- Email: [email protected]
Effects of dietary plant protein sources influencing hepatic lipid metabolism and hepatocyte apoptosis in hybrid grouper (Epinephelus lanceolatus♂ × Epinephelus fuscoguttatus♀)
Aquaculture 506 (2019) 437–444
Contents lists available at ScienceDirect
Aquaculture journal homepage: www.elsevier.com/locate/aquaculture
Effects of dietary plant protein sources influencing hepatic lipid metabolism and hepatocyte apoptosis in hybrid grouper (Epinephelus lanceolatus♂ × Epinephelus fuscoguttatus♀)
T
Huaqun Ye, Minglei Xu, Leling Chen, Xiaohong Tan, Shu Chen, Cuiyun Zou, Zhenzhu Sun, ⁎ ⁎ Qingying Liu, Chaoxia Ye , Anli Wang Institute of Modern Aquaculture Science and Engineering, Guangzhou Key Laboratory of Subtropical Biodiversity and Biomonitoring, Guangdong Provincial Key Laboratory for Healthy and Safe Aquaculture, School of Life Science, South China Normal University, Guangzhou 510631, People's Republic of China
A R T I C LE I N FO
A B S T R A C T
Keywords: Hybrid grouper Fish meal Plant protein Lipid metabolism Apoptosis
A 56-day feeding trial was conducted to evaluate the effects of replacing dietary fish meal (FM) with a complementary mixture of plant protein (PP) consisting of soybean meal (SBM), corn gluten meal (CGM) and cottonseed meal (CSM) on hepatic lipid metabolism and hepatocyte apoptosis in juvenile hybrid grouper, Epinephelus lanceolatus♂ × E. fuscoguttatus♀ (31.64 ± 0.82 g). A basal diet (FM60) with FM as the sole protein source was compared to diets progressively replacing 25% (FM45), 50% (FM30) and 75% (FM15) of FM protein. No significant differences were observed in growth performance and feed utilization when up to 75% of FM protein was replaced by PP sources. The hepatosomatic index (HSI) was markedly increased as dietary PP inclusion increased, but crude lipid content in the liver showed the opposite trend. Plasma cholesterol (CHO), high-density lipoprotein cholesterol (HDL-C) and low-density lipoprotein cholesterol (LDL-C) of fish fed the PP containing diets were all significantly lower than the control. Liver histological analysis showed a higher levels of hepatocyte vacuolization and nuclear pycnosis occurred as dietary PP inclusion increased, but the amounts of hepatic lipid droplets showed a decreasing trend with increasing PP inclusion levels. Moreover, dietary PP inclusion down-regulated the mRNA levels of lipid metabolism-related genes including peroxisome proliferatoractivated receptor alpha (PPARα), carnitine palmitoyltransferase 1 (CPT1), apolipoprotein AI (Apo-AI) and lipoprotein lipase (LPL). On the other hand, dietary PP sources also down-regulated the apoptosis-related genes including caspase-3, caspase-7, caspase-8 and p53. The present study provided new evidence for the PP sourcesinduced lipid metabolism in carnivorous fish, and provided new insight into the relationship between dietary PP sources and cell apoptosis.
1. Introduction The global fish meal (FM) demands have far exceeded its supply in the last decades. Currently, finding available supply and economical feasible alternative protein ingredients for FM is a major objective for sustainable aquaculture in the future (Naylor et al., 2009). Among all the alternatives, plant protein (PP) ingredients, such as soybean meal (SBM), corn gluten meal (CGM) and cottonseed meal (CSM), have been widely recommended specifically regarding the cost as they seem to be cheaper compared to FM. And using mixtures of those PP sources with various nutrition properties is usually a more adequate strategy for replacing FM protein than using individual alternative protein sources (Oliva-Teles et al., 2015; Zhang et al., 2012). It is predicted that the
⁎
development and sustainability of future aquaculture could significantly depend on the identification of new suitable less costly alternative PP ingredients that can replace FM without compromising the performance of the animals (Gatlin et al., 2007). However, when considering PP ingredients in aquafeeds aspects such as imbalanced essential amino acid (EAA), the presence of anti-nutritional factors (ANFs) and complex carbohydrates must be addressed, which could impose some limitation to their use in diet formulations (NRC, 2011; Vielma et al., 2003). Caution must be also taken to avoid unintended consequences in fish health, liver histology and function, lipid metabolism as well as immune status. In fish, lipids act as a major energy source, and lipid stores support various physiological, developmental and reproductive processes
Corresponding authors. E-mail addresses: [email protected] (C. Ye), [email protected] (A. Wang).
https://doi.org/10.1016/j.aquaculture.2019.03.075 Received 3 February 2019; Received in revised form 31 March 2019; Accepted 31 March 2019 Available online 02 April 2019 0044-8486/ © 2019 Elsevier B.V. All rights reserved.
Aquaculture 506 (2019) 437–444
H. Ye, et al.
(Tocher, 2003). Generally, dietary protein source per se influences the regulation of lipid metabolism affecting the gene expression and activity of lipogenic enzymes as well as adipocites lipolysis (Albalat et al., 2005; Dias et al., 1998). Available knowledge showed that lipid composition and metabolism in cultivated fish species could be remarkably affected when dietary FM was replaced by PP ingredients (Dias et al., 2005; Gu et al., 2014; Messina et al., 2013; Pratoomyot et al., 2010; Yu et al., 2015). It has been well established that plant feedstuff generally has a hypocholesterolemic effect on farmed fish, being characterized by lower liver and plasma triglyceride as well as cholesterol (CHO) levels (Dias et al., 2005; Maita et al., 2006; Ramdath et al., 2017; SitjàBobadilla et al., 2005; Ye et al., 2019). In contrast, several studies have reported that a hyperlipidemia or hepatic fat deposition were found in cultivated fish fed with a PP containing diet (Yaghoubi et al., 2016; Yin et al., 2018). This controversy may stem from the discrepancy in fish species, growth status, rearing conditions, dietary compositions, feeding strategy and more specifically in PP ingredients as well as ANFs. Due to the complexity of the mechanism by which the dietary protein source per se could affect lipid metabolism in fish and because of the variety of alternate protein sources especially PP ingredients, it is necessary to investigate the underlying molecular mechanism of PP sources-induced lipid metabolism in farmed fish. On the other hand, the immunity of fish could also be largely affected by feed ingredients and its nutrients (Kiron, 2012). Fish liver is known to be the main organ for detoxification and the normal structure and function of which is closely associated with immunity. As one of the central regulatory features of immune defence mechanism against abiotic, biotic or chemical mediated stress, apoptosis (programmed cell death) is a normal physiological process that plays a central role in the differentiation and maintenance of the liver (Cheng et al., 2015; Schuster and Krieglstein, 2002; Teodoro and Branton, 1997). Apoptosis is orchestrated by a family of cysteine proteases known as the caspases (Slee et al., 2001). Two major pathways of caspase activation have been elucidated in vertebrates undergoing apoptosis, namely the extrinsic pathway (death receptor pathway) that directly activates the initiator caspase-8 and the intrinsic pathway (mitochondrial pathway) that is initiated by the release of cytochrome c activating downstream initiator caspse-9 and effector caspase-3 (Takle and Andersen, 2010). Meanwhile, caspase-7 was also considered to be an important downstream effector caspase that primarily playing a supportive role in the execution phase of apoptosis (Brentnall et al., 2013). In addition, there are other signaling pathways such as p53-dependent pathway which responds to stressors that disrupt the fidelity of DNA replication and cell division (Harris and Levine, 2005). To date, there is no study concerning dietary PP sources-induced apoptotic cell death in fish, making this topic worth investigation. The hybrid grouper (E. fuscoguttatus ♀ × E. lanceolatus ♂), a new carnivorous species that was first produced at Borneo Marine Research Institute of Universiti Malaysia Sabah (Ch Ng and Senoo, 2008), is considered as a potential candidate for marine aquaculture production in Asian region and has been globally commercialized because of its high market value and appreciated flesh. However, so far, studies regarding the effects of dietary PP sources on lipid metabolism and cell apoptosis of hybrid grouper are scarce. Therefore, the present study was undertaken to evaluate the effects of replacing FM with a complementary mixture of PP sources consisting of SBM, CGM and CSM, with supplemental lysine, methionine and taurine, on growth performance, liver histology, lipid metabolism and cell apoptosis, as well as the hepatic gene expression of juvenile hybrid grouper.
Table 1 Formulation and proximate composition of the experimental diets (g kg−1 dry diet). Ingredients
FM60
FM45
FM30
FM15
White fish meala Soybean mealb Corn gluten mealc Cottonseed meald Wheat flour Fish oil Brewer's yeast Ca(H2PO4)2 Lecithin Choline chloride (50%) Vitamin C Mineral and vitamin mixe Cellulose Lysinef Methionineg Taurineh Cholesterol Nutrient levels (g kg−1 dry diet) Moisture Crude protein Crude lipid Ash
600.0 0.0 0.0 0.0 120.0 50.0 20.0 20.0 10.0 5.0 5.0 20.0 140.0 0.0 0.0 0.0 10.0
450.0 73.6 51.9 53.6 120.0 58.3 20.0 20.0 10.0 5.0 5.0 20.0 88.0 3.8 0.9 10.0 10.0
300.0 147.1 103.8 107.1 120.0 66.6 20.0 20.0 10.0 5.0 5.0 20.0 45.9 7.6 1.8 10.0 10.0
150.0 220.7 155.7 160.7 120.0 74.9 20.0 20.0 10.0 5.0 5.0 20.0 4.0 11.3 2.7 10.0 10.0
80.0 430.8 100.3 130.9
84.8 433.1 103.5 121.8
89.1 440.2 114.5 103.1
84.2 440.7 109.5 89.0
a Peruvian anchovy meal (10.28% moisture, 65.83% crude protein, 9.11% crude lipid), Peru. b Dehulled and defatted soybean meal (3.30% moisture, 44.75% crude protein, 3.60% crude lipid), Zhanjiang Bohai Agriculture Development Co., Ltd., China. c Corn gluten meal (5.05% moisture, 63.42% crude protein, 2.96% crude lipid), Qinhuangdao Lihua Starch Co., Ltd., China. d Concentrated cottonseed meal (8.25% moisture, 61.44% crude protein, 2.24% crude lipid), Anxiang Xinrui Biotechnology Co., Ltd., China. e Mineral and vitamin mix, Guangzhou Chengyi Aquatic Technology Co., Ltd., China. f L-lysine mono-hydrochloride, Guangzhou Rikang Nutrition Technology Co., Ltd., China. g L-methionine, Guangzhou Rikang Nutrition Technology Co., Ltd., China. h Taurine, Guangzhou Rikang Nutrition Technology Co., Ltd., China.
concentrated CSM were employed as substitutes for FM protein. A Peruvian anchovy meal was selected as the control (FM60), and 25% (FM45), 50% (FM30) and 75% (FM15) of the anchovy meal was replaced with a combination of SBM, CGM and CSM. At each FM replacement, PP ingredients were added equivalent to the amount of protein in the FM replaced. PP based diets were supplemented with crystalline lysine, methionine and taurine to simulate those levels existing in the FM based diet. When preparing the diets, all of the dried ingredients were finely ground into powder, weighed and thoroughly mixed in a groove form mixer (CH-50, Shanghai Tianxiang & Chentai Pharmaceutical Machinery Co., Ltd., Shanghai, China). Distilled water (30% diet mix) was added and thoroughly blended, then pelleted into 2.5-mm diameter size using a pellet-making machine (Valva-60, Guangzhou Weilawei Machinery Co., Ltd., Guangzhou, China). The pellets were then oven-dried at 70 °C for 5 h and stored in plastic bags at −20 °C until used. 2.2. Experimental fish and feeding trial The hybrid grouper juveniles were obtained and transported from Marine Fisheries Development Center of Guangdong Province (Huizhou, China) to the research center of Zhanjiang Guolian Feed Co., Ltd. (Zhanjiang, China). Fish were then acclimatized to the experimental conditions while feeding on a commercial diet (Guangdong Yuequn Ocean Biological Research Development Co., Ltd., Jieyang, China) twice daily for 2 weeks. After the acclimatization, healthy fish with an average body weight of 31.64 ± 0.82 g were distributed
2. Materials and methods 2.1. Experimental diets preparation The formulation and proximate composition of the experimental diets are given in Table 1. Dehulled and defatted SBM, CGM and 438
Aquaculture 506 (2019) 437–444
H. Ye, et al.
randomly into 12 cylindrical tanks (400 L, 3 tanks per diet, 30 fish per tank). Fish were hand-fed twice daily at 8:00 and 16:00 to apparent satiation for 56 days. During the rearing period, each tank had supplemental aeration and continuous flow of water at a rate of 3 L min−1 in a re-circulating system. Water temperature was ranged from 25.2 to 28.2 °C, salinity from 28 to 32 psu, pH from 7.4 to 7.8, dissolved oxygen ≥6.0 mg L−1, NH4+-N ≤ 0.2 mg L−1 and NO2−-N ≤ 0.1 mg L−1.
2.6. Plasma biochemical measurements
2.3. Sample collection and analysis
2.7. Liver histological analysis
At the end of the feeding trial, all fish populations and mean body weight in each tank were determined. Then three fish from each tank were sampled and stored at −20 °C for analysis of whole body composition. Six fish randomly selected from each tank were anesthetized with tricaine methanesulfonate (MS-222; Sigma, St. Louis, MO, USA) at 100 mg L−1 and blood was collected by caudal venipuncture using 2 mL heparinized syringes. Blood samples were collected into anticoagulation tubes in order to obtain plasma. After collection, the whole blood was centrifuged at a rate of 3000 rpm for 15 min at 4 °C. The plasma samples were subsequently separated and stored at −80 °C for measurement of biochemical parameters. Viscera and liver of six fish sampled from each tank were collected and weighed. For histological analysis, the liver tissue samples were collected, and then fixed in 10% buffered formalin saline for further processing. For mRNA expression assays, liver samples were excised immediately, frozen in liquid nitrogen and stored at −80 °C until analysis. Finally, dorsal muscles were dissected and stored at −20 °C for further analysis of their nutrient composition.
Liver histological analysis were performed according to the method described by Chen et al. (2015). Briefly, for hematoxylin and eosin (H& E) observation, liver samples were gradually dehydrated in ethanol, clarified in benzene and embedded in paraffin wax. The tissue wax was cut into 4 μm sections. Fixed sections were stained with H&E and then prepared for light microscopy. For Oil Red O observation, the liver samples were sectioned (8 μm) on a cryostat microtome (CRYOSTAR NX50, Thermo, Shanghai, China). Sections were fixed in cold 10% buffered formalin and rinsed in distilled water, and then immersed briefly in 60% isopropanpol. After being stained with the oil red solution, sections were rinsed for a few seconds in two changes of 60% isopropanol. After two washes in distilled water, sections were stained in hematoxylin and mounted in glycerin jelly and subsequently prepared for light microscopy. The quantified areas of hepatic vacuoles in the H&E observation and lipid droplets in the Oil Red O observation were evaluated by using Image J software as described by Wei et al. (2017).
Plasma CHO, triacylglycerol (TG), high-density lipoprotein cholesterol (HDL-C) and low-density lipoprotein cholesterol (LDL-C) were analyzed using a ROCHE-P800 automatic biochemical analyzer (Roche, Basel, Switzerland) by the colorimetric method (Coz-Rakovac et al., 2008).
2.8. RNA extraction and real-time quantitative PCR (q-PCR)
2.4. Growth performance
The liver samples of six fish from each tank were pooled and total RNA was isolated from the samples using 1 mL TRIzol reagent (Vazyme Biotech Co., Ltd., China). The purity and concentration of isolated RNA were measured using a NanoDrop 2000 spectrophotometer (NanoDrop Technologies, USA). RNA integrity was confirmed by electrophoresis in 1.2% agarose gel. Single-stranded cDNA was synthesized from 1 μg total RNA using PrimeScript RT reagent Kit with gDNA Eraser (Takara, Dalian, China). The cDNA templates were then stored at −80 °C for later analysis. For q-PCR, the specific primer pairs are shown in Table 2 according to our transcriptome unigen (unpublished data). The β-actin gene was
The following variables were calculated:
Weight gain (WG,%) = (final body weight–initial body weight) /initial body weight × 100 Feed efficiency (FE) = wet weight gain/dry feed fed Protein efficiency ratio (PER) = wet weight gain/total protein consumed
Feed intake (FI,%day −1) = 100 × total amount of the feed consumed /[(initial body weight + final body weight)/2]
Table 2 Primers pairs used for quantitative PCR Primer sequences.
/days of feeding trial Hepatosomatic index (HSI,%) = 100 × liver wet weight/body wet weight
Primers
Quantitative PCR primers, forward/reverse (5′ to 3′)
Viscerosomatic index (VSI,%) = 100 × visceral wet weight
PPARα
F: CATCGACAATGACGCCCTC R: GCCGCTATCCCGTAAACAAC F: TCCTTACCGTTGGTCCCTCT R: CTTTCCATCTGCTGCTCTATCTC F: TCTTGCTCTCGCCCTTCTG R: TTTTGGCACTGTCCTTCACCT F: TTCAACAGCACCTCCAAAACC R: GTGAGCCAGTCCACCACGAT F: CGCAAAGAGTAGCGACGGA R: CGATGCTGGGGAAATTCAGAC F: ATAAGATGAGCCACCAGCGA R: GATACAGGCGAAACACGAGC F: TGCTTCTTGTGTCGTGATGTTG R: GCGTCGGTCTCTTCTGGTTG F: TTTTCCTGGTTATGTTTCGTGG R: TTGCTTGTAGAGCCCTTTTGC F: GGCACCAAACAAACCAAAAAAC R: GTCAAGCAACTCCAGACCATCA F: TACGAGCTGCCTGACGGACA R: GGCTGTGATCTCCTTCTGC
/body wet weight
CPT1
Condition factor (CF, g cm−3) = 100 × body weight/body length3
Apo-AI
Survival (%) = 100 × final fish number/initial fish number
LPL caspase-3
2.5. Fish and diets proximate composition
caspase-7
Nutrient composition of diets, whole body, muscle and liver were analyzed according to the standard methods of AOAC (2005) (Berbert et al., 2005). Moisture was determined by drying samples to constant weight at 105 °C. crude protein (N × 6.25) was determined by Kjeldahl method after acid digestion using an automatic Kjeltec™ 8400 (FOSS, Hoganos, Sweden). Crude lipid was determined by petroleum ether extraction using a Soxtec™ 2055 (FOSS, Hoganos, Sweden). Ash was determined by incineration in a muffle furnace (FO610C, Yamato Scientific Co., Ltd., Tokyo, Japan) at 550 °C for 6 h.
caspase-8 caspase-9 p53 β-actin
PPARα, peroxisome proliferator-activated receptor alpha; CPT1, carnitine palmitoyltransferase 1; Apo-AI, apolipoprotein AI; LPL, lipoprotein lipase. 439
Aquaculture 506 (2019) 437–444
H. Ye, et al.
used as a housekeeping gene that was amplified using β-actin-F and βactin-R gene-specific primers. Real-time PCR was amplified in an ABI 7500 real-time PCR machine (Applied Biosystems, USA) using ChamQTM SYBR® q-PCR Master Mix (Vazyme, Nanjing, China) following the manufacture's recommendations. Before the RT-PCR experiments, the specificity and efficiency of the primers above were evaluated. The standard equation and correlation coefficient were determined by constructing a standard curve using a serial dilution of cDNA. The reaction mixtures were 20 μL in total volume, containing 2 μL cDNA sample, 10 μL 2 × SYBR Premix Ex Taq, 0.5 μL each of the 10 μM forward and reverse primers, and 7 μL dH2O. The real-time PCR conditions were as follows: 94 °C for 5 min, then 40 cycles at 95 °C for 15 s, 60 °C for 1 min. All samples were run in triplicate, and each assay was repeated three times. After finishing the program, the threshold cycle (Ct) values were obtained from each sample. Relative gene expression levels were evaluated using 2-△△CT method (Livak and Schmittgen, 2001).
3.3. Plasma biochemical parameters Plasma biochemical parameters of juvenile hybrid grouper are shown in Table 5. Dietary PP inclusion significantly decreased plasma CHO, HDL-C and LDL-C contents (P < .05) while no significant differences were observed in TG content among all fish groups (P > .05). 3.4. Liver histology Liver histology (H&E and Oil Red O staining) is presented in Fig. 1. From the H&E staining, fish fed the basal diet showed normal hepatocyte morphology with regular liver lobule and liver sinusoid, but higher levels of dietary PP sources induced apparent morphological changes, characterized by higher occurrence rates of hepatocyte vacuolization and nuclear atrophy, disappearance or reduction that are signs of nuclear pycnosis (Fig. 1A–D). Relative areas for hepatic vacuoles in H&E staining were markedly increased with increasing dietary PP inclusion (Fig. 2A). For Oil Red O staining, the increase of dietary PP sources obviously reduced the amounts of hepatic lipid droplets (Fig. 1E–H). Meanwhile, the Oil Red O-relative areas in the liver of fish were significantly decreased as dietary PP inclusion increased (P < .05) (Fig. 2B).
2.9. Statistical analysis One-way ANOVA and Duncan's multiple range test were conducted to examine significant differences among mean values of treatments by using SPSS 17.0 (SPSS Inc. Michigan Avenue, Chicago, IL, USA). Moreover, a follow-up trend analysis using orthogonal polynomial contrasts was performed to determine whether the significant effects were linear and/or quadratic. Statistically significant differences required that P-value < .05.
3.5. mRNA levels of lipid metabolism-related genes in the liver of hybrid grouper As shown in Fig. 3, the transcriptional levels of peroxisome proliferator-activated receptor alpha (PPARα) and lipoprotein lipase (LPL) in the liver of fish were significantly decreased when dietary PP sources exceeded 50% (P < .05). Meanwhile, the mRNA level of carnitine palmitoyltransferase 1 (CPT1) showed a decreasing trend as dietary PP ingredients increased. The mRNA level of apolipoprotein AI (Apo-AI) in the liver of fish fed the PP containing diets was significantly lower than the control group (P < .05).
3. Results 3.1. Growth performance, feed utilization and morphological parameters As shown in Table 3, there were no significant differences in FBW, WG, FE, PER, FI and survival among dietary treatments after 56-day feeding trial (P > .05). For morphological parameters, the HSI in fish fed the FM30 and FM15 diets were significantly higher than the other groups (P < .05) while the VSI and CF showed no differences among treatments (P > .05).
3.6. mRNA levels of apoptosis-related genes in the liver of hybrid grouper As shown in Fig. 4, the transcriptional levels of caspase-8 and p53 in the liver of fish were gradually down-regulated with increasing levels of dietary PP sources. The mRNA level of p53 was significantly decreased when dietary PP sources reached 75% (P < .05). Meanwhile, the mRNA levels of caspase-3, caspase-7 and caspase-8 in the liver of fish fed the PP containing diets were significantly lower than the control FM60 group (P < .05). But the caspase-9 mRNA level was not significantly different among all fish groups (P > .05).
3.2. Nutrient composition in whole body, muscle and liver Data on fish nutrient composition are presented in Table 4. The whole body composition were not markedly affected by dietary PP sources (P > .05). Muscle crude protein did not vary among groups but muscle lipid content varied and the lowest were observed in fish fed the FM30 diet. For liver composition, crude protein and lipid contents showed a decreasing trend with increasing levels of dietary PP sources. The content of crude lipid in the liver was significantly decreased when dietary PP sources exceeded 50% (P < .05).
4. Discussion In the present study, after a 56-day feeding trial, no apparent
Table 3 Growth performance, feed utilization and morphological parameters in juvenile hybrid grouper fed the experimental diets for 56 days. Diets
FM60
FM45
FM30
FM15
ANOVA (P)
Linear trend (P)
Quadratic trend (P)
IBW (g) FBW (g) WG (%) FE PER (%) FI (% day−1) HSI (%) VSI (%) CF (g cm−3) Survival (%)
31.60 ± 0.88 70.37 ± 6.18 119.58 ± 14.69 0.83 ± 0.03 1.66 ± 0.05 1.48 ± 0.08 1.41 ± 0.13b 7.08 ± 0.58 2.48 ± 0.08 95.00 ± 5.00
30.73 ± 1.66 69.43 ± 9.45 124.54 ± 13.64 0.75 ± 0.01 1.52 ± 0.01 1.60 ± 0.04 1.26 ± 0.12b 7.04 ± 0.41 2.58 ± 0.07 95.00 ± 5.00
32.73 ± 0.45 76.75 ± 9.55 136.32 ± 29.14 0.80 ± 0.11 1.64 ± 0.22 1.60 ± 0.01 1.80 ± 0.32a 7.70 ± 0.78 2.61 ± 0.03 100.00 ± 0.00
31.50 ± 2.03 68.88 ± 11.49 115.32 ± 17.66 0.80 ± 0.03 1.64 ± 0.06 1.52 ± 0.09 1.85 ± 0.04a 7.83 ± 0.46 2.47 ± 0.13 98.33 ± 2.89
0.427 0.822 0.748 0.723 0.763 0.186 0.011 0.279 0.195 0.344
0.662 0.919 0.987 0.852 0.898 0.488 0.010 0.062 0.986 0.150
0.894 0.862 0.639 0.743 0.822 0.075 0.033 0.187 0.089 0.352
IBW, initial body weight; FBW, final body weight; WG, weight gain; FE, feed efficiency; PER, protein efficiency ratio; FI, feed intake; HSI, hepatosomatic index; VSI, viscerosomatic index; CF, condition factor. Values are mean ± SD of three replicates; means with different subscripts are significantly different (P < .05). 440
Aquaculture 506 (2019) 437–444
H. Ye, et al.
Table 4 Nutrient composition (% of wet weight) in whole body, muscle and liver of juvenile hybrid grouper fed the experimental diets for 56 days. Diets
FM60
FM45
FM30
FM15
ANOVA (P)
Linear trend (P)
Quadratic trend (P)
Whole body composition Moisture 70.33 ± 2.08 Crude protein 18.76 ± 1.47 Crude lipid 5.06 ± 0.44 Ash 4.88 ± 0.43
68.85 ± 1.44 19.51 ± 0.53 6.40 ± 0.52 4.86 ± 0.33
67.44 ± 2.43 19.41 ± 0.54 5.87 ± 0.78 4.53 ± 0.34
68.86 ± 1.94 19.18 ± 1.11 6.35 ± 0.86 4.59 ± 0.19
0.425 0.804 0.170 0.504
0.283 0.647 0.089 0.171
0.265 0.619 0.195 0.406
Muscle composition Moisture Crude protein Crude lipid Ash
76.03 ± 0.71 21.36 ± 0.53 1.30 ± 0.20ab 1.29 ± 0.14
76.22 ± 1.02 21.23 ± 0.36 1.73 ± 0.43a 1.29 ± 0.31
76.29 ± 0.26 21.43 ± 0.36 1.19 ± 0.13b 1.18 ± 0.10
75.79 ± 0.08 21.52 ± 0.22 1.40 ± 0.09ab 1.26 ± 0.12
0.778 0.827 0.182 0.878
0.690 0.470 0.939 0.699
0.584 0.688 0.852 0.861
Liver composition Crude protein Crude lipid
19.27 ± 0.74a 10.22 ± 0.58a
19.41 ± 3.30a 8.54 ± 1.08ab
16.60 ± 1.96ab 6.48 ± 0.82b
14.97 ± 1.55b 7.23 ± 1.23b
0.072 0.020
0.009 0.013
0.032 0.011
ANOVA (P)
Linear trend (P)
Quadratic trend (P)
0.015 0.149 0.005 0.000
0.001 0.029 0.002 0.000
0.007 0.099 0.002 0.001
Values are mean ± SD of three replicates; means with different subscripts are significantly different (P < .05). Table 5 Plasma biochemical parameters of juvenile hybrid grouper fed the experimental diets for 56 days. Diets
FM60 −1
CHO (mmol L ) TG (mmol L−1) HDL-C (mmol L−1) LDL-C (mmol L−1)
4.01 1.61 1.26 1.78
± ± ± ±
FM45 a
0.66 0.25 0.14a 0.12a
2.68 1.41 0.57 1.02
± ± ± ±
FM30 b
0.46 0.21 0.25b 0.01b
2.44 1.47 0.46 0.93
± ± ± ±
FM15 b
0.40 0.09 0.12b 0.02b
1.64 1.14 0.29 0.49
± ± ± ±
b
0.06 0.17 0.02b 0.01c
CHO, cholesterol; TG, triacylglycerol; HDL-C, high-density lipoprotein cholesterol; LDL-C, low-density lipoprotein cholesterol. Values are mean ± SD of three replicates; means with different subscripts are significantly different (P < .05).
Fig. 1. Light microscopy of the liver histology with H&E staining (A–D, 400×) or Oil Red O staining (E–H, 400×) in juvenile hybrid grouper fed with different experimental diets including FM60 (A and E), FM45 (B and F), FM30 (C and G) and FM15 (D and H) for 56 days. Scale bar: 50 μm. Lipids appear red and nuclei appear blue after staining with Oil Red O. The depth of colour of the red stain and the size of the lipid droplets were positively correlated with the lipid content. Nu, nuclei; Va, vacuolation; Ld, lipid droplet. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
previous studies which suggest that high levels of mixtures of PP ingredients in practical diets can go from 75% to complete replacement of FM without compromising growth performance in other carnivorous species, such as Senegalese sole (Solea senegalensis) (Cabral et al., 2013; Valente et al., 2016), Siberian sturgeon (Acipenser baerii Brandt) (Yun et al., 2014), gilthead sea bream (Sparus aurata) (Francesco et al., 2010; Gómez-Requeni et al., 2004), cobia (Rachycentron canadum) (Salze et al., 2010), rainbow trout (Oncorhynchus mykiss) (Lee et al., 2010) and European sea bass (Dicentrarchus labrax) (Kaushik et al., 2004). The range of tolerance to PP ingredients in these fish may be dependent on the species, growth status, rearing conditions and more specifically on quality of the PP sources, in terms of digestibility and presence of ANFs
reductions were observed in the growth performance and feed utilization when a blend of PP sources replaced up to 75% of FM protein, with proper EAA and taurine supplementation, in diet for grouper juveniles. Previous studies based on the analysis of specific growth rate have reported that in hybrid grouper feed, the maximum replacement levels of FM, by soy protein concentrate (Mohd Faudzi et al., 2018) and cottonseed protein concentrate (Yin et al., 2018) were 50% (338.0 g kg−1 dry diet) and 34% (204.0 g kg−1 dry diet), respectively. In our study, however, the 75% replacement of FM (450.0 g kg−1 dry diet) by PP ingredients was achieved, which could be due to the reasonable strategy of blending various PP nutritive properties with proper EAA and taurine supplementation. Our results are in accordance with 441
Aquaculture 506 (2019) 437–444
H. Ye, et al.
Fig. 2. Relative areas for hepatic vacuoles in H&E staining (A) and lipid droplets in Oil Red O staining (B) of the liver from hybrid grouper fed the experimental diets for 56 days. Values are mean ± SD of three replicates; means with different subscripts are significantly different (P < .05). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
accumulation which was a common morphological alteration in fish liver (Spisni et al., 1998). In a previous study it was noticed that a hepatic fat deposition was aggravated in hybrid grouper with a significantly increased level of serum triglycerides when dietary FM replacement level of cottonseed protein concentrate exceeded 36% (Yin et al., 2018). However, our result of Oil Red O staining clearly indicated that the amounts of hepatic lipid droplets were markedly reduced as dietary PP inclusion increased (Figs. 1E–H and 2B). Furthermore, the present study showed a concomitant decrease in plasma CHO level in fish fed the PP containing diets, which was in accordance with the hypocholesterolemic effect of PP sources in most previous studies (Dias et al., 2005; Ramdath et al., 2017; Sitjà-Bobadilla et al., 2005; Ye et al., 2019). Therefore, our results clearly indicated that the hepatic vacuoles in H&E staining of high level PP containing groups may not be exactly lipid accumulation, but more like glycogen deposits (Pereira et al., 2002; Silvia et al., 2010) despite the lack of relevant evidences. To further uncover the relationship between hepatic lipid metabolism and PP sources in fish, we next analyzed the transcriptional levels of lipid metabolism-related genes in the liver of hybrid grouper. Generally, lipid metabolism including lipid synthesis, oxidation, catabolism, transport and uptake, represents a complex process, and many key enzymes and transcriptional factors are involved in these processes (Chen et al., 2013). As an important transcriptional factor, PPARα plays an intermediary role in regulating the catabolism of fatty acids by increasing the expression of key lipolytic enzymes (Ribet et al., 2010). CPT1 is considered as the main regulatory enzyme in long-chain fatty acid oxidation because it catalyses the conversion of fatty acid-CoAs into fatty acid-carnitines for entry into the mitochondrial matrix (Kerner and Hoppel, 2000). In the present study, the mRNA levels of PPARα and CPT1 were down-regulated by high level of dietary PP ingredients, probably as a compensatory mechanism for the reduced contents of hepatic lipid droplet and plasma CHO, but this hypothesis needs further verification. In addition, Apo-AI plays a vital role in regulating plasma HDL-C and LDL-C contents (Yadav et al., 2018). The decreased Apo-AI level caused by dietary PP inclusion in this study was in agreement with the reduced HDL-C and LDL-C contents in the plasma of hybrid grouper. On the other hand, LPL is considered to be a crucial rate-limiting enzyme in the provision of tissue fatty acids, and it determines how dietary lipids are partitioned towards storage or utilization (Huang et al., 2014). Since the fish liver is the major organ with respect to lipid synthesis and storage, the down-regulation of LPL mRNA level with higher replacement level in our study may indicate a decrease in import of lipids into liver to be reesterified for storage or an increase in import of lipids from liver to nearby tissues to be utilized for energy purposes (Zheng et al., 2013). Our study indicated that dietary PP sources could decrease several key gene expression profiles involved in lipid oxidation, synthesis and transport as well as associated transcriptional factors, thus leading to abnormal lipid metabolism and reduced hepatic lipid content in hybrid grouper. The reduced crude lipid content of the liver with a higher replacing level further supports the notion.
Fig. 3. Relative mRNA expression of peroxisome proliferator-activated receptor alpha (PPARα), carnitine palmitoyltransferase 1 (CPT1), apolipoprotein AI (Apo-AI) and lipoprotein lipase (LPL) in the liver of hybrid grouper fed the experimental diets for 56 days. Relative mRNA expression was evaluated by real-time quantitative PCR. Values are mean ± SD of three replicates. Bars of the same gene bearing with different letters are significantly different by Duncan's test (P < .05).
Fig. 4. Relative mRNA expression of caspase-3, caspase-8, caspase-9 and p53 in the liver of hybrid grouper fed the experimental diets for 56 days. Relative mRNA expression was evaluated by real-time quantitative PCR. Values are mean ± SD of three replicates. Bars of the same gene bearing with different letters are significantly different by Duncan's test (P < .05).
(Gatlin et al., 2007; NRC, 2011). It is well known that the liver is an important organ with respect to lipid metabolism in fish. The liver histological changes can be easily recognized if feed containing protein or fat is used (Caballero et al., 2004). In this study, a higher level of hepatocyte vacuolization occurred as dietary PP inclusion increased (Fig. 1A–D and Fig. 2A). Usually, the hepatocyte vacuolization was considered to be related to the lipid
442
Aquaculture 506 (2019) 437–444
H. Ye, et al.
between dietary PP sources and cell apoptosis.
Taking all the above results together, it turned out that dietary PP sources could be involved in modulating lipid balance in the liver of hybrid grouper at the transcriptional levels, thus interrupting lipid homeostasis and consequently reduced the hepatic lipid droplets, plasma CHO, HDL-C and LDL-C contents as well as crude lipid content in the liver. To our knowledge, these results provide new evidence for the lipid-lowering effect of PP sources in carnivorous fish. However, it is worthy to note that the significantly higher HSI reveled an abnormally enlarged liver in hybrid grouper fed with a high level of dietary PP inclusion, which may be a sign of hepatic lesions. The underlying mechanism for these hepatic lesions as well as the hepatocyte vacuolization in hybrid grouper needs further study. In fish, the size of a nucleus generally reveals changes in liver metabolism, such as pycnosis, karyolysis of the nucleus or necrosis of the cell (Raškovic et al., 2011). In this study, results from the liver H&E staining showed that fish fed a high level of dietary PP sources induced an apparent nuclear pycnosis, characterized by nuclear atrophy, disappearance or reduction. A previous study reported that nuclear atrophy was found in the liver of juvenile sharpsnout sea bream (Diplodus puntazzo) fed a sunflower meal containing diet (Silvia et al., 2010). Likewise, the similar results of atrophied nuclei and cytoplasm of hepatocytes were also observed in orange-spotted grouper (Epinephelus coioides, Hamilton) fed with a diet having 30% of FM protein replaced by SBM protein (Shiu et al., 2015). This result may indicate that the grouper liver could not effectively metabolize high levels of dietary PP ingredients in particular the amounts of ANFs because they are novel to most cultivated fish species and could exert possible harmful effects on aquatic animals such as liver damage and immune suppression (Akande et al., 2010; Krogdahl et al., 2010). On the other hand, a previous study has noticed that the occurrence of nuclear pycnosis is associated with cell apoptosis when aquatic organisms are under environmental stressors (Jin et al., 2017). Thus, we next explored the effect of PP ingredients on the hepatocyte apoptosis of hybrid grouper to further clarify the possible toxicity mechanism of ANFs. In general, caspase activity has been demonstrated to be a useful indicator for detecting stress-induced apoptosis in the early-life stages of fish (Jiang et al., 2016). In our study, the mRNA levels of caspase-3, caspase-7 and caspase-8 in the liver of grouper were significantly decreased as dietary PP inclusion increased. Furthermore, the p53 level also showed this similar trend. A previous study found that caspase-3 activity decreased in the intestine and stomach of common dentex (Dentex dentex) after feeding with a SBM containing diet (Antonopoulou et al., 2017). Since apoptosis is one of the self-defence responses for scavenging cells damaged by environmental stress, our results may indicate that dietary PP ingredients could exert a toxic effect largely due to a number of ANFs that are part of the inherent defence mechanisms in all plants (Krogdahl et al., 2010). This possible toxic effect on grouper liver that inhibits hepatocyte apoptosis via both the caspasedependent and p53-dependent pathway poses a potential threat to the hybrid grouper when exposed to environmental stressors. For example, the reduced apoptotic mRNA levels in the long term may result in impairment of hepatic capacity for regeneration and repair of tissue damage, and thus may lead to histopathological changes of liver in hybrid grouper. To date, limited information is available concerning the hepatocyte apoptosis in fish fed a PP containing diet. Our study can provide new evidence for clarifying the possible toxicity mechanisms of ANFs on the liver of carnivorous fish. In conclusion, our study showed that a complementary mixture of PP sources consisting of SBM, CGM and CSM can replace up to 75% of FM protein in formulated diets for hybrid grouper juveniles without compromising growth performance and feed utilization. However, dietary PP ingredients not only reduced hepatic lipid content by modulating the lipid metabolism-related genes, but also inhibiting hepatocyte apoptosis by down-regulating apoptosis-related genes, which provided new evidence for the PP sources-induced lipid metabolism in carnivorous fish, and provided new insight into the relationship
Acknowledgements This research was supported by National Key R&D Program of China (2018YFD0900400), Guangdong Provincial Oceanic Fisheries Science and Technology Project (A201601C04), Guangdong Provincial Natural Science Foundation (2018A030313222, 2016A030313447). References Akande, K.E., Doma, U.D., Agu, H.O., Adamu, H.M., 2010. Major antinutrients found in plant protein sources: their effect on nutrition. Pak. J. Nutr. 9, 827–832. Albalat, A., Gómez-Requeni, P., Rojas, P., Médale, F., Kaushik, S., Vianen, G.J., Van den Thillart, G., Gutiérrez, J., Pérez-Sánchez, J., Navarro, I., 2005. Nutritional and hormonal control of lipolysis in isolated gilthead seabream (Sparus aurata) adipocytes. Am. J. Phys. Regul. Integr. Comp. Phys. 289, R259–R265. Antonopoulou, E., Chouri, E., Feidantsis, K., Lazou, A., Chatzifotis, S., 2017. Effects of partial dietary supplementation of fish meal with soymeal on the stress and apoptosis response in the digestive system of common dentex (Dentex dentex). J. Biol. Res. 24, 14. Berbert, D.M., Queiroz, E.C., Melo, A., 2005. Official Methods of Analysis of AOAC International. Brentnall, M., Rodriguez-Menocal, L., De Guevara, R.L., Cepero, E., Boise, L.H., 2013. Caspase-9, caspase-3 and caspase-7 have distinct roles during intrinsic apoptosis. BMC Cell Biol. 14, 32. Caballero, M.J., Izquierdo, M.S., Kjørsvik, E., Fernandez, A.J., Rosenlund, G., 2004. Histological alterations in the liver of sea bream, Sparus aurata L., caused by short-or long-term feeding with vegetable oils. Recovery of normal morphology after feeding fish oil as the sole lipid source. J. Fish Dis. 27, 531–541. Cabral, E.M., Tjr, F., Campos, S.D., Castro-Cunha, M., Mbpp, O., Cunha, L.M., Lmp, V., 2013. Replacement of fish meal by plant protein sources up to 75% induces good growth performance without affecting flesh quality in ongrowing Senegalese sole. Aquaculture 380–383, 130–138. Ch Ng, C.L., Senoo, S., 2008. Egg and larval development of a new hybrid grouper, tiger grouper Epinephelus fuscoguttatus × giant grouper E. lanceolatus. Aquacult. Sci. 56, 505–512. Chen, Q., Gong, Y., Luo, Z., Zheng, J., Zhu, Q., 2013. Differential effect of waterborne cadmium exposure on lipid metabolism in liver and muscle of yellow catfish Pelteobagrus fulvidraco. Aquat. Toxicol. 142, 380–386. Chen, Q.L., Luo, Z., Wu, K., Huang, C., Zhuo, M.Q., Song, Y.F., Hu, W., 2015. Differential effects of dietary copper deficiency and excess on lipid metabolism in yellow catfish Pelteobagrus fulvidraco. Comp. Biochem. Physiol. B: Biochem. Mol. Biol. 184, 19–28. Cheng, C.H., Yang, F.F., Ling, R.Z., Liao, S.A., Miao, Y.T., Ye, C.X., Wang, A.L., 2015. Effects of ammonia exposure on apoptosis, oxidative stress and immune response in pufferfish (Takifugu obscurus). Aquat. Toxicol. 164, 61–71. Coz-Rakovac, R., Smuc, T., Popovic, N.T., Strunjak-Perovic, I., Hacmanjek, M., Jadan, M., 2008. Novel methods for assessing fish blood biochemical data. J. Appl. Ichthyol. 24, 77–80. Dias, J., Alvarez, M.J., Diez, A., Arzel, J., Corraze, G., Bautista, J.M., Kaushik, S.J., 1998. Regulation of hepatic lipogenesis by dietary protein/energy in juvenile European seabass (Dicentrarchus labrax). Aquaculture 161, 169–186. Dias, J., Alvarez, M.J., Arzel, J., Corraze, G., Diez, A., Bautista, J.M., Kaushik, S.J., 2005. Dietary protein source affects lipid metabolism in the European seabass (Dicentrarchus labrax). Comp. Biochem. Physiol. A Mol. Integr. Physiol. 142, 19–31. Francesco, M.D., Parisi, G., Pérez Sánchez, J., Gómez Réqueni, P., Médale, F., Kaushik, S.J., Mecatti, M., Poli, B.M., 2010. Effect of high-level fish meal replacement by plant proteins in gilthead sea bream (Sparus aurata) on growth and body/fillet quality traits. Aquac. Nutr. 13, 361–372. Gatlin, D.M., Barrows, F.T., Brown, P., Dabrowski, K., Gaylord, T.G., Hardy, R.W., Herman, E., Hu, G., Krogdahl, Å., Nelson, R., 2007. Expanding the utilization of sustainable plant products in aquafeeds: a review. Aquac. Res. 38, 551–579. Gómez-Requeni, P., Mingarro, M., Calduch-Giner, J.A., Médale, F., Martin, S.A.M., Houlihan, D.F., Kaushik, S., Pérez-Sánchez, J., 2004. Protein growth performance, amino acid utilisation and somatotropic axis responsiveness to fish meal replacement by plant protein sources in gilthead sea bream (Sparus aurata). Aquaculture 232, 493–510. Gu, M., Kortner, T.M., Penn, M., Hansen, A.K., Krogdahl, Å., 2014. Effects of dietary plant meal and soya-saponin supplementation on intestinal and hepatic lipid droplet accumulation and lipoprotein and sterol metabolism in Atlantic salmon (Salmo salar L.). Br. J. Nutr. 111, 432–444. Harris, S.L., Levine, A.J., 2005. The p53 pathway: positive and negative feedback loops. Oncogene 24, 2899. Huang, C., Chen, Q., Luo, Z., Shi, X., Pan, Y., Song, Y., Zhuo, M., Wu, K., 2014. Timedependent effects of waterborne copper exposure influencing hepatic lipid deposition and metabolism in javelin goby Synechogobius hasta and their mechanism. Aquat. Toxicol. 155, 291–300. Jiang, J.H., Chen, Y.H., Yu, R.X., Zhao, X.P., Qiang, W., Cai, L.M., 2016. Pretilachlor has the potential to induce endocrine disruption, oxidative stress, apoptosis and immunotoxicity during zebrafish embryo development. Environ. Toxicol. Pharmacol. 42, 125–134. Jin, J., Wang, Y., Wu, Z., Hergazy, A., Lan, J., Zhao, L., Liu, X., Chen, N., Lin, L., 2017.
443
Aquaculture 506 (2019) 437–444
H. Ye, et al.
Res. 307, 1–14. Shiu, Y.L., Hsieh, S.L., Guei, W.C., Tsai, Y.T., Chiu, C.H., Liu, C.H., 2015. Using Bacillus subtilis E20-fermented soybean meal as replacement for fish meal in the diet of orange-spotted grouper (Epinephelus coioides, Hamilton). Aquac. Res. 46, 1403–1416. Silvia, N.M., Ana, T., Silvia, M., Miguel, J.C., 2010. Sunflower meal as a partial substitute in juvenile sharpsnout sea bream (Diplodus puntazzo) diets: amino acid retention, gut and liver histology. Aquaculture 298, 275–281. Sitjà-Bobadilla, A., Peña-Llopis, S., Gómez-Requeni, P., Médale, F., Kaushik, S., PérezSánchez, J., 2005. Effect of fish meal replacement by plant protein sources on nonspecific defence mechanisms and oxidative stress in gilthead sea bream (Sparus aurata). Aquaculture 249, 387–400. Slee, E.A., Adrain, C., Martin, S.J., 2001. Executioner caspase-3,-6, and-7 perform distinct, non-redundant roles during the demolition phase of apoptosis. J. Biol. Chem. 276, 7320–7326. Spisni, E., Tugnoli, M., Ponticelli, A., Mordenti, T., Tomasi, V., 1998. Hepatic steatosis in artificially fed marine teleosts. J. Fish Dis. 21, 177–184. Takle, H., Andersen, O., 2010. Caspases and apoptosis in fish. J. Fish Biol. 71, 326–349. Teodoro, J.G., Branton, P.E., 1997. Regulation of apoptosis by viral gene products. J. Virol. 71, 1739–1746. Tocher, D.R., 2003. Metabolism and functions of lipids and fatty acids in teleost fish. Rev. Fish. Sci. 11, 107–184. Valente, L.M.P., Cabral, E.M., Sousa, V., Cunha, L.M., Fernandes, J.M.O., 2016. Plant protein blends in diets for Senegalese sole affect skeletal muscle growth, flesh texture and the expression of related genes. Aquaculture 453, 77–85. Vielma, J., Koskela, J., Ruohonen, K., Jokinen, I., Kettunen, J., 2003. Optimal diet composition for European whitefish (Coregonus lavaretus): carbohydrate stress and immune parameter responses. Aquaculture 225, 3–16. Wei, C., Wu, K., Gao, Y., Zhang, L., Li, D., Luo, Z., 2017. Magnesium reduces hepatic lipid accumulation in yellow catfish (Pelteobagrus fulvidraco) and modulates lipogenesis and lipolysis via PPARα, JAK-STAT, and AMPK pathways in hepatocytes1-3. J. Nutr. 147, 1070–1078. Yadav, D., Kim, S., Bae, M., Kim, J., Cho, K., 2018. The ability of different ketohexoses to alter Apo-AI structure and function in vitro and to induce hepatosteatosis, oxidative stress, and impaired plasma lipid profile in hyperlipidemic zebrafish. Oxidative Med. Cell. Longev. 2018. Yaghoubi, M., Mozanzadeh, M.T., Marammazi, J.G., Safari, O., Gisbert, E., 2016. Dietary replacement of fish meal by soy products (soybean meal and isolated soy protein) in silvery-black porgy juveniles (Sparidentex hasta). Aquaculture 464, 50–59. Ye, H., Ye, C., Xu, M., Liu, Q., Sun, Z., Zou, C., Chen, L., Su, N., 2019. Effects of replacing fish meal with soybean meal on growth performance, feed utilization and physiological status of juvenile obscure puffer, Takifugu obscurus. Comp. Biochem. Physiol. Part C: Toxicol. Pharmacol. 216, 75–81. Yin, B., Liu, H., Tan, B., Dong, X., Chi, S., Yang, Q., Zhang, S., Chen, L., 2018. Cottonseed protein concentrate (CPC) suppresses immune function in different intestinal segments of hybrid grouper ♀Epinephelus fuscoguttatus × ♂Epinephelus lanceolatu via TLR-2/MyD88 signaling pathways. Fish Shellfish Immunol. 81, 318–328. Yu, H., Gao, Q., Dong, S., Wen, B., 2015. Changes in fatty acid profiles of sea cucumber Apostichopus japonicus (Selenka) induced by terrestrial plants in diets. Aquaculture 442, 119–124. Yun, B., Xue, M., Wang, J., Sheng, H., Zheng, Y., Wu, X., Li, J., 2014. Fishmeal can be totally replaced by plant protein blend at two protein levels in diets of juvenile Siberian sturgeon, Acipenser baerii Brandt. Aquac. Nutr. 20, 69–78. Zhang, Y.X., Øverland, M., Shearer, K.D., Sørensen, M., Mydland, L.T., Storebakken, T., 2012. Optimizing plant protein combinations in fish meal-free diets for rainbow trout (Oncorhynchus mykiss) by a mixture model. Aquaculture 360, 25–36. Zheng, J., Luo, Z., Liu, C., Chen, Q., Tan, X., Zhu, Q.L., Gong, Y., 2013. Differential effects of acute and chronic zinc (Zn) exposure on hepatic lipid deposition and metabolism in yellow catfish Pelteobagrus fulvidraco. Aquat. Toxicol. 132, 173–181.
Transcriptomic analysis of liver from grass carp (Ctenopharyngodon idellus) exposed to high environmental ammonia reveals the activation of antioxidant and apoptosis pathways. Fish Shellfish Immunol. 63, 444–451. Kaushik, S.J., Coves, D., Dutto, G., Blanc, D., 2004. Almost total replacement of fish meal by plant protein sources in the diet of a marine teleost, the European seabass, Dicentrarchus labrax. Aquaculture 230, 391–404. Kerner, J., Hoppel, C., 2000. Fatty acid import into mitochondria. Biochim. Biophys. Acta (BBA)-Mol. Cell Biol. Lipids 1486, 1–17. Kiron, V., 2012. Fish immune system and its nutritional modulation for preventive health care. Anim. Feed Sci. Technol. 173, 111–133. Krogdahl, Å., Penn, M., Thorsen, J., Refstie, S., Bakke, A.M., 2010. Important antinutrients in plant feedstuffs for aquaculture: an update on recent findings regarding responses in salmonids. Aquac. Res. 41, 333–344. Lee, K.J., Powell, M., Barrows, F., Smiley, S., Bechtel, P., Hardy, R., 2010. Evaluation of supplemental fish bone meal made from Alaska seafood processing byproducts and dicalcium phosphate in plant protein based diets for rainbow trout (Oncorhynchus mykiss). Aquaculture 302, 248–255. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2−ΔΔCT method. Methods 25, 402–408. Maita, M., Maekawa, J., SATOH, K.I., Futami, K., Satoh, S., 2006. Disease resistance and hypocholesterolemia in yellowtail Seriola quinqueradiata fed a non-fishmeal diet. Fish. Sci. 72, 513–519. Messina, M., Piccolo, G., Tulli, F., Messina, C.M., Cardinaletti, G., Tibaldi, E., 2013. Lipid composition and metabolism of European sea bass (Dicentrarchus labrax L.) fed diets containing wheat gluten and legume meals as substitutes for fish meal. Aquaculture 376, 6–14. Mohd Faudzi, N., Yong, A.S.K., Shapawi, R., Senoo, S., Biswas, A., Takii, K., 2018. Soy protein concentrate as an alternative in replacement of fish meal in the feeds of hybrid grouper, brown-marbled grouper (Epinephelus fuscoguttatus) × giant grouper (E. lanceolatus) juvenile. Aquac. Res. 49, 431–441. Naylor, R.L., Hardy, R.W., Bureau, D.P., Chiu, A., Elliott, M., Farrell, A.P., Forster, I., Gatlin, D.M., Goldburg, R.J., Hua, K., 2009. Feeding aquaculture in an era of finite resources. Proc. Natl. Acad. Sci. 106 (36), 15103–15110. NRC, 2011. Nutrient Requirements of Fish and Shrimp. National Academy Press, Washington, DC. Oliva-Teles, A., Enes, P., Peres, H., 2015. Replacing fishmeal and fish oil in industrial aquafeeds for carnivorous fish. In: Feed and Feeding Practices in Aquaculture. Elsevier, pp. 203–233. Pereira, O., Rosa, E., Pires, M.A., Fontaınhas-Fernandes, A., 2002. Brassica by-products in diets of rainbow trout (Oncorhynchus mykiss) and their effects on performance, body composition, thyroid status and liver histology. Anim. Feed Sci. Technol. 101, 171–182. Pratoomyot, J., Bendiksen, E.Å., Bell, J.G., Tocher, D.R., 2010. Effects of increasing replacement of dietary fishmeal with plant protein sources on growth performance and body lipid composition of Atlantic salmon (Salmo salar L.). Aquaculture 305, 124–132. Ramdath, D.D., Padhi, E.M., Sarfaraz, S., Renwick, S., Duncan, A.M., 2017. Beyond the cholesterol-lowering effect of soy protein: a review of the effects of dietary soy and its constituents on risk factors for cardiovascular disease. Nutrients 9, 324. Raškovic, B.S., Stankovic, M.B., Markovic, Z.Z., Poleksic, V.D., 2011. Histological methods in the assessment of different feed effects on liver and intestine of fish. J. Agric. Sci. 56, 87–100. Ribet, C., Montastier, E., Valle, C., Bezaire, V., Mazzucotelli, A., Mairal, A., Viguerie, N., Langin, D., 2010. Peroxisome proliferator-activated receptor-α control of lipid and glucose metabolism in human white adipocytes. Endocrinology 151, 123–133. Salze, G., Mclean, E., Battle, P.R., Schwarz, M.H., Craig, S.R., 2010. Use of soy protein concentrate and novel ingredients in the total elimination of fish meal and fish oil in diets for juvenile cobia, Rachycentron canadum. Aquaculture 298, 294–299. Schuster, N., Krieglstein, K., 2002. Mechanisms of TGF-β-mediated apoptosis. Cell Tissue
444
Contents lists available at ScienceDirect
Aquaculture journal homepage: www.elsevier.com/locate/aquaculture
Effects of dietary plant protein sources influencing hepatic lipid metabolism and hepatocyte apoptosis in hybrid grouper (Epinephelus lanceolatus♂ × Epinephelus fuscoguttatus♀)
T
Huaqun Ye, Minglei Xu, Leling Chen, Xiaohong Tan, Shu Chen, Cuiyun Zou, Zhenzhu Sun, ⁎ ⁎ Qingying Liu, Chaoxia Ye , Anli Wang Institute of Modern Aquaculture Science and Engineering, Guangzhou Key Laboratory of Subtropical Biodiversity and Biomonitoring, Guangdong Provincial Key Laboratory for Healthy and Safe Aquaculture, School of Life Science, South China Normal University, Guangzhou 510631, People's Republic of China
A R T I C LE I N FO
A B S T R A C T
Keywords: Hybrid grouper Fish meal Plant protein Lipid metabolism Apoptosis
A 56-day feeding trial was conducted to evaluate the effects of replacing dietary fish meal (FM) with a complementary mixture of plant protein (PP) consisting of soybean meal (SBM), corn gluten meal (CGM) and cottonseed meal (CSM) on hepatic lipid metabolism and hepatocyte apoptosis in juvenile hybrid grouper, Epinephelus lanceolatus♂ × E. fuscoguttatus♀ (31.64 ± 0.82 g). A basal diet (FM60) with FM as the sole protein source was compared to diets progressively replacing 25% (FM45), 50% (FM30) and 75% (FM15) of FM protein. No significant differences were observed in growth performance and feed utilization when up to 75% of FM protein was replaced by PP sources. The hepatosomatic index (HSI) was markedly increased as dietary PP inclusion increased, but crude lipid content in the liver showed the opposite trend. Plasma cholesterol (CHO), high-density lipoprotein cholesterol (HDL-C) and low-density lipoprotein cholesterol (LDL-C) of fish fed the PP containing diets were all significantly lower than the control. Liver histological analysis showed a higher levels of hepatocyte vacuolization and nuclear pycnosis occurred as dietary PP inclusion increased, but the amounts of hepatic lipid droplets showed a decreasing trend with increasing PP inclusion levels. Moreover, dietary PP inclusion down-regulated the mRNA levels of lipid metabolism-related genes including peroxisome proliferatoractivated receptor alpha (PPARα), carnitine palmitoyltransferase 1 (CPT1), apolipoprotein AI (Apo-AI) and lipoprotein lipase (LPL). On the other hand, dietary PP sources also down-regulated the apoptosis-related genes including caspase-3, caspase-7, caspase-8 and p53. The present study provided new evidence for the PP sourcesinduced lipid metabolism in carnivorous fish, and provided new insight into the relationship between dietary PP sources and cell apoptosis.
1. Introduction The global fish meal (FM) demands have far exceeded its supply in the last decades. Currently, finding available supply and economical feasible alternative protein ingredients for FM is a major objective for sustainable aquaculture in the future (Naylor et al., 2009). Among all the alternatives, plant protein (PP) ingredients, such as soybean meal (SBM), corn gluten meal (CGM) and cottonseed meal (CSM), have been widely recommended specifically regarding the cost as they seem to be cheaper compared to FM. And using mixtures of those PP sources with various nutrition properties is usually a more adequate strategy for replacing FM protein than using individual alternative protein sources (Oliva-Teles et al., 2015; Zhang et al., 2012). It is predicted that the
⁎
development and sustainability of future aquaculture could significantly depend on the identification of new suitable less costly alternative PP ingredients that can replace FM without compromising the performance of the animals (Gatlin et al., 2007). However, when considering PP ingredients in aquafeeds aspects such as imbalanced essential amino acid (EAA), the presence of anti-nutritional factors (ANFs) and complex carbohydrates must be addressed, which could impose some limitation to their use in diet formulations (NRC, 2011; Vielma et al., 2003). Caution must be also taken to avoid unintended consequences in fish health, liver histology and function, lipid metabolism as well as immune status. In fish, lipids act as a major energy source, and lipid stores support various physiological, developmental and reproductive processes
Corresponding authors. E-mail addresses: [email protected] (C. Ye), [email protected] (A. Wang).
https://doi.org/10.1016/j.aquaculture.2019.03.075 Received 3 February 2019; Received in revised form 31 March 2019; Accepted 31 March 2019 Available online 02 April 2019 0044-8486/ © 2019 Elsevier B.V. All rights reserved.
Aquaculture 506 (2019) 437–444
H. Ye, et al.
(Tocher, 2003). Generally, dietary protein source per se influences the regulation of lipid metabolism affecting the gene expression and activity of lipogenic enzymes as well as adipocites lipolysis (Albalat et al., 2005; Dias et al., 1998). Available knowledge showed that lipid composition and metabolism in cultivated fish species could be remarkably affected when dietary FM was replaced by PP ingredients (Dias et al., 2005; Gu et al., 2014; Messina et al., 2013; Pratoomyot et al., 2010; Yu et al., 2015). It has been well established that plant feedstuff generally has a hypocholesterolemic effect on farmed fish, being characterized by lower liver and plasma triglyceride as well as cholesterol (CHO) levels (Dias et al., 2005; Maita et al., 2006; Ramdath et al., 2017; SitjàBobadilla et al., 2005; Ye et al., 2019). In contrast, several studies have reported that a hyperlipidemia or hepatic fat deposition were found in cultivated fish fed with a PP containing diet (Yaghoubi et al., 2016; Yin et al., 2018). This controversy may stem from the discrepancy in fish species, growth status, rearing conditions, dietary compositions, feeding strategy and more specifically in PP ingredients as well as ANFs. Due to the complexity of the mechanism by which the dietary protein source per se could affect lipid metabolism in fish and because of the variety of alternate protein sources especially PP ingredients, it is necessary to investigate the underlying molecular mechanism of PP sources-induced lipid metabolism in farmed fish. On the other hand, the immunity of fish could also be largely affected by feed ingredients and its nutrients (Kiron, 2012). Fish liver is known to be the main organ for detoxification and the normal structure and function of which is closely associated with immunity. As one of the central regulatory features of immune defence mechanism against abiotic, biotic or chemical mediated stress, apoptosis (programmed cell death) is a normal physiological process that plays a central role in the differentiation and maintenance of the liver (Cheng et al., 2015; Schuster and Krieglstein, 2002; Teodoro and Branton, 1997). Apoptosis is orchestrated by a family of cysteine proteases known as the caspases (Slee et al., 2001). Two major pathways of caspase activation have been elucidated in vertebrates undergoing apoptosis, namely the extrinsic pathway (death receptor pathway) that directly activates the initiator caspase-8 and the intrinsic pathway (mitochondrial pathway) that is initiated by the release of cytochrome c activating downstream initiator caspse-9 and effector caspase-3 (Takle and Andersen, 2010). Meanwhile, caspase-7 was also considered to be an important downstream effector caspase that primarily playing a supportive role in the execution phase of apoptosis (Brentnall et al., 2013). In addition, there are other signaling pathways such as p53-dependent pathway which responds to stressors that disrupt the fidelity of DNA replication and cell division (Harris and Levine, 2005). To date, there is no study concerning dietary PP sources-induced apoptotic cell death in fish, making this topic worth investigation. The hybrid grouper (E. fuscoguttatus ♀ × E. lanceolatus ♂), a new carnivorous species that was first produced at Borneo Marine Research Institute of Universiti Malaysia Sabah (Ch Ng and Senoo, 2008), is considered as a potential candidate for marine aquaculture production in Asian region and has been globally commercialized because of its high market value and appreciated flesh. However, so far, studies regarding the effects of dietary PP sources on lipid metabolism and cell apoptosis of hybrid grouper are scarce. Therefore, the present study was undertaken to evaluate the effects of replacing FM with a complementary mixture of PP sources consisting of SBM, CGM and CSM, with supplemental lysine, methionine and taurine, on growth performance, liver histology, lipid metabolism and cell apoptosis, as well as the hepatic gene expression of juvenile hybrid grouper.
Table 1 Formulation and proximate composition of the experimental diets (g kg−1 dry diet). Ingredients
FM60
FM45
FM30
FM15
White fish meala Soybean mealb Corn gluten mealc Cottonseed meald Wheat flour Fish oil Brewer's yeast Ca(H2PO4)2 Lecithin Choline chloride (50%) Vitamin C Mineral and vitamin mixe Cellulose Lysinef Methionineg Taurineh Cholesterol Nutrient levels (g kg−1 dry diet) Moisture Crude protein Crude lipid Ash
600.0 0.0 0.0 0.0 120.0 50.0 20.0 20.0 10.0 5.0 5.0 20.0 140.0 0.0 0.0 0.0 10.0
450.0 73.6 51.9 53.6 120.0 58.3 20.0 20.0 10.0 5.0 5.0 20.0 88.0 3.8 0.9 10.0 10.0
300.0 147.1 103.8 107.1 120.0 66.6 20.0 20.0 10.0 5.0 5.0 20.0 45.9 7.6 1.8 10.0 10.0
150.0 220.7 155.7 160.7 120.0 74.9 20.0 20.0 10.0 5.0 5.0 20.0 4.0 11.3 2.7 10.0 10.0
80.0 430.8 100.3 130.9
84.8 433.1 103.5 121.8
89.1 440.2 114.5 103.1
84.2 440.7 109.5 89.0
a Peruvian anchovy meal (10.28% moisture, 65.83% crude protein, 9.11% crude lipid), Peru. b Dehulled and defatted soybean meal (3.30% moisture, 44.75% crude protein, 3.60% crude lipid), Zhanjiang Bohai Agriculture Development Co., Ltd., China. c Corn gluten meal (5.05% moisture, 63.42% crude protein, 2.96% crude lipid), Qinhuangdao Lihua Starch Co., Ltd., China. d Concentrated cottonseed meal (8.25% moisture, 61.44% crude protein, 2.24% crude lipid), Anxiang Xinrui Biotechnology Co., Ltd., China. e Mineral and vitamin mix, Guangzhou Chengyi Aquatic Technology Co., Ltd., China. f L-lysine mono-hydrochloride, Guangzhou Rikang Nutrition Technology Co., Ltd., China. g L-methionine, Guangzhou Rikang Nutrition Technology Co., Ltd., China. h Taurine, Guangzhou Rikang Nutrition Technology Co., Ltd., China.
concentrated CSM were employed as substitutes for FM protein. A Peruvian anchovy meal was selected as the control (FM60), and 25% (FM45), 50% (FM30) and 75% (FM15) of the anchovy meal was replaced with a combination of SBM, CGM and CSM. At each FM replacement, PP ingredients were added equivalent to the amount of protein in the FM replaced. PP based diets were supplemented with crystalline lysine, methionine and taurine to simulate those levels existing in the FM based diet. When preparing the diets, all of the dried ingredients were finely ground into powder, weighed and thoroughly mixed in a groove form mixer (CH-50, Shanghai Tianxiang & Chentai Pharmaceutical Machinery Co., Ltd., Shanghai, China). Distilled water (30% diet mix) was added and thoroughly blended, then pelleted into 2.5-mm diameter size using a pellet-making machine (Valva-60, Guangzhou Weilawei Machinery Co., Ltd., Guangzhou, China). The pellets were then oven-dried at 70 °C for 5 h and stored in plastic bags at −20 °C until used. 2.2. Experimental fish and feeding trial The hybrid grouper juveniles were obtained and transported from Marine Fisheries Development Center of Guangdong Province (Huizhou, China) to the research center of Zhanjiang Guolian Feed Co., Ltd. (Zhanjiang, China). Fish were then acclimatized to the experimental conditions while feeding on a commercial diet (Guangdong Yuequn Ocean Biological Research Development Co., Ltd., Jieyang, China) twice daily for 2 weeks. After the acclimatization, healthy fish with an average body weight of 31.64 ± 0.82 g were distributed
2. Materials and methods 2.1. Experimental diets preparation The formulation and proximate composition of the experimental diets are given in Table 1. Dehulled and defatted SBM, CGM and 438
Aquaculture 506 (2019) 437–444
H. Ye, et al.
randomly into 12 cylindrical tanks (400 L, 3 tanks per diet, 30 fish per tank). Fish were hand-fed twice daily at 8:00 and 16:00 to apparent satiation for 56 days. During the rearing period, each tank had supplemental aeration and continuous flow of water at a rate of 3 L min−1 in a re-circulating system. Water temperature was ranged from 25.2 to 28.2 °C, salinity from 28 to 32 psu, pH from 7.4 to 7.8, dissolved oxygen ≥6.0 mg L−1, NH4+-N ≤ 0.2 mg L−1 and NO2−-N ≤ 0.1 mg L−1.
2.6. Plasma biochemical measurements
2.3. Sample collection and analysis
2.7. Liver histological analysis
At the end of the feeding trial, all fish populations and mean body weight in each tank were determined. Then three fish from each tank were sampled and stored at −20 °C for analysis of whole body composition. Six fish randomly selected from each tank were anesthetized with tricaine methanesulfonate (MS-222; Sigma, St. Louis, MO, USA) at 100 mg L−1 and blood was collected by caudal venipuncture using 2 mL heparinized syringes. Blood samples were collected into anticoagulation tubes in order to obtain plasma. After collection, the whole blood was centrifuged at a rate of 3000 rpm for 15 min at 4 °C. The plasma samples were subsequently separated and stored at −80 °C for measurement of biochemical parameters. Viscera and liver of six fish sampled from each tank were collected and weighed. For histological analysis, the liver tissue samples were collected, and then fixed in 10% buffered formalin saline for further processing. For mRNA expression assays, liver samples were excised immediately, frozen in liquid nitrogen and stored at −80 °C until analysis. Finally, dorsal muscles were dissected and stored at −20 °C for further analysis of their nutrient composition.
Liver histological analysis were performed according to the method described by Chen et al. (2015). Briefly, for hematoxylin and eosin (H& E) observation, liver samples were gradually dehydrated in ethanol, clarified in benzene and embedded in paraffin wax. The tissue wax was cut into 4 μm sections. Fixed sections were stained with H&E and then prepared for light microscopy. For Oil Red O observation, the liver samples were sectioned (8 μm) on a cryostat microtome (CRYOSTAR NX50, Thermo, Shanghai, China). Sections were fixed in cold 10% buffered formalin and rinsed in distilled water, and then immersed briefly in 60% isopropanpol. After being stained with the oil red solution, sections were rinsed for a few seconds in two changes of 60% isopropanol. After two washes in distilled water, sections were stained in hematoxylin and mounted in glycerin jelly and subsequently prepared for light microscopy. The quantified areas of hepatic vacuoles in the H&E observation and lipid droplets in the Oil Red O observation were evaluated by using Image J software as described by Wei et al. (2017).
Plasma CHO, triacylglycerol (TG), high-density lipoprotein cholesterol (HDL-C) and low-density lipoprotein cholesterol (LDL-C) were analyzed using a ROCHE-P800 automatic biochemical analyzer (Roche, Basel, Switzerland) by the colorimetric method (Coz-Rakovac et al., 2008).
2.8. RNA extraction and real-time quantitative PCR (q-PCR)
2.4. Growth performance
The liver samples of six fish from each tank were pooled and total RNA was isolated from the samples using 1 mL TRIzol reagent (Vazyme Biotech Co., Ltd., China). The purity and concentration of isolated RNA were measured using a NanoDrop 2000 spectrophotometer (NanoDrop Technologies, USA). RNA integrity was confirmed by electrophoresis in 1.2% agarose gel. Single-stranded cDNA was synthesized from 1 μg total RNA using PrimeScript RT reagent Kit with gDNA Eraser (Takara, Dalian, China). The cDNA templates were then stored at −80 °C for later analysis. For q-PCR, the specific primer pairs are shown in Table 2 according to our transcriptome unigen (unpublished data). The β-actin gene was
The following variables were calculated:
Weight gain (WG,%) = (final body weight–initial body weight) /initial body weight × 100 Feed efficiency (FE) = wet weight gain/dry feed fed Protein efficiency ratio (PER) = wet weight gain/total protein consumed
Feed intake (FI,%day −1) = 100 × total amount of the feed consumed /[(initial body weight + final body weight)/2]
Table 2 Primers pairs used for quantitative PCR Primer sequences.
/days of feeding trial Hepatosomatic index (HSI,%) = 100 × liver wet weight/body wet weight
Primers
Quantitative PCR primers, forward/reverse (5′ to 3′)
Viscerosomatic index (VSI,%) = 100 × visceral wet weight
PPARα
F: CATCGACAATGACGCCCTC R: GCCGCTATCCCGTAAACAAC F: TCCTTACCGTTGGTCCCTCT R: CTTTCCATCTGCTGCTCTATCTC F: TCTTGCTCTCGCCCTTCTG R: TTTTGGCACTGTCCTTCACCT F: TTCAACAGCACCTCCAAAACC R: GTGAGCCAGTCCACCACGAT F: CGCAAAGAGTAGCGACGGA R: CGATGCTGGGGAAATTCAGAC F: ATAAGATGAGCCACCAGCGA R: GATACAGGCGAAACACGAGC F: TGCTTCTTGTGTCGTGATGTTG R: GCGTCGGTCTCTTCTGGTTG F: TTTTCCTGGTTATGTTTCGTGG R: TTGCTTGTAGAGCCCTTTTGC F: GGCACCAAACAAACCAAAAAAC R: GTCAAGCAACTCCAGACCATCA F: TACGAGCTGCCTGACGGACA R: GGCTGTGATCTCCTTCTGC
/body wet weight
CPT1
Condition factor (CF, g cm−3) = 100 × body weight/body length3
Apo-AI
Survival (%) = 100 × final fish number/initial fish number
LPL caspase-3
2.5. Fish and diets proximate composition
caspase-7
Nutrient composition of diets, whole body, muscle and liver were analyzed according to the standard methods of AOAC (2005) (Berbert et al., 2005). Moisture was determined by drying samples to constant weight at 105 °C. crude protein (N × 6.25) was determined by Kjeldahl method after acid digestion using an automatic Kjeltec™ 8400 (FOSS, Hoganos, Sweden). Crude lipid was determined by petroleum ether extraction using a Soxtec™ 2055 (FOSS, Hoganos, Sweden). Ash was determined by incineration in a muffle furnace (FO610C, Yamato Scientific Co., Ltd., Tokyo, Japan) at 550 °C for 6 h.
caspase-8 caspase-9 p53 β-actin
PPARα, peroxisome proliferator-activated receptor alpha; CPT1, carnitine palmitoyltransferase 1; Apo-AI, apolipoprotein AI; LPL, lipoprotein lipase. 439
Aquaculture 506 (2019) 437–444
H. Ye, et al.
used as a housekeeping gene that was amplified using β-actin-F and βactin-R gene-specific primers. Real-time PCR was amplified in an ABI 7500 real-time PCR machine (Applied Biosystems, USA) using ChamQTM SYBR® q-PCR Master Mix (Vazyme, Nanjing, China) following the manufacture's recommendations. Before the RT-PCR experiments, the specificity and efficiency of the primers above were evaluated. The standard equation and correlation coefficient were determined by constructing a standard curve using a serial dilution of cDNA. The reaction mixtures were 20 μL in total volume, containing 2 μL cDNA sample, 10 μL 2 × SYBR Premix Ex Taq, 0.5 μL each of the 10 μM forward and reverse primers, and 7 μL dH2O. The real-time PCR conditions were as follows: 94 °C for 5 min, then 40 cycles at 95 °C for 15 s, 60 °C for 1 min. All samples were run in triplicate, and each assay was repeated three times. After finishing the program, the threshold cycle (Ct) values were obtained from each sample. Relative gene expression levels were evaluated using 2-△△CT method (Livak and Schmittgen, 2001).
3.3. Plasma biochemical parameters Plasma biochemical parameters of juvenile hybrid grouper are shown in Table 5. Dietary PP inclusion significantly decreased plasma CHO, HDL-C and LDL-C contents (P < .05) while no significant differences were observed in TG content among all fish groups (P > .05). 3.4. Liver histology Liver histology (H&E and Oil Red O staining) is presented in Fig. 1. From the H&E staining, fish fed the basal diet showed normal hepatocyte morphology with regular liver lobule and liver sinusoid, but higher levels of dietary PP sources induced apparent morphological changes, characterized by higher occurrence rates of hepatocyte vacuolization and nuclear atrophy, disappearance or reduction that are signs of nuclear pycnosis (Fig. 1A–D). Relative areas for hepatic vacuoles in H&E staining were markedly increased with increasing dietary PP inclusion (Fig. 2A). For Oil Red O staining, the increase of dietary PP sources obviously reduced the amounts of hepatic lipid droplets (Fig. 1E–H). Meanwhile, the Oil Red O-relative areas in the liver of fish were significantly decreased as dietary PP inclusion increased (P < .05) (Fig. 2B).
2.9. Statistical analysis One-way ANOVA and Duncan's multiple range test were conducted to examine significant differences among mean values of treatments by using SPSS 17.0 (SPSS Inc. Michigan Avenue, Chicago, IL, USA). Moreover, a follow-up trend analysis using orthogonal polynomial contrasts was performed to determine whether the significant effects were linear and/or quadratic. Statistically significant differences required that P-value < .05.
3.5. mRNA levels of lipid metabolism-related genes in the liver of hybrid grouper As shown in Fig. 3, the transcriptional levels of peroxisome proliferator-activated receptor alpha (PPARα) and lipoprotein lipase (LPL) in the liver of fish were significantly decreased when dietary PP sources exceeded 50% (P < .05). Meanwhile, the mRNA level of carnitine palmitoyltransferase 1 (CPT1) showed a decreasing trend as dietary PP ingredients increased. The mRNA level of apolipoprotein AI (Apo-AI) in the liver of fish fed the PP containing diets was significantly lower than the control group (P < .05).
3. Results 3.1. Growth performance, feed utilization and morphological parameters As shown in Table 3, there were no significant differences in FBW, WG, FE, PER, FI and survival among dietary treatments after 56-day feeding trial (P > .05). For morphological parameters, the HSI in fish fed the FM30 and FM15 diets were significantly higher than the other groups (P < .05) while the VSI and CF showed no differences among treatments (P > .05).
3.6. mRNA levels of apoptosis-related genes in the liver of hybrid grouper As shown in Fig. 4, the transcriptional levels of caspase-8 and p53 in the liver of fish were gradually down-regulated with increasing levels of dietary PP sources. The mRNA level of p53 was significantly decreased when dietary PP sources reached 75% (P < .05). Meanwhile, the mRNA levels of caspase-3, caspase-7 and caspase-8 in the liver of fish fed the PP containing diets were significantly lower than the control FM60 group (P < .05). But the caspase-9 mRNA level was not significantly different among all fish groups (P > .05).
3.2. Nutrient composition in whole body, muscle and liver Data on fish nutrient composition are presented in Table 4. The whole body composition were not markedly affected by dietary PP sources (P > .05). Muscle crude protein did not vary among groups but muscle lipid content varied and the lowest were observed in fish fed the FM30 diet. For liver composition, crude protein and lipid contents showed a decreasing trend with increasing levels of dietary PP sources. The content of crude lipid in the liver was significantly decreased when dietary PP sources exceeded 50% (P < .05).
4. Discussion In the present study, after a 56-day feeding trial, no apparent
Table 3 Growth performance, feed utilization and morphological parameters in juvenile hybrid grouper fed the experimental diets for 56 days. Diets
FM60
FM45
FM30
FM15
ANOVA (P)
Linear trend (P)
Quadratic trend (P)
IBW (g) FBW (g) WG (%) FE PER (%) FI (% day−1) HSI (%) VSI (%) CF (g cm−3) Survival (%)
31.60 ± 0.88 70.37 ± 6.18 119.58 ± 14.69 0.83 ± 0.03 1.66 ± 0.05 1.48 ± 0.08 1.41 ± 0.13b 7.08 ± 0.58 2.48 ± 0.08 95.00 ± 5.00
30.73 ± 1.66 69.43 ± 9.45 124.54 ± 13.64 0.75 ± 0.01 1.52 ± 0.01 1.60 ± 0.04 1.26 ± 0.12b 7.04 ± 0.41 2.58 ± 0.07 95.00 ± 5.00
32.73 ± 0.45 76.75 ± 9.55 136.32 ± 29.14 0.80 ± 0.11 1.64 ± 0.22 1.60 ± 0.01 1.80 ± 0.32a 7.70 ± 0.78 2.61 ± 0.03 100.00 ± 0.00
31.50 ± 2.03 68.88 ± 11.49 115.32 ± 17.66 0.80 ± 0.03 1.64 ± 0.06 1.52 ± 0.09 1.85 ± 0.04a 7.83 ± 0.46 2.47 ± 0.13 98.33 ± 2.89
0.427 0.822 0.748 0.723 0.763 0.186 0.011 0.279 0.195 0.344
0.662 0.919 0.987 0.852 0.898 0.488 0.010 0.062 0.986 0.150
0.894 0.862 0.639 0.743 0.822 0.075 0.033 0.187 0.089 0.352
IBW, initial body weight; FBW, final body weight; WG, weight gain; FE, feed efficiency; PER, protein efficiency ratio; FI, feed intake; HSI, hepatosomatic index; VSI, viscerosomatic index; CF, condition factor. Values are mean ± SD of three replicates; means with different subscripts are significantly different (P < .05). 440
Aquaculture 506 (2019) 437–444
H. Ye, et al.
Table 4 Nutrient composition (% of wet weight) in whole body, muscle and liver of juvenile hybrid grouper fed the experimental diets for 56 days. Diets
FM60
FM45
FM30
FM15
ANOVA (P)
Linear trend (P)
Quadratic trend (P)
Whole body composition Moisture 70.33 ± 2.08 Crude protein 18.76 ± 1.47 Crude lipid 5.06 ± 0.44 Ash 4.88 ± 0.43
68.85 ± 1.44 19.51 ± 0.53 6.40 ± 0.52 4.86 ± 0.33
67.44 ± 2.43 19.41 ± 0.54 5.87 ± 0.78 4.53 ± 0.34
68.86 ± 1.94 19.18 ± 1.11 6.35 ± 0.86 4.59 ± 0.19
0.425 0.804 0.170 0.504
0.283 0.647 0.089 0.171
0.265 0.619 0.195 0.406
Muscle composition Moisture Crude protein Crude lipid Ash
76.03 ± 0.71 21.36 ± 0.53 1.30 ± 0.20ab 1.29 ± 0.14
76.22 ± 1.02 21.23 ± 0.36 1.73 ± 0.43a 1.29 ± 0.31
76.29 ± 0.26 21.43 ± 0.36 1.19 ± 0.13b 1.18 ± 0.10
75.79 ± 0.08 21.52 ± 0.22 1.40 ± 0.09ab 1.26 ± 0.12
0.778 0.827 0.182 0.878
0.690 0.470 0.939 0.699
0.584 0.688 0.852 0.861
Liver composition Crude protein Crude lipid
19.27 ± 0.74a 10.22 ± 0.58a
19.41 ± 3.30a 8.54 ± 1.08ab
16.60 ± 1.96ab 6.48 ± 0.82b
14.97 ± 1.55b 7.23 ± 1.23b
0.072 0.020
0.009 0.013
0.032 0.011
ANOVA (P)
Linear trend (P)
Quadratic trend (P)
0.015 0.149 0.005 0.000
0.001 0.029 0.002 0.000
0.007 0.099 0.002 0.001
Values are mean ± SD of three replicates; means with different subscripts are significantly different (P < .05). Table 5 Plasma biochemical parameters of juvenile hybrid grouper fed the experimental diets for 56 days. Diets
FM60 −1
CHO (mmol L ) TG (mmol L−1) HDL-C (mmol L−1) LDL-C (mmol L−1)
4.01 1.61 1.26 1.78
± ± ± ±
FM45 a
0.66 0.25 0.14a 0.12a
2.68 1.41 0.57 1.02
± ± ± ±
FM30 b
0.46 0.21 0.25b 0.01b
2.44 1.47 0.46 0.93
± ± ± ±
FM15 b
0.40 0.09 0.12b 0.02b
1.64 1.14 0.29 0.49
± ± ± ±
b
0.06 0.17 0.02b 0.01c
CHO, cholesterol; TG, triacylglycerol; HDL-C, high-density lipoprotein cholesterol; LDL-C, low-density lipoprotein cholesterol. Values are mean ± SD of three replicates; means with different subscripts are significantly different (P < .05).
Fig. 1. Light microscopy of the liver histology with H&E staining (A–D, 400×) or Oil Red O staining (E–H, 400×) in juvenile hybrid grouper fed with different experimental diets including FM60 (A and E), FM45 (B and F), FM30 (C and G) and FM15 (D and H) for 56 days. Scale bar: 50 μm. Lipids appear red and nuclei appear blue after staining with Oil Red O. The depth of colour of the red stain and the size of the lipid droplets were positively correlated with the lipid content. Nu, nuclei; Va, vacuolation; Ld, lipid droplet. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
previous studies which suggest that high levels of mixtures of PP ingredients in practical diets can go from 75% to complete replacement of FM without compromising growth performance in other carnivorous species, such as Senegalese sole (Solea senegalensis) (Cabral et al., 2013; Valente et al., 2016), Siberian sturgeon (Acipenser baerii Brandt) (Yun et al., 2014), gilthead sea bream (Sparus aurata) (Francesco et al., 2010; Gómez-Requeni et al., 2004), cobia (Rachycentron canadum) (Salze et al., 2010), rainbow trout (Oncorhynchus mykiss) (Lee et al., 2010) and European sea bass (Dicentrarchus labrax) (Kaushik et al., 2004). The range of tolerance to PP ingredients in these fish may be dependent on the species, growth status, rearing conditions and more specifically on quality of the PP sources, in terms of digestibility and presence of ANFs
reductions were observed in the growth performance and feed utilization when a blend of PP sources replaced up to 75% of FM protein, with proper EAA and taurine supplementation, in diet for grouper juveniles. Previous studies based on the analysis of specific growth rate have reported that in hybrid grouper feed, the maximum replacement levels of FM, by soy protein concentrate (Mohd Faudzi et al., 2018) and cottonseed protein concentrate (Yin et al., 2018) were 50% (338.0 g kg−1 dry diet) and 34% (204.0 g kg−1 dry diet), respectively. In our study, however, the 75% replacement of FM (450.0 g kg−1 dry diet) by PP ingredients was achieved, which could be due to the reasonable strategy of blending various PP nutritive properties with proper EAA and taurine supplementation. Our results are in accordance with 441
Aquaculture 506 (2019) 437–444
H. Ye, et al.
Fig. 2. Relative areas for hepatic vacuoles in H&E staining (A) and lipid droplets in Oil Red O staining (B) of the liver from hybrid grouper fed the experimental diets for 56 days. Values are mean ± SD of three replicates; means with different subscripts are significantly different (P < .05). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
accumulation which was a common morphological alteration in fish liver (Spisni et al., 1998). In a previous study it was noticed that a hepatic fat deposition was aggravated in hybrid grouper with a significantly increased level of serum triglycerides when dietary FM replacement level of cottonseed protein concentrate exceeded 36% (Yin et al., 2018). However, our result of Oil Red O staining clearly indicated that the amounts of hepatic lipid droplets were markedly reduced as dietary PP inclusion increased (Figs. 1E–H and 2B). Furthermore, the present study showed a concomitant decrease in plasma CHO level in fish fed the PP containing diets, which was in accordance with the hypocholesterolemic effect of PP sources in most previous studies (Dias et al., 2005; Ramdath et al., 2017; Sitjà-Bobadilla et al., 2005; Ye et al., 2019). Therefore, our results clearly indicated that the hepatic vacuoles in H&E staining of high level PP containing groups may not be exactly lipid accumulation, but more like glycogen deposits (Pereira et al., 2002; Silvia et al., 2010) despite the lack of relevant evidences. To further uncover the relationship between hepatic lipid metabolism and PP sources in fish, we next analyzed the transcriptional levels of lipid metabolism-related genes in the liver of hybrid grouper. Generally, lipid metabolism including lipid synthesis, oxidation, catabolism, transport and uptake, represents a complex process, and many key enzymes and transcriptional factors are involved in these processes (Chen et al., 2013). As an important transcriptional factor, PPARα plays an intermediary role in regulating the catabolism of fatty acids by increasing the expression of key lipolytic enzymes (Ribet et al., 2010). CPT1 is considered as the main regulatory enzyme in long-chain fatty acid oxidation because it catalyses the conversion of fatty acid-CoAs into fatty acid-carnitines for entry into the mitochondrial matrix (Kerner and Hoppel, 2000). In the present study, the mRNA levels of PPARα and CPT1 were down-regulated by high level of dietary PP ingredients, probably as a compensatory mechanism for the reduced contents of hepatic lipid droplet and plasma CHO, but this hypothesis needs further verification. In addition, Apo-AI plays a vital role in regulating plasma HDL-C and LDL-C contents (Yadav et al., 2018). The decreased Apo-AI level caused by dietary PP inclusion in this study was in agreement with the reduced HDL-C and LDL-C contents in the plasma of hybrid grouper. On the other hand, LPL is considered to be a crucial rate-limiting enzyme in the provision of tissue fatty acids, and it determines how dietary lipids are partitioned towards storage or utilization (Huang et al., 2014). Since the fish liver is the major organ with respect to lipid synthesis and storage, the down-regulation of LPL mRNA level with higher replacement level in our study may indicate a decrease in import of lipids into liver to be reesterified for storage or an increase in import of lipids from liver to nearby tissues to be utilized for energy purposes (Zheng et al., 2013). Our study indicated that dietary PP sources could decrease several key gene expression profiles involved in lipid oxidation, synthesis and transport as well as associated transcriptional factors, thus leading to abnormal lipid metabolism and reduced hepatic lipid content in hybrid grouper. The reduced crude lipid content of the liver with a higher replacing level further supports the notion.
Fig. 3. Relative mRNA expression of peroxisome proliferator-activated receptor alpha (PPARα), carnitine palmitoyltransferase 1 (CPT1), apolipoprotein AI (Apo-AI) and lipoprotein lipase (LPL) in the liver of hybrid grouper fed the experimental diets for 56 days. Relative mRNA expression was evaluated by real-time quantitative PCR. Values are mean ± SD of three replicates. Bars of the same gene bearing with different letters are significantly different by Duncan's test (P < .05).
Fig. 4. Relative mRNA expression of caspase-3, caspase-8, caspase-9 and p53 in the liver of hybrid grouper fed the experimental diets for 56 days. Relative mRNA expression was evaluated by real-time quantitative PCR. Values are mean ± SD of three replicates. Bars of the same gene bearing with different letters are significantly different by Duncan's test (P < .05).
(Gatlin et al., 2007; NRC, 2011). It is well known that the liver is an important organ with respect to lipid metabolism in fish. The liver histological changes can be easily recognized if feed containing protein or fat is used (Caballero et al., 2004). In this study, a higher level of hepatocyte vacuolization occurred as dietary PP inclusion increased (Fig. 1A–D and Fig. 2A). Usually, the hepatocyte vacuolization was considered to be related to the lipid
442
Aquaculture 506 (2019) 437–444
H. Ye, et al.
between dietary PP sources and cell apoptosis.
Taking all the above results together, it turned out that dietary PP sources could be involved in modulating lipid balance in the liver of hybrid grouper at the transcriptional levels, thus interrupting lipid homeostasis and consequently reduced the hepatic lipid droplets, plasma CHO, HDL-C and LDL-C contents as well as crude lipid content in the liver. To our knowledge, these results provide new evidence for the lipid-lowering effect of PP sources in carnivorous fish. However, it is worthy to note that the significantly higher HSI reveled an abnormally enlarged liver in hybrid grouper fed with a high level of dietary PP inclusion, which may be a sign of hepatic lesions. The underlying mechanism for these hepatic lesions as well as the hepatocyte vacuolization in hybrid grouper needs further study. In fish, the size of a nucleus generally reveals changes in liver metabolism, such as pycnosis, karyolysis of the nucleus or necrosis of the cell (Raškovic et al., 2011). In this study, results from the liver H&E staining showed that fish fed a high level of dietary PP sources induced an apparent nuclear pycnosis, characterized by nuclear atrophy, disappearance or reduction. A previous study reported that nuclear atrophy was found in the liver of juvenile sharpsnout sea bream (Diplodus puntazzo) fed a sunflower meal containing diet (Silvia et al., 2010). Likewise, the similar results of atrophied nuclei and cytoplasm of hepatocytes were also observed in orange-spotted grouper (Epinephelus coioides, Hamilton) fed with a diet having 30% of FM protein replaced by SBM protein (Shiu et al., 2015). This result may indicate that the grouper liver could not effectively metabolize high levels of dietary PP ingredients in particular the amounts of ANFs because they are novel to most cultivated fish species and could exert possible harmful effects on aquatic animals such as liver damage and immune suppression (Akande et al., 2010; Krogdahl et al., 2010). On the other hand, a previous study has noticed that the occurrence of nuclear pycnosis is associated with cell apoptosis when aquatic organisms are under environmental stressors (Jin et al., 2017). Thus, we next explored the effect of PP ingredients on the hepatocyte apoptosis of hybrid grouper to further clarify the possible toxicity mechanism of ANFs. In general, caspase activity has been demonstrated to be a useful indicator for detecting stress-induced apoptosis in the early-life stages of fish (Jiang et al., 2016). In our study, the mRNA levels of caspase-3, caspase-7 and caspase-8 in the liver of grouper were significantly decreased as dietary PP inclusion increased. Furthermore, the p53 level also showed this similar trend. A previous study found that caspase-3 activity decreased in the intestine and stomach of common dentex (Dentex dentex) after feeding with a SBM containing diet (Antonopoulou et al., 2017). Since apoptosis is one of the self-defence responses for scavenging cells damaged by environmental stress, our results may indicate that dietary PP ingredients could exert a toxic effect largely due to a number of ANFs that are part of the inherent defence mechanisms in all plants (Krogdahl et al., 2010). This possible toxic effect on grouper liver that inhibits hepatocyte apoptosis via both the caspasedependent and p53-dependent pathway poses a potential threat to the hybrid grouper when exposed to environmental stressors. For example, the reduced apoptotic mRNA levels in the long term may result in impairment of hepatic capacity for regeneration and repair of tissue damage, and thus may lead to histopathological changes of liver in hybrid grouper. To date, limited information is available concerning the hepatocyte apoptosis in fish fed a PP containing diet. Our study can provide new evidence for clarifying the possible toxicity mechanisms of ANFs on the liver of carnivorous fish. In conclusion, our study showed that a complementary mixture of PP sources consisting of SBM, CGM and CSM can replace up to 75% of FM protein in formulated diets for hybrid grouper juveniles without compromising growth performance and feed utilization. However, dietary PP ingredients not only reduced hepatic lipid content by modulating the lipid metabolism-related genes, but also inhibiting hepatocyte apoptosis by down-regulating apoptosis-related genes, which provided new evidence for the PP sources-induced lipid metabolism in carnivorous fish, and provided new insight into the relationship
Acknowledgements This research was supported by National Key R&D Program of China (2018YFD0900400), Guangdong Provincial Oceanic Fisheries Science and Technology Project (A201601C04), Guangdong Provincial Natural Science Foundation (2018A030313222, 2016A030313447). References Akande, K.E., Doma, U.D., Agu, H.O., Adamu, H.M., 2010. Major antinutrients found in plant protein sources: their effect on nutrition. Pak. J. Nutr. 9, 827–832. Albalat, A., Gómez-Requeni, P., Rojas, P., Médale, F., Kaushik, S., Vianen, G.J., Van den Thillart, G., Gutiérrez, J., Pérez-Sánchez, J., Navarro, I., 2005. Nutritional and hormonal control of lipolysis in isolated gilthead seabream (Sparus aurata) adipocytes. Am. J. Phys. Regul. Integr. Comp. Phys. 289, R259–R265. Antonopoulou, E., Chouri, E., Feidantsis, K., Lazou, A., Chatzifotis, S., 2017. Effects of partial dietary supplementation of fish meal with soymeal on the stress and apoptosis response in the digestive system of common dentex (Dentex dentex). J. Biol. Res. 24, 14. Berbert, D.M., Queiroz, E.C., Melo, A., 2005. Official Methods of Analysis of AOAC International. Brentnall, M., Rodriguez-Menocal, L., De Guevara, R.L., Cepero, E., Boise, L.H., 2013. Caspase-9, caspase-3 and caspase-7 have distinct roles during intrinsic apoptosis. BMC Cell Biol. 14, 32. Caballero, M.J., Izquierdo, M.S., Kjørsvik, E., Fernandez, A.J., Rosenlund, G., 2004. Histological alterations in the liver of sea bream, Sparus aurata L., caused by short-or long-term feeding with vegetable oils. Recovery of normal morphology after feeding fish oil as the sole lipid source. J. Fish Dis. 27, 531–541. Cabral, E.M., Tjr, F., Campos, S.D., Castro-Cunha, M., Mbpp, O., Cunha, L.M., Lmp, V., 2013. Replacement of fish meal by plant protein sources up to 75% induces good growth performance without affecting flesh quality in ongrowing Senegalese sole. Aquaculture 380–383, 130–138. Ch Ng, C.L., Senoo, S., 2008. Egg and larval development of a new hybrid grouper, tiger grouper Epinephelus fuscoguttatus × giant grouper E. lanceolatus. Aquacult. Sci. 56, 505–512. Chen, Q., Gong, Y., Luo, Z., Zheng, J., Zhu, Q., 2013. Differential effect of waterborne cadmium exposure on lipid metabolism in liver and muscle of yellow catfish Pelteobagrus fulvidraco. Aquat. Toxicol. 142, 380–386. Chen, Q.L., Luo, Z., Wu, K., Huang, C., Zhuo, M.Q., Song, Y.F., Hu, W., 2015. Differential effects of dietary copper deficiency and excess on lipid metabolism in yellow catfish Pelteobagrus fulvidraco. Comp. Biochem. Physiol. B: Biochem. Mol. Biol. 184, 19–28. Cheng, C.H., Yang, F.F., Ling, R.Z., Liao, S.A., Miao, Y.T., Ye, C.X., Wang, A.L., 2015. Effects of ammonia exposure on apoptosis, oxidative stress and immune response in pufferfish (Takifugu obscurus). Aquat. Toxicol. 164, 61–71. Coz-Rakovac, R., Smuc, T., Popovic, N.T., Strunjak-Perovic, I., Hacmanjek, M., Jadan, M., 2008. Novel methods for assessing fish blood biochemical data. J. Appl. Ichthyol. 24, 77–80. Dias, J., Alvarez, M.J., Diez, A., Arzel, J., Corraze, G., Bautista, J.M., Kaushik, S.J., 1998. Regulation of hepatic lipogenesis by dietary protein/energy in juvenile European seabass (Dicentrarchus labrax). Aquaculture 161, 169–186. Dias, J., Alvarez, M.J., Arzel, J., Corraze, G., Diez, A., Bautista, J.M., Kaushik, S.J., 2005. Dietary protein source affects lipid metabolism in the European seabass (Dicentrarchus labrax). Comp. Biochem. Physiol. A Mol. Integr. Physiol. 142, 19–31. Francesco, M.D., Parisi, G., Pérez Sánchez, J., Gómez Réqueni, P., Médale, F., Kaushik, S.J., Mecatti, M., Poli, B.M., 2010. Effect of high-level fish meal replacement by plant proteins in gilthead sea bream (Sparus aurata) on growth and body/fillet quality traits. Aquac. Nutr. 13, 361–372. Gatlin, D.M., Barrows, F.T., Brown, P., Dabrowski, K., Gaylord, T.G., Hardy, R.W., Herman, E., Hu, G., Krogdahl, Å., Nelson, R., 2007. Expanding the utilization of sustainable plant products in aquafeeds: a review. Aquac. Res. 38, 551–579. Gómez-Requeni, P., Mingarro, M., Calduch-Giner, J.A., Médale, F., Martin, S.A.M., Houlihan, D.F., Kaushik, S., Pérez-Sánchez, J., 2004. Protein growth performance, amino acid utilisation and somatotropic axis responsiveness to fish meal replacement by plant protein sources in gilthead sea bream (Sparus aurata). Aquaculture 232, 493–510. Gu, M., Kortner, T.M., Penn, M., Hansen, A.K., Krogdahl, Å., 2014. Effects of dietary plant meal and soya-saponin supplementation on intestinal and hepatic lipid droplet accumulation and lipoprotein and sterol metabolism in Atlantic salmon (Salmo salar L.). Br. J. Nutr. 111, 432–444. Harris, S.L., Levine, A.J., 2005. The p53 pathway: positive and negative feedback loops. Oncogene 24, 2899. Huang, C., Chen, Q., Luo, Z., Shi, X., Pan, Y., Song, Y., Zhuo, M., Wu, K., 2014. Timedependent effects of waterborne copper exposure influencing hepatic lipid deposition and metabolism in javelin goby Synechogobius hasta and their mechanism. Aquat. Toxicol. 155, 291–300. Jiang, J.H., Chen, Y.H., Yu, R.X., Zhao, X.P., Qiang, W., Cai, L.M., 2016. Pretilachlor has the potential to induce endocrine disruption, oxidative stress, apoptosis and immunotoxicity during zebrafish embryo development. Environ. Toxicol. Pharmacol. 42, 125–134. Jin, J., Wang, Y., Wu, Z., Hergazy, A., Lan, J., Zhao, L., Liu, X., Chen, N., Lin, L., 2017.
443
Aquaculture 506 (2019) 437–444
H. Ye, et al.
Res. 307, 1–14. Shiu, Y.L., Hsieh, S.L., Guei, W.C., Tsai, Y.T., Chiu, C.H., Liu, C.H., 2015. Using Bacillus subtilis E20-fermented soybean meal as replacement for fish meal in the diet of orange-spotted grouper (Epinephelus coioides, Hamilton). Aquac. Res. 46, 1403–1416. Silvia, N.M., Ana, T., Silvia, M., Miguel, J.C., 2010. Sunflower meal as a partial substitute in juvenile sharpsnout sea bream (Diplodus puntazzo) diets: amino acid retention, gut and liver histology. Aquaculture 298, 275–281. Sitjà-Bobadilla, A., Peña-Llopis, S., Gómez-Requeni, P., Médale, F., Kaushik, S., PérezSánchez, J., 2005. Effect of fish meal replacement by plant protein sources on nonspecific defence mechanisms and oxidative stress in gilthead sea bream (Sparus aurata). Aquaculture 249, 387–400. Slee, E.A., Adrain, C., Martin, S.J., 2001. Executioner caspase-3,-6, and-7 perform distinct, non-redundant roles during the demolition phase of apoptosis. J. Biol. Chem. 276, 7320–7326. Spisni, E., Tugnoli, M., Ponticelli, A., Mordenti, T., Tomasi, V., 1998. Hepatic steatosis in artificially fed marine teleosts. J. Fish Dis. 21, 177–184. Takle, H., Andersen, O., 2010. Caspases and apoptosis in fish. J. Fish Biol. 71, 326–349. Teodoro, J.G., Branton, P.E., 1997. Regulation of apoptosis by viral gene products. J. Virol. 71, 1739–1746. Tocher, D.R., 2003. Metabolism and functions of lipids and fatty acids in teleost fish. Rev. Fish. Sci. 11, 107–184. Valente, L.M.P., Cabral, E.M., Sousa, V., Cunha, L.M., Fernandes, J.M.O., 2016. Plant protein blends in diets for Senegalese sole affect skeletal muscle growth, flesh texture and the expression of related genes. Aquaculture 453, 77–85. Vielma, J., Koskela, J., Ruohonen, K., Jokinen, I., Kettunen, J., 2003. Optimal diet composition for European whitefish (Coregonus lavaretus): carbohydrate stress and immune parameter responses. Aquaculture 225, 3–16. Wei, C., Wu, K., Gao, Y., Zhang, L., Li, D., Luo, Z., 2017. Magnesium reduces hepatic lipid accumulation in yellow catfish (Pelteobagrus fulvidraco) and modulates lipogenesis and lipolysis via PPARα, JAK-STAT, and AMPK pathways in hepatocytes1-3. J. Nutr. 147, 1070–1078. Yadav, D., Kim, S., Bae, M., Kim, J., Cho, K., 2018. The ability of different ketohexoses to alter Apo-AI structure and function in vitro and to induce hepatosteatosis, oxidative stress, and impaired plasma lipid profile in hyperlipidemic zebrafish. Oxidative Med. Cell. Longev. 2018. Yaghoubi, M., Mozanzadeh, M.T., Marammazi, J.G., Safari, O., Gisbert, E., 2016. Dietary replacement of fish meal by soy products (soybean meal and isolated soy protein) in silvery-black porgy juveniles (Sparidentex hasta). Aquaculture 464, 50–59. Ye, H., Ye, C., Xu, M., Liu, Q., Sun, Z., Zou, C., Chen, L., Su, N., 2019. Effects of replacing fish meal with soybean meal on growth performance, feed utilization and physiological status of juvenile obscure puffer, Takifugu obscurus. Comp. Biochem. Physiol. Part C: Toxicol. Pharmacol. 216, 75–81. Yin, B., Liu, H., Tan, B., Dong, X., Chi, S., Yang, Q., Zhang, S., Chen, L., 2018. Cottonseed protein concentrate (CPC) suppresses immune function in different intestinal segments of hybrid grouper ♀Epinephelus fuscoguttatus × ♂Epinephelus lanceolatu via TLR-2/MyD88 signaling pathways. Fish Shellfish Immunol. 81, 318–328. Yu, H., Gao, Q., Dong, S., Wen, B., 2015. Changes in fatty acid profiles of sea cucumber Apostichopus japonicus (Selenka) induced by terrestrial plants in diets. Aquaculture 442, 119–124. Yun, B., Xue, M., Wang, J., Sheng, H., Zheng, Y., Wu, X., Li, J., 2014. Fishmeal can be totally replaced by plant protein blend at two protein levels in diets of juvenile Siberian sturgeon, Acipenser baerii Brandt. Aquac. Nutr. 20, 69–78. Zhang, Y.X., Øverland, M., Shearer, K.D., Sørensen, M., Mydland, L.T., Storebakken, T., 2012. Optimizing plant protein combinations in fish meal-free diets for rainbow trout (Oncorhynchus mykiss) by a mixture model. Aquaculture 360, 25–36. Zheng, J., Luo, Z., Liu, C., Chen, Q., Tan, X., Zhu, Q.L., Gong, Y., 2013. Differential effects of acute and chronic zinc (Zn) exposure on hepatic lipid deposition and metabolism in yellow catfish Pelteobagrus fulvidraco. Aquat. Toxicol. 132, 173–181.
Transcriptomic analysis of liver from grass carp (Ctenopharyngodon idellus) exposed to high environmental ammonia reveals the activation of antioxidant and apoptosis pathways. Fish Shellfish Immunol. 63, 444–451. Kaushik, S.J., Coves, D., Dutto, G., Blanc, D., 2004. Almost total replacement of fish meal by plant protein sources in the diet of a marine teleost, the European seabass, Dicentrarchus labrax. Aquaculture 230, 391–404. Kerner, J., Hoppel, C., 2000. Fatty acid import into mitochondria. Biochim. Biophys. Acta (BBA)-Mol. Cell Biol. Lipids 1486, 1–17. Kiron, V., 2012. Fish immune system and its nutritional modulation for preventive health care. Anim. Feed Sci. Technol. 173, 111–133. Krogdahl, Å., Penn, M., Thorsen, J., Refstie, S., Bakke, A.M., 2010. Important antinutrients in plant feedstuffs for aquaculture: an update on recent findings regarding responses in salmonids. Aquac. Res. 41, 333–344. Lee, K.J., Powell, M., Barrows, F., Smiley, S., Bechtel, P., Hardy, R., 2010. Evaluation of supplemental fish bone meal made from Alaska seafood processing byproducts and dicalcium phosphate in plant protein based diets for rainbow trout (Oncorhynchus mykiss). Aquaculture 302, 248–255. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2−ΔΔCT method. Methods 25, 402–408. Maita, M., Maekawa, J., SATOH, K.I., Futami, K., Satoh, S., 2006. Disease resistance and hypocholesterolemia in yellowtail Seriola quinqueradiata fed a non-fishmeal diet. Fish. Sci. 72, 513–519. Messina, M., Piccolo, G., Tulli, F., Messina, C.M., Cardinaletti, G., Tibaldi, E., 2013. Lipid composition and metabolism of European sea bass (Dicentrarchus labrax L.) fed diets containing wheat gluten and legume meals as substitutes for fish meal. Aquaculture 376, 6–14. Mohd Faudzi, N., Yong, A.S.K., Shapawi, R., Senoo, S., Biswas, A., Takii, K., 2018. Soy protein concentrate as an alternative in replacement of fish meal in the feeds of hybrid grouper, brown-marbled grouper (Epinephelus fuscoguttatus) × giant grouper (E. lanceolatus) juvenile. Aquac. Res. 49, 431–441. Naylor, R.L., Hardy, R.W., Bureau, D.P., Chiu, A., Elliott, M., Farrell, A.P., Forster, I., Gatlin, D.M., Goldburg, R.J., Hua, K., 2009. Feeding aquaculture in an era of finite resources. Proc. Natl. Acad. Sci. 106 (36), 15103–15110. NRC, 2011. Nutrient Requirements of Fish and Shrimp. National Academy Press, Washington, DC. Oliva-Teles, A., Enes, P., Peres, H., 2015. Replacing fishmeal and fish oil in industrial aquafeeds for carnivorous fish. In: Feed and Feeding Practices in Aquaculture. Elsevier, pp. 203–233. Pereira, O., Rosa, E., Pires, M.A., Fontaınhas-Fernandes, A., 2002. Brassica by-products in diets of rainbow trout (Oncorhynchus mykiss) and their effects on performance, body composition, thyroid status and liver histology. Anim. Feed Sci. Technol. 101, 171–182. Pratoomyot, J., Bendiksen, E.Å., Bell, J.G., Tocher, D.R., 2010. Effects of increasing replacement of dietary fishmeal with plant protein sources on growth performance and body lipid composition of Atlantic salmon (Salmo salar L.). Aquaculture 305, 124–132. Ramdath, D.D., Padhi, E.M., Sarfaraz, S., Renwick, S., Duncan, A.M., 2017. Beyond the cholesterol-lowering effect of soy protein: a review of the effects of dietary soy and its constituents on risk factors for cardiovascular disease. Nutrients 9, 324. Raškovic, B.S., Stankovic, M.B., Markovic, Z.Z., Poleksic, V.D., 2011. Histological methods in the assessment of different feed effects on liver and intestine of fish. J. Agric. Sci. 56, 87–100. Ribet, C., Montastier, E., Valle, C., Bezaire, V., Mazzucotelli, A., Mairal, A., Viguerie, N., Langin, D., 2010. Peroxisome proliferator-activated receptor-α control of lipid and glucose metabolism in human white adipocytes. Endocrinology 151, 123–133. Salze, G., Mclean, E., Battle, P.R., Schwarz, M.H., Craig, S.R., 2010. Use of soy protein concentrate and novel ingredients in the total elimination of fish meal and fish oil in diets for juvenile cobia, Rachycentron canadum. Aquaculture 298, 294–299. Schuster, N., Krieglstein, K., 2002. Mechanisms of TGF-β-mediated apoptosis. Cell Tissue
444