., Wang, X.-C., Jin, L., Cao, Q., 2013. Glycyrrhizic acid attenuates CCl4-induced hepatocyte apoptosis in rats via a p53-mediated pathway. World journal of gastroenterology: WJG 19, 3781. Hao, Z.-M., Fan, X.-B., Li, S., Lv, Y.-F., Su, H.-Q., Jiang, H.-P., Li, H.-H., 2012. Vaccination with platelet-derived growth factor B kinoids inhibits CCl4-induced hepatic fibrosis in mice. Journal of

ip t

Pharmacology and Experimental Therapeutics 342, 835-842. Hua, J., Qiu, D.K., Li, J.Q., Li, E.L., Chen, X.Y., Peng, Y.S., 2007. Expression of Toll‐like receptor 4 in rat

cr

liver during the course of carbon tetrachloride‐induced liver injury. Journal of gastroenterology and hepatology 22, 862-869.

us

Ikatsu, H., Shinoda, S., Nakajima, T., 1998. CYP2E1 level in rat liver injured by the interaction between carbon tetrachloride and chloroform. JOURNAL OF OCCUPATIONAL HEALTH-ENGLISH EDITION- 40, 223-229.

an

Jia, R., Cao, L., Xu, P., Jeney, G., Yin, G., 2012. In vitro and in vivo hepatoprotective and antioxidant effects of Astragalus polysaccharides against carbon tetrachloride-induced hepatocyte damage in common carp (Cyprinus carpio). Fish physiology and biochemistry 38, 871-881. Jiang, W., Gao, M., Sun, S., Bi, A., Xin, Y., Han, X., Wang, L., Yin, Z., Luo, L., 2012. Protective effect of Research Communications 422, 344-350.

M

l-theanine on carbon tetrachloride-induced acute liver injury in mice. Biochemical and Biophysical Kavitha, P., Ramesh, R., Bupesh, G., Stalin, A., Subramanian, P., 2011. Hepatoprotective activity of

ed

Tribulus terrestris extract against acetaminophen-induced toxicity in a freshwater fish (Oreochromis mossambicus). In Vitro Cellular & Developmental Biology-Animal 47, 698-706. Kim, H.-Y., Park, J., Lee, K.-H., Lee, D.-U., Kwak, J.-H., Kim, Y.S., Lee, S.-M., 2011. Ferulic acid protects

ce pt

against carbon tetrachloride-induced liver injury in mice. Toxicology 282, 104-111. Kotsanis, N., Metcalfe, C., 1991. Enhancement of hepatocarcinogenesis in rainbow trout with carbon tetrachloride. Bulletin of environmental contamination and toxicology 46, 879-886. Krasnov, A., Afanasyev, S., Oikari, A., 2007. Hepatic responses of gene expression in juvenile brown trout (Salmo trutta lacustris) exposed to three model contaminants applied singly and in combination. Environmental Toxicology and Chemistry 26, 100-109. Krasnov, A., Koskinen, H., Rexroad, C., Afanasyev, S., Mölsä, H., Oikari, A., 2005. Transcriptome

Ac

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

responses to carbon tetrachloride and pyrene in the kidney and liver of juvenile rainbow trout (< i> Oncorhynchus mykiss). Aquatic toxicology 74, 70-81. Larsen, B.D., Rampalli, S., Burns, L.E., Brunette, S., Dilworth, F.J., Megeney, L.A., 2010. Caspase 3/caspase-activated DNase promote cell differentiation by inducing DNA strand breaks. Proceedings of the National Academy of Sciences 107, 4230-4235. Li, J., Yuan, J., 2008. Caspases in apoptosis and beyond. Oncogene 27, 6194-6206. Lin, X., Huang, R., Zhang, S., Zheng, L., Wei, L., He, M., Zhou, Y., Zhuo, L., Huang, Q., 2012. Methyl helicterate protects against CCl< sub> 4-induced liver injury in rats by inhibiting oxidative stress, NF-κB activation, Fas/FasL pathway and cytochrome P4502E1 level. Food and Chemical Toxicology.

Page 14 of 27

15

Liu, S.L., Esposti, S.D., Yao, T., Diehl, A.M., Zern, M.A., 1995. Vitamin E therapy of acute CCl4‐induced hepatic injury in mice is associated with inhibition of nuclear factor kappa B binding. Hepatology 22, 1474-1481. Livak, K.J., Schmittgen, T.D., 2001. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2

− ΔΔCT

Method. methods 25, 402-408.

Lora, J., Alonso, F.J., Segura, J.A., Lobo, C., Marquez, J., Mates, J.M., 2004. Antisense glutaminase inhibition decreases glutathione antioxidant capacity and increases apoptosis in Ehrlich ascitic tumour

ip t

cells. European Journal of Biochemistry 271, 4298-4306.

Malhi, H., Gores, G.J., 2008. Cellular and molecular mechanisms of liver injury. Gastroenterology 134, 1641-1654.

cr

Manuelpillai, U., Tchongue, J., Lourensz, D., Vaghjiani, V., Samuel, C.S., Liu, A., Williams, E.D., Sievert, W., 2010. Transplantation of human amnion epithelial cells reduces hepatic fibrosis in

us

immunocompetent CCl4-treated mice. Cell Transplantation 19, 1157-1168.

Marucci, L., Alpini, G., Glaser, S.S., Alvaro, D., Benedetti, A., Francis, H., Phinizy, J.L., Marzioni, M., Mauldin, J., Venter, J., 2003. Taurocholate feeding prevents CCl4-induced damage of large through

PI3-kinase-dependent

mechanism.

American

Journal

of

an

cholangiocytes

Physiology-Gastrointestinal and Liver Physiology 284, G290-G301.

Miller, A.H., Maletic, V., Raison, C.L., 2009. Inflammation and its discontents: the role of cytokines in the pathophysiology of major depression. Biological psychiatry 65, 732-741.

M

Muller, D.N., Dechend, R., Mervaala, E.M., Park, J.-K., Schmidt, F., Fiebeler, A., Theuer, J., Breu, V., Ganten, D., Haller, H., 2000. NF-κB inhibition ameliorates angiotensin II–induced inflammatory damage in rats. Hypertension 35, 193-201.

ed

OECD, 1994. OECD Guidelines for the Testing of Chemicals. Organization for Economic. Ohkawa, H., Ohishi, N., Yagi, K., 1979. Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Analytical biochemistry 95, 351-358.

ce pt

Parajuli, D.R., Park, E.-J., Che, X.-H., Jiang, W.-Y., Kim, Y.-C., Sohn, D.H., Lee, S.H., 2013. PF2401-SF, Standardized Fraction of Salvia miltiorrhiza, Induces Apoptosis of Activated Hepatic Stellate Cells in Vitro and in Vivo. Molecules 18, 2122-2134.

Peskin, A.V., Winterbourn, C.C., 2000. A microtiter plate assay for superoxide dismutase using a water-soluble tetrazolium salt (WST-1). Clinica Chimica Acta 293, 157-166. Pesonen, M., Andersson, T.B., 1997. Fish primary hepatocyte culture; an important model for xenobiotic metabolism and toxicity studies. Aquat. Toxicol. 37, 253-267.

Ac

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

Råbergh, C.M., Lipsky, M.M., 1997. Toxicity of chloroform and carbon tetrachloride in primary cultures of rainbow trout hepatocytes. Aquatic toxicology 37, 169-182. Recknagel, R.O., Glende Jr, E.A., Dolak, J.A., Waller, R.L., 1989. Mechanisms of carbon tetrachloride toxicity. Pharmacology & therapeutics 43, 139-154. Reyes-Gordillo, K., Segovia, J., Shibayama, M., Vergara, P., Moreno, M.G., Muriel, P., 2007. Curcumin protects against acute liver damage in the rat by inhibiting NF-κB, proinflammatory cytokines production and oxidative stress. Biochimica et Biophysica Acta (BBA)-General Subjects 1770, 989-996. Roychowdhury, S., Chiang, D.J., Mandal, P., McMullen, M.R., Liu, X., Cohen, J.I., Pollard, J., Feldstein, A.E., Nagy, L.E., 2012. Inhibition of Apoptosis Protects Mice from Ethanol‐Mediated Acceleration of

Page 15 of 27

16

Early Markers of CCl4‐Induced Fibrosis but not Steatosis or Inflammation. Alcoholism: Clinical and Experimental Research 36, 1139-1147. Schwabe, R.F., Seki, E., Brenner, D.A., 2006. Toll-like receptor signaling in the liver. Gastroenterology 130, 1886-1900. Shi, H., Dong, L., Jiang, J., Zhao, J., Zhao, G., Dang, X., Lu, X., Jia, M., 2012. Chlorogenic acid reduces liver inflammation and fibrosis through inhibition of toll-like receptor 4 signaling pathway. Toxicology. Shim, J.-Y., Kim, M.-H., Kim, H.-D., Ahn, J.-Y., Yun, Y.-S., Song, J.-Y., 2010. Protective action of the

ip t

immunomodulator ginsan against carbon tetrachloride-induced liver injury via control of oxidative stress and the inflammatory response. Toxicology and applied pharmacology 242, 318-325.

Son, G., Iimuro, Y., Seki, E., Hirano, T., Kaneda, Y., Fujimoto, J., 2007. Selective inactivation of NF-κB in Physiology-Gastrointestinal and Liver Physiology 293, G631-G639.

cr

the liver using NF-κB decoy suppresses CCl4-induced liver injury and fibrosis. American Journal of

us

Statham, C.N., Croft, W.A., Lech, J.J., 1978. Uptake, distribution, and effects of carbon tetrachloride in rainbow trout (Salmo gairdneri). Toxicology and Applied Pharmacology 45, 131-140. Tanaka, T., Takahashi, K., Iwamoto, N., Agawa, Y., Sawada, Y., Yoshimura, Y., Zaima, N., Moriyama, T.,

an

Kawamura, Y., 2012. Hepatoprotective action of dietary bluefin tuna skin proteins on CCl4-intoxicated mice. Fisheries science 78, 911-921.

Tao, L.-L., Cheng, Y.-Y., Ding, D., Mei, S., Xu, J.-W., Yu, J., Ou-Yang, Q., Deng, L., Chen, Q., Li, Q.-Q., 2012. C/EBP-α ameliorates CCl4-induced liver fibrosis in mice through promoting apoptosis of hepatic

M

stellate cells with little apoptotic effect on hepatocytes in vitro and in vivo. Apoptosis 17, 492-502. Vajdovich, P., Szilagyi, A., Gaál, T., 1995. Evaluation of blood lipid peroxidation parameters in carbon tetrachloride (CCl4) toxicity in sheep. Acta veterinaria Hungarica 43, 423.

ed

Wang, L.-L., Liu, T., Wang, C., Zhao, F.-Q., Zhang, Z.-W., Yao, H.-D., Xing, H.-J., Xu, S.-W., 2013. Effects of atrazine and chlorpyrifos on the production of nitric oxide and expression of inducible nitric oxide 43, 324-239.

ce pt

synthase in the brain of common carp (Cyprinus carpio L.). Ecotoxicology and environmental safety Weber, L.W., Boll, M., Stampfl, A., 2003. Hepatotoxicity and mechanism of action of haloalkanes: carbon tetrachloride as a toxicological model. CRC Critical Reviews in Toxicology 33, 105-136. Wieckowska, A., Zein, N.N., Yerian, L.M., Lopez, A.R., McCullough, A.J., Feldstein, A.E., 2006. In vivo assessment of liver cell apoptosis as a novel biomarker of disease severity in nonalcoholic fatty liver disease. Hepatology 44, 27-33.

Yan, F., Zhang, Q.Y., Jiao, L., Han, T., Zhang, H., Qin, L.P., Khalid, R., 2009. Synergistic hepatoprotective

Ac

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

effect of< i> Schisandrae lignans with< i> Astragalus polysaccharides on chronic liver injury in rats. Phytomedicine 16, 805-813. Yen, F.-L., Wu, T.-H., Lin, L.-T., Cham, T.-M., Lin, C.-C., 2009. Naringenin-loaded nanoparticles improve the physicochemical properties and the hepatoprotective effects of naringenin in orally-administered rats with CCl4-induced acute liver failure. Pharmaceutical research 26, 893-902. Yin, G.J., Cao, L.P., Xu, P., Jeney, G., Nakao, M., Lu, C.P., 2011. Hepatoprotective and antioxidant effects of Glycyrrhiza glabra extract against carbon tetrachloride (CCl4)-induced hepatocyte damage in common carp (Cyprinus carpio). Fish Physiology and Biochemistry 37, 209-216.

Page 16 of 27

Table legend

Ac

ce pt

ed

M

an

us

cr

ip t

Table 1. Primer utilized for gene expression analysis by for qRT-PCR

Page 17 of 27

Table(s)

Genes ß-actin

Primer sequence (5´-3´)

Amplicon size (pb)

Gen Bank

100

M24113.1

100

ip t

Table 1. Primer utilized for gene expression analysis by for qRT-PCR

F: GCAGATGTGGATTAGCAAGCAG R: TTGAGTCGGCGTGAAGTGG

cREL

F: AATGTGGTGCGTCTGTGCTT

F: AACCAGGACCAGGCTTTCACT

198

us

TNF-ɑ

cr

R:TGTTGTCATAGATGGGGTTGGA

F: TGGTCTCGGGTCTCGAATGT R: CAGCGCTGCAAACCTATCATC

F: ACCGGCACACGTTACAACACTT

M

IL-1ß

an

R: CATGTAGCGGCCATAGGAATC iNOS

AY163837.1

AJ311800,2

73

AJ242906

109

AJ245635.1

73

AY102632

116

AJ621425.1

IL-6

ed

R: GGGTGGTTGGCATCTGGTTCAT F: GCAGCGCATCTTGAGTGTTTAC

IL-12

ce pt

R: CTGCTGCTCCATCACTGTCTTC F: TCTGTAGAGGTCACATATCCACG

Ac

R: AAGTTCGGTTTGGAGCAGTC

Page 18 of 27

Figure legends

Fig.1. Effcts of CCl4 on liver damage and necrosis. A, serum GPT and GOT activities; B, liver histopathology stained with hematoxylin and eosin, : cytoplasmatic vacuolation; bar = 25 µm. The data is expressed as mean ± SD (n=15). **P<0.01, compared with control.

ip t

Fig.2. The changes of antioxidant capacity and lipid peroxidation in CCl4-treated carps. The data is expressed as mean ± SD (n=15). *P<0.05; **P<0.01, compared with control.

cr

Fig.3. The changes of CYP2E1 and TLR4 in CCl4-treated carps. The data is expressed as mean ± SD (n=15). *P<0.05; **P<0.01, compared with control.

us

Fig.4. The changes of the inflammatory cytokines and cREL mRNA expression in CCl4-treated carps. The data is expressed as mean ± SD (n=15). *P<0.05; **P<0.01, compared with control

an

Fig.5. Cytotoxicity evaluation in carp primary hepatocyte after different time exposure to CCl4. A, cell viability, B, morphologic changes of hepatocyte, bar = 100 µm. The data is expressed as mean ± SD (n=4). *P<0.05; **P<0.01, compared with the value of normal control (0 h).

M

Fig.6. The changes of caspase-3 (A), caspase-8 (B) and caspase-9 levels (C) in CCl4-treated liver cells. The data is expressed as mean ± SD (n=4). *P<0.05; **P<0.01, compared with the value of normal control.

Ac ce p

te

d

Fig.7. Scheme showing the proposed hepatoxicity mechanisms of CCl4. CCl4 was activated by CYP2E1 to form highly reactive free radicals in carp liver. These radicals could induced oxidative stress and lipid peroxidation, which attacked and destroyed membrane structure and antioxidant defense system. Meanwhile, Oxidative stress also triggered the TNF- release and increased TRL4 level, and then activated NF-κB, allowing its nuclear translocation. The activated nuclear translocation factors stimulated the expression of iNOS and interleukins-1ß, -6 and 12, causing cellular inflammation and necrosis. In turn, the release of highly reactive oxygen and nitrogen species from inflammatory cells, further exacerbated oxidative and nitrosative stress. In addition, high levels of TNF- activated liver cells apoptosis. Consequently, hepatic damage occurred in CCl4-treated carp.

Page 19 of 27

Figure(s)

A

Control

60

**

50

CCl4 treatment

40

**

30

20 10 GOT (IU/l)

ip t

0 GPT (IU/l)

an

us

cr

B

Control

CCl4 treatment

M

Fig.1. Effcts of CCl4 on liver damage and necrosis. A, serum GPT and GOT activities; B, liver histopathology stained with hematoxylin and eosin,

: cytoplasmatic vacuolation; bar = 25

Ac

ce pt

ed

µm. The data is expressed as mean ± SD (n=15). **P<0.01, compared with control.

Page 20 of 27

B 8 7 6 5 4 3 2 1 0

200

SOD (Uml)

*

** 100

50

Control

C

D 20

CAT (U/ml)

300 250 200 150 100 50 0

15 10

an

**

CCl4 treatment

cr

CCl4 treatment

ip t

0

Control

*

5 0

Control

CCl4 treatment

Control

M

GPx (U/ml)

150

us

T-AOC (U/ml)

A

200

150

50 0

ce pt

**

100

CCl4 treatment

8 6 4 2 0

Control

CCl4 treatment

Ac

Control

*

10

MDA (nmol/ml)

ed

F

GSH (mg/ml)

E

CCl4 treatment

Fig.2. The changes of antioxidant capacity and lipid peroxidation in CCl4-treated carps. The data is expressed as mean ± SD (n=15). *P<0.05; **P<0.01, compared with control.

Page 21 of 27

1.4 Control

1.2

**

CCl4 treatment

1

*

0.8

ip t

0.6 0.4

cr

0.2 0

TLR4 (ng/mgprot)

us

CYP2E1 (pmol/mgprot)

Fig.3. The changes of CYP2E1 and TLR4 in CCl4-treated carps. The data is expressed as mean ±

Ac

ce pt

ed

M

an

SD (n=15). *P<0.05; **P<0.01, compared with control.

Page 22 of 27

B

2 1.8 1.6 1.4 1.2 1 0.8 0.6 0.4 0.2 0

4

*

TNF-ɑ mRNA levels (arbitary units)

**

3.5 3 2.5 2 1.5 1 0.5 0

Control

CCl4 treatment

Control

C

D

2 1.5 1

0.5

**

2.5

2 1.5 1

an

0.5

us

IL-1ß mRNA levels (arbitary units)

INOS mRNA levels (arbitary units)

*

0

CCl4 treatment

cr

3

2.5

ip t

cREL mRNA levels (arbitary units)

A

0

CCl4 treatment

E

Control

M

Control

CCl4 treatment

F

ed

2 1.5

1 0.5 0

Control

CCl4 treatment

IL-12 mRNA levels (arbitary units)

2.5

*

ce pt

IL-6 mRNA levelss (arbitary units)

2.5

** 2

1.5 1

0.5 0 Control

CCl4 treatment

Fig.4. The changes of the inflammatory cytokines and cREL mRNA expression in CCl4-treated

Ac

carps. The data is expressed as mean ± SD (n=15). *P<0.05; **P<0.01, compared with control

Page 23 of 27

A

Normal control

Cell viability (%)

120

CCl4 treatment *

**

**

2

8

16

100 80 60 40 0

0

1

4

cr

Time (h)

ip t

20

0h

an

us

B

8h

4h

M

Fig.5. Cytotoxicity evaluation in carp primary hepatocyte after different time exposure to CCl4. A, cell viability, B, morphologic changes of hepatocyte, bar = 100 µm. The data is expressed as mean

Ac

ce pt

ed

± SD (n=4). *P<0.05; **P<0.01, compared with the value of normal control (0 h).

Page 24 of 27

A

Normal control

Caspase -3 (µmol/gprot)

60

**

CCl4 treatment **

50 40

30 20 10 0 1

2

4

8

16

ip t

0

Time (h)

Normal control

CCl4 treatment

Caspase -8 (µmol/gprot)

60

cr

B

**

50

**

*

us

40

30 20

0 0

1

2

4

8

16

60 50

*

40

30 20 10 0 0

CCl4 treatment ** *

ce pt

Caspase -9 (µmol/gprot)

Normal control

ed

C

1

2

M

Time (h)

an

10

4 Time (h)

8

16

Ac

Fig.6. The changes of caspase-3 (A), caspase-8 (B) and caspase-9 levels (C) in CCl4-treated liver cells. The data is expressed as mean ± SD (n=4). *P<0.05; **P<0.01, compared with the value of normal control.

Page 25 of 27

CCl4 CYP2E1 Oxidative stress TRL4 increase Activated NF-κB

INOS

M

an

Inflammation response

us

NO IL-1ß, IL-6, IL-12

Antioxidant defense system injury

ip t

Activated apoptosis

Membrane dysfunction

cr

TNF- ɑ release

Lipid peroxidation

ed

Hepatic damage (Liver cells death) Fig.7. Scheme showing the proposed hepatoxicity mechanisms of CCl4. CCl4 was activated by CYP2E1 to form highly reactive free radicals in carp liver. These radicals could induced oxidative

ce pt

stress and lipid peroxidation, which attacked and destroyed membrane structure and antioxidant defense system. Meanwhile, Oxidative stress also triggered the TNF-ɑ release and increased TRL4 level, and then activated NF-κB, allowing its nuclear translocation. The activated nuclear translocation factors stimulated the expression of iNOS and interleukins-1ß, -6 and 12, causing cellular inflammation and necrosis. In turn, the release of highly reactive oxygen and nitrogen

Ac

species from inflammatory cells, further exacerbated oxidative and nitrosative stress. In addition, high levels of TNF-ɑ activated liver cells apoptosis. Consequently, hepatic damage occurred in CCl4-treated carp.

Page 26 of 27

*Highlights (for review)

Highlights We explored the underlying toxicology of CCl4 at the cellular and molecular levels QRT-PCR detected the gene expression of NF-κB and inflammatory cytokines The apoptosis and necrosis occurred simultaneously in carp liver damage

Ac

ce pt

ed

M

an

us

cr

ip t

CCl4 activated the TNF-ɑ /NF-κB and TRL4/NF-κB signaling pathways

Page 27 of 27