Effects of crude oil exposure and elevated temperature on the liver transcriptome of polar cod (Boreogadus saida)

Aquatic Toxicology 165 (2015) 9–18

Contents lists available at ScienceDirect

Aquatic Toxicology journal homepage: www.elsevier.com/locate/aquatox

Effects of crude oil exposure and elevated temperature on the liver transcriptome of polar cod (Boreogadus saida) Øivind Andersen a,b,∗ , Marianne Frantzen c , Marte Rosland b , Gerrit Timmerhaus a , Adrijana Skugor a , Aleksei Krasnov a a

Nofima, N-1430, Ås, Norway Department of Animal and Aquaculture Sciences, Norwegian University of Life Sciences, N-1430, Ås, Norway c Akvaplan-niva, FRAM – High North Research Centre for Climate and the Environment, N-9296 Tromsø, Norway b

a r t i c l e

i n f o

Article history: Received 15 January 2015 Received in revised form 23 March 2015 Accepted 18 April 2015 Available online 6 May 2015 Keywords: Polar cod Oil pollution Xenobiotics Microarray analysis Aglomerular kidneys

a b s t r a c t Petroleum-related activities in the Arctic have raised concerns about the adverse effects of potential oil spill on the environment and living organisms. Polar cod plays a key role in the Arctic marine ecosystem and is an important species for monitoring oil pollution in this region. We examined potential interactions of oil pollution and global warming by analysing liver transcriptome changes in polar cod exposed to crude oil at elevated temperature. Adult males and females were kept at high (11 ◦ C) or normal (4 ◦ C) temperature for 5 days before exposure to mechanically dispersed crude oil for 2 days followed by recovery in clean sea water for 11 days at the two temperatures. Genome-wide microarray analysis of liver samples revealed numerous differentially expressed genes induced by uptake of oil as confirmed by increased levels of bile polycyclic aromatic hydrocarbon (PAH) metabolites. The hepatic response included genes playing important roles in xenobiotic detoxification and closely related biochemical processes, but also of importance for protein stress response, cell repair and immunity. Though magnitude of transcriptome responses was similar at both temperatures, the upregulated expression of cyp1a1 and several chaperone genes was much stronger at 11 ◦ C. Most gene expression changes returned to basal levels after recovery. The microarray results were validated by qPCR measurement of eleven selected genes representing both known and novel biomarkers to assess exposure to anthropogenic threats on polar cod. Strong upregulation of the gene encoding fibroblast growth factor 7 is proposed to protect the liver of polar fish with aglomerular kidneys from the toxic effect of accumulated biliary compounds. The highly altered liver transcriptome patterns after acute oil exposure and recovery suggests rapid responses in polar cod to oil pollutants and the ability to cope with toxicity in relatively short time. © 2015 Elsevier B.V. All rights reserved.

1. Introduction The Arctic contains one of the world’s largest petroleum resources and the region is becoming increasingly accessible due to receding sea ice and technological advancements. Oil spills from operational or accidental discharges represent a major threat to Arctic marine organisms and therefore studies of the effects of oil pollution are given high priority. Polar cod (Boreogadus saida) is widely distributed in the Arctic seas of northern Greenland, Alaska, Canada and Russia, and plays a key role in the Arctic marine ecosys-

∗ Corresponding author at: Nofima, P.O.Box 5010, Ås, Norway. Tel.: +47 93060248. E-mail addresses: oivind.andersen@nofima.no (Ø. Andersen), [email protected] (M. Frantzen), [email protected] (M. Rosland), gerrit.timmerhaus@nofima.no (G. Timmerhaus), adrijana.skugor@nofima.no (A. Skugor), aleksei.krasnov@nofima.no (A. Krasnov). http://dx.doi.org/10.1016/j.aquatox.2015.04.023 0166-445X/© 2015 Elsevier B.V. All rights reserved.

tem by linking the food web between higher and lower trophic levels (Welch et al., 1992; Christiansen et al., 2012). The overlapping distribution with potential petroleum-related activities and its location in the ice edge, a natural oil spill sink, makes the polar cod an important species for monitoring oil pollution in the Arctic (Stange and Klungsøyr, 1997; Jonsson et al., 2010; Gardiner et al., 2013). Polar cod experiences temperatures from close to the freezing point of sea water to +7 ◦ C in July, but the predicted warming of the Arctic may impair growth and reproduction (Doney et al., 2012; Nahrgang et al., 2014; Brown and Thatje, 2015). Further, petroleum exposure seemed to depress routine metabolism in polar cod (Christiansen et al., 2010). Melting ice increases risk of contact between fish and oil spills, while thermal stress may enhance vulnerability to toxic pollutants. Polycyclic aromatic hydrocarbons (PAHs) are the primary toxic constituents in crude oil, and cytotoxic, immunotoxic, mutagenic

10

Ø. Andersen et al. / Aquatic Toxicology 165 (2015) 9–18

and carcinogenic effects have been reported in diverse fish species (Reichert et al., 1998; Vogelbein, 2003; Reynaud and Deschaux, 2006). Exposure of embryos and fry to crude oil-derived PAH causes cardiac dysfunctions and abnormalities in neural system, spinal curvature and craniofacial structures (Carls et al., 2008; Hicken et al., 2011; Incardona et al., 2014). Biotransformation of lipophilic compounds forms water-soluble conjugates which are rapidly excreted via urine in fish with glomerular nephrons by a combination of glomerular filtration and tubular transport (James, 1987). The aglomerular kidney of polar fish protects against the loss of the vital antifreeze proteins, but hampers urinary secretion and causes the accumulation of toxic bile compounds (Dobbs et al., 1974; DeVries, 1988; Pritchard and Bend, 1984; Christiansen et al., 1996). Studies of biotransformation in oil-exposed fish, including polar cod, have commonly measured the gene expression and activities of enzymes involved in protection against xenobiotics and free radicals (van der Oost et al., 2003; Nahrgang et al., 2009, 2010a,b). Our knowledge about the toxic effects of PAH has been increased by expanding the repertoire of biomarkers, such as genes encoding peroxisomal enzymes of lipid metabolism (Bilbao et al., 2010), immune genes (Hur et al., 2013), alcohol dehydrogenase (OsorioYanez et al., 2012) and glycine N-methyltransferase, a mediator in the methionine and folate cycles (Fang et al., 2010). However, while the candidate gene approach is limited for elucidating the complex effects of PAH mixtures, transcriptome analyses of multiple genes may provide a comprehensive overview of the toxicogenomic responses. Studies on joint effects of PAH and elevated water temperature on fish are scarce. Exposure of juvenile Atlantic cod to oil dispersants caused greater induction of hepatic EROD activity at higher temperature (Lyons et al., 2011), while gill CYP1A levels and EROD activity in North Sea dab (Limanda limanda) exposed to polyaromatic contaminants were inversely related to water temperature (Sleiderink et al., 1995). Rainbow trout exposed to PAH at 12 ◦ C and 24 ◦ C showed quantitative and qualitative differences in temporal dynamics of biomarkers (Brinkmann et al., 2013). Here, we examined transcriptome changes in the liver of polar cod induced by acute crude oil exposure combined with elevated temperature to assess the adverse effects of oil spills in the Arctic combined with the predicted climatic changes. Gene expression (in this aticle gene expression is taken as synonymous to gene transcription, although it is acknowledged that gene expression is additionally affected, e.g., by translational efficiency and mRNA and protein stability) was analysed with a genome-wide oligonucleotide microarray based on Atlantic cod genome sequences (Krasnov et al., 2013), and selected genes representing novel biomarker candidates were validated by quantitative qPCR. For exposure concentration verifications water samples were analyzed for total hydrocarbon content (THC) and PAH concentrations, and the bioavailability of the dispersed oil was measured by semi-quantification of biliary PAH metabolites.

2. Material and methods 2.1. Fish collection and maintenance Polar cod were caught outside Svalbard in January, 2013 by a benthic trawl (Campelen Super 1800) equipped with a fish-lift to prevent the fish from being injured during trawling. The fish were kept on board the vessel in a circular transport tanks supplied with running seawater during transport to Akvaplan–Niva’s marine facility in Tromsø, Norway. The fish were placed in a 1000 L holding tank for acclimation and maintenance at water temperature of 3–4 ◦ C and simulated ambient Svalbard photoperiod (January: 0 L:24D, February–April: gradual change from 9 L:15D to 24 L:0D, May: 24 L:0D) until the start of the experiment in May 2013. The fish were hand fed twice a week with a commercial marine fish feed (Skretting, 3–4 mm dry pellets). 2.2. Experimental set-up In total 56 adult fish (three months post-spawning) of mixed gender with body weight of 28.9 ± 18.0 g and total length of 16.4 ± 4.5 cm were divided randomly into four 120-L tanks (n = 14 per tank) with circulating seawater at the ambient temperature of 4 ◦ C for two weeks. The water temperature in two tanks was gradually increased to 11 ◦ C during 4 days, and the fish were maintained at either 4 or 11 ◦ C for 5 days. All fish were then transferred to 4 equivalent tanks for 2-day exposure to mechanically dispersed crude oil or clean seawater (control) at 4 or 11 ◦ C (see Section 2.3). Seven fish from each tank were then sampled randomly, while the remaining fish were transferred back to the clean water tanks at 4 or 11 ◦ C and sampled after 11 days of recovery. The fish were hand-fed every day, except for 2 days before and during oil exposure. 2.3. Oil exposure The work was carried out in accordance with the laws and regulations controlling experiments/procedures in live animals in Norway and has been approved by the Norwegian Animal Research Authority (NARA; ID 5561). A static, spiked oil exposure treatment was performed according to the protocol developed by CEDRE, France, for the DISCOBIOL project (Milinkovitch et al., 2013). Naphthenic crude oil (Troll) with an initial concentration of 67 mg oil/L sea water was added through a funnel fixed at the surface 24 h before the fish were transferred to the experiment tanks and exposed to the dispersed oil for 48 h. The funnel was connected to a pump at the bottom of the tank ensuring a homogenous mixture of oil and water throughout the water column. Oxygen was percolated into the water of the exposure tanks through air stones to ensure >90% O2 -saturation throughout the exposure period. The same experimental system was used for the control tanks without addition of oil. Water samples for chemical analysis were taken

Table 1 Selected genes and primer sequences (5’–>3’) for RT-qPCR verification. Gene

Symbol

Forward primer

Reverse primer

Aryl-hydrocarbon receptor repressor b TCDD-inducible poly [ADP-ribose] polymerase ATP-binding cassette, sub-family G (WHITE), member 2 UDP glucuronosyltransferase Cytochrome P450, family1, member C2 Cytochrome P450, family 1, member A1 Phosphoserine aminotransferase 3-phosphoadenosine 5-phosphosulfate synthase 2 Fibroblast growth factor 7 Gamma-crystallin B Mitochondrial uncoupling protein 2 Ubiquitin

ahrr tiparp abcg2 ugt2a2 cyp1c2 cyp1a1 psat papss2 fgf7 crygb ucp2 ubi

CAAGCGAATCCAGAGAAACC TCAACATCAAGGAGGGCTTC TGGCGTACCAGGGAGTAGAT AATGGTTGCCTCAGAACGAC TGTCTGGAAGCCTGTCTGTG CCACCCCGAGATGCAGG TGAGTGTCCTGTGGTCTTCG GTGATGGAGGGAGGTGATTG CGGCAAGGAGATGTTTATCG CATGTCCAACTGCATGTCCT GCCATCCTCAAACACAACCT GGCCGCAAAGATGCAGAT

GCGTAGAACACCATCCCATC AAGAGGAGGGGTGAGGAGAA TTTGGTGTAAGCGATGGACA GCACTTCCAGCCTCAAGATG CGTTGCCGTATTTCTTAGCC CGAAGGTGTCTTTGGGGA ACTTCTGCTTGTTGAGCGTCT CAGTGGAGTGAGGCGGTATT GAAGTGGGACGCTATGTGCT CATCATCCTGCCCCTGTACT ATGTAGCGGGTCTTCACCAC CTGGGCTCGACCTAAGAGT

Ø. Andersen et al. / Aquatic Toxicology 165 (2015) 9–18

11

Table 2 Chemical characterization of exposure media at the start and at the end of the 2-days exposure period. Concentrations are given in mg/L for total hydrocarbon content (THC), ␮g/L for individual and SUM polycyclic aromatic hydrocarbons (PAHs). Ctrl: control, MDO: mechanically dispersed oil. Start of exposure (T0 h) 4 ◦C

End of exposure (T48 h) 11 ◦ C

4 ◦C

11 ◦ C

Treatment

Ctrl

MDO

Ctrl

MDO

Ctrl

MDO

Ctrl

MDO

[Nominal oil] (mg/L)

0

67

0

67

0

67

0

67

THC (mg/L) PAH (mg/L) Naphthalene C1-Naphthalene C2-Naphthalene C3-Naphthalene Acenaphthylene Acenaphthene Fluorene Phenanthrene Dibenzothiophene C1-Anthr/Phenanthrene C1-Dibenzothiophene Antracene C2-dibenzothiophene C2-Anthr/Phenanthrene C3-Anthr/Phenanthrene C3-dibenzothiophene FLuoranthene Pyrene Benzo(a)anthracene Chrysene Benzo(b)fluoranthene Benzo(k)fluoranthene Benzo(a)pyrene Indeno(1,2,3-cd)pyrene Benzo(ghi)perylene Dibenzo(a,h)anthracene SUM 26 PAH

0.0

9.6

0.0

13.5

0.0

6.8

0.0

0.7

0.496 0.906 0.879 0.270 <0.002 <0.015 <0.069 <0.049 0.016 <0.182 <0.031 <0.001 <0.061 <0.296 <0.165 <0.053 <0.03 <0.31 <0.007 <0.014 <0.031 <0.017 <0.01 <0.023 <0.013 <0.009 2.57

8.92 26.3 69.7 114 0.027 0.813 2.19 6.61 0.928 15.6 2.69 0.041 9.60 30.3 23.0 9.70 0.512 0.503 0.091 0.604 0.209 0.027 0.104 0.042 0.070 0.018 323

0.306 0.680 0.853 0.266 <0.002 <0.015 <0.069 <0.049 0.009 <0.182 <0.031 < 0.001 <0.061 <0.296 <0.165 <0.053 <0.03 <0.31 <0.007 <0.014 <0.031 <0.017 < 0.01 <0.023 <0.013 <0.009 2.11

2.49 11.6 49.2 108 0.016 0.670 2.14 7.29 1.05 17.7 3.13 0.017 10.1 32.4 25.7 10.5 0.555 0.519 0.102 0.723 0.220 0.031 0.110 0.053 0.087 0.019 284

0.178 0.299 <0.731 0.368 <0.002 <0.015 <0.069 <0.049 < 0.006 <0.182 <0.031 <0.001 <0.061 < 0.296 <0.165 <0.053 < 0.03 <0.31 <0.007 <0.014 <0.031 <0.017 < 0.01 <0.023 <0.013 <0.009 0.845

1.99 5.28 17.0 45.0 0.012 0.223 0.629 2.49 0.352 8.77 1.48 0.033 6.20 19.9 17.0 6.71 0.296 <0.31 0.060 0.441 0.153 0.020 0.079 0.037 0.055 0.015 134

0.063 <0.146 <0.731 0.263 <0.002 <0.015 <0.069 <0.049 < 0.006 <0.182 <0.031 <0.001 <0.061 < 0.296 <0.165 <0.053 < 0.03 <0.31 <0.007 <0.014 <0.031 <0.017 < 0.01 <0.023 <0.013 <0.009 0.326

0.313 1.13 2.65 4.24 <0.002 0.067 0.197 0.426 0.068 0.930 0.156 0.010 0.591 2.02 1.76 0.699 0.030 <0.31 <0.007 0.050 <0.031 <0.017 < 0.01 <0.023 <0.013 <0.009 15.3

from the centre of the water column of all experimental tanks at the start and end of oil exposure and stored at −20 ◦ C until analyses. 2.4. Water chemistry All chemical analyzes were conducted by Unilab analyse AS, Tromsø, Norway. Water samples were analyzed for total hydrocarbon content (THC) and the 16 Environmental Protection Agency (EPA) priority PAHs plus un-substituted and C1–C3-alkylated naphthalenes, phenanthrenes and dibenzothiophenes (NPD; 26 PAHs in total). The measured THC and PAH concentrations represent both dissolved components and oil droplets. Determination of THC (C10–C35) was performed on isooctane extracts by gas chromatography–flame ionization detector (GC–FID). External standard solutions were also run on the GC to confirm the valid external standard curve. Blank samples were processed and analyzed in the same way as real samples, and calculation of THC in real samples were corrected for the blank values. Analysis for 16 EPA PAHs plus NPD was performed on isooctane extracts by GC–mass spectrometry (GC–MS) operated in selected ion monitoring mode. Each sample extract was analyzed once on the GC–MS, as well as calibration solutions of known PAH-NPD-concentrations (including deuterated standards). Calculation of PAH- NPD in real samples was corrected for the blank values. Limit of detection (LOD) were determined from the average value and standard deviation of a series of blank samples. In determination of SUM PAHs, only values above LOD were included. 2.5. Tissue sampling and RNA extraction The fish were anesthetized in 5% metacaine and sacrificed by a sharp blow to the head. Liver was dissected out, fixed in RNAlater®

and stored at −20◦ C prior to gene expression analyses. The gall bladder was placed into a cryo vial, snap-frozen in liquid nitrogen and stored at −80 ◦ C prior to analysis of biliary PAH metabolites. RNA was extracted from liver by suspending chopped samples (∼100 ␮g) in 1 mL Isol-RNA (VWR) before homogenization with 1.4 mm ceramic (zirconium oxide) beads in a Precellys®24 homogenizor (Bertin Technologies) at 5500 rpm for 2 × 20 s. After the separation of nucleic acids from proteins using chloroform, the upper layer of the supernatant was added to equal volumes of lysis buffer and 96 % ethanol, vortexed and applied on a 96 Well Total RNA filter plate (Norgen Biotek Corporation). After centrifugation of aggregated DNA, total RNA was purified by PureLink® Pro96 RNA Purification Kit (Life technologies) according to manufacturer’s instructions. Genomic DNA was removed by on-column DNase 1 digestion (Sigma–Aldrich). The RNA quality was assessed with Agilent 2100 Bioanalyzer (Agilent Technologies), and the quantity was measured by NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific. The isolated RNA was stored at −80 ◦ C prior to analysis. 2.6. Biliary PAH metabolites Biliary PAH metabolites were measured with a PerkinElmer spectrofluorometer LS55 through synchronous fluorescence scan (SFS) spectrometry. Bile extract was diluted ×4000 in distilled water and a scan of arbitrary fluorescence intensity from 250 to 500 nm excitation wavelengths was performed with ␭ 42 nm (Aas et al., 2000). The fluorescence spectrum of distilled water (triplicate) was subtracted from the fluorescence spectrum of each sample, and the three main fluorescence peaks at 290, 341 and 380 nm excitation wavelength, corresponding to metabolites derived from 2/3-ring PAHs, 4-ring PAHs, and 5/6-ring PAHs,

12

Ø. Andersen et al. / Aquatic Toxicology 165 (2015) 9–18

Fig. 1. Biliary PAH metabolites in polar cod after 2-days oil exposure (A, C, E) and after 11 days post-exposure recovery in clean sea water (B, D, F). 2/3-ring (A–B), 4-ring (C–D), 5/6-ring (E–F) Ctrl; control, MDO; mechanically dispersed oil. Different lower case letters indicates significant differences (p ≤ 0.05) between the groups.

respectively, were extracted. Data were analyzed with nonparametric Kruskal–Wallis ANOVA followed by a multiple comparison of mean ranks of all groups. 2.7. Microarray analyses Liver transcriptome changes were assessed by comparing gene expression profiles of oil-exposed and control groups at two different temperatures using the second version of the genome-wide Atlantic cod oligonucleotide microarray ACIQ2 (Krasnov et al., 2013) fabricated by Agilent Technologies UK Ltd. in a 4 × 44 k format. The design included two treatments (oil exposure and control), two temperatures (4 and 11 ◦ C) and two time-points for exposed fish (2 days after oil exposure and 11 days after recovery) and one time-point (day 2) for controls. Five to six replicates were analyzed using totally 32 microarrays. Individual samples were competitively hybridized against a common pooled-reference consisting of an equalized mixture of all samples. RNA amplification, labeling and fragmentation were performed using two-colour Quick Amp Labeling Kit and Gene Expression Hybridization kit following the manufacturer’s instructions (Agilent Technologies). The input of total RNA used in each reaction was 100 ng. Hybridization was performed at 65 ◦ C at the rotation speed of 10 rpm for 17 h in the oven (Agilent Technologies). The slides were washed with Gene Expression Wash Buffers 1 and 2 as described by the manufacturer. Scanning was performed at 5 ␮m resolution using an Axon

GenePix 4200AL Scanner (MDS Analytical Technologies) and Gene Pix Pro was applied for grid alignment, feature extraction and quantification. Nofima’s bioinformatic package STARS (Krasnov et al., 2011) was used for data processing and mining. After filtration of low quality spots flagged by Gene Pix Pro lowess normalization of log2 -expression ratios (ER) was performed. Differentially expressed genes were selected by difference between the exposed and control fish: |log2 -ER| > 1 (2-fold) and p < 0.01. For hierarchical clustering, Pearson r was used as distance metric and the tree was built with Ward’s method. 2.8. Real-time qPCR analysis Results from the microarray analysis were validated by running SYBR Green real-time quantitative polymerase chain reaction (RTqPCR) on 11 selected genes. Forward and reverse primers (Table 1) were designed using Primer3 (v. 0.4.0). RT-qPCR was carried out on four pools of five livers sampled after 2-days oil exposure or clean water at 4 or 11 ◦ C. For each pool, 4.5 ␮g RNA was used for the cDNA synthesis according to manufacturer’s instructions (Agilent Technologies). The RT-qPCR reactions were performed in duplicates, and a negative control without cDNA was included for each primer set. Ubiquitin was used as a reference gene to normalize the data (Johnsen and Andersen, 2012). The RT-qPCR was performed by using LightCycler® 480 Instrument (Roche Applied Science) with the following cycles: 95 ◦ C 5 min, then 45 cycles of

Ø. Andersen et al. / Aquatic Toxicology 165 (2015) 9–18

13

Fig. 2. A: Hierarchical clustering by differentially expressed genes in polar cod after oil exposure at elevated temperature. The samples are designated by treatments: O: (log2ER)2. oil-exposed, C: control; R: recovery, 4 and 11 indicate the two temperatures. B: Magnitude of differential gene expression was assessed as

95 ◦ C 10 sek, 60 ◦ C 20 sek and 72 ◦ C 30 sek, before final extension at 60 ◦ C for 1 min. The mRNA levels of the selected genes were determined according to the 2−CT method (Livak and Schmittgen, 2001). The method uses the CT -value (number of PCR cycles at which the fluorescence generated crosses the threshold) to calculate the normalized difference between the oil-exposed and control fish in a fold change expression. To compare the microarray and qPCR results, a Spearman’s rank rho test was conducted by Tinn-R (v. 2.4.1.5, GNU General Public License). 3. Results 3.1. Water chemistry and biliary PAH metabolites At the start of oil exposure the THC concentration was 9.6 and 13.5 mg/L in the 4 ◦ C and 11 ◦ C treatment, respectively, and 0 mg/L in the controls (Table 2). During the 2-day exposure period the THC concentration decreased to 6.8 and 0.7 mg/L at 4 ◦ C and 11 ◦ C, respectively, reflecting a more rapid oil weathering process at the elevated temperature. Comparable trends were observed for SUM 26 PAH. The dispersions were dominated by naphthalene and 3-ring PAHs (un-substituted PAHs and their C1–C3 alkylated homologues), and a more rapid decrease in 2-and 3-ring PAHs was observed in the 11 ◦ C treatment than in the 4 ◦ C throughout the 2-day exposure period. Biliary PAH metabolites showed significantly higher fluorescence values in exposed fish when compared to the controls after the 2-day treatment period (Fig. 1A, C, E). The oil-exposed fish showed more variable levels of the PAH metabolites after 11 days recovery, but generally with significantly higher fluorescence values in exposed fish than in the controls (Fig. 1B, D, F). No significant differences between the two temperatures were observed after either 2 or 11 days. No mortality was observed throughout exposure and recovery.

(Fig. 2B). Responses to oil exposure at 4 or 11 ◦ C were similar by scale at the transcriptome level while differences were observed in regulation of individual genes as exemplified below. 3.3. Differentially expressed genes and predicted activated pathways Inspection of the differentially expressed genes revealed the characteristic features of the hepatic responses to toxic compounds comprising diverse processes in the xenobiotic metabolism (Table 3A). A hallmark of the transcriptional response was induction of the gene encoding the aryl hydrocarbon receptor repressor (AhRR), a negative regulator of the master transcription factor AhR in biotransformation (Hahn et al., 2009). Much stronger upregulation at 4 ◦ C compared to 11 ◦ C was shown by the AhR target gene tiparp (gene encoding TCDD-inducible poly [ADP-ribose] polymerase) and mid1ip1 (gene encoding Mid1-interacting protein 1) involved in the regulation of hepatic gluconeogenesis and lipogenesis, respectively (Diani-Moore et al., 2010; Inoue et al., 2011). Conversely, a number of genes with important roles in xenobiotic detoxification and related processes showed stronger up-regulation in fish exposed to oil at elevated temperature, such as the more than 7-fold increase of cyp1a1 at 11 ◦ C versus 1.8-fold up-regulation at 4 ◦ C. Together with the transcriptional

3.2. Overview of liver transcriptome changes Microarray analysis of liver sampled from fish after oil exposure at 4 or 11 ◦ C revealed 1517 differentially expressed genes. Hierarchical clustering divided the samples in six clusters that coincided with the treatment groups (Fig. 2A). Difference between the oil exposure and recovery was greater than that by the temperatures, and samples from recovered fish were much closer to the controls than samples taken after oil exposure. The magnitude of expression changes markedly decreased with time at both temperatures

Fig. 3. Quantitative real-time PCR validation of 11 selected genes identified in the microarray analysis. Each bar represents the difference in gene expression between o o oil-exposed and control fish kept at 4 C or 11 C. Abbreviations are explained in Table 1.

14

Ø. Andersen et al. / Aquatic Toxicology 165 (2015) 9–18

Table 3 Differentially expressed genes involved in A. Xenobiotic metabolism and B. Meta-bolism of cofactors, aromatic and lipophylic compounds. Data are given as fold-changes compared to control after 2-days oil exposure (Oil) and after 11-days recovery (Recov) at 4 ◦ C or 11 ◦ C. (A) Xenobiotic metabolism: regulators, transporters and enzymes

Oil 4 ◦ C

Oil 11 ◦ C

Recov 4 ◦ C

Recov 11 ◦ C

Aryl-hydrocarbon receptor repressor b Nuclear receptor coactivator 7 ATP-binding cassette, sub-family G (WHITE), member 2 ATP-binding cassette transporter sub-family G member 2a ATP-binding cassette sub-family C (CFTR/MRP) member 2 Cytochrome P450 2C33-like Cytochrome P450 2Y3 Cytochrome P450 1A1 Cytochrome P450 2C33-1 Cytochrome P450 2C33-2 Cytochrome P450 1C2-like Cytochrome P450 2J2 Cytochrome P450 27C1 Cytochrome P450 11B2 Cytochrome P450 2J24-1 Cytochrome P450 2J24-2 Cytochrome P450 7A1 Cytochrome P450 19A1B, aromatase Alcohol dehydrogenase [NADP(+)] A TCDD-inducible poly [ADP-ribose] polymerase Uridine-cytidine kinase 2A Organic solute transporter subunit alpha UDP glucuronosyltransferase 5 family polypeptide d1-1 UDP glucuronosyltransferase 5 family polypeptide d1-2 Glutathione S-transferase M Glutathione S-transferase theta-4 3-phosphoadenosine 5-phosphosulfate synthase 2 Gamma-glutamyltransferase family

13.97 4.85 2.52 2.17 2.24 2.02 2.10 1.80 2.11 2.44 4.30 1.72 −5.05 2.15 1.13 −2.12 −2.46 1.38 2.05 10.10 1.84 1.80 1.96 2.32 2.65 2.44 8.23 3.57

5.71 7.66 3.83 4.61 3.70 2.50 2.91 7.56 3.21 3.37 5.22 2.89 1.58 2.78 2.23 −1.31 −1.65 −1.14 2.61 6.37 6.68 3.09 2.71 5.39 1.31 2.58 20.60 2.89

−1.08 1.46 1.18 1.07 1.24 1.25 1.23 −2.12 1.39 1.35 −1.22 2.18 −3.15 1.50 1.41 −1.36 1.54 −1.64 1.40 −1.37 −1.26 1.25 1.50 1.79 1.56 −1.03 1.18 −1.02

−1.29 1.93 1.41 1.66 1.32 1.24 1.46 1.13 1.51 1.44 2.18 −1.06 9.04 1.26 1.28 3.93 −1.38 −3.61 1.43 −1.23 −1.08 1.42 1.83 1.67 −1.48 −1.16 1.13 −1.26

(B) Metabolism of cofactors, aromatic and lipophylic compounds

Oil 4 ◦ C

Oil 11 ◦ C

Recov 4 ◦ C

Recov 11 ◦ C

5-methyltetrahydrofolate-homocysteine methyltransferase 6-pyruvoyl tetrahydrobiopterin synthase-1 6-pyruvoyl tetrahydrobiopterin synthase-2 Phosphoserine aminotransferase Aminolevulinate delta-synthetase 1 Uroporphyrinogen decarboxylase Tyrosine aminotransferase Tryptophan 2 3-dioxygenase A Enoyl Coenzyme A hydratase 1, peroxisomal Mid1-interacting protein 1-B Hydroxysteroid (17-beta) dehydrogenase 10

2.03 2.48 2.44 4.63 8.64 −1.04 5.48 5.94 3.26 13.00 3.06

2.20 16.75 13.26 8.05 12.31 2.45 3.07 2.08 2.35 4.79 4.72

−1.10 1.26 1.22 −1.86 −1.98 1.71 1.13 −1.18 −1.13 2.21 −1.09

−1.22 2.36 2.41 1.16 −1.01 2.44 −1.53 −1.17 1.75 −1.19 −1.28

activation of genes encoding a panel of phase I CYP enzymes, the oil exposure also was predicted to trigger phase II of biotransformation by as the mRNA expression of genes that encode enzymes that activate sulphur and that conjugate xenobiotics with glucuronate and glutathione; gamma-glutamyltransferases (GGT), UDP-glucuronosyltransferases (UGT) and glutathione Stransferases (GST) was increased. Genes encoding transporters from the ABC-binding cassette superfamily that expel phase II products from the cells (Hollenstein et al., 2007) showed about 4-fold upregulated mRNA expression after oil exposure at 11 ◦ C. Upregulated expression was shown for genes encoding other enzymes implicated in detoxification, including alcohol dehydrogenase [NADP(+)] (ADH) reducing aliphatic and aromatic aldehydes and uridine-cytidine kinase 2A (UCK) activating several important frontline antimetabolite drugs (Nakayama et al., 1985; Appleby et al., 2005). Genes encoding a number of enzymes with key roles in biosynthesis of cofactors were induced by oil exposure (Table 3B). Phosphoserine aminotransferase (PSAT) and 6-pyruvoyl tetrahydrobiopterin (PTP) synthase play an important part in biosynthesis of the cofactors pyridoxine and folate, respectively, while aminolevulinate delta-synthase 1 (ALAS1) is the key enzyme of heme biosynthesis, the essential cofactor of multiple enzymes including CYPs. We noted the predicted stimulation of several biochemical pathways that can be indirectly involved in the detoxification by

enhancement of steroid metabolism and conversion of aromatic amino acids, such as enoyl coenzyme A hydratase 1 (ECHS1) and delta(35)-delta(24)-dienoyl-CoA isomerase (3,2 DCI) interacting with diverse lipophilic compounds in peroxisomes and mitochondria. Exposure to oil pollutants and induction of biotransformation was associated with stress as evidenced by the upregulation of genes encoding Jun transcription factors (Table 4) (Leppä and Bohmann, 1999; Meixner et al., 2010). Increased chaperone activity was suggested by the induction of a panel of genes encoding heat shock proteins and their cognates, and five genes encoding crystalline gamma-like proteins with predicted chaperone properties showed markedly greater reaction to oil exposure at high temperature. The highly induced gene encoding transglutaminase 2 (TG2) cross-links proteins protecting them from chemical, enzymatic, and mechanical disruption (Greenberg et al., 1991). Several up-regulated genes are likely involved in repair of hepatic tissues, including genes encoding fibroblast growth factor 7, connective tissue growth factor (CTGF), Kruppel-like transcription factors (KLFs) and cysteine-rich angiogenic inducer 61 (CYR61). Exposure to oil decreased the expression of multiple immune genes, especially at higher temperature, while only three genes showed up-regulation (Table 5). Genes involved in antiviral responses were preponderant (86 of 101 features) and 84 of these were members of the three multigene families with unknown roles (Krasnov et al., 2013).

Ø. Andersen et al. / Aquatic Toxicology 165 (2015) 9–18

15

Table 4 Differentially expressed genes involved in stress responses and tissue reparation. Data are fold-changes to control. Gene name

Oil 4 ◦ C

Oil 11 ◦ C

Recov 4 ◦ C

Jun B Jun C-1 Jun C-2 Crystallin gamma A Crystallin gamma B Crystallin gamma C Crystallin gamma D Crystallin gamma E DnaJ (Hsp40) homolog subfamily A member 3B DnaJ (Hsp40) homolog subfamily B member 12 DnaJ (Hsp40) homolog subfamily B member 6 FK506 binding protein 5 Heat shock cognate 70 kDa protein 1 Heat shock cognate 70 kDa protein 2 Heat shock protein 70-1 Heat shock protein 70-2 Heat shock protein 9 Heat shock protein 90-alpha 2 Transglutaminase 2C polypeptide Mitochondrial uncoupling protein 3 Solute carrier family 25 member 47-B Selenoprotein W2a Selenoprotein T1a Selenoprotein 15 kDa Thioredoxin-like 1 Thioredoxin-like protein Glutaredoxin 3 Hemopexin Fibroblast growth factor 7 Connective tissue growth factor Kruppel-like transcription factor 4a Krueppel-like factor 15 Cysteine-rich angiogenic inducer 61 Filamin A-interacting protein 1-like Iodothyronine deiodinase-1 Iodothyronine deiodinase-2 Xylosyltransferase 1

2.75 4.30 4.05 −3.27 −2.16 −1.62 −2.20 −1.85 2.92 3.26 1.75 3.49 4.65 10.08 8.57 9.29 1.89 3.32 6.12 −7.95 −5.78 1.42 1.24 1.18 2.23 1.46 3.55 2.53 6.43 6.40 2.74 5.90 7.43 6.43 5.32 5.37 10.42

2.56 2.10 1.69 10.37 15.67 5.76 3.72 9.01 3.03 2.72 2.89 5.43 1.56 2.91 2.57 1.60 3.27 2.11 15.04 −2.68 −3.62 2.39 2.17 2.04 2.10 2.45 2.13 1.32 17.90 2.10 4.27 11.62 1.95 17.90 10.67 10.65 9.65

−2.74 −1.28 −1.01 −2.03 −1.87 −1.44 −2.57 −1.49 1.29 1.07 1.57 −1.07 −1.05 −1.12 −1.09 −1.22 1.41 1.11 1.17 −2.66 1.71 1.17 1.37 1.23 1.29 1.47 1.69 −1.29 1.18 −1.24 −1.44 −2.40 −1.18 1.18 −1.66 −1.76 1.09

Recov 11 ◦ C −3.28 −2.42 −2.47 10.08 10.84 4.40 2.34 8.12 1.22 1.32 1.30 −1.08 1.06 1.37 1.20 −1.30 1.48 1.01 2.19 −1.24 −1.42 1.14 1,47 1.78 1.17 1.74 −1.60 −6.67 0.81 −1.81 1.43 1.02 −1.16 −1.23 −1.18 −1.37 1.20

3.4. RT-qPCR validation

4. Discussion

The microarray data were validated by RT-qPCR analysis of 11 selected genes, which were all upregulated in the oil-exposed fish, except for the downregulation of crygb at 4 ◦ C and ucp2 at both temperatures (Fig. 3). Correlation between microarray and RTqPCR data at both temperatures was high (R = 0.9134 at 4 ◦ C and R = 0.7627 at 11 ◦ C).

We investigated the ability of polar cod to cope with acute oil exposure at the elevated temperature of 11 ◦ C, which significantly exceeds the upper level in the habitat (Nahrgang et al., 2010c, 2014). Despite a more rapid decrease in the oil concentration in the exposed water at 11 ◦ C compared to 4 ◦ C, the amount of biliary PAH metabolites did not differ between the two temper-

Table 5 Differentially expressed immune genes. Data are fold-changes to control. Gene name

Oil 4 ◦ C

Oil 11 ◦ C

Mannan-binding lectin NF-kappa-B inhibitor alpha MHC class I antigen MHC class I UDA-like 1 MHC class I UDA-like 2 Eosinophil chemotactic cytokine Hepcidin precursor Immunoglobulin light chain A Immunoglobulin light chain B C-type lectin Toll-like receptor 21 Cytokine receptor family member b17 Suppressor of cytokine signaling 1b T-cell receptor beta chain IL2-inducible T-cell kinase T-cell activation GTPase activating protein TNF receptor superfamily member 14 Interferon regulatory factor 1

2.57 1.79 1.43 −2.36 −2.96 −1.62 −6.28 −2.15 −3.26 −1.44 -3.81 −13.74 1.14 −1.68 1.11 −1.66 −2.24 −2.61

2.33 2.31 3.35 −2.57 −5.87 −1.88 −1.54 −2.66 −3.06 −6.05 -2.46 −2.21 −2.04 −3.03 −2.12 −2.08 −3.13 −5.36

Recov 4 ◦ C −1.05 −1.21 1.19 −1.49 −2.93 −2.38 1.18 −2.07 −1.93 −4.10 −2.08 −2.04 2.81 −1.54 v1.24 1.21 1.14 1.94

Recov 11 ◦ C −1.02 −1.02 1.77 −1.36 −3.55 −3.28 1.55 -2.05 −1.69 −2.41 −2.51 −1.15 1.25 −2.47 −1.85 −1.47 1.52 −1.31

16

Ø. Andersen et al. / Aquatic Toxicology 165 (2015) 9–18

atures at either the end of the exposure period or after recovery. This indicates that the 2-day exposure period resulted in comparable oil accumulation and conversion rate at the two tested temperatures. Rapid upregulation of the detoxifying system was demonstrated by the activation of multiple genes coding for the proteins involved in the biotransformation of xenobiotics. (Naturally, the following discussion requires that the transcriptional activation of a gene is reflected in increased activity of the protein gene product). The aryl hydrocarbon receptor (AhR) mediates a large part of responses caused by exposure to PAH and dioxins (Bock and Köhle, 2006). Activation of AhR by xenobiotics induces the expression of the AhR repressor (AhRR) to inhibit the AhR function in a tissue-specific manner (Mimura et al., 1999). Hence, the low basal levels of liver ahrr mRNA are increased dramatically by AhR ligands, such as TCDD (Hahn et al., 2009), in agreement with the strong upregulation of ahrr expression in the oil-exposed polar cod. A hallmark of the AhR signaling pathway activation is the induction of cyp1a1, a widely used biomarker of PAH exposure (van der Oost et al., 2003). In addition to cyp1a1, several genes encoding other CYP enzymes showed altered expression after exposure to oil. The CYP family is known for the exclusively rapid evolution and diversification in animals and plants, and only scant information is available regarding enzymatic properties of the majority of family members (Nelson, 1998; McKinnon et al., 2008). CYPs play pivotal roles in diverse biochemical processes by interacting with exogenous and/or endogenous substrates, but the substrate specificity of most cod CYPs are unknown. However, the putative CYP homologs specified in the Orthodb database (Kriventseva et al., 2015), which were up- and down-regulated in polar cod, are oxygenating, respectively, xenobiotics and steroids or eicosanoids. Downregulation of cyp7a1, the gene encoding the rate-limiting enzyme for bile acid synthesis, in the oil-exposed polar cod coincided with strong upregulation of fgf7. In mice, hepatic cyp7a1 expression was recently shown to be inhibited by which seems to play a significant role in maintaining bile acid homeostasis by protecting hepatocytes from excessive bile acid toxicity (Sun et al., 2012). Although highly advantageous for fish dependent on antifreeze proteins, aglomerular nephrons may represent a problem when xenobiotics are introduced into the environment. Assuming that the role of is conserved in fish (Katoh and Katoh, 2005), its activation in polar cod might be required for reduction of the toxic effects of accumulated biliary compounds. The oil-exposed polar cod also showed increased expression of ost˛ coding for a key membrane transporter of bile acids, conjugated steroids, and structurally-related molecules across the hepatocyte membrane (Ballatori et al., 2010). While the OST␣ and ␤ transporters were first described in a marine skate (Wang et al., 2001), the upregulated expression in primary biliary cirrhosis (PBC) patients suffering from accumulation of toxic bile acids likely protects the liver from tissue injury (Boyer et al., 2006). While transcriptome responses to oil exposure were similar in magnitude at 4 ◦ C and 11 ◦ C, a number of genes showed temperature-dependent regulation. Intriguingly, the induction of ahrr was markedly greater at low temperature, while the activation of cyp1a1 was much stronger at elevated temperature. Several other genes of xenobiotic metabolism also showed stronger response to oil at 11 ◦ C though difference was less. Elevated temperature may have both positive and negative consequences. On one hand, higher rate of biotransformation most likely enhances clearance of toxic compounds but on the other, this may increase risk of oxidative stress. Modest activation of antioxidant defence was indicated by upregulation of genes coding for selenoproteins, thioredoxins, glutaredoxin and hemopexin. We noted highly decreased mRNA expression of the genes encoding mitochondrial uncoupling protein 2 (ucp2) and solute carrier family 25 member 47-B (slc25a47b), which both disrupt coupling between oxidative phosphorylation and ATP biosynthesis in mitochondria, thus increasing production

of free radicals (Vidal-Puig et al., 2000). Their down-regulation can be interpreted in light of protection from oxidative stress. However, since genes encoding the key enzymes degrading free radicals, such as catalase, superoxide dismutase and glutathione peroxidase were not activated, response to oxidative stress was probably not of high importance in this study. Of note is that Atlantic cod exposed to North Sea oil alone, or in combination with alkylphenols, showed evidence of oxidative stress observed as elevated levels of oxidized glutathione (GSSG) content and GR and CAT activities, but no sign of oxidative damage measured as lipid peroxidation was observed (Sturve et al., 2006). In polar cod, genes encoding antioxidant enzymes were upregulated between 16 hr and 2 d of PAH exposure (Nahrgang et al., 2009), and such transient changes could remain unnoticed in our study. High temperature could also exacerbate PAH-induced perturbations in protein folding by interfering with protein transport from endoplasmatic reticulum to the Golgi, disulfide bond formation, or inhibition of chaperone expression (Lafleur et al., 2013). Among the key strategies to counteract protein conformational damage is the induction of chaperones including HSPs and HSP cognates (Padmini, 2010; Roberts et al., 2010). Whereas the expression of genes encoding gamma crystalline chaperones in polar cod was strongly increased at elevated temperature, the activation of genes encoding several HSPs and their cognates was greater at low temperature. Apparently, the stress responses to elevated temperature were relatively small and most likely did not go beyond the scope of adaptation. In comparison, polar cod acclimated to 0 ◦ C showed an adrenergic response to acute heat stress at 10 ◦ C for 10 min, but not after acclimation to 5 ◦ C (Whiteley et al., 2006). Biomarkers of toxicity and stress showed no differences between oil-exposed and control fish after 11 days in clean water, while the sizeable reduction of transcriptomic changes suggested recovery from the impact. The transcriptome analyses indicated neither induction of apoptosis nor signs of inflammation in the oil-exposed polar cod. Down-regulation of immune genes could indicate higher vulnerability to pathogens. However, this group was represented mainly by the members of a recently identified multi-gene family with NACHT domain (Krasnov et al., 2013); these genes responded to nodavirus but their immune role needs to be confirmed. Nonetheless, it is necessary to keep in mind that low gene expression changes were also observed at exposures to high levels of contaminants and in theory can be evidence of inability to cope with toxicity (Koskinen et al., 2004). Transcriptomics alone is unable to provide a compelling evidence for presence or absence of pathology and needs to be combined with other observations. The present study also aimed to identify novel genes that respond to PAH in polar cod. Both ahrr and fgf7 seem to be highly sensitive and reliable biomarkers, which are strongly upregulated in the oil-exposed fish, and return to the basal levels after recovery. Monitoring of pollution requires markers of exposure and effect. The former detect contact with toxic agents, while the latter help to evaluate protection and damages. Transcriptomics is a highly effective strategy to search for genes that respond to toxicity, although correlation between abundance of transcripts and proteins can be low. With respect to PAH effects on fish, this can be exemplified with discordance between cyp1a1 mRNA levels and EROD activity, which was reported in several fish species including polar cod (Kammann et al., 2008; Nahrgang et al., 2009; Koenig et al., 2013). Though functional conclusions based on gene expression should be done with great caution, differentially expressed genes are commonly recognized as useful exposure markers that have advantages over other assays, primarily rapid, consistent and strong response to pollutants. To conclude, the results produced in this study were well in line with the basic concepts of aquatic toxicology. Polar organisms are evolutionary adapted to extreme conditions that render them

Ø. Andersen et al. / Aquatic Toxicology 165 (2015) 9–18

vulnerable to even moderate environmental changes (di Prisco and Verde, 2006; Pörtner, 2010). Analyses of the liver transcriptome revealed rapid and specific responses of polar code to crude oil, but with relatively small effect of temperature. While polar cod seems to be able to cope with acute oil exposure and temperature changes within relatively short time, long-lasting phenotypic effects such as epigenetic changes warrant further studies. Acknowledgements The study was supported with grant from the Fram Centre. We want to thank Hege Munck and Katrine Hånes Kirste for excellent technical assistance. References Aas, E., Baussant, T., Balk, L., Liewenborg, B., Andersen, O.K., 2000. PAH metabolites in bile, cytochrome P4501A and DNA adducts as environmental risk parameters for chronic oil exposure: a laboratory experiment with Atlantic cod. Aquat. Toxicol. 51, 241–258. Appleby, T.C., Larson, G., Cheney, I.W., Walker, H., Wu, J.Z., Zhong, W., Hong, Z., Yao, N., 2005. Structure of human uridine-cytidine kinase 2 determined by SIRAS using a rotating-anode X-ray generator and a single samarium derivative. Acta Crystallogr. D 61, 278–284. Ballatori, N., Li, N., Fang, F., Boyer, J.L., Christian, W.V., Hammond, C.L., 2010. Ost␣-Ost␤: a key membrane transporter of bile acids and conjugated steroids. Front. Biosci. 14, 2829–2844. Bilbao, E., Cajaraville, M.P., Cancio, I., 2010. Differential transcription of genes involved in peroxisome proliferation in thicklip grey mullets Chelon labrosus injected with benzo(a) pyrene. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 151, 334–342. Bock, K.W., Köhle, C., 2006. Ah receptor: dioxin-mediated toxic responses as hints to deregulated physiologic functions. Biochem. Pharmacol. 72, 393–404. Boyer, J.L., Trauner, M., Mennone, A., Soroka, C.J., Cai, S.Y., Moustafa, T., Zollner, G., Lee, J.Y., Ballatori, N., 2006. Upregulation of a basolateral FXR-dependent bile acid efflux transporter OSTalpha-OSTbeta in cholestasis in humans and rodents. Am. J. Physiol. Gastr. Liver Physiol. 290, G1124–G1130. Brinkmann, M., Hudjetz, S., Kammann, U., Hennig, M., Kuckelkorn, J., Chinoraks, M., Cofalla, C., Wiseman, S., Giesy, J.P., Schäffer, A., Hecker, M., Wölz, J., Schüttrumpf, H., Hollert, H., 2013. How flood events affect rainbow trout: evidence of a biomarker cascade in rainbow trout after exposure to PAH contaminated sediment suspensions. Aquat. Toxicol. 128–129, 13–24. Brown, A., Thatje, S., 2015. The effects of changing climate on faunal depth distributions determine winners and losers. Global Change Biol. 21, 173–180. Carls, M.G., Holland, L., Larsen, M., Collier, T.K., Scholz, N.L., Incardona, J.P., 2008. Fish embryos are damaged by dissolved PAHs, not oil particles. Aquat. Toxicol. 88, 121–127. Christiansen, J.S., Dalmo, R.A., Ingebrigtsen, K., 1996. Xenobiotic excretion in fish with aglomerular kidneys. Mar. Ecol. Prog. Ser. 136, 303–304. Christiansen, J.S., Hop, H., Nilssen, E.M., Joensen, J., 2012. Trophic ecology of sympatric Arctic gadoids, Arctogadus glacialis (Peters, 1872) and Boreogadus saida (Lepechin, 1774), in NE Greenland. Polar Biol. 34, 1247–1257. Christiansen, J.S., Karamushko, L.I., Nahrgang, J., 2010. Sub-lethal levels of waterborne petroleum may depress routine metabolism in polar cod Boreogadus saida (Lepechin, 1774). Polar Biol. 33, 1049–1055. DeVries, A.L., 1988. The role of antifreeze glycopeptides and peptides in the freezing avoidance of antarctic fishes. Comp. Biochem. Physiol. B 90, 611–621. di Prisco, G., Verde, C., 2006. Predicting the impacts of climate change on the evolutionary adaptations of polar fish. Rev. Environ. Sci. Biotechnol. 5, 309–321. Dobbs, G.H., Lin, Y., DeVries, A.L., 1974. Aglomerularism in Antarctic fish. Science 185, 793–794. Doney, S.C., Ruckelshaus, M., Duffy, J.E., Barry, J.P., Chan, F., English, C.A., Galindo, H.M., Grebmeier, J.M., Hollowed, A.B., Knowlton, N., Polovina, J., Rabalais, N.N., Sydeman, W.J., Talley, L.D., 2012. Climate change impacts on marine ecosystems. Annu. Rev. Mar. Sci. 4, 11–37. Diani-Moore, S., Ram, P., Li, X., Mondal, P., Youn, D.Y., Sauve, A.A., Rifkind, A.B., 2010. Identification of the aryl hydrocarbon receptor target gene TiPARP as a mediator of suppression of hepatic gluconeogenesis by 2,3,7,8-tetrachlorodibenzo-p-dioxin and of nicotinamide as a corrective agent for this effect. J. Biol. Chem. 285, 38801–38810. Fang, X., Dong, W., Thornton, C., Willett, K.L., 2010. Benzo[a]pyrene effects on glycine N-methyltransferase mRNA expression and enzyme activity in Fundulus heteroclitus embryos. Aquat. Toxicol. 98, 130–138. Gardiner, W.W., Word, J.Q., Word, J.D., Perkins, R.A., McFarlin, K.M., Hester, B.W., Word, L.S., Ray, C.M., 2013. The acute toxicity of chemically and physically dispersed crude oil to key Arctic species under Arctic conditions during the open water season. Environ. Toxicol. Chem. 32, 2284–2300. Greenberg, C.S., Birckbichler, P.J., Rice, R.H., 1991. Transglutaminases: multifunctional cross-linking enzymes that stabilize tissues. FASEB J. 5, 3071–3077.

17

Hahn, M.E., Allan, L.L., Sherr, D.H., 2009. Regulation of constitutive and inducible AHR signaling: complex interactions involving the AHR repressor. Biochem. Pharmacol. 77, 485–497. Hicken, C.E., Linbo, T.L., Baldwin, D.H., Willis, M.L., Myers, M.S., Holland, L., Larsen, M., Stekoll, M.S., Rice, S.D., Collier, T.K., Scholz, N.L., Incardona, J.P., 2011. Sublethal exposure to crude oil during embryonic development alters cardiac morphology and reduces aerobic capacity in adult fish. Proc. Natl. Acad. Sci. U.S.A 108, 7086–7090. Hollenstein, K., Dawson, R.J.P., Locher, K.P., 2007. Structure and mechanism of ABC transporter proteins. Curr. Opin. Struct. Biol. 17, 412–418. Hur, D., Jeon, J.K., Hong, S., 2013. Analysis of immune gene expression modulated by benzo[a]pyrene in head kidney of olive flounder (Paralichthys olivaceus). Comp. Biochem. Physiol. B Biochem. Mol. Biol. 165, 49–57. Incardona, J.P., Gardner, L.D., Linbo, T.L., Brown, T.L., Esbaugh, A.J., Mager, E.M., Stieglitz, J.D., French, B.L., Labenia, J.S., Laetz, C.A., Tagal, M., Sloan, C.A., Elizur, A., Benetti, D.D., Grosell, M., Block, B.A., Scholz, N.L., 2014. Deepwater Horizon crude oil impacts the developing hearts of large predatory pelagic fish. Proc. Natl. Acad. Sci. U.S.A 111, E1510–1518. Inoue, J., Yamasaki, K., Ikeuchi, E., Satoh, S., Fujiwara, Y., Nishimaki-Mogami, T., Shimizu, M., Sato, R., 2011. Identification of MIG12 as a mediator for stimulation of lipogenesis by LXR activation. Mol. Endocrinol. 25, 995–1005. James, M.O., 1987. Conjugation of organic pollutants in aquatic species. Environ. Health Perspect. 71, 97–103. Johnsen, H., Andersen, Ø., 2012. Sex dimorphic expression of five dmrt genes identified in the Atlantic cod genome. The fish-specific dmrt2b diverged from dmrt2a before the fish whole-genome duplication. Gene 505, 221–232. Jonsson, H., Sundt, R.C., Aas, E., Sanni, S., 2010. The Arctic is no longer put on ice: evaluation of Polar cod (Boreogadus saida) as a monitoring species of oil pollution in cold waters. Mar. Pollut. Bull. 60, 390–395. Kammann, U., Lang, T., Berkau, A.J., Klempt, M., 2008. Biological effect monitoring in dab (Limanda limanda) using gene transcript of CYP1A1 or EROD-a comparison. Environ. Sci. Pollut. Res. Int. 15, 600–605. Koenig, S., Porte, C., Sole, M., Sturve, J., 2013. Biliary PAH and alkylphenol metabolites, biomarker enzyme activities, and gene expression levels in the deep-sea fish Alepocephalus rostratus. Environ. Sci. Technol. 47, 2854–2861. Katoh, Y., Katoh, M., 2005. Comparative genomics on FGF7, FGF10, FGF22 orthologs, and identification of fgf25. Int. J. Mol. Med. 16, 767–770. Koskinen, H., Pehkonen, P., Vehniäinen, E., Krasnov, A., Rexroad, C., Afanasyev, S., Mölsä, H., Oikari, A., 2004. Response of rainbow trout transcriptome to model chemical contaminants. Biochem. Biophys. Res. Commun. 320, 745–753. Krasnov, A., Timmerhaus, G., Afanasyev, S., Jørgensen, S.M., 2011. Development and assessment of oligonucleotide microarrays for Atlantic salmon (Salmo salar L.). Comp. Biochem. Physiol. D 6, 31–38. Krasnov, A., Kileng, Ø., Skugor, S., Jørgensen, S.M., Afanasyev, S., Timmerhaus, G., Sommer, A.I., Jensen, I., 2013. Genomic analysis of the host response nervous necrosis virus in Atlantic cod (Gadus morhua) brain. Mol. Immunol. 54, 443–452. Kriventseva, E.V., Tegenfeldt, F., Petty, T.J., Waterhouse, R.M., Simao, F.A., Pozdnyakov, I.A., Ioannidis, P., Zdobnov, E.M., 2015. OrthoDB v8: update of the hierarchical catalog of orthologs and the underlying free software. Nucleic Acids Res. 43, D250–D256 (Database issue). Lafleur, M.A., Stevens, J.L., Lawrence, J.W., 2013. Xenobiotic perturbation of ER stress and the unfolded protein response. Toxicol. Pathol. 41, 235–262. Leppä, S., Bohmann, D., 1999. Diverse functions of JNK signaling and c-Jun in stress response and apoptosis. Oncogene 18, 6158–6162. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-Delta Delta C) method. Methods 25, 402–408. Lyons, M.C., Wong, D.K., Mulder, I., Lee, K., Burridge, L.E., 2011. The influence of water temperature on induced liver EROD activity in Atlantic cod (Gadus morhua) exposed to crude oil and oil dispersants. Ecotoxicol. Environ. Saf. 74, 904–910. McKinnon, R.A., Sorich, M.J., Ward, M.B., 2008. Cytochrome P450 Part 1: multiplicity and function. J. Pharm. Pract. Res. 38, 55–57. Meixner, A., Karreth, F., Kenner, L., Penninger, J.M., Wagner, E.F., 2010. Jun and JunD-dependent functions in cell proliferation and stress response. Cell Death Differ. 17, 1409–1419. Milinkovitch, T., Imbert, N., Sanchez, W., Le Floch, S., Thomas-Guyon, H., 2013. Toxicological effects of crude oil and oil dispersant: biomarkers in the heart of the juvenile golden grey mullet (Liza aurata). Ecotoxicol. Environ. Saf. 88, 1–8. Mimura, J., Ema, M., Sogawa, K., Fujii-Kuriyama, Y., 1999. Identification of a novel mechanism of regulation of Ah (dioxin) receptor function. Genes Dev. 13, 20–25. Nahrgang, J., Camus, L., Carls, M.G., Gonzalez, P., Jönsson, M., Taban, I.C., Bechmann, R.K., Christiansen, J.S., Hop, H., 2010a. Biomarker responses in polar cod (Boreogadus saida) exposed to the water soluble fraction of crude oil. Aquat. Toxicol. 97, 234–242. Nahrgang, J., Camus, L., Gonzalez, P., Jonsson, M., Christiansen, J.S., Hop, H., 2010b. Biomarker responses in polar cod (Boreogadus saida) exposed to dietary crude oil. Aquat. Toxicol. 96, 77–83. Nahrgang, J., Camus, L., Broms, F., Christiansen, J.S., Hop, H., 2010c. Seasonal baseline levels of physiological and biochemical parameters in polar cod (Boreogadus saida): implications for environmental monitoring. Mar. Pollut. Bull. 60, 1336–1345.

18

Ø. Andersen et al. / Aquatic Toxicology 165 (2015) 9–18

Nahrgang, J., Camus, L., Gonzalez, P., Goksøyr, A., Christiansen, J.S., Hop, H., 2009. PAH biomarker responses in polar cod (Boreogadus saida) exposed to benzo(a) pyrene. Aquat. Toxicol. 94, 309–319. Nahrgang, J., Varpe, O., Korshunova, E., Murzina, S., Hallanger, I.G., Vieweg, I., Berge, J., 2014. Gender specific reproductive strategies of an arctic key species (Boreogadus saida) and implications of climate change. PLoS One 9, e98452. Nakayama, T., Hara, A., Yashiro, K., Sawada, H., 1985. Reductases for carbonyl compounds in human liver. Biochem. Pharmacol. 34, 107–117. Nelson, D.R., 1998. Metazoan cytochrome P450 evolution. Comp. Biochem. Physiol. C 121, 15–22. Osorio-Yanez, C., Garcia-Tavera, J.L., Perez-Nunez, M.T., Poblete-Naredo, I., Munoz, B., Barron-Vivanco, B.S., Rothenberg, S.J., Zapata-Perez, O., Albores, A., 2012. Benzo(a) pyrene induces hepatic AKR1A1 mRNA expression in tilapia fish (Oreochromis niloticus). Toxicol. Mech. Methods 22 (6), 438–444. Padmini, E., 2010. Physiological adaptations of stressed fish to polluted environments: role of heat shock proteins. Rev. Environ. Contam. Toxicol. 206, 1–27. Pritchard, J.B., Bend, J.R., 1984. Mechanism controlling the renal excretion of xenobiotics in fish: effects of chemical structure. Drug Metab. Rev. 15, 655–671. Pörtner, H.O., 2010. Oxygen- and capacity-limitation of thermal tolerance: a matrix for integrating climate-related stressor effects in marine ecosystems. J. Exp. Biol. 213, 881–893. Reynaud, S., Deschaux, P., 2006. The effects of polycyclic aromatic hydrocarbons on the immune system of fish: a review. Aquat. Toxicol. 77, 229–238. Reichert, W.L., Myers, M.S., Peck-Miller, K., French, B., Anulacion, B.F., Collier, T.K., Stein, J.E., Varanasi, U., 1998. Molecular epizootiology of genotoxic events in marine fish: linking contaminant exposure, DNA damage, and tissue-level alterations. Mutat. Res. 411, 215–225. Roberts, R.J., Agius, C., Saliba, C., Bossier, P., Sung, Y.Y., 2010. Heat shock proteins (chaperones) in fish and shellfish and their potential role in relation to fish health: a review. J. Fish Dis. 33, 789–801. Sleiderink, H.M., Oostingh, I., Goksøyr, A., Boon, J.P., 1995. Sensitivity of cytochrome P450 1A induction in dab (Limanda limanda) of different age and

sex as a biomarker for environmental contaminants in the southern North Sea. Arch. Environ. Contam. Toxicol. 28, 423–430. Stange, K., Klungsøyr, J., 1997. Organochlorine contaminants in fish and polycyclic aromatic hydrocarbons in sediments from the Barents Sea. ICES J. Mar. Sci. 54, 318–332. Sturve, J., Hasselberg, L., Fälth, H., Celander, M., Förlin, L., 2006. Effects of North Sea oil and alkylphenols on biomarker responses in juvenile Atlantic cod (Gadus morhua). Aquat. Toxicol. 78 (Suppl. 1), S73–S78. Sun, Z., Yu, X., Wu, W., Jia, D., Chen, Y., Ji, L., Liu, X., Peng, X., Li, Y., Yang, L., Ruan, Y., Gu, J., Ren, S., Zhang, S., 2012. Fibroblast growth factor 7 inhibits cholesterol 7␣-hydroxylase gene expression in hepatocytes. Biochem. Biophys. Res. Commun. 423, 775–780. van der Oost, R., Beyer, J., Vermeulen, N.P.E., 2003. Fish accumulation and biomarkers in environmental risk assessment: a review. Environ. Toxicol. Pharmacol. 13, 57–149. Vidal-Puig, A.J., Grujic, D., Zhang, C.Y., Hagen, T., Boss, O., Ido, Y., Szczepanik, A., Wade, J., Mootha, V., Cortright, R., Muoio, D.M., Lowell, B.B., 2000. Energy metabolism in uncoupling protein 3 gene knockout mice. J. Biol. Chem. 275, 16258–16266. Vogelbein, W.K., 2003. Polycyclic aromatic hydrocarbons and liver carcinogenesis in fish. In: Newman, M.C., Unger, M.A. (Eds.), Fundamentals of Ecotoxicology. 7.2CRC Press LLC, Florida, Vignette, pp. 143–145. Wang, W., Seward, D.J., Li, L., Boyer, J.L., Ballatori, N., 2001. Expression cloning of two genes that together mediate organic solute and steroid transport in the liver of a marine vertebrate. Proc. Natl. Acad. Sci. U.S.A 98, 9431–9436. Welch, H.E., Bergmann, M.A., Siferd, T.D., Martin, K.A., Curtis, M.F., Crawford, R.E., Conover, R.J., Hop, H., 1992. Energy-flow through the marine ecosystem of the lancaster sound region. Arct. Can. 45, 343–357. Whiteley, N.M., Christiansen, J.S., Egginton, S., 2006. Polar cod, Boreogadus saida (Gadidae), show an intermediate stress response between Antarctic and temperate fishes. Comp. Biochem. Physiol. A: Mol. Integr. Physiol. 145, 493–501.