- Email: [email protected]
Effects of cyclophilin A on cell proliferation and gene expressions in human vascular smooth muscle cells and endothelial cells1
Journal of Surgical Research 123, 312–319 (2005) doi:10.1016/j.jss.2004.08.026
Effects of Cyclophilin A on Cell Proliferation and Gene Expressions in Human Vascular Smooth Muscle Cells and Endothelial Cells 1 Hui Yang, M.D., Ph.D., Min Li, Ph.D., Hong Chai, M.D., Ph.D., Shaoyu Yan, Ph.D., Peter Lin, M.D., Alan B. Lumsden, M.D., Qizhi Yao, M.D., Ph.D., and Changyi Chen, M.D., Ph.D.2 Molecular Surgeon Research Center, Division of Vascular Surgery and Endovascular Therapy, Michael E. DeBakey Department of Surgery, Baylor College of Medicine and the Methodist Hospital, Houston, Texas Submitted for publication July 6, 2004
Background. Cyclophilin A (CypA) is a cytosolic protein which involves many biological functions including immune modulation, cell growth, tumorigenesis, and vascular disease. The objective of this study was to determine the effect of CypA on cell proliferation and several gene expressions in human endothelial cells and vascular smooth muscle cells. Methods. Human coronary artery endothelial cells (HCAEC), human lung microvascular endothelial cells (HMVEC-L), and human aorta smooth muscle cells (HAoSMC) were used in this study. Cells were treated with 10 nM CypA for 24 h. The cell proliferation was determined by [ 3H]thymidine incorporation. The mRNA levels of 13 genes including CD147 (receptor for CypA), PDGF-BB, endothelin-1 (ET-1), vascular endothelial growth factor receptor-1 (VEGFR-1), VEGFR-2, VEGFR-3, neuropilin-1 (NRP-1), NRP-2, eNOS, iNOS, nNOS, ICAM-1, and PECAM-1 were semiquantitatively determined by real time RT-PCR as standardized with a house keeping gene -actin. Results. CypA significantly increased cell proliferation of HAoSMC and HMVEC-L by 31% and 45%, respectively, as compared to controls, but had no effect on HCAEC. Blocking CD147 did not affect the mitogenic action of CypA. In addition, CypA also significantly increased the mRNA expression of CD147 by 43% and VEGFR-2 by 65% in HAoSMCs (P < 0.05, t test). HAoSMCs expressed much higher CD147 and neuropilin-1 (NRP-1) mRNA than HMVECs-L and HCAECs (P 1 This work is partially supported by research grants from the National Institutes of Health (Lin: K08 HL076345; Lumsden: R01 HL75824; Yao: AI 49116 and DE15543; and Chen: HL61943, HL60135, HL65916, HL72716, and EB-002436). 2 To whom correspondence and reprint requests should be addressed at Department of Surgery, Baylor College of Medicine, One Baylor Plaza, NAB-2010, Houston, TX 77030. E-mail: [email protected].
0022-4804/05 $30.00 © 2004 Elsevier Inc. All rights reserved.
< 0.017, ANOVA). Furthermore, CypA increased ET-1 mRNA by 22% and VEGFR-1 mRNA by 23% in HMVECs-L, but had limited effects on HCAECs. HMVECs-L had much higher expressions of PDGF-BB, ET-1, VEGFR-2, VEGFR-1, VEGFR-3, and NRP-2 than HAoSMCs and HCAECs (P < 0.017, ANOVA). By contrast, HCAECs had much higher ICAM-1 mRNA levels than HMVECs-L and HAoSMCs (P < 0.017, ANOVA). Conclusions. These data demonstrate that CypA has a mitogenic effect on HAoSMCs and HMVECs-L, but not HCAECs. CD147 may not mediate the action of CypA. In addition, CypA substantially alters the mRNA levels of several key genes in human vascular cells, indicating potential multifunctional roles of CypA in vascular system. Furthermore, this study provides several new aspects of gene expressions in vascular cells. © 2004 Elsevier Inc. All rights reserved. Key Words: cyclophilin A; cell proliferation; gene expression; vascular smooth muscle cell; endothelial cell; CD147; neuropilin-1. INTRODUCTION
Cyclophilin A (CypA) is a ubiquitously distributed intracellular protein belonging to the immunophilin family [1] and is defined on the basis of its binding to the immunosuppressive drug cyclosporine A [2, 3]. Intracellular CypA has peptidylprolyl cis-trans-isomerase (PPIase) activity, which is crucial for folding and isomerization of many proteins [1, 4, 5] and plays a role in the susceptibility to oxidative stress and apoptosis [6, 7]. Recently, it has been found that CypA can be secreted by cells in response to inflammatory stimuli [8, 9] though CypA is initially believed to express solely as an intracellular molecule. There seemed to be a relationship in vivo among inflammation, reactive oxygen species (ROS) and CypA release, as shown by the
312
YANG ET AL.: EFFECTS OF CYCLOPHILIN A ON HUMAN VASCULAR CELLS
high CypA levels in serum from patients with human immunodeficiency virus type-1, rheumatoid arthritis and sepsis [10 –12]. Secreted/extracellular CypA initiated signaling response in diverse target cells. CypA was demonstrated as a potent chemoattractant for neutrophil, eosinophil and T cells in vitro and in vivo [8, 9, 13]. Human recombinant CypA could bind to peroxiredoxin VI and enhance its antioxidant activity [14]. CD147 was recently identified as an essential component of the cell-surface signaling receptor to CypA [15]. Some vascular diseases such as atherosclerosis begin as an inflammatory process and ROS have been implicated in the pathogenesis of atherosclerosis, hypertension, and restenosis. Taking into account the implication of CypA in the process of cell chemotaxis and oxidative stress, Jin et al. [13] first reported that CypA functioned as a secreted oxidative-stress-induced growth factor from rat vascular SMCs and mediated extracellular signal regulated kinase (ERK 1/2) activation and vascular SMCs growth. In addition, recombinant CypA was able to mimic the effects of secreted CypA on the vascular response. Little is known regarding the role of extracellular CypA in human vascular cell growth and gene expressions, which may be related to vascular disease. In the present study, we used in vitro cultures of human aorta smooth muscle cells (HAoSMCs), human lung microvascular endothelial cells (HMVECs-L), and human coronary endothelial cells (HCAECs) to examine the effect of recombinant CypA on cell proliferation and expressions of 13 crucial genes in these cells. Our data demonstrate that CypA has a mitogenic effect on human vascular SMCs and endothelial cells, and blockade of CD147 has limited effects on mitogenic action of CypA. Furthermore, CypA alters several gene expressions of human vascular SMCs and endothelial cells, which may indicate its potential multifunctional role in vascular biology. In addition, comparison of gene expressions in these cell types provides additional information to the understanding of molecular mechanisms related to vascular functions. MATERIALS AND METHODS Chemicals and Reagents SmGM-2 Bulletkit and EGM-2 Bulletkit were purchased from Clonetics (Walkersville, MD). Recombinant human CypA and Trizol reagent were obtained from Sigma (St. Louis, MO). Mouse antihuman CD147 blocking antibody was obtained from Ancell (Bayport, MN) and mouse IgG1 isotype control was purchased from R&D systems (Minneapolis, MN). The iQ SYBR Green supermix was obtained from Bio-Rad (Hercules, CA). [ 3H]thymidine was purchased from Amersham Biosciences (Piscataway, NJ).
Cell Culture HAoSMCs, HMVECs-L and HCAECs were purchased from Clonetics. HAoSMCs were grown in SmGM-2 Bulletkit (SMC basic
313
medium, insulin, EGF, bFGF, and GA-1000) supplemented with 10% FBS. HMVECs-L and HCAECs were cultured in EGM-2 Bulletkit (EC basic medium, hydrocortisone, bFGF, VEGF, long R3-IGF-1, ascorbic acid, EGF, GA-1000, and heparin) supplemented with 10% fetal bovine serum (FBS, Invitrogen Corporation, Grand Island, NJ). HAoSMCs, HMVECs-L, and HCAECs were used at passage 4 to 5 in all experiments. When cell growth reached ⬃70% confluence, HAoSMCs were serum-starved in 0.1% FBS in SMC basic medium supplemented with only GA-1000 for 24 h before testing, and HMVECs-L and HCAECs were serum-starved in 1% FBS in EC basic medium supplemented with only hydrocortisone, ascorbic acid, heparin and GA-1000 for 24 h before testing.
Real-Time PCR Serum-starved cells were treated with CypA or PBS as control for 24 h. Total cellular RNA was isolated by Trizol reagent extraction. The genomic DNA contamination in RNA preparation was removed by using DNA-free kit (Ambion Inc., Austin, TX), which was confirmed by the lack of detectable genomic DNA in PCR reaction with cDNA sample yielded in reverse transcriptase (RTase)-omitted reaction (no RT control). Total RNA (0.5 g) was reverse transcribed into cDNA using iScipt cDNA synthesis kit (Bio-Rad) following the manufacturer’s instruction. Primers for all tested genes were designed via the Beacon Designer 2.1 software (Bio-Rad) and the primer sequences were listed in Table 1. The quality of individual pair of primers was confirmed by running conventional PCR before realtime PCR to make sure there were no detectable primer dimer and non-specific products yielded. The real-time PCR reaction system included the following: 250 nM primers, 50 ng cDNA, and iQ SYBR Green supermix (0.2 mM of each dNTP, 25 units/ml iTaq DNA polymerase, SYBR Green I, 10 nM fluorescein, 3 mM MgCl 2, 50 mM KCl, and 20 mM Tris-HCl). Using the iCycler iQ Real-time PCR detection system (Bio-Rad), PCR cycling conditions were set as follows: 95°C for 90 s, 40 cycles at 95°C for 20 s, and 60°C for 1 min, then melting curve analysis was performed on the iCycler over the range 55 to 95°C by monitoring iQ SYBR green fluorescence with increasing temperature (0.5°C increment changes at 10 s intervals). Specific products were determined as clear single peaks at their melting curves. All sample measurements were performed in triplicate. Sample cycle threshold (Ct) values were determined from plots of relative fluorescence units (RFU) versus PCR cycle number during exponential amplification so that sample measurement comparisons were possible. Standard curves for all primer amplifications were generated by plotting average Ct values against the logarithm starting quantity of target template molecules (series dilution of cDNA template: 50, 10, 2, 0.4, and 0.08 ng), followed by a sum of least squares regression analysis. The correlation coefficient and PCR efficiency of all primers were above 90%, respectively. The gene expression in each sample was calculated as 2^(40-Ct) and further normalized to -actin expression [ ⫽ 2^(Ct (-actin) ⫺ Ct (gene))], and iCycler software (Bio-Rad) was used to extract and quantify the PCR data which were then exported to Excel software (Microsoft, Redmond, WA) for statistical analysis.
[ 3H]thymidine Incorporation Cells (5000 cells/well) were seeded and grown in 96-well plates for 24 h. They were serum-starved for another 24 h. To investigate whether the effect of CypA is mediated by CD147, cells were incubated in anti-CD147 blocking antibody (5 g/ml) for 1 h before addition of CypA or PBS. Normal mouse IgG1 (5 g/ml) was used as isotype control. Cells were then treated with CypA (0.01, 0.1, 1, and 10 nM) or PBS for 24 h and labeled with [ 3H]thymidine at 1 Ci/ml during the last 4 h of CypA treatment. [ 3H]thymidine incorporation was measured in scintillation solution using microplate scintillation & luminescence counter (Packard Biosciences, San Diego, CA).
314
JOURNAL OF SURGICAL RESEARCH: VOL. 123, NO. 2, FEBRUARY 2005
TABLE 1 Primers Sequence for Real-Time PCR* Gene
Gene bank No.
Forward primer
Reverse primer
CD147 PDGF-BB ET-1 VEGFR-1 VEGFR-2 VEGFR-3 NRP-1 NRP-2 eNOS iNOS nNOS ICAM-1 PECAM-1
AB085790 X02811 BC009720 NM_002019 AF063658 NM_002020 BT006995 NM_018534 NM_000603 AF049656 NM_000620 X06990 NM_000442
CCATGCTGGTCTGCAAGTCAG ACTCGATCCGCTCCTTTGATGA CTCCAGAGAGCGTTATGTGACC TCTCACACATCGACAAACCAATACA GCAGGGGACAGAGGGACTTG GACAGCTACAAGTACGAGCATCTG AAGGTTTCTCAGCAAACTACAGTG GATTCGGGATGGGGACAGTGA AGGAACCTGTGTGACCCTCA TGGAGAAAACCCCAGGTGCTA TGTTCGGTGTTCAGCAAATCCA CCCCATGAAACCGAACACACAA CCGGATCTATGACTCAGGGACAT
CCGTTCATGAGGGCCTTGTC GCTCGCCTCCAGAGTGGG TCCGTGGAGGCTATGGCTTC GGTAGCAGTACAATTGAGGACAAGA GAGGCCATCGCTGCACTCA CGTTCTTGCAGTCGAGCAGAA GGGAAGAAGCTGTGATCTGGTC GGTGAACTTGATGTAGAGCATGGA CGAGGTGGTCCGGGTATCC GGAAACCATTTTGATGCTTGTGAC AGATGATCACGGGCGGCTT TGTAGCTGCATGGCATATGTCTTC GGATGGCCTCTTTCTTGTCCAG
* Primers for all tested genes were designed via the Beacon Designer 2.1 software (Bio-Rad Inc., Hercules, CA).
Statistical Analysis Statistic analysis was performed on the Data Analysis tool of Microsoft Excel program (Microsoft Office 2000, Microsoft Inc., Seattle, WA). Data were expressed as mean ⫾ SD. Significant difference of cell proliferation and gene expression between control and CypA-treated groups was determined by paired Student’s t test (twotail). A P value ⬍0.05 was considered statistically significant for t test. Comparison of CD147, NRP-1, and ICAM-1 mRNA levels among three different types of cells after treatment of CypA was analyzed with single factor Analysis of Variance (ANOVA) test. A P value ⬍0.017 (Bonferroni) was considered statistically significant for ANOVA test.
RESULTS Effects of CypA on Cell Proliferation in Human Vascular SMCs and Endothelial Cells
To investigate the potential growth promoting effect of CypA on vascular cells, we treated HAoSMCs, HMVECs-L, and HCAECs with PBS or a series of doses of CypA (0.01, 0.1, 1, and 10 nM). [ 3H]thymidine incorporation was performed as index of cell proliferation. CypA significantly increased [ 3H]thymidine incorporation in both HAoSMCs and HMVECs-L in a dose dependent manner, but had no effects on HCAECs (Fig. 1). Specifically, CypA at 10 nM significantly increased [ 3H]thymidine incorporation by 31% in HAoSMCs and 45% in HMVECs-L, respectively (P ⬍ 0.05, Student’s t test) (Fig. 1). Since CD147 was recently identified as an essential component of the cellsurface signaling receptor to CypA [15], we determined whether anti-CD147 antibody could block CypAinduced cell proliferation in both HAoSMCs and HMVECs-L. The cells were incubated with anti-CD147 blocking antibody (5 g/ml) for 1 h before addition of CypA or PBS. Mouse IgG1 was used as an isotype control. Anti-CD147 blocking antibody failed to elicit a notable alteration of CypA-induced cell proliferation in HAoSMCs and HMVECs-L, respectively, as compared
to CypA treated groups (Fig. 2). These results demonstrated that CypA acts as a mitogen for HAoSMCs and HMVECs-L and CD147 may not mediate this action of CypA. Effects of CypA on Gene Expressions in HAoSMCs
Little is known regarding the role of secreted CypA in human vascular diseases. To help address the putative function of secreted CypA on human vascular cells, quantitative real-time PCR was used to screen the mRNA levels of 13 key genes including a potential CypA receptor (CD147), two growth factors (PDGF-BB and ET-1), three VEGFRs (VEGFR-1, VEGFR-2 and VEGFR-3), two neuropilins (NRP-1 and NRP-2), three nitric oxide synthases (eNOS, iNOS and nNOS), and
FIG. 1. Effects of CypA on cell proliferation in human vascular SMCs and endothelial cells. Serum-starved HAoSMCs, HMVECs-L, and HCAECs were treated with the indicated concentrations of CypA or PBS for 24 h, respectively, and labeled with [ 3H]thymidine at 1 Ci/ml during the last 4 h of CypA or PBS treatment. [ 3H]thymidine incorporation was measured in scintillation solution. CypA significantly increased proliferation of HAoSMCs and HMVECs-L, but not HCAECs. *P ⬍ 0.05 compared with PBS treatment group (Student’s t test).
YANG ET AL.: EFFECTS OF CYCLOPHILIN A ON HUMAN VASCULAR CELLS
315
Effects of CypA on Gene Expressions in HCAECs
FIG. 2. Effect of anti-CD147 antibody on CypA-induced proliferation of HAoSMCs and HMVECs-L. Serum-starved HAoSMCs and HMVECs-L were incubated with anti-CD147 blocking antibody (5 g/ml) for 1 h before addition of CypA or PBS, respectively. Normal mouse IgG1 (5 g/ml) was used as a control. HAoSMCs and HMVECs-L were then treated with CypA (10 nM) or PBS for 24 h and labeled with [ 3H]thymidine at 1 Ci/ml during the last 4 h of CypA or PBS treatment. [ 3H]thymidine incorporation was measured in scintillation solution. Anti-CD147 antibody could not block CypAinduced cell proliferation in these cells. *P ⬍ 0.05 compared with PBS treatment group (Student’s t test).
two adhesion molecules (ICAM-1 and PECAM-1) (Table 2). These molecules selected were based on their potential roles in vascular cells. HAoSMCs showed relatively high expressions of CD147, NRP-1, NRP-2, and ET-1 (Table 2, Fig. 3A) and relatively low expressions of ICAM-1, PECAM-1, VEGFR-2, VEGFR-1, and PDGF-BB (Table 2, Fig. 3B). There were no detectable expressions of eNOS, iNOS, nNOS, and VEGFR-3 (Table 2, Fig. 3). In addition, HAoSMCs had 116% and 200% higher CD147 mRNA levels than HMVECs-L and HCAECs, respectively (P ⬍ 0.017, ANOVA test). It also expressed 27% and 28% higher NRP-1 mRNA than HMVECs-L and HCAECs, respectively (P ⬍ 0.017, ANOVA test). Furthermore, CypA (10 nM) treatment significantly increased mRNA expression of CD147 by 43% and VEGFR-2 by 65% (P ⬍ 0.05, Student’s t test), but decreased expression of VEGFR-1 by 22% and ICAM-1 by 18% (Table 2, Fig. 3). Effects of CypA on Gene Expressions in HMVECs-L
Without CypA treatment, HMVECs-L had relatively high mRNA levels of PECAM-1, ET-1, PDGF-BB, CD147, VEGFR-2, NRP-1, NRP-2, and ICAM-1 (Table 2, Fig. 4A), but expressed relatively low levels of VEGFR-3, eNOS, and VEGFR-1 (Table 2, Fig. 4B). In addition, HMVECs-L had much higher expressions of PDGF-BB, ET-1, VEGFR-2, VEGFR-1, VEGFR-3, and NRP-2 than HAoSMCs and HCAECs (Table 2). Furthermore, in response to CypA treatment (10 nM), HMVECs-L showed increases of ET-1 mRNA by 22% and VEGFR-1 mRNA by 23%, and slight decrease of VEGFR-3 mRNA by 13% (Fig. 4). iNOS and nNOS were not detected in HMVECs-L (Fig. 4B).
Similar to HMVECs-L, HCAECs had relatively high mRNA expressions of PECAM-1, ET-1, NRP-1, PDGFBB, CD147, ICAM-1, NRP-2, and VEGFR-2, but relatively low mRNA expressions of eNOS, VEGFR-1, and VEGFR-3 (Table 2, Fig. 5). There were no detectable mRNA expressions of iNOS and nNOS (Table 2, Fig. 5B). Most notably, HCAECs had three-fold and 68-fold higher ICAM-1 mRNA levels than HMVECs-L and HAoSMCs, respectively (Table 2, P ⬍ 0.017, ANOVA test). CypA had limited effects on gene expressions in HCAECs as compared to HMVECs-L and HAoSMCs. DISCUSSION
This is the first study to determine the effect of CypA on cell proliferation and gene expressions in human vascular cells. CypA significantly increases proliferation of HAoSMCs and HMVECs-L, but not HCAECs. This mitogenic effect of CypA may be correlated with response of gene expressions in these cells. CypA substantially increased mRNA expressions of CD147 and VEGFR-2 in HAoSMCs, and ET-1 and VEGFR-1 in HMVECs-L. CypA had limited effects on gene expressions in HCAECs. In addition, gene expression patterns in these cells present several new discoveries such as NRPs in HAoSMCs and difference between HMVECs-L and HCAECs. Smooth muscle cell proliferation is one of important mechanisms of vascular lesion formation including atherosclerosis and restenosis. In atherosgenesis, chronic inflammatory response results in vascular injury of the arterial wall leading to endothelial dysfunction, macrophage migration and activation, and SMC phenotype switch. SMC becomes proliferative, migratory, and produces extracellular matrix proteins [16]. These inflammatory and fibroproliferative processes in the vascular wall also result in the restenosis following arterial reconstructive procedures because of intimal accumulation of SMCs [17]. SMC proliferation is regulated by many factors including growth factors, cytokines, adhesion molecules, hemodynamic conditions, and gene expression status. Recently, many other molecules such as CypA are found to regulate SMC proliferation. One report showed that CypA secretion from rat SMCs was increased by oxidative stress, and secreted CypA could, in turn, stimulate SMC proliferation and activation of ERK 1/2 pathways [13]. It is a great beginning to study potential roles of CypA in vascular disease although many questions have not been addressed yet. It is unknown whether it affects human SMC proliferation and gene expressions. In consistent with the findings in rat SMCs [13], our study demonstrates that human recombinant CypA significantly increases HAoSMC proliferation in a dose
316
JOURNAL OF SURGICAL RESEARCH: VOL. 123, NO. 2, FEBRUARY 2005
TABLE 2 Comparison of Gene Expressions in Three Types of Cells* HAoSMC
CD147 PDGF-BB ET-1 VEGFR-1 VEGFR-2 VEGFR-3 NRP-1 NRP-2 eNOS iNOS nNOS ICAM-1 PECAM-1
HMVEC-L
HCAEC
Control
CypA (10 nM)
Control
CypA (10 nM)
Control
CypA (10 nM)
0.081000 0.000028 0.003300 0.000046 0.000051 0.000000 0.048000 0.009600 0.000000 0.000000 0.000000 0.000330 0.000069
0.116000 0.000032 0.003700 0.000036 0.000084 0.000000 0.049000 0.011000 0.000000 0.000000 0.000000 0.000270 0.000078
0.037300 0.036450 0.064760 0.000759 0.035950 0.009200 0.037350 0.020001 0.003596 0.000000 0.000000 0.005440 0.114210
0.034000 0.036450 0.079150 0.000934 0.038470 0.008030 0.041980 0.022850 0.003381 0.000000 0.000000 0.005830 0.122210
0.027000 0.026600 0.037014 0.000376 0.010000 0.000341 0.037000 0.018500 0.001137 0.000000 0.000000 0.022800 0.107200
0.029400 0.031400 0.038600 0.000304 0.009190 0.000288 0.036500 0.015400 0.001280 0.000000 0.000000 0.023700 0.120200
* The mRNA level of each gene in each sample was normalized to that of -actin. Relative mRNA level was presented as 2^[Ct ( Ct (gene)].
dependent manner. This finding is particular important in understanding new factors in human vascular disease. The molecular mechanisms of CypA-induced SMC proliferation and other cell functions are poorly understood. A recent study in white blood cells indicates that CypA may interact with its receptor on the cell surface [18]. Indeed, CD147, a type-I transmembrane protein is essential for these cyclophilin-mediated signaling events [18, 19]. CypA binds to CD147 and transmits a signal to trigger chemotaxis of human neutrophils [18]. In addition, CypB also shares a common receptor CD147 with CypA [19]. Anti-CD147 antibody is able to block CypB-induced T-cell adhesion [18]. Unlike clas-
actin)
⫺
sical ligand-receptor interactions, CypB did not cause down-regulation of CD147 after its binding [20]. To determine whether CD147 mediates CypA-induced vascular cell proliferation, anti-CD147 antibody was pre-incubated with cells before CypA was added to HAoSMCs for cell proliferation assay in our study. Our data showed that CD147 antibody could not block CypA-induced HAoSMC proliferation. Specific reasons for this result are not known. CypA could have other mechanisms to induce cell proliferation rather than CD147 signaling in HAoSMCs. This is a critical question and warranted for further investigation. The effect of extracellular CypA on gene expressions in human vascular SMCs has not been previ-
FIG. 3. Effect of CypA on gene expressions in HAoSMCs. Serum-starved HAoSMCs were treated with CypA (10 nM) or PBS for 24 h. Total RNA was extracted and then reverse transcribed to cDNA. Fifty ng of cDNA of each sample was used in real-time PCR analysis to detect each gene expression. The mRNA level of each gene in each sample was normalized to that of -actin. Relative mRNA level was presented as 2^[Ct ( actin) ⫺ Ct (gene)]. Data for genes with relatively high or low scale of mRNA levels were demonstrated in (A) or (B), respectively. Data are expressed as mean ⫾ SD of triplicate values from three separate experiments. *P ⬍ 0.05 compared with PBS treatment group (Student’s t test).
YANG ET AL.: EFFECTS OF CYCLOPHILIN A ON HUMAN VASCULAR CELLS
317
FIG. 4. Effect of CypA on gene expression profile in HMVECs-L. Serum-starved HMVECs-L were treated with CypA (10 nM) or PBS for 24 h. cDNA preparation and analysis of real-time PCR data were described in the legend of Fig. 3. Data for genes with relatively high or low scale of mRNA levels were demonstrated in (A) or (B), respectively. Data are expressed as mean ⫾ SD of triplicate values from three separate experiments.
ously reported. In this study, we investigated 13 gene expressions in HAoSMCs by real time PCR after CypA treatment. Very interestingly, CypA significantly increased mRNA expression of CD147 by 43% and VEGFR-2 by 65%, which may contribute to its mitogenic effect on HAoSMCs. In addition, HAoSMCs express higher mRNA levels of CD147 and NRP-1 than human endothelial cells. These two molecules have been very limitedly studied in vascular SMCs. In addition to the role of CD147 as a potential receptor for CypA, CD147 has been found to participate in the cell-surface orientation of monocarboxylic acid transporters to the plasma membrane. It is also likely to participate in HIV infection [21]. CD147 in tumor cells triggers the production or release of matrix metalloproteinases in the surrounding mesenchymal cells and tumor cells, thereby con-
tributing to tumor invasion [21]. NRP-1 is a transmembrane glycoprotein, which has been characterized as a receptor for both semaphorins for neuronal guidance and VEGF for angiogenesis [22]. Recently, NRP-1 has been found to express in several cancer cells and endothelial cells [23]. Only one study showed NRP-1 was expressed in vascular SMCs in human breast cancer tissues [24]. Potential functions of CD147 and NRP-1 in vascular cells remain to be elucidated. Endothelial cells are active participants in the inflammatory response, vascular disease, wound healing, and tumor growth. They are involved in diverse activities including the regulation of leukocyte extravasation, angiogenesis, cytokine production, protease and extracellular matrix synthesis, vasodilation and blood vessel permeability, and antigen
FIG. 5. Effect of CypA on gene expressions in HCAECs. Serum-starved HCAECs were treated with CypA (10 nM) or PBS for 24 h. cDNA preparation and analysis of real-time PCR data were described in the legend of Fig. 3. Data for genes with relatively high or low scale of mRNA levels were demonstrated in (A) or (B), respectively. Data are expressed as mean ⫾ SD of triplicate values from three separate experiments.
318
JOURNAL OF SURGICAL RESEARCH: VOL. 123, NO. 2, FEBRUARY 2005
presentation [25]. Normal endothelial cells of the vessel wall are usually quiescent with minimal cell proliferation rates. Increased endothelial proliferation involves both physiological and pathologic responses. Specially, endothelial cell proliferation and activation are associated with several types of vascular diseases including coronary arteries and lungs. Recently, CypA has been found to have roles in regulation of vascular SMC functions [13], but it is not clear whether it also affects endothelial cell proliferation and gene expressions. In this study, we demonstrate, for the first time, that CypA significantly increases HMVECs-L proliferation, but not HCAECs. Effects of CypA on gene expressions are also different between these two types of endothelial cells. CypA treatment increased ET-1 mRNA by 22% and VEGFR-1 mRNA by 23%, while it slightly decreased VEGFR-3 mRNA by 13% in HMVECs-L. However, CypA had very limited effects on these gene changes in HACECs. These data may be correlated with CypA-induced cell proliferation. In addition, HMVECs-L had much higher expressions of PDGF-BB, ET-1, VEGFR-2, VEGFR-1, VEGFR-3, and NRP-2 than HCAECs, suggesting the mechanisms of functional differences between these two cell types. These data provide new evidence supporting endothelial heterogeneity. Endothelial cells are heterogeneous within species where they differ depending upon the location of the vessels and can vary in phenotype, function, and their response to growth factors [26]. A heterogeneous distribution of vascular adhesion molecule has also been observed in vascular endothelium from different regions of the human cardiovascular system, such as the aorta, pulmonary, coronary arteries and umbilical vein and artery [27]. In this study, HCAECs had three-fold higher ICAM-1 mRNA levels than HMVECs-L. Only recently, the importance of endothelial heterogeneity in vascular function and disease has been recognized. Active investigations in this field are just beginning and should have significant advances in the near future. In summary, proliferation and gene expressions of vascular smooth muscle cells and endothelial cells play important roles in both vascular biology and disease. This study demonstrates human recombinant CypA can significantly increase proliferation of HAoSMCs and HMVECs-L, but not HCAECs. This mitogenic effect is correlated with distinguished gene expression changes in these cell types. In addition, comparison of gene expression patterns among these cell types provides new insights to the understanding of cellular functions in vascular system. For example, relatively high expression of CD147 and NRP-1 in HAoSMCs and differences of gene expression levels between HMVECs-L and HCAECs may
have significance in biological functions for these cells, which are warranted for further investigation. REFERENCES 1. 2.
3.
4.
5.
Galat, A. Peptidylproline cis-trans-isomerases: Immunophilins. Eur. J. Biochem. 216: 689, 1993. Fruman, D. A., Burakoff, S. J., and Bierer, B. E. Immunophilins in protein folding and immunosuppression. FASEB. J. 8: 391, 1994. Liu, J. FK506 and cyclosporin, molecular probes for studying intracellular signal transduction. Immunol. Today. 14: 290, 1993. Bergsma, D. J., Eder, C., Gross, M., Kersten, H., Sylvester, D., Appelbaum, E., Cusimano, D., Livi, G. P., McLaughlin, M. M., and Kasyan, K. The cyclophilin multigene family of peptidylprolyl isomerases. Characterization of three separate human isoforms. J. Biol. Chem. 266: 23204, 1991. Kofron, J. L., Kuzmic, P., Kishore, V., Colon-Bonilla, E., and Rich, D. H. Determination of kinetic constants for peptidyl prolyl cis-trans isomerases by an improved spectrophotometric assay. Biochemistry 30: 6127, 1991.
6.
Crompton, M. Mitochondrial intermembrane junctional complexes and their role in cell death. J. Physiol. 529: 11, 2000.
7.
Hailstrap, A. P., Doran, E., Gillespie, J. P., and O’Toole A. Mitochondria and cell death. Biochem. Soc. Trans. 28: 170, 2000.
8.
Sherry, B., Yarlett, N., Strupp, A., and Cerami, A. Identification of cyclophilin as a proinflammatory secretory product of lipopolysaccharide-activated macrophages. Proc. Natl. Acad. Sci. USA 89: 3511, 1992.
9.
Xu, Q., Leiva, M. C., Fischkoff, S. A., Handschumacher, R. E., and Lyttle, C. R. Leukocyte chemotactic activity of cyclophilin. J. Biol. Chem. 267: 11968, 1992.
10.
Billich, A., Winkler, G., Aschauer, H., Rot, A., and Peichl, P. Presence of cyclophilin A in synovial fluids of patients with rheumatoid arthritis. J. Exp. Med. 185: 975, 1997.
11.
Tegeder, I., Schumacher, A., John, S., Geiger, H., Geisslinger, G., Bang, H., and Brune, K. Elevated serum cyclophilin levels in patients with severe sepsis. J. Clin. Immunol. 17: 380, 1997.
12.
Endrich, M. M., and Gehring, H. The V3 loop of human immunodeficiency virus type-1 envelope protein is a high-affinity ligand for immunophilins present in human blood. Eur. J. Biochem. 252: 441, 1998.
13.
Jin, Z. G., Melaragno, M. G., Liao, D. F., Yan, C., Haendeler, J., Suh, Y. A., Lambeth, J. D., and Berk, B. C. Cyclophilin A is a secreted growth factor induced by oxidative stress. Circ. Res. 87: 789, 2000.
14.
Lee, S. P., Hwang, Y. S., Kim, Y. J., Kwon, K. S., Kim, H. J., Kim, K., and Chae, H. Z. Cyclophilin a binds to peroxiredoxins and activates its peroxidase activity. J. Biol. Chem. 276: 29826, 2001.
15.
Yurchenko, V., Zybarth, G., O’Connor M., Dai, W. W., Franchin, G., Hao, T., Guo, H., Hung, H. C., Toole, B., Gallay, P., Sherry, B., and Bukrinsky, M. Active site residues of cyclophilin A are crucial for its signaling activity via CD147. J. Biol. Chem. 277: 22959, 2002.
16.
Ross, R. Atherosclerosis is an inflammatory disease. N. Engl. J. Med. 340: 115, 1999.
17.
Bailey, S. R. Coronary restenosis: A review of current insights and therapies. Catheter. Cardiovasc. Interv. 55: 265, 2002.
18.
Kitsukawa, T., Shimono, A., Kawakami, A., Kondoh, H., and Fujisawa, H. Overexpression of a membrane protein, neuropi-
YANG ET AL.: EFFECTS OF CYCLOPHILIN A ON HUMAN VASCULAR CELLS
19.
20.
21.
22.
lin, in chimeric mice causes anomalies in the cardiovascular system, nervous system and limbs. Development 121: 4309, 1995. Yamada, Y., Takakura, N., Yasue, H., Ogawa, H., Fujisawa, H., and Suda, T. Exogenous clustered neuropilin 1 enhances vasculogenesis and angiogenesis. Blood 97: 1671, 2001. Gagnon, M. L., Bielenberg, D. R., Gechtman, Z., Miao, H. Q., Takashima, S., Soker, S., and Klagsbrun, M. Identification of a natural soluble neuropilin-1 that binds vascular endothelial growth factor: In vivo expression and antitumor activity. Proc. Natl. Acad. Sci. USA 25: 2573, 2000. Muramatsu, T., and Miyauchi, T. Basigin (CD147): A multifunctional transmembrane protein involved in reproduction, neural function, inflammation and tumor invasion. Histol. Histopathol. 18: 981, 2003. Neufeld, G., Cohen, T., Shraga, N., Lange, T., Kessler, O., and Herzog, Y. The neuropilins: Multifunctional semaphorin and VEGF receptors that modulate axon guidance and angiogenesis. Trends. Cardiovasc. Med. 12: 13, 2002.
319
23.
Klagsbrun, M., Takashima, S., and Mamluk, R. The role of neuropilin in vascular and tumor biology. Adv. Exp. Med. Biol. 515: 33, 2002.
24.
Stephenson, J. M., Banerjee, S., Saxena, N. K., Cherian, R., and Banerjee, S. K. Neuropilin-1 is differentially expressed in myoepithelial cells and vascular smooth muscle cells in preneoplastic and neoplastic human breast: A possible marker for the progression of breast cancer. Int. J. Cancer. 101: 409, 2002.
25.
Sumpio, B. E., Riley, J. T., and Dardik, A. Cells in focus: Endothelial cell. Int. J. Biochem. Cell. Biol. 34: 1508, 2002.
26.
Keegan, A., Hill, C., Kumar, S., Phillips, P., Schor, A., and Weiss, J. Purified tumor angiogenesis factor enhanced proliferation of capillary, but not aortic endothelial cells in vitro. J. Cell. Sci. 55: 261, 1982.
27.
Page, C., Rose, M., Yacoub, M., and Pigott, R. Antigenic heterogeneity of vascular endothelium. Am. J. Pathol. 141: 673, 1992.
Effects of Cyclophilin A on Cell Proliferation and Gene Expressions in Human Vascular Smooth Muscle Cells and Endothelial Cells 1 Hui Yang, M.D., Ph.D., Min Li, Ph.D., Hong Chai, M.D., Ph.D., Shaoyu Yan, Ph.D., Peter Lin, M.D., Alan B. Lumsden, M.D., Qizhi Yao, M.D., Ph.D., and Changyi Chen, M.D., Ph.D.2 Molecular Surgeon Research Center, Division of Vascular Surgery and Endovascular Therapy, Michael E. DeBakey Department of Surgery, Baylor College of Medicine and the Methodist Hospital, Houston, Texas Submitted for publication July 6, 2004
Background. Cyclophilin A (CypA) is a cytosolic protein which involves many biological functions including immune modulation, cell growth, tumorigenesis, and vascular disease. The objective of this study was to determine the effect of CypA on cell proliferation and several gene expressions in human endothelial cells and vascular smooth muscle cells. Methods. Human coronary artery endothelial cells (HCAEC), human lung microvascular endothelial cells (HMVEC-L), and human aorta smooth muscle cells (HAoSMC) were used in this study. Cells were treated with 10 nM CypA for 24 h. The cell proliferation was determined by [ 3H]thymidine incorporation. The mRNA levels of 13 genes including CD147 (receptor for CypA), PDGF-BB, endothelin-1 (ET-1), vascular endothelial growth factor receptor-1 (VEGFR-1), VEGFR-2, VEGFR-3, neuropilin-1 (NRP-1), NRP-2, eNOS, iNOS, nNOS, ICAM-1, and PECAM-1 were semiquantitatively determined by real time RT-PCR as standardized with a house keeping gene -actin. Results. CypA significantly increased cell proliferation of HAoSMC and HMVEC-L by 31% and 45%, respectively, as compared to controls, but had no effect on HCAEC. Blocking CD147 did not affect the mitogenic action of CypA. In addition, CypA also significantly increased the mRNA expression of CD147 by 43% and VEGFR-2 by 65% in HAoSMCs (P < 0.05, t test). HAoSMCs expressed much higher CD147 and neuropilin-1 (NRP-1) mRNA than HMVECs-L and HCAECs (P 1 This work is partially supported by research grants from the National Institutes of Health (Lin: K08 HL076345; Lumsden: R01 HL75824; Yao: AI 49116 and DE15543; and Chen: HL61943, HL60135, HL65916, HL72716, and EB-002436). 2 To whom correspondence and reprint requests should be addressed at Department of Surgery, Baylor College of Medicine, One Baylor Plaza, NAB-2010, Houston, TX 77030. E-mail: [email protected].
0022-4804/05 $30.00 © 2004 Elsevier Inc. All rights reserved.
< 0.017, ANOVA). Furthermore, CypA increased ET-1 mRNA by 22% and VEGFR-1 mRNA by 23% in HMVECs-L, but had limited effects on HCAECs. HMVECs-L had much higher expressions of PDGF-BB, ET-1, VEGFR-2, VEGFR-1, VEGFR-3, and NRP-2 than HAoSMCs and HCAECs (P < 0.017, ANOVA). By contrast, HCAECs had much higher ICAM-1 mRNA levels than HMVECs-L and HAoSMCs (P < 0.017, ANOVA). Conclusions. These data demonstrate that CypA has a mitogenic effect on HAoSMCs and HMVECs-L, but not HCAECs. CD147 may not mediate the action of CypA. In addition, CypA substantially alters the mRNA levels of several key genes in human vascular cells, indicating potential multifunctional roles of CypA in vascular system. Furthermore, this study provides several new aspects of gene expressions in vascular cells. © 2004 Elsevier Inc. All rights reserved. Key Words: cyclophilin A; cell proliferation; gene expression; vascular smooth muscle cell; endothelial cell; CD147; neuropilin-1. INTRODUCTION
Cyclophilin A (CypA) is a ubiquitously distributed intracellular protein belonging to the immunophilin family [1] and is defined on the basis of its binding to the immunosuppressive drug cyclosporine A [2, 3]. Intracellular CypA has peptidylprolyl cis-trans-isomerase (PPIase) activity, which is crucial for folding and isomerization of many proteins [1, 4, 5] and plays a role in the susceptibility to oxidative stress and apoptosis [6, 7]. Recently, it has been found that CypA can be secreted by cells in response to inflammatory stimuli [8, 9] though CypA is initially believed to express solely as an intracellular molecule. There seemed to be a relationship in vivo among inflammation, reactive oxygen species (ROS) and CypA release, as shown by the
312
YANG ET AL.: EFFECTS OF CYCLOPHILIN A ON HUMAN VASCULAR CELLS
high CypA levels in serum from patients with human immunodeficiency virus type-1, rheumatoid arthritis and sepsis [10 –12]. Secreted/extracellular CypA initiated signaling response in diverse target cells. CypA was demonstrated as a potent chemoattractant for neutrophil, eosinophil and T cells in vitro and in vivo [8, 9, 13]. Human recombinant CypA could bind to peroxiredoxin VI and enhance its antioxidant activity [14]. CD147 was recently identified as an essential component of the cell-surface signaling receptor to CypA [15]. Some vascular diseases such as atherosclerosis begin as an inflammatory process and ROS have been implicated in the pathogenesis of atherosclerosis, hypertension, and restenosis. Taking into account the implication of CypA in the process of cell chemotaxis and oxidative stress, Jin et al. [13] first reported that CypA functioned as a secreted oxidative-stress-induced growth factor from rat vascular SMCs and mediated extracellular signal regulated kinase (ERK 1/2) activation and vascular SMCs growth. In addition, recombinant CypA was able to mimic the effects of secreted CypA on the vascular response. Little is known regarding the role of extracellular CypA in human vascular cell growth and gene expressions, which may be related to vascular disease. In the present study, we used in vitro cultures of human aorta smooth muscle cells (HAoSMCs), human lung microvascular endothelial cells (HMVECs-L), and human coronary endothelial cells (HCAECs) to examine the effect of recombinant CypA on cell proliferation and expressions of 13 crucial genes in these cells. Our data demonstrate that CypA has a mitogenic effect on human vascular SMCs and endothelial cells, and blockade of CD147 has limited effects on mitogenic action of CypA. Furthermore, CypA alters several gene expressions of human vascular SMCs and endothelial cells, which may indicate its potential multifunctional role in vascular biology. In addition, comparison of gene expressions in these cell types provides additional information to the understanding of molecular mechanisms related to vascular functions. MATERIALS AND METHODS Chemicals and Reagents SmGM-2 Bulletkit and EGM-2 Bulletkit were purchased from Clonetics (Walkersville, MD). Recombinant human CypA and Trizol reagent were obtained from Sigma (St. Louis, MO). Mouse antihuman CD147 blocking antibody was obtained from Ancell (Bayport, MN) and mouse IgG1 isotype control was purchased from R&D systems (Minneapolis, MN). The iQ SYBR Green supermix was obtained from Bio-Rad (Hercules, CA). [ 3H]thymidine was purchased from Amersham Biosciences (Piscataway, NJ).
Cell Culture HAoSMCs, HMVECs-L and HCAECs were purchased from Clonetics. HAoSMCs were grown in SmGM-2 Bulletkit (SMC basic
313
medium, insulin, EGF, bFGF, and GA-1000) supplemented with 10% FBS. HMVECs-L and HCAECs were cultured in EGM-2 Bulletkit (EC basic medium, hydrocortisone, bFGF, VEGF, long R3-IGF-1, ascorbic acid, EGF, GA-1000, and heparin) supplemented with 10% fetal bovine serum (FBS, Invitrogen Corporation, Grand Island, NJ). HAoSMCs, HMVECs-L, and HCAECs were used at passage 4 to 5 in all experiments. When cell growth reached ⬃70% confluence, HAoSMCs were serum-starved in 0.1% FBS in SMC basic medium supplemented with only GA-1000 for 24 h before testing, and HMVECs-L and HCAECs were serum-starved in 1% FBS in EC basic medium supplemented with only hydrocortisone, ascorbic acid, heparin and GA-1000 for 24 h before testing.
Real-Time PCR Serum-starved cells were treated with CypA or PBS as control for 24 h. Total cellular RNA was isolated by Trizol reagent extraction. The genomic DNA contamination in RNA preparation was removed by using DNA-free kit (Ambion Inc., Austin, TX), which was confirmed by the lack of detectable genomic DNA in PCR reaction with cDNA sample yielded in reverse transcriptase (RTase)-omitted reaction (no RT control). Total RNA (0.5 g) was reverse transcribed into cDNA using iScipt cDNA synthesis kit (Bio-Rad) following the manufacturer’s instruction. Primers for all tested genes were designed via the Beacon Designer 2.1 software (Bio-Rad) and the primer sequences were listed in Table 1. The quality of individual pair of primers was confirmed by running conventional PCR before realtime PCR to make sure there were no detectable primer dimer and non-specific products yielded. The real-time PCR reaction system included the following: 250 nM primers, 50 ng cDNA, and iQ SYBR Green supermix (0.2 mM of each dNTP, 25 units/ml iTaq DNA polymerase, SYBR Green I, 10 nM fluorescein, 3 mM MgCl 2, 50 mM KCl, and 20 mM Tris-HCl). Using the iCycler iQ Real-time PCR detection system (Bio-Rad), PCR cycling conditions were set as follows: 95°C for 90 s, 40 cycles at 95°C for 20 s, and 60°C for 1 min, then melting curve analysis was performed on the iCycler over the range 55 to 95°C by monitoring iQ SYBR green fluorescence with increasing temperature (0.5°C increment changes at 10 s intervals). Specific products were determined as clear single peaks at their melting curves. All sample measurements were performed in triplicate. Sample cycle threshold (Ct) values were determined from plots of relative fluorescence units (RFU) versus PCR cycle number during exponential amplification so that sample measurement comparisons were possible. Standard curves for all primer amplifications were generated by plotting average Ct values against the logarithm starting quantity of target template molecules (series dilution of cDNA template: 50, 10, 2, 0.4, and 0.08 ng), followed by a sum of least squares regression analysis. The correlation coefficient and PCR efficiency of all primers were above 90%, respectively. The gene expression in each sample was calculated as 2^(40-Ct) and further normalized to -actin expression [ ⫽ 2^(Ct (-actin) ⫺ Ct (gene))], and iCycler software (Bio-Rad) was used to extract and quantify the PCR data which were then exported to Excel software (Microsoft, Redmond, WA) for statistical analysis.
[ 3H]thymidine Incorporation Cells (5000 cells/well) were seeded and grown in 96-well plates for 24 h. They were serum-starved for another 24 h. To investigate whether the effect of CypA is mediated by CD147, cells were incubated in anti-CD147 blocking antibody (5 g/ml) for 1 h before addition of CypA or PBS. Normal mouse IgG1 (5 g/ml) was used as isotype control. Cells were then treated with CypA (0.01, 0.1, 1, and 10 nM) or PBS for 24 h and labeled with [ 3H]thymidine at 1 Ci/ml during the last 4 h of CypA treatment. [ 3H]thymidine incorporation was measured in scintillation solution using microplate scintillation & luminescence counter (Packard Biosciences, San Diego, CA).
314
JOURNAL OF SURGICAL RESEARCH: VOL. 123, NO. 2, FEBRUARY 2005
TABLE 1 Primers Sequence for Real-Time PCR* Gene
Gene bank No.
Forward primer
Reverse primer
CD147 PDGF-BB ET-1 VEGFR-1 VEGFR-2 VEGFR-3 NRP-1 NRP-2 eNOS iNOS nNOS ICAM-1 PECAM-1
AB085790 X02811 BC009720 NM_002019 AF063658 NM_002020 BT006995 NM_018534 NM_000603 AF049656 NM_000620 X06990 NM_000442
CCATGCTGGTCTGCAAGTCAG ACTCGATCCGCTCCTTTGATGA CTCCAGAGAGCGTTATGTGACC TCTCACACATCGACAAACCAATACA GCAGGGGACAGAGGGACTTG GACAGCTACAAGTACGAGCATCTG AAGGTTTCTCAGCAAACTACAGTG GATTCGGGATGGGGACAGTGA AGGAACCTGTGTGACCCTCA TGGAGAAAACCCCAGGTGCTA TGTTCGGTGTTCAGCAAATCCA CCCCATGAAACCGAACACACAA CCGGATCTATGACTCAGGGACAT
CCGTTCATGAGGGCCTTGTC GCTCGCCTCCAGAGTGGG TCCGTGGAGGCTATGGCTTC GGTAGCAGTACAATTGAGGACAAGA GAGGCCATCGCTGCACTCA CGTTCTTGCAGTCGAGCAGAA GGGAAGAAGCTGTGATCTGGTC GGTGAACTTGATGTAGAGCATGGA CGAGGTGGTCCGGGTATCC GGAAACCATTTTGATGCTTGTGAC AGATGATCACGGGCGGCTT TGTAGCTGCATGGCATATGTCTTC GGATGGCCTCTTTCTTGTCCAG
* Primers for all tested genes were designed via the Beacon Designer 2.1 software (Bio-Rad Inc., Hercules, CA).
Statistical Analysis Statistic analysis was performed on the Data Analysis tool of Microsoft Excel program (Microsoft Office 2000, Microsoft Inc., Seattle, WA). Data were expressed as mean ⫾ SD. Significant difference of cell proliferation and gene expression between control and CypA-treated groups was determined by paired Student’s t test (twotail). A P value ⬍0.05 was considered statistically significant for t test. Comparison of CD147, NRP-1, and ICAM-1 mRNA levels among three different types of cells after treatment of CypA was analyzed with single factor Analysis of Variance (ANOVA) test. A P value ⬍0.017 (Bonferroni) was considered statistically significant for ANOVA test.
RESULTS Effects of CypA on Cell Proliferation in Human Vascular SMCs and Endothelial Cells
To investigate the potential growth promoting effect of CypA on vascular cells, we treated HAoSMCs, HMVECs-L, and HCAECs with PBS or a series of doses of CypA (0.01, 0.1, 1, and 10 nM). [ 3H]thymidine incorporation was performed as index of cell proliferation. CypA significantly increased [ 3H]thymidine incorporation in both HAoSMCs and HMVECs-L in a dose dependent manner, but had no effects on HCAECs (Fig. 1). Specifically, CypA at 10 nM significantly increased [ 3H]thymidine incorporation by 31% in HAoSMCs and 45% in HMVECs-L, respectively (P ⬍ 0.05, Student’s t test) (Fig. 1). Since CD147 was recently identified as an essential component of the cellsurface signaling receptor to CypA [15], we determined whether anti-CD147 antibody could block CypAinduced cell proliferation in both HAoSMCs and HMVECs-L. The cells were incubated with anti-CD147 blocking antibody (5 g/ml) for 1 h before addition of CypA or PBS. Mouse IgG1 was used as an isotype control. Anti-CD147 blocking antibody failed to elicit a notable alteration of CypA-induced cell proliferation in HAoSMCs and HMVECs-L, respectively, as compared
to CypA treated groups (Fig. 2). These results demonstrated that CypA acts as a mitogen for HAoSMCs and HMVECs-L and CD147 may not mediate this action of CypA. Effects of CypA on Gene Expressions in HAoSMCs
Little is known regarding the role of secreted CypA in human vascular diseases. To help address the putative function of secreted CypA on human vascular cells, quantitative real-time PCR was used to screen the mRNA levels of 13 key genes including a potential CypA receptor (CD147), two growth factors (PDGF-BB and ET-1), three VEGFRs (VEGFR-1, VEGFR-2 and VEGFR-3), two neuropilins (NRP-1 and NRP-2), three nitric oxide synthases (eNOS, iNOS and nNOS), and
FIG. 1. Effects of CypA on cell proliferation in human vascular SMCs and endothelial cells. Serum-starved HAoSMCs, HMVECs-L, and HCAECs were treated with the indicated concentrations of CypA or PBS for 24 h, respectively, and labeled with [ 3H]thymidine at 1 Ci/ml during the last 4 h of CypA or PBS treatment. [ 3H]thymidine incorporation was measured in scintillation solution. CypA significantly increased proliferation of HAoSMCs and HMVECs-L, but not HCAECs. *P ⬍ 0.05 compared with PBS treatment group (Student’s t test).
YANG ET AL.: EFFECTS OF CYCLOPHILIN A ON HUMAN VASCULAR CELLS
315
Effects of CypA on Gene Expressions in HCAECs
FIG. 2. Effect of anti-CD147 antibody on CypA-induced proliferation of HAoSMCs and HMVECs-L. Serum-starved HAoSMCs and HMVECs-L were incubated with anti-CD147 blocking antibody (5 g/ml) for 1 h before addition of CypA or PBS, respectively. Normal mouse IgG1 (5 g/ml) was used as a control. HAoSMCs and HMVECs-L were then treated with CypA (10 nM) or PBS for 24 h and labeled with [ 3H]thymidine at 1 Ci/ml during the last 4 h of CypA or PBS treatment. [ 3H]thymidine incorporation was measured in scintillation solution. Anti-CD147 antibody could not block CypAinduced cell proliferation in these cells. *P ⬍ 0.05 compared with PBS treatment group (Student’s t test).
two adhesion molecules (ICAM-1 and PECAM-1) (Table 2). These molecules selected were based on their potential roles in vascular cells. HAoSMCs showed relatively high expressions of CD147, NRP-1, NRP-2, and ET-1 (Table 2, Fig. 3A) and relatively low expressions of ICAM-1, PECAM-1, VEGFR-2, VEGFR-1, and PDGF-BB (Table 2, Fig. 3B). There were no detectable expressions of eNOS, iNOS, nNOS, and VEGFR-3 (Table 2, Fig. 3). In addition, HAoSMCs had 116% and 200% higher CD147 mRNA levels than HMVECs-L and HCAECs, respectively (P ⬍ 0.017, ANOVA test). It also expressed 27% and 28% higher NRP-1 mRNA than HMVECs-L and HCAECs, respectively (P ⬍ 0.017, ANOVA test). Furthermore, CypA (10 nM) treatment significantly increased mRNA expression of CD147 by 43% and VEGFR-2 by 65% (P ⬍ 0.05, Student’s t test), but decreased expression of VEGFR-1 by 22% and ICAM-1 by 18% (Table 2, Fig. 3). Effects of CypA on Gene Expressions in HMVECs-L
Without CypA treatment, HMVECs-L had relatively high mRNA levels of PECAM-1, ET-1, PDGF-BB, CD147, VEGFR-2, NRP-1, NRP-2, and ICAM-1 (Table 2, Fig. 4A), but expressed relatively low levels of VEGFR-3, eNOS, and VEGFR-1 (Table 2, Fig. 4B). In addition, HMVECs-L had much higher expressions of PDGF-BB, ET-1, VEGFR-2, VEGFR-1, VEGFR-3, and NRP-2 than HAoSMCs and HCAECs (Table 2). Furthermore, in response to CypA treatment (10 nM), HMVECs-L showed increases of ET-1 mRNA by 22% and VEGFR-1 mRNA by 23%, and slight decrease of VEGFR-3 mRNA by 13% (Fig. 4). iNOS and nNOS were not detected in HMVECs-L (Fig. 4B).
Similar to HMVECs-L, HCAECs had relatively high mRNA expressions of PECAM-1, ET-1, NRP-1, PDGFBB, CD147, ICAM-1, NRP-2, and VEGFR-2, but relatively low mRNA expressions of eNOS, VEGFR-1, and VEGFR-3 (Table 2, Fig. 5). There were no detectable mRNA expressions of iNOS and nNOS (Table 2, Fig. 5B). Most notably, HCAECs had three-fold and 68-fold higher ICAM-1 mRNA levels than HMVECs-L and HAoSMCs, respectively (Table 2, P ⬍ 0.017, ANOVA test). CypA had limited effects on gene expressions in HCAECs as compared to HMVECs-L and HAoSMCs. DISCUSSION
This is the first study to determine the effect of CypA on cell proliferation and gene expressions in human vascular cells. CypA significantly increases proliferation of HAoSMCs and HMVECs-L, but not HCAECs. This mitogenic effect of CypA may be correlated with response of gene expressions in these cells. CypA substantially increased mRNA expressions of CD147 and VEGFR-2 in HAoSMCs, and ET-1 and VEGFR-1 in HMVECs-L. CypA had limited effects on gene expressions in HCAECs. In addition, gene expression patterns in these cells present several new discoveries such as NRPs in HAoSMCs and difference between HMVECs-L and HCAECs. Smooth muscle cell proliferation is one of important mechanisms of vascular lesion formation including atherosclerosis and restenosis. In atherosgenesis, chronic inflammatory response results in vascular injury of the arterial wall leading to endothelial dysfunction, macrophage migration and activation, and SMC phenotype switch. SMC becomes proliferative, migratory, and produces extracellular matrix proteins [16]. These inflammatory and fibroproliferative processes in the vascular wall also result in the restenosis following arterial reconstructive procedures because of intimal accumulation of SMCs [17]. SMC proliferation is regulated by many factors including growth factors, cytokines, adhesion molecules, hemodynamic conditions, and gene expression status. Recently, many other molecules such as CypA are found to regulate SMC proliferation. One report showed that CypA secretion from rat SMCs was increased by oxidative stress, and secreted CypA could, in turn, stimulate SMC proliferation and activation of ERK 1/2 pathways [13]. It is a great beginning to study potential roles of CypA in vascular disease although many questions have not been addressed yet. It is unknown whether it affects human SMC proliferation and gene expressions. In consistent with the findings in rat SMCs [13], our study demonstrates that human recombinant CypA significantly increases HAoSMC proliferation in a dose
316
JOURNAL OF SURGICAL RESEARCH: VOL. 123, NO. 2, FEBRUARY 2005
TABLE 2 Comparison of Gene Expressions in Three Types of Cells* HAoSMC
CD147 PDGF-BB ET-1 VEGFR-1 VEGFR-2 VEGFR-3 NRP-1 NRP-2 eNOS iNOS nNOS ICAM-1 PECAM-1
HMVEC-L
HCAEC
Control
CypA (10 nM)
Control
CypA (10 nM)
Control
CypA (10 nM)
0.081000 0.000028 0.003300 0.000046 0.000051 0.000000 0.048000 0.009600 0.000000 0.000000 0.000000 0.000330 0.000069
0.116000 0.000032 0.003700 0.000036 0.000084 0.000000 0.049000 0.011000 0.000000 0.000000 0.000000 0.000270 0.000078
0.037300 0.036450 0.064760 0.000759 0.035950 0.009200 0.037350 0.020001 0.003596 0.000000 0.000000 0.005440 0.114210
0.034000 0.036450 0.079150 0.000934 0.038470 0.008030 0.041980 0.022850 0.003381 0.000000 0.000000 0.005830 0.122210
0.027000 0.026600 0.037014 0.000376 0.010000 0.000341 0.037000 0.018500 0.001137 0.000000 0.000000 0.022800 0.107200
0.029400 0.031400 0.038600 0.000304 0.009190 0.000288 0.036500 0.015400 0.001280 0.000000 0.000000 0.023700 0.120200
* The mRNA level of each gene in each sample was normalized to that of -actin. Relative mRNA level was presented as 2^[Ct ( Ct (gene)].
dependent manner. This finding is particular important in understanding new factors in human vascular disease. The molecular mechanisms of CypA-induced SMC proliferation and other cell functions are poorly understood. A recent study in white blood cells indicates that CypA may interact with its receptor on the cell surface [18]. Indeed, CD147, a type-I transmembrane protein is essential for these cyclophilin-mediated signaling events [18, 19]. CypA binds to CD147 and transmits a signal to trigger chemotaxis of human neutrophils [18]. In addition, CypB also shares a common receptor CD147 with CypA [19]. Anti-CD147 antibody is able to block CypB-induced T-cell adhesion [18]. Unlike clas-
actin)
⫺
sical ligand-receptor interactions, CypB did not cause down-regulation of CD147 after its binding [20]. To determine whether CD147 mediates CypA-induced vascular cell proliferation, anti-CD147 antibody was pre-incubated with cells before CypA was added to HAoSMCs for cell proliferation assay in our study. Our data showed that CD147 antibody could not block CypA-induced HAoSMC proliferation. Specific reasons for this result are not known. CypA could have other mechanisms to induce cell proliferation rather than CD147 signaling in HAoSMCs. This is a critical question and warranted for further investigation. The effect of extracellular CypA on gene expressions in human vascular SMCs has not been previ-
FIG. 3. Effect of CypA on gene expressions in HAoSMCs. Serum-starved HAoSMCs were treated with CypA (10 nM) or PBS for 24 h. Total RNA was extracted and then reverse transcribed to cDNA. Fifty ng of cDNA of each sample was used in real-time PCR analysis to detect each gene expression. The mRNA level of each gene in each sample was normalized to that of -actin. Relative mRNA level was presented as 2^[Ct ( actin) ⫺ Ct (gene)]. Data for genes with relatively high or low scale of mRNA levels were demonstrated in (A) or (B), respectively. Data are expressed as mean ⫾ SD of triplicate values from three separate experiments. *P ⬍ 0.05 compared with PBS treatment group (Student’s t test).
YANG ET AL.: EFFECTS OF CYCLOPHILIN A ON HUMAN VASCULAR CELLS
317
FIG. 4. Effect of CypA on gene expression profile in HMVECs-L. Serum-starved HMVECs-L were treated with CypA (10 nM) or PBS for 24 h. cDNA preparation and analysis of real-time PCR data were described in the legend of Fig. 3. Data for genes with relatively high or low scale of mRNA levels were demonstrated in (A) or (B), respectively. Data are expressed as mean ⫾ SD of triplicate values from three separate experiments.
ously reported. In this study, we investigated 13 gene expressions in HAoSMCs by real time PCR after CypA treatment. Very interestingly, CypA significantly increased mRNA expression of CD147 by 43% and VEGFR-2 by 65%, which may contribute to its mitogenic effect on HAoSMCs. In addition, HAoSMCs express higher mRNA levels of CD147 and NRP-1 than human endothelial cells. These two molecules have been very limitedly studied in vascular SMCs. In addition to the role of CD147 as a potential receptor for CypA, CD147 has been found to participate in the cell-surface orientation of monocarboxylic acid transporters to the plasma membrane. It is also likely to participate in HIV infection [21]. CD147 in tumor cells triggers the production or release of matrix metalloproteinases in the surrounding mesenchymal cells and tumor cells, thereby con-
tributing to tumor invasion [21]. NRP-1 is a transmembrane glycoprotein, which has been characterized as a receptor for both semaphorins for neuronal guidance and VEGF for angiogenesis [22]. Recently, NRP-1 has been found to express in several cancer cells and endothelial cells [23]. Only one study showed NRP-1 was expressed in vascular SMCs in human breast cancer tissues [24]. Potential functions of CD147 and NRP-1 in vascular cells remain to be elucidated. Endothelial cells are active participants in the inflammatory response, vascular disease, wound healing, and tumor growth. They are involved in diverse activities including the regulation of leukocyte extravasation, angiogenesis, cytokine production, protease and extracellular matrix synthesis, vasodilation and blood vessel permeability, and antigen
FIG. 5. Effect of CypA on gene expressions in HCAECs. Serum-starved HCAECs were treated with CypA (10 nM) or PBS for 24 h. cDNA preparation and analysis of real-time PCR data were described in the legend of Fig. 3. Data for genes with relatively high or low scale of mRNA levels were demonstrated in (A) or (B), respectively. Data are expressed as mean ⫾ SD of triplicate values from three separate experiments.
318
JOURNAL OF SURGICAL RESEARCH: VOL. 123, NO. 2, FEBRUARY 2005
presentation [25]. Normal endothelial cells of the vessel wall are usually quiescent with minimal cell proliferation rates. Increased endothelial proliferation involves both physiological and pathologic responses. Specially, endothelial cell proliferation and activation are associated with several types of vascular diseases including coronary arteries and lungs. Recently, CypA has been found to have roles in regulation of vascular SMC functions [13], but it is not clear whether it also affects endothelial cell proliferation and gene expressions. In this study, we demonstrate, for the first time, that CypA significantly increases HMVECs-L proliferation, but not HCAECs. Effects of CypA on gene expressions are also different between these two types of endothelial cells. CypA treatment increased ET-1 mRNA by 22% and VEGFR-1 mRNA by 23%, while it slightly decreased VEGFR-3 mRNA by 13% in HMVECs-L. However, CypA had very limited effects on these gene changes in HACECs. These data may be correlated with CypA-induced cell proliferation. In addition, HMVECs-L had much higher expressions of PDGF-BB, ET-1, VEGFR-2, VEGFR-1, VEGFR-3, and NRP-2 than HCAECs, suggesting the mechanisms of functional differences between these two cell types. These data provide new evidence supporting endothelial heterogeneity. Endothelial cells are heterogeneous within species where they differ depending upon the location of the vessels and can vary in phenotype, function, and their response to growth factors [26]. A heterogeneous distribution of vascular adhesion molecule has also been observed in vascular endothelium from different regions of the human cardiovascular system, such as the aorta, pulmonary, coronary arteries and umbilical vein and artery [27]. In this study, HCAECs had three-fold higher ICAM-1 mRNA levels than HMVECs-L. Only recently, the importance of endothelial heterogeneity in vascular function and disease has been recognized. Active investigations in this field are just beginning and should have significant advances in the near future. In summary, proliferation and gene expressions of vascular smooth muscle cells and endothelial cells play important roles in both vascular biology and disease. This study demonstrates human recombinant CypA can significantly increase proliferation of HAoSMCs and HMVECs-L, but not HCAECs. This mitogenic effect is correlated with distinguished gene expression changes in these cell types. In addition, comparison of gene expression patterns among these cell types provides new insights to the understanding of cellular functions in vascular system. For example, relatively high expression of CD147 and NRP-1 in HAoSMCs and differences of gene expression levels between HMVECs-L and HCAECs may
have significance in biological functions for these cells, which are warranted for further investigation. REFERENCES 1. 2.
3.
4.
5.
Galat, A. Peptidylproline cis-trans-isomerases: Immunophilins. Eur. J. Biochem. 216: 689, 1993. Fruman, D. A., Burakoff, S. J., and Bierer, B. E. Immunophilins in protein folding and immunosuppression. FASEB. J. 8: 391, 1994. Liu, J. FK506 and cyclosporin, molecular probes for studying intracellular signal transduction. Immunol. Today. 14: 290, 1993. Bergsma, D. J., Eder, C., Gross, M., Kersten, H., Sylvester, D., Appelbaum, E., Cusimano, D., Livi, G. P., McLaughlin, M. M., and Kasyan, K. The cyclophilin multigene family of peptidylprolyl isomerases. Characterization of three separate human isoforms. J. Biol. Chem. 266: 23204, 1991. Kofron, J. L., Kuzmic, P., Kishore, V., Colon-Bonilla, E., and Rich, D. H. Determination of kinetic constants for peptidyl prolyl cis-trans isomerases by an improved spectrophotometric assay. Biochemistry 30: 6127, 1991.
6.
Crompton, M. Mitochondrial intermembrane junctional complexes and their role in cell death. J. Physiol. 529: 11, 2000.
7.
Hailstrap, A. P., Doran, E., Gillespie, J. P., and O’Toole A. Mitochondria and cell death. Biochem. Soc. Trans. 28: 170, 2000.
8.
Sherry, B., Yarlett, N., Strupp, A., and Cerami, A. Identification of cyclophilin as a proinflammatory secretory product of lipopolysaccharide-activated macrophages. Proc. Natl. Acad. Sci. USA 89: 3511, 1992.
9.
Xu, Q., Leiva, M. C., Fischkoff, S. A., Handschumacher, R. E., and Lyttle, C. R. Leukocyte chemotactic activity of cyclophilin. J. Biol. Chem. 267: 11968, 1992.
10.
Billich, A., Winkler, G., Aschauer, H., Rot, A., and Peichl, P. Presence of cyclophilin A in synovial fluids of patients with rheumatoid arthritis. J. Exp. Med. 185: 975, 1997.
11.
Tegeder, I., Schumacher, A., John, S., Geiger, H., Geisslinger, G., Bang, H., and Brune, K. Elevated serum cyclophilin levels in patients with severe sepsis. J. Clin. Immunol. 17: 380, 1997.
12.
Endrich, M. M., and Gehring, H. The V3 loop of human immunodeficiency virus type-1 envelope protein is a high-affinity ligand for immunophilins present in human blood. Eur. J. Biochem. 252: 441, 1998.
13.
Jin, Z. G., Melaragno, M. G., Liao, D. F., Yan, C., Haendeler, J., Suh, Y. A., Lambeth, J. D., and Berk, B. C. Cyclophilin A is a secreted growth factor induced by oxidative stress. Circ. Res. 87: 789, 2000.
14.
Lee, S. P., Hwang, Y. S., Kim, Y. J., Kwon, K. S., Kim, H. J., Kim, K., and Chae, H. Z. Cyclophilin a binds to peroxiredoxins and activates its peroxidase activity. J. Biol. Chem. 276: 29826, 2001.
15.
Yurchenko, V., Zybarth, G., O’Connor M., Dai, W. W., Franchin, G., Hao, T., Guo, H., Hung, H. C., Toole, B., Gallay, P., Sherry, B., and Bukrinsky, M. Active site residues of cyclophilin A are crucial for its signaling activity via CD147. J. Biol. Chem. 277: 22959, 2002.
16.
Ross, R. Atherosclerosis is an inflammatory disease. N. Engl. J. Med. 340: 115, 1999.
17.
Bailey, S. R. Coronary restenosis: A review of current insights and therapies. Catheter. Cardiovasc. Interv. 55: 265, 2002.
18.
Kitsukawa, T., Shimono, A., Kawakami, A., Kondoh, H., and Fujisawa, H. Overexpression of a membrane protein, neuropi-
YANG ET AL.: EFFECTS OF CYCLOPHILIN A ON HUMAN VASCULAR CELLS
19.
20.
21.
22.
lin, in chimeric mice causes anomalies in the cardiovascular system, nervous system and limbs. Development 121: 4309, 1995. Yamada, Y., Takakura, N., Yasue, H., Ogawa, H., Fujisawa, H., and Suda, T. Exogenous clustered neuropilin 1 enhances vasculogenesis and angiogenesis. Blood 97: 1671, 2001. Gagnon, M. L., Bielenberg, D. R., Gechtman, Z., Miao, H. Q., Takashima, S., Soker, S., and Klagsbrun, M. Identification of a natural soluble neuropilin-1 that binds vascular endothelial growth factor: In vivo expression and antitumor activity. Proc. Natl. Acad. Sci. USA 25: 2573, 2000. Muramatsu, T., and Miyauchi, T. Basigin (CD147): A multifunctional transmembrane protein involved in reproduction, neural function, inflammation and tumor invasion. Histol. Histopathol. 18: 981, 2003. Neufeld, G., Cohen, T., Shraga, N., Lange, T., Kessler, O., and Herzog, Y. The neuropilins: Multifunctional semaphorin and VEGF receptors that modulate axon guidance and angiogenesis. Trends. Cardiovasc. Med. 12: 13, 2002.
319
23.
Klagsbrun, M., Takashima, S., and Mamluk, R. The role of neuropilin in vascular and tumor biology. Adv. Exp. Med. Biol. 515: 33, 2002.
24.
Stephenson, J. M., Banerjee, S., Saxena, N. K., Cherian, R., and Banerjee, S. K. Neuropilin-1 is differentially expressed in myoepithelial cells and vascular smooth muscle cells in preneoplastic and neoplastic human breast: A possible marker for the progression of breast cancer. Int. J. Cancer. 101: 409, 2002.
25.
Sumpio, B. E., Riley, J. T., and Dardik, A. Cells in focus: Endothelial cell. Int. J. Biochem. Cell. Biol. 34: 1508, 2002.
26.
Keegan, A., Hill, C., Kumar, S., Phillips, P., Schor, A., and Weiss, J. Purified tumor angiogenesis factor enhanced proliferation of capillary, but not aortic endothelial cells in vitro. J. Cell. Sci. 55: 261, 1982.
27.
Page, C., Rose, M., Yacoub, M., and Pigott, R. Antigenic heterogeneity of vascular endothelium. Am. J. Pathol. 141: 673, 1992.