Effects of dietary lipid levels on sub-adult triploid rainbow trout (Oncorhynchus mykiss): 1. Growth performance, digestive ability, health status and expression of growth-related genes

Aquaculture 513 (2019) 734394

Contents lists available at ScienceDirect

Aquaculture journal homepage: www.elsevier.com/locate/aquaculture

Effects of dietary lipid levels on sub-adult triploid rainbow trout (Oncorhynchus mykiss): 1. Growth performance, digestive ability, health status and expression of growth-related genes

T

Yuqiong Menga,b,1, Kangkang Qianb,1, Rui Maa, Xiaohong Liub, Buying Hanb, Jihong Wuc, ⁎ Lu Zhangd, Taorong Zhanc, Xuemin Hua, Haining Tianb, Changzhong Lib, a

State Key Laboratory of Plateau Ecology and Agriculture, Qinghai University, Xining, China College of Eco-Environmental Engineering, Qinghai University, Xining, China Qinghai Minze Longyangxia Ecological Aquaculture Co., LTD., Longyangxia 811800, PR China d Tongwei Co., LTD., Chengdu 610000, PR China b c

ARTICLE INFO

ABSTRACT

Keywords: Triploid rainbow trout Lipid Growth Digest Anti-oxidative capacity

A growth trial was conducted to evaluate the effects of dietary lipid levels on the growth performance, feed utilization, digestive ability, health status and expression of growth-related genes of female triploid rainbow trout (Oncorhynchus mykiss). Six isonitrogenous diets, containing 46% protein were formulated with graded lipid levels of 6.6 (Diet 1), 12.3 (Diet 2), 14.8 (Diet 3), 19.5 (Diet 4), 22.8 (Diet 5) and 29.4% (Diet 6). Each diet was fed to quadruplicated groups of fish with initial average weight of 233 g in freshwater cages for 80 days. Results showed that there were significant linear and quadratic responses in growth performance, feed utilization, digestive ability and health status of sub-adult fish (P < .05). Final weight, specific growth rate (SGR), feed intake (FI), stomach protease activity, activity of lipase in pyloric caeca, activity of amylase in pyloric caeca and intestine showed a general increasing trend with increasing dietary protein level. Feed conversion ratio (FCR) decreased with increasing dietary protein level. No significant difference of intestinal morphology was observed in any of the groups (P > .05) except that the highest value for muscular layer thickness and density of goblet cells were found in Diet 6 treatment (P < .05). When examining health status, no negative effects were found in the antioxidative capacity of the intestine and liver (P > .05), however, the lowest value of plasma total antioxidative capacity (T-AOC) content and highest plasma malonaldehyde (MDA) content were shown in Diet 6 treatment (P < .05). There was no significant difference in plasma enzymes in any of the groups (P > .05) except for activities of aspartate aminotransferase (AST) and creatine kinase (CK), which increased as dietary lipid levels increased (P < .05). The expression of growth-related genes was at first significantly improved (P < .05) and then kept consistent (P > .05). Broken-line regression analysis of FCR showed that the minimum dietary lipid level of triploid rainbow trout was 23.3% in the present study. In summary, we found that triploid rainbow trout could use or tolerate high dietary lipid level (up to 29.4%) with no negative effect on fish growth, feed utilization, liver or intestine health. The minimum dietary lipid level for sub-adult triploid rainbow trout was estimated to be 23.3% based on FCR under the present conditions.

1. Introduction Sexual maturation of fish usually results in decreasing growth rates, increasing incidence of disease and deteriorating organoleptic properties (Piferrer et al., 2009) and it has been a major challenge in fish farming, particularly in salmonids (Fraser et al., 2012). To avoid problems associated with sexual maturation, aquaculture industry induces

triploidy for producing sterile fish to aquaculture and fisheries management (Benfey, 1999). Triploids are individuals whose cells possess three complete sets of chromosomes, whereas diploids have two complete chromosome sets. In salmonids, such as rainbow trout, triploid females do not undergo sexual maturation, and therefore do not experience the shift from somatic to gonadal growth (Manor et al., 2014). Besides, triploid rainbow trout production may achieve a year-round

Corresponding author. E-mail address: [email protected] (C. Li). 1 Equally contributing authors. ⁎

https://doi.org/10.1016/j.aquaculture.2019.734394 Received 26 November 2018; Received in revised form 9 August 2019; Accepted 9 August 2019 Available online 10 August 2019 0044-8486/ © 2019 Elsevier B.V. All rights reserved.

Aquaculture 513 (2019) 734394

Y. Meng, et al.

Table 1 Formulation and proximate compositions of the experimental diets (% dry matter). Ingredients

Diet 1 (6.6%)

Diet 2 (12.3%)

Diet 3 (14.8%)

Diet 4 (19.5%)

Diet 5 (22.8%)

Diet 6 (29.4%)

Fish meal Wheat meala Corn starcha Fish oil Soybean oil Mineral premixb Vitamin premixc Ca (H2PO4)2 Choline chloride Mold inhibitor Antioxidants Betaine Astaxanthind Total

60 12 22.22 0 3 0.5 0.5 0.8 0.3 0.1 0.05 0.5 0.03 100

60 12 18.22 4 3 0.5 0.5 0.8 0.3 0.1 0.05 0.5 0.03 100

60 12 14.22 8 3 0.5 0.5 0.8 0.3 0.1 0.05 0.5 0.03 100

60 12 11.22 11 3 0.5 0.5 0.8 0.3 0.1 0.05 0.5 0.03 100

60 12 6.22 16 3 0.5 0.5 0.8 0.3 0.1 0.05 0.5 0.03 100

60 12 0.22 22 3 0.5 0.5 0.8 0.3 0.1 0.05 0.5 0.03 100

Proximate analysis (n = 3) Moisture (%) Crude protein (% dry matter) Crude lipid (% dry matter) Ash (% dry matter) Gross energy (KJ/g)

4.3 46.3 6.6 11.1 18.9

4.2 46.6 12.3 11.1 20.0

3.7 46.1 14.8 11.1 21.1

4.6 45.8 19.5 10.8 22.4

4.3 45.8 22.8 10.9 22.9

4.2 45.5 29.4 10.9 24.2

a

a

Fish meal, crude protein 69.5%, crude lipid 8%; Wheat meal, crude protein 15%, crude lipid 1.2%; Corn starch, crude protein 0.3%, crude lipid 0.2%. Mineral premix included the following (mg/kg diet): sodium, 1500; iron, 3000; copper, 90; zinc, 1500; manganese, 800; selenium, 4.3; iodine, 21; cobalt, 3. c Vitamin premix included the following (each kg−1 diet): vitamin A, 50 KIU; vitamin D3, 20 KIU; vitamin E, 390 mg; vitamin K, 150 mg; vitamin B1, 120 mg; vitamin B2, 165 mg; vitamin B6, 130 mg; vitamin B12, 0.5 mg; biotin, 2.4 mg; folic acid, 75 mg; inositol, 1200 mg; niacin, 670 mg; ascorbic acid, 2500 mg. d Astaxanthin: 10% (CAROPHYLL®, DSM, Netherlands). b

characteristics as well as health status etc., are closely related to fish growth. Studies have shown that dietary lipid deficiency could cause poor digestion, low immunity and therefore, slow growth (Zhu et al., 2016). While feeding over-doses of dietary lipid may not only cause reduced feed intake (FI) and increased feed conversion ratio (FCR) (Xu et al., 2011; Yi et al., 2014) but also place a strain on the fish with respect to oxidative stress (Stephan et al., 1995; Hemre and Sandnes, 1999; Jin et al., 2013), leading to impaired health and retarded growth. Hence, an appropriate level of dietary lipids is important for maintaining favorable growth and health of farmed fish. Energy metabolism and growth are under complex endocrine control, which directly or indirectly involves several hormones and growth factors (Sacobie et al., 2016). Growth hormone (GH), which is secreted by the pituitary gland, is the master growth regulator in all vertebrates, and acts on target tissues via its receptor GHR (growth hormone receptor), or indirectly by stimulating production of IGFs (insulin-like growth factors) (Fuentes et al., 2013; Rolland et al., 2015). The liver is the main site of synthesis for circulating IGF-I and IGF-II (Plisetskaya, 1998). It was reported in rainbow trout that plasma IGF-I and IGF-II levels were correlated to their hepatic mRNA levels, and were reflected in body mass and growth rates (Gabillard et al., 2003; Gabillard et al., 2006). As the main regulator of the GH/IGF system, nutritional status and its relationship with the system were widely investigated in fish (Dyer et al., 2004; Hevrøy et al., 2007; Taylor et al., 2008). A study in juvenile rainbow trout (3 g) showed differences in gene expression between diploids and triploids for proteins related to energy metabolism, including IGFeI, both during regular feeding and during shortterm (1-week) starvation and re-feeding (Cleveland and Weber, 2014). Another study, using different diets or feeding regimes, identified positive correlations between IGF-I concentration and growth rate in several fish species, including salmonids (Dyer et al., 2004). Therefore, it is likely that nutritional/energy status affect the growth of fish through growth-related gene expression. Given the fundamental role of dietary energy intake on growth dynamics in fish and the evidence supporting the significant effects of triploidy on macronutrient utilization (Sacobie et al., 2016), the present study aimed to investigate the effects of dietary lipid levels on triploid rainbow trout, especially relating to growth performance, digestive

supply of larger-sized fish with high quality meat (Sheehan et al., 1999). Therefore, the production of all-female triploid rainbow trout has been widely practiced in fish culture. Recent years have seen a rapid growth of trout farming in China. After importation of eyed eggs from USA, Norway and Denmark, female triploid rainbow trout are farmed in fresh water with clean, cold spring water for 2–3 years until reaching market size of around 4 kg. It has become one of the main cold-water fish species cultured in China with annual production of > 30,000 tons (Ma et al., 2019). Initial interest in triploids for use in aquaculture began in the mid1970s (Fraser et al., 2012). Numerous studies comparing diploids and triploid have shown differences in physiological aspects, such as survival, growth, haematology and immunocompetence (Benfey, 1999; Piferrer et al., 2009). Therefore, it is of high interest to evaluate the nutrient utilizations and dietary requirements of triploid fishes separately to their diploid counterparts (Fraser et al., 2012). Several studies have shown that triploid salmon have different requirements of phosphorus (Burke et al., 2010; Fjelldal et al., 2016) and histidine (Taylor et al., 2015), compared to diploids. However, there have been still very few studies of nutritional requirements focused on triploid rainbow trout. The lack of basic nutritional knowledge hampers the sustainable development of this industry. Lipids are one of the most important nutrients in fish feed. It is well established that dietary lipids are not only the most important source of energy and essential fatty acids, but also act as the carrier for essential fat-soluble nutrients (Sargent et al., 1999). The lipid requirements of normal diploid rainbow trout have been investigated in different studies and results varied during the years. It was accepted to be 12% (dry matter) in the early years (NRC, 1981), and then researchers found that fish fed diets with lipid level higher than 20% (dry matter) could gain better growth performance (Hecht and Mcewan, 1992; Luzzana et al., 1994; Gélineau et al., 2001). Although the data for triploid fish is still lacking, differences in lipid utilization, storage and mobilization between diploid and triploid brook charr (Sacobie et al., 2016) and rainbow trout (Manor et al., 2015) were observed. Therefore, the optimum dietary lipid levels of triploid and diploid rainbow trout might be different and need to be evaluated separately. Fish physiology conditions, such as digestive and metabolism 2

Aquaculture 513 (2019) 734394

Y. Meng, et al.

ability, health status, and expression of growth-related genes.

2.4. Chemical analysis Each feed ingredient and experimental diet was analyzed in triplicate for dry matter, crude protein, crude lipid and ash using standard methods of the Association of Official Analytical Chemists (1995). Samples of the ingredients and diets were dried to a constant weight at 105 °C to determine the moisture content. Crude lipid concentration was determined by ether extraction using Soxhlet method (36680analyer, BUCHI, Switzerland), crude protein was analyzed by measuring nitrogen (N × 6.25) using the Kjeldahl method (2300- Autoanalyzer, FOSS, Denmark), and ash by combustion at 550 °C. Gross energy was determined by burning the samples in an adiabatic bomb calorimeter (IKA Calorimeter, C400, Germany). Samples of liver, stomach, pyloric caeca and intestine were homogenized by an electric homogenizer (XHF-D, Xinzhi, China) on ice using the buffer specified for each enzyme according to the commercial kit manufacturer's instructions. The 10% w/v homogenate of each tissue was then centrifuged at 4 °C at 10,000 × g for 15 min, with the supernatant stored at −80 °C prior to analysis. Total anti-oxidative capacity (T-AOC) and malonaldehyde (MDA) contents in plasma, liver and intestine, lipase and amylase activities in digestive organs as well as tissue protein content were analyzed by using commercial kits (Najing Jiancheng Bioengineering Institute, China) as described in Ma et al. (2019). Acid protease activity in the stomach as well as alkaline protease activity in the pyloric caeca and intestine were assayed using the method of Natalia et al. (2004). Unit definition: the total protease in 1 mg protein, which hydrolyzed protein to 1 μg amino acid in 1 min at 37 °C, was considered as 1 activity unit. All the analyses were performed on four biological replicates for each treatment. Enzymological indexes of plasma such as Aspartate aminotransferase (AST), alanine amino transferase (ALT), alkaline phosphatase (ALP), lactate dehydrogenase (LDH) and creatine kinase (CK) were assayed in a certified hospital using standard clinical methods in an automatic biochemical analyzer (ADVIA 2400; SIEMENS, Munich, Germany). All the analyses were performed on four biological replicates for each treatment.

2. Materials and methods 2.1. Experimental diets Diet formulation and proximate compositions of the experimental diets are shown in Table 1. Fish meal was used as main dietary protein source, fish oil and soybean oil were used as the main lipid sources, wheat meal and corn starch were used as carbohydrate sources. Six isonitrogenous diets (dietary protein level: 46% dry matter) with graded lipid levels of 6.6, 12.3, 14.8, 19.5, 22.8 and 29.4% (measured by the Soxhlet method) were named as Diet 1, Diet 2, Diet 3, Diet 4, Diet 5 and Diet 6 respectively. All the experimental diets were produced by Tongwei Co., Ltd., China. The finely ground dry ingredients were thoroughly mixed in a commercial mixer (SLHSJ2, Muyang, China) and pulverized in a super micro mill (SWFL110B, Muyang, China). Subsequently, 3% soybean oil was mixed in. The mixture was steam pelleted using an extruder (X185, Wenger, USA) equipped with a 4 mm ring die. The pellets were immediately dried in a dryer (SKGD200 × 4, Jiuniu, China). The supplemental fish oil was then added to the diet using a vacuum coater (VACLMMIXER 2100*2600, LAMEC, Italy). The pellets were cooled in a vertical cooler and finally all diets were packaged and kept frozen at −20 °C until used. 2.2. Fish and feeding Sub-adult female triploid rainbow trout from the same population were obtained from Qinghai Minze Longyangxia Ecological Aquaculture Co., Ltd., China. Prior to the feeding trial, the fish were fed with a commercial diet to acclimate to the experimental conditions for two weeks. Then, all the fish were fasted for 48 h then weighed. A total of 2400 fish with an initial average weight of 233 g were randomly distributed into 24 net cages (3 × 3 × 6 m) with 100 fish each. Each cage was randomly assigned to one of the six experimental diets, resulting in 4 replicates for each diet. An 80-day feeding trial (from October to December) was conducted in Longyangxia reservoir, Qinghai province, China. Fish were hand-fed to apparent satiation twice daily at 08:30 and 16:30. During this period, feed consumption as well as the number and weight of dead fish were recorded. The water temperature ranged from 8 to 16 °C, and dissolved oxygen remained higher than 7 mg/l.

2.5. Intestinal morphology analysis For intestinal morphology analysis, one sample from each cage was randomly chosen from Diet 1, 3, 5 and 6 treatments (4 replicates per treatment). They were processed into paraffin wax blocks, cut into 5μm-thick cross sections using a microtome and then stained with haematoxylin and eosin for examination by light microscopy (ECLIPSE NieU, Nikon corporation, Tokyo Japan). Electronic images were further analyzed using Image J software (National Institutes of Health, Bethesda, MD, USA) for assessing dimensions of villus, enterocytes, microvillus, muscular layer and density of goblet cells as described in Cai et al. (2013) and Meng et al. (2017).

2.3. Sampling procedure After the feeding trial, all the experimental fish were fasted for 3 days, anesthetized with eugenol (1: 10000) (Shanghai Reagent Corp, China) and then counted and weighed. Blood samples of three randomly selected fish per net cage were taken from the caudal vein and collected in heparinized syringes and centrifuged (4000 ×g, 10 min) to separate plasma. Plasma samples with similar volume from three fish of the same net cage were pooled as one biological replicate. Samples of liver, stomach, pyloric caeca and intestine tissue from the bled fish were subsequently dissected and tissue samples of similar size was pooled, respectively, according to the same procedure for plasma. Four biological replicates for each treatment were produced, and all the samples were frozen in liquid nitrogen and then stored at −80 °C for further analysis. For morphology analysis, segments (1–2 cm lengths) of the mid-intestine from another three randomly selected fish per cage were collected and placed into Bouin fixative solution for fixation. After 24 h, the samples were transferred into 70% ethanol solution until further study.

2.6. Real-time quantitative PCR analysis of growth-related genes Total RNA was extracted from fish liver in Diet 1, 3, 5 and 6 treatments (four biological replicates for each treatments) using an RNA simple total RNA Kit (TIANGEN, China). RNA quality and quantity were assessed using agarose gel (1%) electrophoresis and spectrophotometric (A260: 280 nm ratio) analysis, respectively. RNA was reverse transcribed into cDNA using the PrimeScript™ RT reagent Kit (TaKaRa, China). Specific primers of the growth hormone receptor (ghr), insulin-like growth factor-I (igf1) and insulin-like growth factor-II (igf2) genes were designed based on the relevant cDNA sequences of rainbow trout (Table 2). qPCR was conducted with the Multiwell Plate 96 reaction system (LightCycler® 480, Roche, USA) in a final volume of 20 μl containing 0.5 μl (10 μM) each of forward and reverse primer, 10 μl SYBR® 3

Aquaculture 513 (2019) 734394

Y. Meng, et al.

Table 2 Primer sequences for real-time PCR. Target gene a

ghr

b

igf1

igf2c β-actin a b c

Primer sequence (5′-3′)

GenBank accession no.

F: CTCACCATTGGCTTCGGAGA R: GGTGTTGGAGAGGGGAAAGG F: ACTGTGCCCCTGTCAAGTCT R: CTGTGCTGTCCTACGCTCTG F: ATTGCGCTGGCACTTACTCT R: GGAGCGTCTGCTGTTAGACC F: TACAACGAGCTGAGGGTGGC R: GGCAGGGGTGTTGAAGGTCT

NM_001124731.1 M95183.1 M95184.1 AJ438158.1

ghr: growth hormone receptor. igf1: insulin-like growth factor-I. igf2: insulin-like growth factor-II. Fig. 1. Based on the broken-line regression analysis, relationship between dietary lipid levels and feed conversion ratio (FCR) indicates that the minimum dietary lipid level for the feed utilization of sub-adult triploid rainbow trout was 23.3% dry matter. Each point represents the mean of four replicates.

Premix Ex Taq™ II (2×), 1 μl cDNA and 8 μl ddH2O. Relative abundance of mRNA was normalized by the expression of β-actin and calculated using the 2-ΔΔCt method. 2.7. Calculations

linear and quadratic responses were observed on the final weight, SGR, FI and FCR as the level of dietary lipid increased in the present study (P < .05). With increasing dietary lipid levels from 6.6% to 29.4%, the final weight and SGR showed an increasing trend, while a decreasing trend was observed for the FCR. Based on the broken-line regression analysis of FCR, the minimum dietary lipid level of sub-adult female triploid rainbow trout was estimated to be 23.3% dry matter with a diet containing 46% protein (Fig. 1).

Specific growth rate (SGR,%/day) = 100 × ln [final body weight (g)/initial body weight (g)] /days of the experiment

Feed intake (FI,%/day) = 100 × feed fed (g)/[days ×(initial body weight (g) + final body weight

3.2. Digestive enzyme activities

(g))/2]

The activities of protease, lipase and amylase in different digestive organs of sub-adult triploid rainbow trout fed the experimental diets are presented in Table 4. There were linear and quadratic responses in stomach acid protease activity, amylase activity in pyloric caeca and intestine with dietary lipid level increased (P < .05), they all reached their maximum values in Diet 6 treatment. Moreover, the lipase activity in pyloric caeca generally increased linearly with increasing dietary lipid level (P < .05). Alkaline protease activity in pyloric caeca and intestine as well as intestinal lipase activity were not significantly affected by dietary lipid levels (P > .05).

Feed conversion ratio (FCR) = feed fed (g)/body weight gain (g) Survival rate (%) = 100 × [(final number of fish)/(initial number of fish)] 2.8. Statistical analysis Data were subjected to regression analysis (linear and quadratic) using SPSS 19.0 for Windows. Dietary lipid level (analyzed) served as the independent variable and a 5% level of probability (P < .05) was chosen in advance to sufficiently demonstrate a statistically significant difference. Gene expression data were analyzed using one-way ANOVA followed by a Duncan's test. The relationship between dietary lipid levels and FCR was estimated by broken-line regression analysis (Robbins et al., 1979; Robbins, 1986).

3.3. Intestinal morphology Cross-sections of the mid-intestine are shown in Fig. 2, Intestinal mucosa consist of a simple epithelium (E) and a lamina propria (LP). The epithelium layer was composed of a single layer of enterocytes, which were interspersed with mucous-secreting goblet cells (GCs) and various leucocytes (L) scattered throughout the mucosal surfaces. Gross qualitative observations of the mid-intestine revealed that all fish intestine samples were healthy and without obvious signs of intestinal inflammation. The results of quantitative assessment, based on electronic images,

3. Results 3.1. Growth performance The results of growth performance and feed utilization are presented in Table 3. No significant differences were found in initial weight and survival rate (98.3–100%) among all treatments (P > .05). Both

Table 3 Growth performance and feed utilization of sub-adult triploid rainbow trout fed the experimental diets for 80 days.

Initial weight (g) Final weight (g) Specific growth rate (%/day) Feed intake (%/day) Feed conversion ratio Survival rate (%) a

Diet 1

Diet 2

Diet 3

Diet 4

Diet 5

Diet 6

(6.6%)

(12.3%)

(14.8%)

(19.5%)

(22.8%)

(29.4%)

233 468 0.87 0.97 1.17 99.8

233 514 0.99 0.96 1.03 99

233 610 1.2 1.19 1.07 100

233 648 1.28 1.19 1.03 98.8

233 655 1.3 1.17 0.98 98.3

233 682 1.34 1.17 0.97 99.3

Pooled S.E.M.: pooled standard error of means. 4

Pooled S.E.M.a

Regression (P, r2) Linear

0.2 17 0.04 0.02 0.02 0.2

0.901 0.000 0.000 0.000 0.000 0.234

Quadratic 0.001 0.854 0.824 0.496 0.553 0.067

0.417 0.000 0.000 0.000 0.000 0.429

0.084 0.918 0.915 0.636 0.586 0.081

Aquaculture 513 (2019) 734394

Y. Meng, et al.

Table 4 Digestive enzyme activities of sub-adult triploid rainbow trout fed the experimental diets for 80 days. Digestive enzyme

Protease (U/mgprot) Lipase (U/gprot) Amylase (U/mgprot) a

Digestive organ

Stomach Pyloric caeca Intestine Pyloric caeca Intestine Pyloric caeca Intestine

Diet 1

Diet 2

Diet 3

Diet 4

Diet 5

Diet 6

Pooled

Regression (P, r2)

(6.6%)

(12.3%)

(14.8%)

(19.5%)

(22.8%)

(29.4%)

S.E.M.a

Linear

0.29 15.9 1.97 63.9 65.1 0.16 0.08

0.38 57.3 2.09 126.8 59.9 0.16 0.09

0.56 50.3 3.03 119.8 103.1 0.25 0.11

0.67 54.3 4.54 148 115.7 0.26 0.14

0.77 59.7 3.73 168.8 114.2 0.27 0.24

0.84 24.4 2.92 209.7 110.1 0.3 0.28

0.06 5.3 0.31 13.7 7.2 0.01 0.02

0.018 0.471 0.307 0.013 0.123 0.003 0.005

Quadratic 0.577 0.077 0.148 0.613 0.305 0.745 0.707

0.043 0.183 0.16 0.058 0.12 0.013 0.006

0.649 0.432 0.457 0.614 0.507 0.763 0.822

Pooled S.E.M.: pooled standard error of means.

2005). In the present study, fish fed diets with low lipid levels (6.6% and 12.3%) showed the lowest FI compared to other treatments. Similar results were also observed in other fish species (Du et al., 2005; Li et al., 2016a). The reason may be that fish usually avoid eating unbalanced diets or low energy diets and hence the diets with low lipid levels (< 12.3%) were not attractive for the fish. With increasing dietary lipid levels, FCR showed a decreasing trend with the lowest values observed in fish fed diets with the highest two lipid levels (22.8% and 29.4%). Improved feed efficiency by feeding diets with high lipid levels was also found in studies with diploid rainbow trout (Gélineau et al., 2001; Yigit et al., 2002). The consistent FCR values in Diet 5 (0.98) and 6 treatments (0.97) indicated that diets with a minimum lipid level of 22.8% may satisfy the basic needs of fish for lipids. Besides, from the practical standpoint, to reduce costs of feed while maintaining a relatively high growth rate, maximizing feed utilization is probably more important than maximizing growth. Therefore, a broken-line regression analysis of FCR was conducted and the results showed that the minimum dietary lipid level of triploid rainbow trout was estimated to be 23.3% dry matter with a diet containing 46% protein. Growth involves several processes and is strongly influenced by the digestive and absorptive physiology of an organism (Sagada et al., 2017). In order to keep the availability of nutrients, feed degradation in the digestive tract of fish largely depends on digestive enzymes. Adaptive changes in activities of digestion enzymes in relation to the dietary lipid levels were reported previously (Li et al., 2016b; Sivaramakrishnan et al., 2016; Qiang et al., 2016). The present study showed that with increasing dietary lipid levels, activities of protease, lipase and amylase increased, suggesting that fish could utilize feed efficiently when dietary lipid levels ranged from 14.8% to 29.4%. Similar results were also observed in other studies, in which low dietary lipid level resulted in low activities of digestive enzymes (Sivaramakrishnan et al., 2016; Qiang et al., 2016). The gastrointestinal tract is the first site of exposure to dietary ingredients. Therefore, the histomorphology of the gastrointestinal tract was commonly in focus to assess effects of feeds (Meng et al., 2017; Yu et al., 2014). In the present study, based on the results of growth performance and feed utilization, four treatments (Diet 1, 6.6%; Diet 3, 14.8%; Diet 5, 22.8% and Diet 6, 29.4%) were chosen to study the effects of dietary lipid levels on fish intestine. The histomorphology of the mid-intestine revealed that all the samples were healthy with no obvious signs of intestinal inflammation. Histomorphometric analysis showed that dietary lipid levels between 6.6% - 29.4% did not influence the heights of villus, enterocyte and microvillus, indicating that the absorptive function of triploid rainbow trout was not influenced by dietary lipid levels. However, muscular layer thickness and density of goblet cells significantly increased with increasing dietary lipid levels. Several studies of fish suggested that the thickening of muscular layer correlated with temporary storage and expulsion of faecal material, while an increased number of goblet cells indicated increased mucus production, which was associated with mucosal protection against shear stress and chemical damage as well as lubrication for faecal

are shown in Table 5. No significant differences were found in the heights of villus, enterocyte and microvillus (P > .05). The muscular layer thickness and density of goblet cells were linearly and quadratically related to the increasing of dietary lipid level (P < .05), both reaching their maximum value in Diet 6 treatment. 3.4. Anti-oxidative capacity As shown in Table 6, T-AOC content in fish liver and intestine as well as MDA content in liver were not affected by dietary lipid levels (P > .05). There were linear and quadratic responses in plasma T-AOC content, plasma MDA content and intestinal MDA content as the level of dietary lipid increased (P < .05). The lowest value of plasma T-AOC was noted in Diet 6 treatment. With increasing dietary lipid level, the plasma MDA content and intestinal MDA content showed a general increasing and decreasing trend, respectively. 3.5. Plasma enzymological indexes Data on plasma enzymological indexes of sub-adult triploid rainbow trout are shown in Table 7. There was no significant difference in the activities of ALT, ALP and LDH (P > .05). The plasma AST and CK activity was linearly and quadratically related to the increasing of dietary lipid level (P < .05). Fish fed diet containing 29.4% lipid showed the highest value of plasma AST and CK activity. 3.6. Relative mRNA expression levels of hepatic growth-related genes Relative mRNA expression levels of hepatic growth-related genes were significantly affected by dietary lipid levels (P < .05; Fig. 3). The gene expression levels of ghr and igf2 significantly increased as increasing dietary lipid levels (P < .05) and then plateaued in Diet 5 and 6 treatments (P > .05). The igf1 gene expression level in Diet 1 was significantly lower than it in Diet 3, 5, 6 treatments (P < .05), no difference was found among Diet 3, 5, 6 treatments (P > .05). 4. Discussion In the present study, we found that increased dietary lipid contents increased the growth performance of sub-adult triploid rainbow trout. Generally, a decline in growth might appear when fish were fed with excessive energy rich diets, as was observed in grass carp (Du et al., 2005), turbot (Regost et al., 2001), salmon (Silverstein et al., 1999) as well as rainbow trout (Weatherup et al., 1997). Our results suggest, that, triploid rainbow trout could use or tolerate high dietary lipid level (up to 29.4%) without compromising growth. Similar results were also found in diploid rainbow trout, in which fish fed with 30% lipid obtained higher value of SGR than fish fed with 20% dietary lipid (Gélineau et al., 2001). The growth of fish depends on the fish's nutrients intake and utilization. It is assumed that fish can adjust their feed intake to satisfy their digestible energy requirements (Du et al., 5

Aquaculture 513 (2019) 734394

Y. Meng, et al.

Fig. 2. Cross-section appearance of the mid-intestine in sub-adult triploid rainbow trout fed Diet 1 (a, a1), Diet 3 (b, b1), Diet 5 (c, c1), Diet 6 (d, d1) for 80 days, respectively (a/b/c/d: bar = 200 μm; a1/b1/c1/d1: bar = 50 μm.). E = epithelium, LP = lamina propria, VH = Villus height, MLT = Muscular layer thickness, GCs = goblet cells, L = leucocytes, EH = Enterocyte height, MH = Microvillus height.

expulsion (Grau et al., 1992; Murray et al., 2010). The mild intestinal histological changes found in the current study may be due to the fish's adaption to a relatively higher feed intake. However, due to the limited information on the effects of intestinal histomorphology caused by dietary lipid availability, further research is needed. Fish tissue is prone to oxidation due to its high content of lipids and fatty acid compositions. Lipid peroxidation is thought to cause destruction and damage of cell membranes, with potential pathological effects on cells and tissues (Zhu et al., 2016). To counter these effects, fish have developed antioxidant defenses (Lewis-McCrea and Lall,

2007). The T-AOC represents total enzyme and non-enzyme original antioxidative capacity of the body and MDA is one of the most readily assayed end products of both enzymatic and non-enzymatic lipid peroxidation reactions (Meng et al., 2017). They can be used as reliable indicators of fish health status as they have been extensively investigated in toxicological tests as stress parameters (Jin et al., 2013). In the present study, the T-AOC and MDA contents in liver and intestine were not affected by dietary lipid levels, suggesting that diets with high lipid levels up to 22.8% and 29.4% did not cause side effects to the health status of the digestion and metabolism organs in triploid 6

Aquaculture 513 (2019) 734394

Y. Meng, et al.

Table 5 Intestinal morphometric analysis of sub-adult triploid rainbow trout fed the experimental diets for 80 days.a Digestive organ

Villus height (μm) Enterocyte height (μm) Microvillus height (μm) Muscular layer thickness (μm) Density of goblet cells (numbers per villus) a

Diet 1

Diet 3

Diet 5

Diet 6

Pooled

Regression (P, r2)

(6.6%)

(14.8%)

(22.8%)

(29.4%)

S.E.M.a

Linear

591 44 1.78 168 13.8

634 44.3 1.63 212 15.6

652 53.3 1.81 214 20.8

655 47.9 1.73 270 23.7

14.3 1.5 0.02 9.9 1.4

0.076 0.251 0.614 0.002 0.036

Quadratic 0.342 0.100 0.033 0.728 0.441

0.23 0.531 0.149 0.010 0.006

0.343 0.100 0.419 0.734 0.771

Pooled S.E.M.: pooled standard error of means.

Table 6 Anti-oxidative capacity of sub-adult triploid rainbow trout fed the experimental diets for 80 days.

T-AOC MDAc

a b c

b

Liver (mmol/mgprot) Intestine (mmol/mgprot) Plasma (mmol/ml) Liver (mmol/mgprot) Intestine (nmol/mgprot) Plasma (nmol/ml)

Diet 1

Diet 2

Diet 3

Diet 4

Diet 5

Diet 6

Pooled

Regression (P, r2)

(6.6%)

(12.3%)

(14.8%)

(19.5%)

(22.8%)

(29.4%)

S.E.M.a

Linear

0.074 0.103 1.25 0.52 6.66 16.2

0.072 0.12 1.49 0.49 5.57 19.5

0.049 0.107 1.17 0.54 4.55 30.1

0.048 0.109 1.26 0.44 5.21 31.1

0.045 0.103 1.037 0.64 4.14 31.8

0.056 0.119 0.85 0.45 3.41 40.1

0.005 0.005 0.06 0.03 0.33 2.1

0.106 0.911 0.002 0.494 0.000 0.006

Quadratic 0.33 0.002 0.758 0.069 0.934 0.684

0.205 0.650 0.014 0.754 0.000 0.030

0.41 0.134 0.76 0.09 0.937 0.689

Pooled S.E.M.: pooled standard error of means. T-AOC: total anti-oxidative capacity. MDA: malondialdehyde.

Table 7 Plasma enzymological indexes of sub-adult triploid rainbow trout fed the experimental diets for 80 days. Plasma Enzymes

Diet 1

Diet 2

Diet 3

Diet 4

Diet 5

Diet 6

Pooled

Regression (P, r2)

(U/l)

(6.6%)

(12.3%)

(14.8%)

(19.5%)

(22.8%)

(29.4%)

S.E.M.a

Linear

244 10.3 152 251 1847

215 10.7 142 167 2293

241 12.3 145 201 2780

254 11.8 164 204 3303

254 11.5 173 172 4629

305 12.8 171 170 5309

11 0.5 4.4 11 377

0.044 0.051 0.101 0.189 0.010

b

AST ALTc ALPd LDHe CKf a b c d e f

Quadratic 0.297 0.282 0.208 0.139 0.437

0.077 0.15 0.105 0.321 0.028

0.372 0.292 0.336 0.187 0.479

Pooled S.E.M.: pooled standard error of means. AST: aspartate aminotransferase. ALT; alanine aminotransferase. ALP: alkaline phosphatase. LDH: lactate dehydrogenase. CK: creatine kinase.

rainbow trout. Similar evidence was found for plasma enzymological indexes. AST, ALT, ALP and LDH belong to the non-plasma-specific enzymes which are located within tissue cells and have no known physiological function in plasma (Hemre and Sandnes, 1999; Jiang et al., 2015). Thus, elevated levels of these plasma enzymes can be interpreted as indicators for liver damage and dysfunctions (Wang et al., 2016). In the present study, the activities of ALT, ALP and LDH in plasma were not different between low and high lipid level treatments. Different results were reported in a study with hybrid snakehead, where excess dietary lipid levels caused an elevated ALT and decreased ALP level in plasma (Zhang et al., 2017). Based on these results, triploid rainbow trout seems to be able to use or tolerate high dietary lipid levels (up to 29.4%) with no negative effect on fish liver and intestine health. Numerous studies have suggested that GH and IGFs are essential for modulating the growth of fish and can be evaluated by their hepatic mRNA expressions (Rolland et al., 2015). Measuring IGF-I can be a useful tool to detect, and possibly predict, subtle changes in growth, and provide an alternative method to traditional techniques for optimizing diet formulation (Dyer et al., 2004). In the present study, based

Fig. 3. Relative mRNA expression of growth hormone receptor (ghr), insulin-like growth factor-I (igf1) and insulin-like growth factor-II (igf2) genes in liver of subadult triploid rainbow trout fed the experimental diets for 80 days. Columns represented the mean ± S.E.M. of four replicate groups. Columns that do not have the same superscript are significantly different (P < .05). 7

Aquaculture 513 (2019) 734394

Y. Meng, et al.

on the results of growth performance, four treatments (Diet 1, 6.6%; Diet 3, 14.8%; Diet 5, 22.8% and Diet 6, 29.4%) were chosen to study the effects of dietary lipid levels on hepatic mRNA expression of growth-related genes. Hepatic ghr, igf1 and igf2 expression levels were generally increasing with dietary lipid levels up to 22.8% and did not increase further in higher levels. This result was close to the estimated minimum lipid level of sub-adult triploid rainbow trout (23.3%). Due to the growth-promoting-effect of GH and IGFs, it is reasonable to conclude that the fast growth of triploid rainbow trout in Diet 5 and 6 treatments may partly be because of the high dietary lipid levels (22.8% and 29.4%) promoting hepatic ghr, igf1 and igf2 gene expression. A study with pejerrey also showed that the optimal dietary lipid level improved growth of fish by promoting the proper functioning of GH/ IGF system (Gómez-Requeni et al., 2012). In conclusion, triploid rainbow trout could use or tolerate high dietary lipid level (up to 29.4%) with no negative effect on fish growth, feed utilization and fish liver and intestine health. Based on the FCR, the minimum level of dietary lipid for sub-adult triploid rainbow trout was estimated to be 23.3% dry matter with a diet containing 46% protein, which was also reflected by hepatic growth-related genes (ghr, igf1 and igf2) expressions. Thus, based on the present study, diets with lipid levels between 23% and 30% (at protein level of 46%) can be recommended for triploid rainbow trout.

and hepatic lipogenesis in rainbow trout. Reprod. Nutr. Dev. 41, 487–503. Gómez-Requeni, P., Kraemer, M.N., Canosa, L.F., 2012. Regulation of somatic growth and gene expression of the GH–IGF system and PRP-PACAP by dietary lipid level in early juveniles of a teleost fish, the pejerrey (odontesthes bonariensis). J. Comp. Physiol. B. 182, 517–530. Grau, A., Crespo, S., Sarasquete, M.C., Canales, M.L.G.D., 1992. The digestive tract of the amberjack Seriola dumerili, Risso: a light and scanning electron microscope study. J. Fish Biol. 41, 287–303. Hecht, T., Mcewan, A.G., 1992. Changes in gross protein and lipid requirements of rainbow trout, Oncorhynchus mykiss (Walbaum), at elevated temperatures. Aquac. Res. 23, 133–148. Hemre, G.-I., Sandnes, K., 1999. Effect of dietary lipid level on muscle composition in Atlantic salmon Salmo salar. Aquac. Nutr. 5, 9–16. Hevrøy, E.M., Elmowafi, A., Taylor, R.G., Olsvik, P.A., Norberg, B., Espe, M., 2007. Lysine intake affects gene expression of anabolic hormones in Atlantic salmon, Salmo salar. Gen. Comp. Endocrinol. 152, 39–46. Jiang, S., Wu, X., Li, W., Wu, M., Luo, Y., Lu, S., Lin, H., 2015. Effects of dietary protein and lipid levels on growth, feed utilization, body and plasma biochemical compositions of hybrid grouper (Epinephelus lanceolatus ♂ × Epinephelus fuscoguttatus ♀) juveniles. Aquaculture. 446, 148–155. Jin, Y., Tian, L., Zeng, S., Xie, S., Yang, H., Liang, G., Liu, Y., 2013. Dietary lipid requirement on non-specific immune responses in juvenile grass carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 34, 1202–1208. Lewis-McCrea, L.M., Lall, S.P., 2007. Effects of moderately oxidized dietary lipid and the role of vitamin E on the development of skeletal abnormalities in juvenile Atlantic halibut (Hippoglossus hippoglossus). Aquaculture. 262, 142–155. Li, A., Yuan, X., Liang, X.F., Liu, L., Li, J., Li, B., Fang, J., Li, J., He, S., Xue, M., 2016a. Adaptations of lipid metabolism and food intake in response to low and high fat diets in juvenile grass carp (Ctenopharyngodon idellus). Aquaculture 457, 43–49. Li, S., Mai, K., Xu, W., Yuan, Y., Zhang, Y., Zhou, H., Ai, Q., 2016b. Effects of dietary lipid level on growth, fatty acid composition, digestive enzymes and expression of some lipid metabolism related genes of orange-spotted grouper larvae (Epinephelus coioides H.). Aquac. Res. 47, 2481–2495. Luzzana, U., Serrini, G., Moretti, V.M., Gianesini, C., Valfrè, F., 1994. Effect of expanded feed with high fish oil content on growth and fatty acid composition of rainbow trout. Aquacult. Int. 2, 239–248. Ma, R., Liu, X., Meng, Y., Wu, J., Zhang, L., Han, B., Qian, K., Luo, Z., Wei, Y., Li, C., 2019. Protein nutrition on subadult triploid rainbow trout (1): dietary requirement and effect on anti-oxidative capacity, protein digestion and absorption. Aquaculture 507, 428–434. Manor, M.L., Weber, G.M., Cleveland, B.M., Kenney, P.B., 2014. Effects of feeding level and sexual maturation on fatty acid composition of energy stores in diploid and triploid rainbow trout (Oncorhynchus mykiss). Aquaculture 418-419, 17–25. Manor, M.L., Cleveland, B.M., Weber, G.M., Kenney, P.B., 2015. Effects of sexual maturation and feeding level on fatty acid metabolism gene expression in muscle, liver, and visceral adipose tissue of diploid and triploid rainbow trout, Oncorhynchus mykiss. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 179, 17–26. Meng, Y., Ma, R., Ma, J., Han, D., Xu, W., Zhang, W., Mai, K., 2017. Dietary nucleotides improve the growth performance, antioxidative capacity and intestinal morphology of turbot (Scophthalmus maximus). Aquac. Nutr. 23, 585–593. Murray, H.M., Wright, G.M., Goff, G.P., 2010. A comparative histological and histochemical study of the post-gastric alimentary canal from three species of pleuronectid, the Atlantic halibut, the yellowtail flounder and the winter flounder. J. Fish Biol. 48, 187–206. Natalia, Y., Hashim, R., Ali, A., Chong, A., 2004. Characterization of digestive enzymes in a carnivorous ornamental fish, the Asian bony tongue Scleropages formosus (Osteoglossidae). Aquaculture 233, 305–320. National Research Council (NRC), 1981. Nutrient Requirements of Coldwater Fishes. Nutrient Requirements of Domestic Animals. National Academy of Sciences, Washington DC, USA. Piferrer, F., Beaumont, A., Falguière, J.C., Flajšhans, M., Haffray, P., Colombo, L., 2009. Polyploid fish and shellfish: production, biology and applications to aquaculture for performance improvement and genetic containment. Aquaculture. 293, 125–156. Plisetskaya, E.M., 1998. Some of my not so favorite things about insulin and insulin-like growth factors in fish. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 121, 3–11. Qiang, J., He, J., Yang, H., Sun, Y.L., Tao, Y.F., Xu, P., Zhu, Z.X., 2016. Dietary lipid requirements of larval genetically improved farmed tilapia, Oreochromis niloticus (L.), and effects on growth performance, expression of digestive enzyme genes, and immune response. Aquac. Res. 48, 2827–2840. Regost, C., Arzel, J., Cardinal, M., Robin, J., Laroche, M., Kaushik, S.J., 2001. Dietary lipid level, hepatic lipogenesis and flesh quality in turbot (Psetta maxima). Aquaculture. 193, 291–309. Robbins, K.R., 1986. A Method, SAS Program, and Example for Fitting the Broken-Line to Growth Data. University of Tennessee Agricultural Experiment Station. Robbins, K.R., Norton, H.W., Baker, D.H., 1979. Estimation of nutrient requirements from growth data. J. Nutr. 109, 1710–1714. Rolland, M., Dalsgaard, J., Holm, J., Gómez-Requeni, P., Skov, P.V., 2015. Dietary methionine level affects growth performance and hepatic gene expression of GH-IGF system and protein turnover regulators in rainbow trout (Oncorhynchus mykiss) fed plant protein-based diets. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 181, 33–41. Sacobie, C.F.D., Burke, H.A., Lall, S.P., Benfey, T.J., 2016. The effect of dietary energy level on growth and nutrient utilization by juvenile diploid and triploid brook charr, Salvelinus fontinalis. Aquac. Nutr. 22, 1091–1100. Sagada, G., Chen, J., Shen, B., Huang, A., Sun, L., Jiang, J., Jin, C., 2017. Optimizing protein and lipid levels in practical diet for juvenile northern snakehead fish (Channa argus). Anim. Nutr. 3, 156–163.

Acknowledgements This research was financially supported by grants from the National Natural Science Foundation of China (No. 31860731) and the Provincial Natural Science Foundation of Qinghai, China (2016-NK135). We would like to thank Guocai Dong, Jianhua Hou, Maocuo Niang, Jinjie Guo, Guilan Jiang for their support and help during this study. Special thanks to Dr. Gerrit Timmerhaus and Dr. Ian Mather for their kind help in revision of the manuscript. References Association of Official Analytical Chemists (AOAC), 1995. Official Methods of Analysis of Official Analytical Chemists International, 16th edn. Association of Official Analytical Chemists, Arlington, VA. Benfey, T.J., 1999. The physiology and behavior of triploid fishes. Rev. Fish. Sci. 7, 39–67. Burke, H.A., Sacobie, C.F.D., Lall, S.P., Benfey, T.J., 2010. The effect of triploidy on juvenile Atlantic salmon (Salmo salar) response to varying levels of dietary phosphorus. Aquaculture 306, 259–301. Cai, C., Song, L., Wang, Y., Wu, P., Ye, Y., Zhang, Z., Yang, C., 2013. Assessment of the feasibility of including high levels of rapeseed meal and peanut meal in diets of juvenile crucian carp (Carassius auratus gibelio ♀ × Cyprinus carpio ♂): growth, immunity, intestinal morphology, and microflora. Aquaculture 410, 203–215. Cleveland, B.M., Weber, G.M., 2014. Ploidy effects on genes regulating growth mechanisms during fasting and refeeding in juvenile rainbow trout (Oncorhynchus mykiss). Mol. Cell. Endocrinol. 382, 139–149. Du, Z.Y., Liu, Y.J., Tian, L.X., Wang, J.T., Wang, Y., Liang, G.Y., 2005. Effect of dietary lipid level on growth, feed utilization and body composition by juvenile grass carp (Ctenopharyngodon idella). Aquac. Nutr. 11, 139–146. Dyer, A.R., Barlow, C.G., Bransden, M.P., Carter, C.G., Glencross, B.D., Richardson, N., Thomas, P.M., Williams, K.C., Carragher, J.F., 2004. Correlation of plasma IGF-I concentrations and growth rate in aquacultured finfish: a tool for assessing the potential of new diets. Aquaculture. 236, 583–592. Fjelldal, P.G., Hansen, T.J., Lock, E.J., Wargelius, A., Fraser, T.W.K., Sambraus, F., ElMowafi, A., Albrektsen, S., Waagbø, R., Ørnsrud, R., 2016. Increased dietary phosphorous prevents vertebral deformities in triploid Atlantic salmon (Salmo salar L.). Aquac. Nutr. 22, 72–90. Fraser, T.W.K., Fjelldal, P.G., Hansen, T., Mayer, I., 2012. Welfare considerations of triploid fish. Rev. Fish. Sci. 20, 192–211. Fuentes, E.N., Valdés, J.A., Molina, A., Björnsson, B.T., 2013. Regulation of skeletal muscle growth in fish by the growth hormone - insulin-like growth factor system. Gen. Comp. Endocrinol. 192, 136–148. Gabillard, J.C., Weil, C., Rescan, P.Y., Navarro, I., Gutiérrez, J., Le, B.P., 2003. Effects of environmental temperature on IGF1, IGF2, and IGF type I receptor expression in rainbow trout (Oncorhynchus mykiss). Gen. Comp. Endocrinol. 133, 233–242. Gabillard, J.C., Kamangar, B.B., Montserrat, N., 2006. Coordinated regulation of the GH/ IGF system genes during refeeding in rainbow trout (Oncorhynchus mykiss). J. Endocrinol. 191, 15–24. Gélineau, A., Corraze, G., Boujard, T., Larroquet, L., Kaushik, S., 2001. Relation between dietary lipid level and voluntary feed intake, growth, nutrient gain, lipid deposition

8

Aquaculture 513 (2019) 734394

Y. Meng, et al. Sargent, J., McEvoy, L., Estevez, A., Bell, J.G.B., Bell, M., Henderson, J., Tocher, D., 1999. Lipid nutrition of marine fish during early development: current status and future directions. Aquaculture 179, 217–229. Sheehan, R.J., Shasteen, S.P., Suresh, A.V., Kapuscinski, A.R., Seeb, J.E., 1999. Better growth in all-female diploid and triploid rainbow trout. Trans. Am. Fish. Soc. 128, 491–498. Silverstein, J.T., Shearer, K.D., Dickhoff, W.W., Plisetskaya, E.M., 1999. Regulation of nutrient and energy balance in salmon. Aquaculture 177, 161–169. Sivaramakrishnan, T., Sahu, N.P., Jain, K.K., Muralidhar, A.P., Saravanan, K., Ferosekhan, S., Praveenraj, J., Artheeswaran, N., 2016. Optimum dietary lipid requirement of Pangasianodon hypophthalmus juveniles in relation to growth, fatty acid profile, body indices and digestive enzyme activity. Aquacult. Int. 1–14. Stephan, G., Guillaume, J., Lamour, F., 1995. Lipid peroxidation in turbot (Scophthalmus maximus) tissue: effect of dietary vitamin E and dietary n-6 or n-3 polyunsaturated fatty acids. Aquaculture. 130, 251–268. Taylor, J.F., Porter, M.J.R., Bromage, N.R., Migaud, H., 2008. Relationships between environmental changes, maturity, growth rate and plasma insulin-like growth factor-I (IGF-I) in female rainbow trout. Gen. Comp. Endocrinol. 155, 257–270. Taylor, J.F., Waagbø, R., Diez-Padrisa, M., Campbell, P., Walton, J., Hunter, D., Matthew, C., Migaud, H., 2015. Adult triploid Atlantic salmon (Salmo salar) have higher dietary histidine requirements to prevent cataract development in seawater. Aquac. Nutr. 21, 18–32. Wang, J., Lu, R., Sun, J., Xie, D., Yang, F., Nie, G., 2016. Differential expression of lipid metabolism-related genes and miRNAs in Ctenopharyngodon idella liver in relation to

fatty liver induced by high non-protein energy diets. Aquac. Res. 1–16. Weatherup, R.N., McCracken, K.J., Foy, B., Rice, D., McKendry, J., Mairs, R.J., Hoey, R., 1997. The effects of dietary fat on performance and body composition of farmed rainbow trout (Oncoryhnchus mykiss). Aquaculture. 151, 173–184. Xu, J.H., Qin, J., Yan, B.L., Zhu, M., Luo, G., 2011. Effects of dietary lipid levels on growth performance, feed utilization and fatty acid composition of juvenile Japanese seabass (Lateolabrax japonicus) reared in seawater. Aquacult. Int. 19, 79–89. Yi, X., Zhang, F., Xu, W., Li, J., Zhang, W., Mai, K., 2014. Effects of dietary lipid content on growth, body composition and pigmentation of large yellow croaker Larimichthys croceus. Aquaculture. 434, 355–361. Yigit, M., Yardim, Ö., Koshio, S., 2002. The protein sparing effects of high lipid levels in diets for rainbow trout (Oncorhynchus mykiss, W. 1792) with special reference to reduction of total nitrogen excretion. Isr. J. Aquacult. 54, 79–88. Yu, H.H., Han, F., Xue, M., Wang, J., Tacon, P., Zheng, Y.H., Wu, X.F., Zhang, Y.J., 2014. Efficacy and tolerance of yeast cell wall as an immunostimulant in the diet of Japanese seabass (Lateolabrax japonicus). Aquaculture. 432, 217–224. Zhang, Y., Sun, Z., Wang, A., Ye, C., Zhu, X., 2017. Effects of dietary protein and lipid levels on growth, body and plasma biochemical composition and selective gene expression in liver of hybrid snakehead (channa maculate ♀ × channa argus ♂) fingerlings. Aquaculture. 468, 1–9. Zhu, H., He, A., Chen, L., Qin, J., Li, E., Li, Q., Wang, H., Zhang, T., Su, X., 2016. Effects of dietary lipid level and n-3/n-6 fatty acid ratio on growth, fatty acid composition and lipid peroxidation in Russian sturgeon Acipenser gueldenstaedtii. Aquac. Nutr. 23, 879–890.

9