- Email: [email protected]
Effects of different CpG oligodeoxynucleotides with inactivated avian H5N1 influenza virus on mucosal immunity of chickens1
IMMUNOLOGY, HEALTH, AND DISEASE Effects of different CpG oligodeoxynucleotides with inactivated avian H5N1 influenza virus on mucosal immunity of chickens1 Jia Fu, Jinfeng Liang, Haihong Kang, Jian Lin, Qinghua Yu, and Qian Yang2 Key Laboratory of Animal Physiology and Biochemistry, Ministry of Agriculture, Nanjing Agricultural University, Weigang 1, Nanjing, Jiangsu, 210095, China cretory IgA antibody level in the lavage fluid of upper respiratory tract increased significantly after intranasal immunization with IAIV and CpG-ODN, so did AIVspecific IgG in serum (P < 0.01). Among all the designed CpG-ODN, CpG-ODN F3 with an addition of poly-guanosine strings at the 3′-end not only had the best enhancement on local mucosal immune response but also showed an effective induction of systemic immune response. Most importantly, the virus challenge study showed that prior administration of IAIV with CpG-ODN F3 could protect chickens effectively against live AIV H5N1 challenge. Additionally, among all the CpG-ODN in our study, the cost of the designed CpGODN F3 was the lowest because of the partially phosphorothioate backbone. Therefore, we speculated that CpG-ODN F3 with efficient adjuvant activity and a big cost advantage over CpG-ODN F1 (CpG-ODN 2006) might serve as an efficient and affordable nasal adjuvant for inactivated AIV vaccine in chicken.
Key words: avian H5N1 influenza virus, CpG oligodeoxynucleotide, intranasal immunization, avian Toll-like receptor, virus challenge 2013 Poultry Science 92:2866–2875 http://dx.doi.org/10.3382/ps.2013-03205
INTRODUCTION The avian influenza virus (AIV) has been an important pathogen for the poultry industry for many years. The highly pathogenic avian influenza H5N1 virus remains a major global health concern because it has rapid evolution, high genetic diversity, broad host range, and potential human-to-human transmission (Zhou et al., 2012). Currently, most inactivated AIV oil emulsion vaccines on the market are administered via the intramuscular route. Although the intramuscular route can stimulate systemic immunity, it does
©2013 Poultry Science Association Inc. Received March 25, 2013. Accepted July 5, 2013. 1 There were no potential conflicts of interest (financial, professional, or personal) that are relevant to the manuscript. 2 Corresponding author: [email protected]
not induce sufficient mucosal immunity. Furthermore the stress reaction caused by intramuscular injection can potentially slow down the growth of poultry, and the deposit of stable emulsion can reduce the quality of animal meat (Xiaowen et al., 2009). Avian influenza virus mainly spreads through respiratory tract route, so the intranasal immunization can be efficient to block the transmission route of AIV. Previous studies demonstrated that intranasal immunization was an effective route for inducing mucosal immunity against various virus and was very promising to deliver vaccines (Zuercher, 2003; Thompson and Staats, 2011). The intranasal delivery of inactivated virus alone is often insufficient for inducing effective immune protection. However, the mucosal immune response can be enhanced significantly after co-administration of inactivated virus with appropriate adjuvant (Petrovsky and Aguilar, 2004; Scheerlinck et al., 2006). CpG oligodeoxynucleotide (CpG-ODN) is a short single-stranded
2866
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 12, 2014
ABSTRACT Oligodeoxynucleotide containing unmethylated CpG motifs (CpG-ODN) has been proved to be a potent and safe vaccine adjuvant. However, the application of CpG-ODN in poultry vaccines was limited because of its high cost to benefit ratio. The objective of this study was to identify the CpG-ODN with efficient adjuvant activity and low cost in chickens. Four sequences of CpG-ODN were designed based on CpGODN 2006, which was used as a template and positive sequence in our study. In the current study, in vitro observations revealed that the designed CpG-ODN had efficient immunostimulatory effects on chicken splenic lymphocytes. The in vivo results showed that the mRNA expressions of IL-6, IL-12, interferon-γ, and Toll-like receptor (TLR) 21 in upper respiratory tract tissues increased significantly in the early period after intranasal immunization with inactivated avian H5N1 influenza virus (IAIV) and CpG-ODN (P < 0.01). In addition, the avian influenza virus (AIV)-specific se-
2867
INACTIVATED AVIAN H5N1 INFLUENZA VIRUS Table 1. Sequences of CpG oligodeoxynucleotide (CpG-ODN) used in this study Sequence 5′-3′
Characteristic
CpG-ODN F1 (CpG-ODN 2006, positive sequences)
TCGTCGTTTTGTCGTTTTGTCGTT
Non-CpG-ODN F2 (negative sequences)
TCGTGCTTTTGTGCTTTTGTGCTT
CpG-ODN F3 (designed)
TCGTCGTTGTCGTTTTGTCGTTGGGGGG
CpG-ODN F4 (designed)
TCGTCGTTTTGTCGTTCGGCGCGCGCCG
CpG-ODN F5 (designed)
TCAACGTTTTGTCGTT
CpG-ODN F6 (designed)
TCGTCGTTGTCGTTAACGACAACGACGA
24 bases, phosphorothioate all bases 24 bases, phosphorothioate all bases 28 bases, poly-guanosine strings at 3′ end phosphorothioate 8 bases in bold 28 bases, palindrome structure at 3′ end phosphorothioate all bases 16 bases, phosphorothioate all bases 28 bases, palindrome sequences phosphorothioate all bases
synthetic DNA molecule that contains unmethlyated CpG motifs. It was reported that CpG-ODN was a kind of potent mucosal adjuvants, which could promote the immune effect of inactivated vaccine by mucosal immunization (Yang et al., 2009). CpG-ODN can stimulate dendritic cells, macrophages, and B cells by activating NF-κB pathway, and then promote cytokine secretion and expression of co-stimulatory molecules, and finally enhance the immune response with a tendency toward Th1 type response (Xiang et al., 2008). The immunostimulatory activity of CpG-ODN is related to its sequence and structural features, including the numbers of CpG motifs, phosphorothioate modification of backbone, poly-guanosine (poly-G) strings, palindrome structure, and so on (Du et al., 2007). CpG oligodeoxynucleotide has been demonstrated to be an excellent immune adjuvant in various mammalian vaccines. However, only a few studies have confirmed its efficacy in avian vaccines (Ameiss et al., 2006; Roh et al., 2006). Nowadays the application of CpG-ODN is limited in the poultry vaccine industry because of its high cost to benefit ratio. Therefore, CpG-ODN with lower cost and high immunostimulatory effect is necessary for avian vaccines. In this study, 4 sequences of CpG-ODN were designed based on CpG-ODN 2006, which was used as a template and positive control CpG-ODN; then the adjuvant effects of the designed CpG-ODN on inactivated avian H5N1 influenza virus (IAIV) vaccine were investigated in chickens.
MATERIALS AND METHODS Vaccine Strain and the Designed CpG-ODN Inactivated avian H5N1 influenza virus [A/ duck/2009, Re5 strain, 1 × 108.6 ELD50 (50% embryo lethal dose)/0.1 mL] was purchased from Yebio Biological Engineering Co. Ltd. (Qingdao, China). The pure CpG-ODN was synthesized at Takara Biotech Co. Ltd., Dalian, China (Table 1). CpG oligodeoxynucleotide free of endotoxins was resuspended in sterile PBS at a concentration of 1 mg/mL and stored at −20°C.
Proliferation Assay Proliferation of chicken splenic lymphocytes was analyzed using a WST-8 Cell Counting Kit-8 (CCK-8, Beyotime Institute of Biotechnology, Jiangsu, China). Briefly, 60-d-old specific pathogen-free (SPF) Hyline chickens obtained from Jiangsu Academy of Agricultural Sciences (Nanjing, China) were decapitated. Then single cell suspensions from spleen were isolated by mechanical method and carefully layered onto Ficoll-Hypaque Solution with specific gravity 1.077 (Beijing Dingguo Changsheng Biotech Co. Ltd., Beijing, China). After centrifugation at 250 × g at 20°C for 30 min, the cells in the interfaces were collected and washed with PBS. Finally, the isolated cells were resuspended in RPMI 1640 (Gibco BRL Co. Ltd., Grand Island, NY) supplemented with 10% fetal bovine serum (Hyclon, Logan, UT) at a final concentration of 1 × l06 cells /mL. Next, lymphocytes were added into 96-well plate (90 μL/well). Six ODN sequences (Table 1) were respectively added at a final concentration of 30 μg/mL (10 μL/well); Concanavalin A (Sigma, St. Louis, MO) was used as a positive control (100 ng/ mL); and PBS was used as a negative control. The RPMI 1640 medium alone without cells was added to the bank wells. After culture at 37°C with 5% CO2 for 3 d, the CCK-8 solution (10 μL/well) was added to the plates. Following incubation at 37°C with 5% CO2 for 2 h, the absorbance was read by using a 450nm filter. The stimulation indices (SI) were calculated with the formula SICpG = (ODCpG − ODbank control)/ (ODnegative well − ODbank well), where OD is optical density.
Immunization Schedule In total, 224 three-day-old SPF Hyline chickens (male) were obtained from Jiangsu Academy of Agricultural Sciences (Nanjing, China). Chickens were randomly divided into 8 groups and immunized at 7 d old. One group of chickens was intranasally immunized with 120 μL of PBS as the negative control group. One
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 12, 2014
CpG-ODN
2868
Fu et al.
Table 2. Sequences of primers used for quantitative real-time PCR Gene1
Primer
Primer sequence
IL-6
Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse
CGGCAGATGGTGATAAATCC CCCTCACGGTCTTCTCCATA ACCAGCCGACTGAGATGTTC GTGCTCCAGGTCTTGGGATA AGCTGACGGTGGACCTATTATT GGCTTTGCGCTGGATTC CAACAGACTGCTGGAGGTGA TGCAGCTTCAGGTCGTACAG ATGAAGCCCAGAGCAAAAGA GGGGTGTTGAAGGTCTCAAA
IL-12 IFN-γ TLR21 β-Actin 1IFN
Product size (bp)
Accession no.
160
HM179640
163
DQ202328
259
Y07922
159
NM_001030558
222
L08165
= interferon; TLR = Toll-like receptor.
μL of ROX dye II, and 0.4 μL of forward and reverse specific primer (10 μM) with an ABI 7 500 instrument (ABI, USA). Sequences of primers used for quantitative real-time PCR (RT-qPCR) were shown in Table 2. The data were reported as values normalized to the housekeeping gene (β-actin) and calculated as the following formula (Pfaffl, 2001): relative quantification = 2−ΔΔCt, ΔΔCt = (Cttarget gene − Ctβ-actin)treated group − (Cttarget gene − Ctβ-actin)untreated group.
Sample Collection
ELISA for SIgA in Lavage Fluid and IgG in Serum
Chickens were decapitated at 24 h after booster immunization. The samples of nasal cavity and trachea tissues were collected from 6 chickens in each group and stored in liquid nitrogen for detection of cytokines and Toll-like receptor (TLR) 21 expression. Chickens were decapitated at wk 3, 5, and 7 after the first immunization, respectively (6 chickens per group). Nasal cavity and trachea tissues were collected and were repeatedly washed with 0.5 mL of PBS for collecting lavage liquid. Then the lavage liquid was centrifuged at 3,000 × g at 4°C for 10 min. Finally the supernatant was collected and stored at −20°C for detection of AIVspecific secretory IgA (SIgA). Blood samples were collected from the wing vein of chickens weekly after the first immunization (6 chickens per group). Then the serum samples were collected after centrifugation at 3,000 × g at 20°C for 15 min and finally stored at −20°C.
Quantitative Real-Time PCR for IL-6, IL-12, Interferon-γ, and TLR21 in the Upper Respiratory Tract The total RNA of nasal cavity and trachea tissue was obtained with an RNA extraction kit (Tiangen Biotech Co. Ltd., Beijing, China). The total RNA was reverse-transcribed into cDNA with PrimeScript RT master Mix Perfect Real Time (Takara Bio Inc.). To determine the mRNA expression levels, 2 μL of cDNA was amplified in a 20-μL reaction mixture containing 10 μL of SYBR Premix Ex Taq (Takara Bio Inc.), 0.4
The AIV-specific SIgA in lavage liquid was assayed by indirect ELISA. Briefly, polystyrene plates were coated overnight at 4°C with 0.1 mL of IAIV (108.6 ELD50/0.1 mL, 1:2,000 diluted in carbonate bicarbonate, pH 9.6). Following 3 washes with PBS containing 0.05% Tween-20 (PBST, 0.01M, pH 7.4), the plates were blocked with 0.2 mL of 1.5% BSA for 2 h at 37°C. After 3 washes with PBST, 0.1 mL of nasal lavage fluid or tracheal lavage fluid diluted in PBS was added to the plates and incubated for 1 h at 37°C. Following 3 washes with PBST, goat anti-chicken IgA (Bethyl Laboratories Inc., USA) was added and incubated at 37°C for 1 h. After 3 washes with PBST, 0.1 mL of rabbit anti-goat IgG conjugated with horseradish peroxidase (Bethyl Laboratories Inc.) was added and incubated at 37°C for 1 h. After 3 washes with PBST, 0.1 mL of chromogenic substrate (TMB, Sunshine Biotechnology Co. Ltd., Nanjing, China) was added and incubated at 37°C for 10 min. Color development was stopped by addition of 0.05 mL of H2SO4 (2 M). The optical density at 450 nm (OD450) was recorded by using a universal Microplate Reader ELx800 (Bio-Tek Instruments Inc., USA). The data were reported as S/N value calculated by the following formula: S/N = (OD450 of sample − OD450 of bank control)/(OD450 of negative control − OD450 of bank control), where OD450 is the optical density at 450 nm, S refers to sample, and N refers to negative control. The serum was diluted 100-fold in PBS, and the AIV-specific IgG antibody in it was detected as above.
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 12, 2014
group of chickens was immunized with 120 μL of IAIV only. Other groups of chickens were intranasally immunized with 120 μL of IAIV mixed with one of the following (30 μg): CpG-ODN F1, non-CpG-ODN F2, CpG-ODN F3, CpG-ODN F4, CpG-ODN F5, or CpGODN F6. All chickens were immunized again at 14 d old. The animal experimental protocols were proved by the Animal Care and Use Committee, Nanjing Agricultural University.
INACTIVATED AVIAN H5N1 INFLUENZA VIRUS
2869
Hemagglutination Inhibition Assay The hemagglutination inhibition (HI) antibody in serum was assayed by hemagglutination inhibition tests, according to the Chinese National Standard of diagnostic techniques for highly pathogenic avian influenza, and the Office International des Epizooties (OIE) standards (OIE, 2005).
Virus Challenge The viral challenge study was performed in a thirdlevel biological safety laboratory in Yebio Biological engineering Co. Ltd. (Qingdao, China), and the chickens were kept under specific pathogen-free conditions in individual ventilated cages. Seven-day-old SPF Hyline chickens (male) obtained from Yebio Biological Engineering Co. Ltd. were randomly divided into 3 groups (20 chickens per group) and intranasally immunized twice (at 7 d and 14 d old). The virus that was intranasally inoculated was IAIV subtype, Re5 strain (1 × 108.6 ELD50/0.1 mL). Groups of chickens received one of the following: 120 μL of PBS, 120 μL of IAIV, or 120 μL of IAIV mixed with 30 μg of CpG-ODN F3. Chickens per group were divided into 2 parts and intranasally challenged with highly virulent H5N1 AIV strain (A/Duck/zhucheng/3/03, 1 × 106.6ELD50/0.1 mL), respectively, at d 7 and 21 after booster immunization. After challenge, chickens were monitored for disease signs and death for 12 d and the survival rate was recorded.
Statistical Analysis Statistical analyses were performed using SPSS Statistical Software 17.0. The statistical significance was analyzed by one-way ANOVA followed by the Duncan’s multiple range tests. A P-value less than 0.01 was considered statistically significant.
RESULTS Immunostimulatory Activity of the Designed CpG-ODN on Chicken Splenic Lymphocytes The SI of all the CpG-ODN on the splenic lymphocytes were significantly higher than that of PBS (P < 0.01), and no significant differences were detected among these sequences (P > 0.05; Figure 1).
mRNA Expression Levels of IL-6, IL-12, Interferon-γ, and TLR21 The mRNA expression levels of IL-6, IL-12, and interferon (IFN)-γ in nasal cavity (Figure 2A) and trachea (Figure 2B) were detected by RT-qPCR. After immunization with IAIV and CpG-ODN, the mRNA expression levels of IL-6, IL-12, and IFN-γ in nasal cavity and trachea were significantly increased (P < 0.01), compared with that in chickens immunized with IAIV alone. The IL-6 expression levels in nasal cavity and trachea were all high in the chickens receiving IAIV with CpG-ODN F1, CpG-ODN F3, or CpG-ODN F6, and no significant differences were detected among the 3 groups (P > 0.05). So were the expression levels of IL12 in nasal cavity in these 3 groups. The IL-12 expression level in trachea from chickens receiving IAIV and CpG-ODN F6 was the highest, but was not significantly different from that in chickens receiving IAIV and CpG-ODN F1 (P > 0.05). Besides, the IFN-γ expression levels in nasal cavity and trachea from chickens receiving IAIV and CpG-ODN F3 were the highest and even significantly increased compared with that from chickens receiving IAIV and CpG-ODN F1 (P < 0.01). Among all the groups co-administration of IAIV and the designed CpG-ODN, the TLR21 expression level in nasal cavity from chickens receiving IAIV and CpGODN F3 was the highest, but was not significantly different from that in chickens receiving IAIV and CpGODN F1 (P > 0.05; Figure 2C). The TLR21 expression
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 12, 2014
Figure 1. The stimulation indices (SI) of CpG oligodeoxynucleotide (CpG-ODN) on chicken splenic lymphocytes. Proliferation of chicken splenic lymphocytes was detected by WST-8 Cell Counting Kit-8 (CCK-8, Beyotime Institute of Biotechnology, Jiangsu, China) assay. The stimulation indices (SI) were calculated as the formula SICpG = (ODCpG − ODbank control)/(ODnegative well − ODbank well), where OD is optical density. All data are shown as the mean ± SEM. Significant difference between 2 groups was indicated by the use of different capital letters (A,B; P < 0.01).
2870
Fu et al.
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 12, 2014
Figure 2. The mRNA expression levels of IL-6, IL-12, interferon (IFN)-γ, and Toll-like receptor (TLR) 21. The chickens were immunized with inactivated avian H5N1 influenza virus (IAIV) plus different CpG oligodeoxynucleotide (CpG-ODN). Nasal cavity and trachea tissues were sampled at 24 h after booster immunization. The mRNA expression levels of IL-6, IL-12, and IFN-γ in nasal cavity (A) and in trachea (B) were detected by quantitative real-time PCR (RT-qPCR). The expression levels of TLR21 in nasal cavity and trachea were also detected by RT-qPCR (C). All data are shown as the mean ± SEM. Significant difference between 2 groups was indicated by the use of different capital letters (A–E; P < 0.01).
levels in trachea from chickens receiving IAIV with CpG-ODN F3 were the highest and significantly higher than that in the trachea from chickens receiving IAIV with CpG-ODN F1 (P < 0.01; Figure 2C).
Level Changes of Local AIV-Specific SIgA The AIV-specific SIgA antibody levels in nasal lavage fluid of all groups (Figure 3A) reached peak at wk
INACTIVATED AVIAN H5N1 INFLUENZA VIRUS
2871
5 after the first immunization. At all sampling points, the AIV-specific SIgA levels in nasal lavage fluid from chickens receiving IAIV together with CpG-ODN F3 or CpG-ODN F1 were all high and significantly higher than that from chickens receiving IAIV alone (P < 0.01); however, there was no significant difference between the 2 groups (P > 0.05). The AIV-specific SIgA antibody levels in tracheal lavage fluid of all groups (Figure 3B) reached a peak at wk 3 after the first immunization. At 3 and 7 wk after the first immunization, the AIV-specific SIgA level in tracheal lavage fluid from chickens receiving IAIV and CpG-ODN F3 was the highest and even significantly higher than that from chickens receiving IAIV and CpG-ODN F1 (P < 0.01).
with IAIV and CpG-ODN F3 or CpG-ODN F6, the levels of AIV-specific IgG antibody in serum were the highest and significantly higher than that in the chickens receiving IAIV and CpG-ODN F1 at wk 1 after the first immunization (P < 0.01; Figure 4A). At wk 3, 5, and 7 after the first immunization, the AIV-specific IgG antibody levels in the chickens receiving IAIV and CpG-ODN F3 were all not significantly different from that in chickens receiving IAIV and CpG-ODN F1 (P > 0.05; Figure 4A). The HI degree in chickens receiving IAIV and CpGODN (except for CpG-ODN F4) reached peak at wk 4 after the first immunization, whereas that in chickens receiving IAIV alone was always low after the first immunization (Figure 4B).
Level Change of AIV-Specific IgG and HI Antibody
Survival Rate
The levels of AIV-specific IgG antibody in serum from chickens receiving IAIV and CpG ODN were significantly higher than that from chickens receiving IAIV alone (P < 0.01; Figure 4A). After immunization
When chickens were virus challenged at d 7 after booster immunization, the survival rate of chickens receiving CpG-ODN F3 with IAIV was 60% (Figure 5A). When chickens were virus challenged at d 21 after booster immunization, the survival rate of chickens re-
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 12, 2014
Figure 3. The level changes of local avian influenza virus (AIV)-specific secretory IgA (SIgA). The AIV-specific SIgA levels in nasal lavage fluid (A) and tracheal lavage fluid (B) collected at wk 3, 5, and 7 after the first immunization were detected by indirect ELISA. The data were reported as the S/N value calculated by the following formula: S/N = (OD450 of sample − OD450 of bank control)/(OD450 of negative control − OD450 of bank control), where OD450 is the optical density at 450 nm, S refers to sample, and N refers to negative control.. All data are shown as the mean ± SEM. Significant difference between 2 groups was indicated by the use of different capital letters (A–G; P < 0.01).
2872
Fu et al.
ceiving CpG-ODN F3 with IAIV was 70% (Figure 5B). The survival rate of chickens receiving IAIV alone was always much lower (Figure 5).
DISCUSSION The nasal mucosa is an effective site for induction of mucosal immunity because of the low threshold for initiation of an immune response, abundant blood vessels, and the presence of nasal-associated lymphoid tissue. Our previous research indicated that intranasal administration of IAIV with appropriate adjuvant was capable of preventing infectious diseases in poultry (Kang et al., 2012). CpG oligodeoxynucleotide is an efficient mucosal adjuvant, and many reports have demonstrated that co-administration of CpG-ODN with antigens by
mucosal immunization could augment the mucosal and systemic immune responses in mice and other animal models (Fukuiwa et al., 2008; Pun et al., 2009). The immune activity of CpG-ODN is genus-specific. For example, CpG-ODN 1826 is an effective CpG-ODN for BALB/c mice, and CpG-ODN 2006 is a high-efficacy ODN for humans and chickens (Ameiss et al., 2006). In this study, 4 sequences of CpG-ODN were designed based on CpG-ODN 2006, and then the effects of the designed CpG-ODN on IAIV vaccine were investigated in chickens to identify the CpG-ODN with efficient adjuvant effects and lower cost. First, we preliminarily evaluated the immunostimulatory activity of CpG-ODN on chicken splenic lymphocytes. The designed CpG-ODN with distinct sequences and structural characteristics were demonstrated to
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 12, 2014
Figure 4. The level change of avian influenza virus (AIV)-specific IgG and hemagglutination inhibition (HI) antibody. The AIV-specific IgG levels in serum collected at wk 1, 3, 5, and 7 after the first immunization were detected by indirect ELISA (A). The data were reported as S/N value calculated by the following formula: S/n = (OD450 of sample − OD450 of bank control)/(OD450 of negative control − OD450 of bank control), where OD450 is the optical density at 450 nm, S refers to sample, and N refers to negative control. All data are shown as the mean ± SEM. A significant difference between 2 groups was indicated by the use of different capital letters (A–E; P < 0.01). Blood samples were collected every week after the first immunization. The HI titers in serum were assayed by HI tests. Chickens were immunized with inactivated avian H5N1 influenza virus (IAIV) plus different CpG-oligodeoxynucleotide, respectively. All data are shown as the mean ± SEM.
INACTIVATED AVIAN H5N1 INFLUENZA VIRUS
2873
have efficient immunostimulatory effects on the proliferation of splenic lymphocytes. These results in vitro could provide a leading direction for a further animal test in vivo. Cellular immunity in the mucosal site plays a very important role in early immune responses to prevent pathogens from entering the epithelium. It is well known that CpG-ODN can directly activate dendritic cells, macrophages, and B cells to promote the secretion of Th1 cytokines (IL-6, IL-12, TNF-α, and so on), and then these cytokines can further activate natural killer cells to secrete IFN-γ or stimulate T cell to enhance the cytotoxic T lymphocytes responses (Wang et al., 2009). In this study, the expression of IL-6, IL-12, and IFN-γ were all significantly increased after booster immunization with IAIV and the designed CpG-ODN, suggesting that the cellular immunity (Th1 type response) had been boosted effectively. The immunostimulatory activity of CpG-ODN is closely related to its sequence and structural features. The poly-G tails, which can form a tetramer and interact with the scavenger receptor, can enhance cellular uptake and the activity of phosphodiester CpG-ODN in vivo (Dalpke et al., 2002; Dalpke and Heeg, 2004). CpG-ODN F3 with an addition of poly-G strings at the 3′-end on the base of CpG-ODN F1 were used in our study. After immunization with IAIV and CpG-ODN F3, the IFN-γ expression in the nasal cavity and trachea were significantly increased compared with that from chickens receiving IAIV with CpG-ODN F1, suggesting that the poly-G strings enhanced the immunostimulatory activity. Previous research has shown that palindrome sequences including CpG motif or the 3′-end palindrome structure could improve immunostimulatory activity of CpG-ODN in mice models (Du et al., 2007). However, the activity of CpG-ODN F4 with an addition of a palindrome structure at the 3′-end did not show significant enhance-
ment compared with that of CpG-ODN F1, as did that of CpG-ODN F6, which was a palindrome sequence. We speculated that the palindrome structure of CpGODN might show distinct activity on different animals because it is known that the immune activity of CpGODN is genus-specific. CpG-ODN F5 with a reduction of a CpG motif was a short sequence, and its cost was reduced to a certain extent. However, the cytokines in chickens receiving CpG-ODN F5 were decreased compared with that in the chickens receiving CpG-ODN F1; this confirmed again that the activity of CpG-ODN was decreased after CpG motif reduction. In short, the designed CpG-ODN could efficiently induce the secretion of Th1 cytokines on the local mucosa at the early immune responses, and CpG-ODN F3 showed the most effective activity among the designed CpG-ODN. In addition to cellular immunity, humoral immunity also plays an important role against virus challenge. Mucosal immunization can induce both mucosal and systemic immune response. Therefore, the AIV-specific antibodies in the mucosal sites and in the serum were all monitored in this study. The AIV-specific SIgA in lavage fluid of the nasal cavity and trachea and AIV-specific IgG in serum were all increased significantly after immunization with IAIV plus the designed CpG-ODN. These increased antibodies may protect chickens from AIV infection well. Among all the designed CpG-ODN, CpG-ODN F3 not only had the best enhancement on local mucosal antibody responses but also showed an effective induction of systemic antibody responses. Together, our study indicated that the designed CpGODN, especially CpG-ODN F3, could potently enhance both cellular immunity and humoral immunity. Some studies have reported that the addition of CpG-ODN in vaccines could increase the ability of protection against virus or bacterial challenge (Wang et al., 2003; Taghavi et al., 2009). Finally, we further eval-
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 12, 2014
Figure 5. The survival rate postchallenge chickens were intranasally virus challenged, respectively, at d 7 (A) and 21 (B) after booster immunization. After challenge, chickens were monitored for disease signs and death for 12 d and the survival rate was recorded. IAIV = inactivated avian H5N1 influenza virus; CpG-ODN = CpG oligodeoxynucleotide.
2874
Fu et al.
ACKNOWLEDGMENTS This work was supported by the National Science Grant of P. R. China (no. 31172302) and a Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (Jiangsu, China).
REFERENCES Ameiss, K. A., J. El Attrache, A. Barri, A. P. McElroy, and D. J. Caldwell. 2006. Influence of orally administered CpG-ODNs on the humoral response to bovine serum albumin (BSA) in chickens. Vet. Immunol. Immunopathol. 110:257–267. http://dx.doi. org/10.1016/j.vetimm.2005.10.011. Beutler, B. 2003. Innate immune responses to microbial poisons: Discovery and function of the toll-like receptors. Annu. Rev. Pharmacol. 43:609–628. Brownlie, R., J. Z. Zhu, B. Allan, G. K. Mutwiri, L. A. Babiuk, A. Potter, and P. Griebel. 2009. Chicken TLR21 acts as a functional homologue to mammalian TLR9 in the recognition of CpG oligodeoxynucleotides. Mol. Immunol. 46:3163–3170. http://dx.doi. org/10.1016/j.molimm.2009.06.002. Dalpke, A. H., and K. Heeg. 2004. CpG-DNA as immune response modifier. Int. J. Med. Microbiol. 294:345–354. http://dx.doi. org/10.1016/j.ijmm.2004.07.005. Dalpke, A. H., S. Zimmermann, I. Albrecht, and K. Heeg. 2002. Phosphodiester CpG oligonucleotides as adjuvants: Polyguanosine runs enhance cellular uptake and improve immunostimulative activity of phosphodiester CpG oligonucleotides in vitro and in vivo. Immunology 106:102–112. Du, H. Y., S. Y. Xia, H. F. Song, N. Li, M. M. Shang, J. Zou, Q. Q. Wang, L. Ou, X. Sun, A. G. Ji, and Z. M. Tang. 2007. Structure-efficacy relationships of immunostimulatory activity of CpG-containing oligodeoxynucleotides on mouse spleen cells. Acta Pharmacol. Sin. 28:1637–1644. http://dx.doi.org/10.1111/ j.1745-7254.2007.00628.x. Fukuiwa, T., S. Sekine, R. Kobayashi, H. Suzuki, K. Kataoka, R. S. Gilbert, Y. Kurono, P. N. Boyaka, A. M. Krieg, J. R. McGhee, and K. Fujihashi. 2008. A combination of Flt3 ligand cDNA and CpG ODN as nasal adjuvant elicits NALT dendritic cells for prolonged mucosal immunity. Vaccine 26:4849–4859. http://dx.doi. org/10.1016/j.vaccine.2008.06.091. Heine, H., and E. Lien. 2003. Toll-like receptors and their function in innate and adaptive immunity. Int. Arch. Allergy Immunol. 130:180–192. http://dx.doi.org/10.1159/000069517. Kang, H., H. Wang, Q. Yu, and Q. Yang. 2012. Effect of intranasal immunization with inactivated avian influenza virus on local and systemic immune responses in ducks. Poult. Sci. 91:1074–1080. http://dx.doi.org/10.3382/ps.2011-01817. Keestra, A. M., M. R. de Zoete, L. I. Bouwman, and J. P. M. van Putten. 2010. Chicken TLR21 is an innate CpG DNA receptor distinct from mammalian TLR9. J. Immunol. 185:460–467. http://dx.doi.org/10.4049/jimmunol.0901921. OIE (Office International Des Epizootics). 2005. Manual of diagnostic tests and vaccines for terrestrial animals. http://www.oie.int. Petrovsky, N., and J. C. Aguilar. 2004. Vaccine adjuvants: Current state and future trends. Immunol. Cell Biol. 82:488–496. http:// dx.doi.org/10.1111/j.0818-9641.2004.01272.x. Pfaffl, M. W. 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29:e45. Pun, P. B., A. A. Bhat, T. Mohan, S. Kulkarni, R. Paranjape, and D. N. Rao. 2009. Intranasal administration of peptide antigens of HIV with mucosal adjuvant CpG ODN coentrapped in microparticles enhances the mucosal and systemic immune responses. Int. Immunopharmacol. 9:468–477. http://dx.doi.org/10.1016/j.intimp.2009.01.012. Roh, H. J., H. W. Sung, and H. M. Kwon. 2006. Effects of DDA, CpG-ODN, and plasmid-encoded chicken IFN-gamma on protective immunity by a DNA vaccine against IBDV in chickens. J. Vet. Sci. 7:361–368.
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 12, 2014
uated the immune protective effect of CpG-ODN F3 via virus challenge test. The addition of CpG-ODN F3 could effectively increase the survival rate of chickens. This may demonstrate the potent adjuvant activity of CpG-ODN F3 on the other side. Toll-like receptor, which can recognize pathogen-associated molecular pattern, has played an important role in linking innate immunity with adaptive immunity (Beutler, 2003; Heine and Lien, 2003). In mammals, CpG-ODN as a kind of pathogen-associated molecular pattern can activate and upregulate the expression of TLR9. However, TLR9 is absent during the evolution of the chicken TLR gene family. Toll-like receptor 21 acts as a functional homolog to mammalian TLR9 (Temperley et al., 2008; Brownlie et al., 2009; Keestra et al., 2010), which occurs in a wide variety of tissues throughout the body. In this study, the TLR21 was found to be expressed in the nasal cavity and tracheal tissues of chicken. Moreover, the expression of TLR21 was increased most significantly after immunization with IAIV and CpG-ODN F3, compared with that in chickens receiving IAIV alone. These results suggested that CpG-ODN F3 could activate TLR21 and upregulate the expression of TLR21mRNA efficiently. This could explain why CpG-ODN F3 in our study had efficient adjuvant effects on IAIV vaccine to a certain extent. Additionally, it is well known that the application of CpG-ODN as an adjuvant in avian vaccines is limited due to the production cost. CpG-ODN commonly has 2 backbones, phosphodiester backbone and phosphorothioate backbone. Currently, CpG-ODN with phosphorothioate backbone is the most widely used in in vivo and in vitro studies because phosphorothioate modification makes CpG-ODN more resistant to nuclease degradation. However, after phosphorothioate modification, the production cost of CpG-ODN is increased to a large extent (about 3-fold increase, or even more). In this study, the CpG-ODN F1, CpG-ODN F3, and CpGODN F6 were demonstrated to have efficient immunoadjuvant effects. The number of bases with phosphorothioate modification in CpG-ODN F3 was 8, whereas that was 24 in CpG-ODN F1 and 28 in CpG-ODN F6. Therefore, the cost of CpG-ODN F3 was reduced to a quite large extent compared with CpG-ODN F1 (CpGODN 2006), which is currently in use. This may provide a more affordable alternative, and then promote the application of CpG ODN in poultry vaccines. In conclusion, we demonstrated that the designed CpG-ODN, especially CpG-ODN F3 as the adjuvant of IAIV, could potently enhance mucosal immune response and systemic immune response of chickens. CpG-ODN F3 with efficient adjuvant activity and a big cost advantage over CpG-ODN F1 (CpG-ODN 2006) may be used as a potential nasal adjuvant for inactivated AIV vaccines in chicken. Our study may promote the application of CpG-ODN in poultry vaccines to a certain extent.
INACTIVATED AVIAN H5N1 INFLUENZA VIRUS
Xiang, X. X., X. Q. Zhou, Q. Xie, H. Yu, and H. J. Zhou. 2008. [Effects of CpG-ODN combined with HBsAg on the phenotype, function and the activity of NF-kappa B and AP-1 of monocytederived dendritic cells in chronic hepatitis B patients]. Chin. J. Hepatol. 16:97–100. Xiaowen, Z., Y. Qinghua, Z. Xiaofei, and Y. Qian. 2009. Co-administration of inactivated avian influenza virus with CpG or rIL2 strongly enhances the local immune response after intranasal immunization in chicken. Vaccine 27:5628–5632. http://dx.doi. org/10.1016/j.vaccine.2009.07.023. Yang, C., H. Shi, J. Zhou, Y. Liang, and H. Xu. 2009. CpG oligodeoxynucleotides are a potent adjuvant for an inactivated polio vaccine produced from Sabin strains of poliovirus. Vaccine 27:6558–6563. http://dx.doi.org/10.1016/j.vaccine.2009.08.047. Zhou, F., G. Q. Wang, P. Buchy, Z. P. Cai, H. L. Chen, Z. W. Chen, G. H. Cheng, X. F. Wan, V. Deubel, and P. Zhou. 2012. A triclade DNA vaccine designed on the basis of a comprehensive serologic study elicits neutralizing antibody responses against all clades and subclades of highly pathogenic avian influenza H5N1 viruses. J. Virol. 86:6970–6978. Zuercher, A. W. 2003. Upper respiratory tract immunity. Viral Immunol. 16:279–289.
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 12, 2014
Scheerlinck, J. P. Y., S. Gekas, H. H. Yen, S. Edwards, M. Pearse, A. Coulter, and P. Sutton. 2006. Local immune responses following nasal delivery of an adjuvanted influenza vaccine. Vaccine 24:3929–3936. http://dx.doi.org/10.1016/j.vaccine.2006.02.032. Taghavi, A., B. Allan, G. Mutwiri, M. Foldvari, A. Van Kessel, P. Willson, L. Babiuk, A. Potter, and S. Gomis. 2009. Enhancement of immunoprotective effect of CpG-ODN by formulation with polyphosphazenes against E. coli septicemia in neonatal chickens. Curr. Drug Deliv. 6:76–82. Temperley, N. D., S. Berlin, I. R. Paton, D. K. Griffin, and D. W. Burt. 2008. Evolution of the chicken Toll-like receptor gene family: A story of gene gain and gene loss. BMC Genomics http:// dx.doi.org/10.1186/1471-2164-9-62. Thompson, A. L., and H. F. Staats. 2011. Cytokines: The future of intranasal vaccine adjuvants. Clin. Dev. Immunol. http:// dx.doi.org/10.1155/2011/289597. Wang, X., P. Jiang, S. Deen, J. Wu, X. Liu, and J. Xu. 2003. Efficacy of DNA vaccines against infectious bursal disease virus in chickens enhanced by coadministration with CpG oligodeoxynucleotide. Avian Dis. 47:1305–1312. Wang, Y. M., C. Q. Shan, S. X. Ming, Y. Liu, Y. C. Du, and G. T. Jiang. 2009. Immunoadjuvant effects of bacterial genomic DNA and CpG oligodeoxynucleotides on avian influenza virus subtype H5N1 inactivated oil emulsion vaccine in chicken. Res. Vet. Sci. 86:399–405. http://dx.doi.org/10.1016/j.rvsc.2008.09.006.
2875
Key words: avian H5N1 influenza virus, CpG oligodeoxynucleotide, intranasal immunization, avian Toll-like receptor, virus challenge 2013 Poultry Science 92:2866–2875 http://dx.doi.org/10.3382/ps.2013-03205
INTRODUCTION The avian influenza virus (AIV) has been an important pathogen for the poultry industry for many years. The highly pathogenic avian influenza H5N1 virus remains a major global health concern because it has rapid evolution, high genetic diversity, broad host range, and potential human-to-human transmission (Zhou et al., 2012). Currently, most inactivated AIV oil emulsion vaccines on the market are administered via the intramuscular route. Although the intramuscular route can stimulate systemic immunity, it does
©2013 Poultry Science Association Inc. Received March 25, 2013. Accepted July 5, 2013. 1 There were no potential conflicts of interest (financial, professional, or personal) that are relevant to the manuscript. 2 Corresponding author: [email protected]
not induce sufficient mucosal immunity. Furthermore the stress reaction caused by intramuscular injection can potentially slow down the growth of poultry, and the deposit of stable emulsion can reduce the quality of animal meat (Xiaowen et al., 2009). Avian influenza virus mainly spreads through respiratory tract route, so the intranasal immunization can be efficient to block the transmission route of AIV. Previous studies demonstrated that intranasal immunization was an effective route for inducing mucosal immunity against various virus and was very promising to deliver vaccines (Zuercher, 2003; Thompson and Staats, 2011). The intranasal delivery of inactivated virus alone is often insufficient for inducing effective immune protection. However, the mucosal immune response can be enhanced significantly after co-administration of inactivated virus with appropriate adjuvant (Petrovsky and Aguilar, 2004; Scheerlinck et al., 2006). CpG oligodeoxynucleotide (CpG-ODN) is a short single-stranded
2866
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 12, 2014
ABSTRACT Oligodeoxynucleotide containing unmethylated CpG motifs (CpG-ODN) has been proved to be a potent and safe vaccine adjuvant. However, the application of CpG-ODN in poultry vaccines was limited because of its high cost to benefit ratio. The objective of this study was to identify the CpG-ODN with efficient adjuvant activity and low cost in chickens. Four sequences of CpG-ODN were designed based on CpGODN 2006, which was used as a template and positive sequence in our study. In the current study, in vitro observations revealed that the designed CpG-ODN had efficient immunostimulatory effects on chicken splenic lymphocytes. The in vivo results showed that the mRNA expressions of IL-6, IL-12, interferon-γ, and Toll-like receptor (TLR) 21 in upper respiratory tract tissues increased significantly in the early period after intranasal immunization with inactivated avian H5N1 influenza virus (IAIV) and CpG-ODN (P < 0.01). In addition, the avian influenza virus (AIV)-specific se-
2867
INACTIVATED AVIAN H5N1 INFLUENZA VIRUS Table 1. Sequences of CpG oligodeoxynucleotide (CpG-ODN) used in this study Sequence 5′-3′
Characteristic
CpG-ODN F1 (CpG-ODN 2006, positive sequences)
TCGTCGTTTTGTCGTTTTGTCGTT
Non-CpG-ODN F2 (negative sequences)
TCGTGCTTTTGTGCTTTTGTGCTT
CpG-ODN F3 (designed)
TCGTCGTTGTCGTTTTGTCGTTGGGGGG
CpG-ODN F4 (designed)
TCGTCGTTTTGTCGTTCGGCGCGCGCCG
CpG-ODN F5 (designed)
TCAACGTTTTGTCGTT
CpG-ODN F6 (designed)
TCGTCGTTGTCGTTAACGACAACGACGA
24 bases, phosphorothioate all bases 24 bases, phosphorothioate all bases 28 bases, poly-guanosine strings at 3′ end phosphorothioate 8 bases in bold 28 bases, palindrome structure at 3′ end phosphorothioate all bases 16 bases, phosphorothioate all bases 28 bases, palindrome sequences phosphorothioate all bases
synthetic DNA molecule that contains unmethlyated CpG motifs. It was reported that CpG-ODN was a kind of potent mucosal adjuvants, which could promote the immune effect of inactivated vaccine by mucosal immunization (Yang et al., 2009). CpG-ODN can stimulate dendritic cells, macrophages, and B cells by activating NF-κB pathway, and then promote cytokine secretion and expression of co-stimulatory molecules, and finally enhance the immune response with a tendency toward Th1 type response (Xiang et al., 2008). The immunostimulatory activity of CpG-ODN is related to its sequence and structural features, including the numbers of CpG motifs, phosphorothioate modification of backbone, poly-guanosine (poly-G) strings, palindrome structure, and so on (Du et al., 2007). CpG oligodeoxynucleotide has been demonstrated to be an excellent immune adjuvant in various mammalian vaccines. However, only a few studies have confirmed its efficacy in avian vaccines (Ameiss et al., 2006; Roh et al., 2006). Nowadays the application of CpG-ODN is limited in the poultry vaccine industry because of its high cost to benefit ratio. Therefore, CpG-ODN with lower cost and high immunostimulatory effect is necessary for avian vaccines. In this study, 4 sequences of CpG-ODN were designed based on CpG-ODN 2006, which was used as a template and positive control CpG-ODN; then the adjuvant effects of the designed CpG-ODN on inactivated avian H5N1 influenza virus (IAIV) vaccine were investigated in chickens.
MATERIALS AND METHODS Vaccine Strain and the Designed CpG-ODN Inactivated avian H5N1 influenza virus [A/ duck/2009, Re5 strain, 1 × 108.6 ELD50 (50% embryo lethal dose)/0.1 mL] was purchased from Yebio Biological Engineering Co. Ltd. (Qingdao, China). The pure CpG-ODN was synthesized at Takara Biotech Co. Ltd., Dalian, China (Table 1). CpG oligodeoxynucleotide free of endotoxins was resuspended in sterile PBS at a concentration of 1 mg/mL and stored at −20°C.
Proliferation Assay Proliferation of chicken splenic lymphocytes was analyzed using a WST-8 Cell Counting Kit-8 (CCK-8, Beyotime Institute of Biotechnology, Jiangsu, China). Briefly, 60-d-old specific pathogen-free (SPF) Hyline chickens obtained from Jiangsu Academy of Agricultural Sciences (Nanjing, China) were decapitated. Then single cell suspensions from spleen were isolated by mechanical method and carefully layered onto Ficoll-Hypaque Solution with specific gravity 1.077 (Beijing Dingguo Changsheng Biotech Co. Ltd., Beijing, China). After centrifugation at 250 × g at 20°C for 30 min, the cells in the interfaces were collected and washed with PBS. Finally, the isolated cells were resuspended in RPMI 1640 (Gibco BRL Co. Ltd., Grand Island, NY) supplemented with 10% fetal bovine serum (Hyclon, Logan, UT) at a final concentration of 1 × l06 cells /mL. Next, lymphocytes were added into 96-well plate (90 μL/well). Six ODN sequences (Table 1) were respectively added at a final concentration of 30 μg/mL (10 μL/well); Concanavalin A (Sigma, St. Louis, MO) was used as a positive control (100 ng/ mL); and PBS was used as a negative control. The RPMI 1640 medium alone without cells was added to the bank wells. After culture at 37°C with 5% CO2 for 3 d, the CCK-8 solution (10 μL/well) was added to the plates. Following incubation at 37°C with 5% CO2 for 2 h, the absorbance was read by using a 450nm filter. The stimulation indices (SI) were calculated with the formula SICpG = (ODCpG − ODbank control)/ (ODnegative well − ODbank well), where OD is optical density.
Immunization Schedule In total, 224 three-day-old SPF Hyline chickens (male) were obtained from Jiangsu Academy of Agricultural Sciences (Nanjing, China). Chickens were randomly divided into 8 groups and immunized at 7 d old. One group of chickens was intranasally immunized with 120 μL of PBS as the negative control group. One
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 12, 2014
CpG-ODN
2868
Fu et al.
Table 2. Sequences of primers used for quantitative real-time PCR Gene1
Primer
Primer sequence
IL-6
Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse
CGGCAGATGGTGATAAATCC CCCTCACGGTCTTCTCCATA ACCAGCCGACTGAGATGTTC GTGCTCCAGGTCTTGGGATA AGCTGACGGTGGACCTATTATT GGCTTTGCGCTGGATTC CAACAGACTGCTGGAGGTGA TGCAGCTTCAGGTCGTACAG ATGAAGCCCAGAGCAAAAGA GGGGTGTTGAAGGTCTCAAA
IL-12 IFN-γ TLR21 β-Actin 1IFN
Product size (bp)
Accession no.
160
HM179640
163
DQ202328
259
Y07922
159
NM_001030558
222
L08165
= interferon; TLR = Toll-like receptor.
μL of ROX dye II, and 0.4 μL of forward and reverse specific primer (10 μM) with an ABI 7 500 instrument (ABI, USA). Sequences of primers used for quantitative real-time PCR (RT-qPCR) were shown in Table 2. The data were reported as values normalized to the housekeeping gene (β-actin) and calculated as the following formula (Pfaffl, 2001): relative quantification = 2−ΔΔCt, ΔΔCt = (Cttarget gene − Ctβ-actin)treated group − (Cttarget gene − Ctβ-actin)untreated group.
Sample Collection
ELISA for SIgA in Lavage Fluid and IgG in Serum
Chickens were decapitated at 24 h after booster immunization. The samples of nasal cavity and trachea tissues were collected from 6 chickens in each group and stored in liquid nitrogen for detection of cytokines and Toll-like receptor (TLR) 21 expression. Chickens were decapitated at wk 3, 5, and 7 after the first immunization, respectively (6 chickens per group). Nasal cavity and trachea tissues were collected and were repeatedly washed with 0.5 mL of PBS for collecting lavage liquid. Then the lavage liquid was centrifuged at 3,000 × g at 4°C for 10 min. Finally the supernatant was collected and stored at −20°C for detection of AIVspecific secretory IgA (SIgA). Blood samples were collected from the wing vein of chickens weekly after the first immunization (6 chickens per group). Then the serum samples were collected after centrifugation at 3,000 × g at 20°C for 15 min and finally stored at −20°C.
Quantitative Real-Time PCR for IL-6, IL-12, Interferon-γ, and TLR21 in the Upper Respiratory Tract The total RNA of nasal cavity and trachea tissue was obtained with an RNA extraction kit (Tiangen Biotech Co. Ltd., Beijing, China). The total RNA was reverse-transcribed into cDNA with PrimeScript RT master Mix Perfect Real Time (Takara Bio Inc.). To determine the mRNA expression levels, 2 μL of cDNA was amplified in a 20-μL reaction mixture containing 10 μL of SYBR Premix Ex Taq (Takara Bio Inc.), 0.4
The AIV-specific SIgA in lavage liquid was assayed by indirect ELISA. Briefly, polystyrene plates were coated overnight at 4°C with 0.1 mL of IAIV (108.6 ELD50/0.1 mL, 1:2,000 diluted in carbonate bicarbonate, pH 9.6). Following 3 washes with PBS containing 0.05% Tween-20 (PBST, 0.01M, pH 7.4), the plates were blocked with 0.2 mL of 1.5% BSA for 2 h at 37°C. After 3 washes with PBST, 0.1 mL of nasal lavage fluid or tracheal lavage fluid diluted in PBS was added to the plates and incubated for 1 h at 37°C. Following 3 washes with PBST, goat anti-chicken IgA (Bethyl Laboratories Inc., USA) was added and incubated at 37°C for 1 h. After 3 washes with PBST, 0.1 mL of rabbit anti-goat IgG conjugated with horseradish peroxidase (Bethyl Laboratories Inc.) was added and incubated at 37°C for 1 h. After 3 washes with PBST, 0.1 mL of chromogenic substrate (TMB, Sunshine Biotechnology Co. Ltd., Nanjing, China) was added and incubated at 37°C for 10 min. Color development was stopped by addition of 0.05 mL of H2SO4 (2 M). The optical density at 450 nm (OD450) was recorded by using a universal Microplate Reader ELx800 (Bio-Tek Instruments Inc., USA). The data were reported as S/N value calculated by the following formula: S/N = (OD450 of sample − OD450 of bank control)/(OD450 of negative control − OD450 of bank control), where OD450 is the optical density at 450 nm, S refers to sample, and N refers to negative control. The serum was diluted 100-fold in PBS, and the AIV-specific IgG antibody in it was detected as above.
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 12, 2014
group of chickens was immunized with 120 μL of IAIV only. Other groups of chickens were intranasally immunized with 120 μL of IAIV mixed with one of the following (30 μg): CpG-ODN F1, non-CpG-ODN F2, CpG-ODN F3, CpG-ODN F4, CpG-ODN F5, or CpGODN F6. All chickens were immunized again at 14 d old. The animal experimental protocols were proved by the Animal Care and Use Committee, Nanjing Agricultural University.
INACTIVATED AVIAN H5N1 INFLUENZA VIRUS
2869
Hemagglutination Inhibition Assay The hemagglutination inhibition (HI) antibody in serum was assayed by hemagglutination inhibition tests, according to the Chinese National Standard of diagnostic techniques for highly pathogenic avian influenza, and the Office International des Epizooties (OIE) standards (OIE, 2005).
Virus Challenge The viral challenge study was performed in a thirdlevel biological safety laboratory in Yebio Biological engineering Co. Ltd. (Qingdao, China), and the chickens were kept under specific pathogen-free conditions in individual ventilated cages. Seven-day-old SPF Hyline chickens (male) obtained from Yebio Biological Engineering Co. Ltd. were randomly divided into 3 groups (20 chickens per group) and intranasally immunized twice (at 7 d and 14 d old). The virus that was intranasally inoculated was IAIV subtype, Re5 strain (1 × 108.6 ELD50/0.1 mL). Groups of chickens received one of the following: 120 μL of PBS, 120 μL of IAIV, or 120 μL of IAIV mixed with 30 μg of CpG-ODN F3. Chickens per group were divided into 2 parts and intranasally challenged with highly virulent H5N1 AIV strain (A/Duck/zhucheng/3/03, 1 × 106.6ELD50/0.1 mL), respectively, at d 7 and 21 after booster immunization. After challenge, chickens were monitored for disease signs and death for 12 d and the survival rate was recorded.
Statistical Analysis Statistical analyses were performed using SPSS Statistical Software 17.0. The statistical significance was analyzed by one-way ANOVA followed by the Duncan’s multiple range tests. A P-value less than 0.01 was considered statistically significant.
RESULTS Immunostimulatory Activity of the Designed CpG-ODN on Chicken Splenic Lymphocytes The SI of all the CpG-ODN on the splenic lymphocytes were significantly higher than that of PBS (P < 0.01), and no significant differences were detected among these sequences (P > 0.05; Figure 1).
mRNA Expression Levels of IL-6, IL-12, Interferon-γ, and TLR21 The mRNA expression levels of IL-6, IL-12, and interferon (IFN)-γ in nasal cavity (Figure 2A) and trachea (Figure 2B) were detected by RT-qPCR. After immunization with IAIV and CpG-ODN, the mRNA expression levels of IL-6, IL-12, and IFN-γ in nasal cavity and trachea were significantly increased (P < 0.01), compared with that in chickens immunized with IAIV alone. The IL-6 expression levels in nasal cavity and trachea were all high in the chickens receiving IAIV with CpG-ODN F1, CpG-ODN F3, or CpG-ODN F6, and no significant differences were detected among the 3 groups (P > 0.05). So were the expression levels of IL12 in nasal cavity in these 3 groups. The IL-12 expression level in trachea from chickens receiving IAIV and CpG-ODN F6 was the highest, but was not significantly different from that in chickens receiving IAIV and CpG-ODN F1 (P > 0.05). Besides, the IFN-γ expression levels in nasal cavity and trachea from chickens receiving IAIV and CpG-ODN F3 were the highest and even significantly increased compared with that from chickens receiving IAIV and CpG-ODN F1 (P < 0.01). Among all the groups co-administration of IAIV and the designed CpG-ODN, the TLR21 expression level in nasal cavity from chickens receiving IAIV and CpGODN F3 was the highest, but was not significantly different from that in chickens receiving IAIV and CpGODN F1 (P > 0.05; Figure 2C). The TLR21 expression
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 12, 2014
Figure 1. The stimulation indices (SI) of CpG oligodeoxynucleotide (CpG-ODN) on chicken splenic lymphocytes. Proliferation of chicken splenic lymphocytes was detected by WST-8 Cell Counting Kit-8 (CCK-8, Beyotime Institute of Biotechnology, Jiangsu, China) assay. The stimulation indices (SI) were calculated as the formula SICpG = (ODCpG − ODbank control)/(ODnegative well − ODbank well), where OD is optical density. All data are shown as the mean ± SEM. Significant difference between 2 groups was indicated by the use of different capital letters (A,B; P < 0.01).
2870
Fu et al.
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 12, 2014
Figure 2. The mRNA expression levels of IL-6, IL-12, interferon (IFN)-γ, and Toll-like receptor (TLR) 21. The chickens were immunized with inactivated avian H5N1 influenza virus (IAIV) plus different CpG oligodeoxynucleotide (CpG-ODN). Nasal cavity and trachea tissues were sampled at 24 h after booster immunization. The mRNA expression levels of IL-6, IL-12, and IFN-γ in nasal cavity (A) and in trachea (B) were detected by quantitative real-time PCR (RT-qPCR). The expression levels of TLR21 in nasal cavity and trachea were also detected by RT-qPCR (C). All data are shown as the mean ± SEM. Significant difference between 2 groups was indicated by the use of different capital letters (A–E; P < 0.01).
levels in trachea from chickens receiving IAIV with CpG-ODN F3 were the highest and significantly higher than that in the trachea from chickens receiving IAIV with CpG-ODN F1 (P < 0.01; Figure 2C).
Level Changes of Local AIV-Specific SIgA The AIV-specific SIgA antibody levels in nasal lavage fluid of all groups (Figure 3A) reached peak at wk
INACTIVATED AVIAN H5N1 INFLUENZA VIRUS
2871
5 after the first immunization. At all sampling points, the AIV-specific SIgA levels in nasal lavage fluid from chickens receiving IAIV together with CpG-ODN F3 or CpG-ODN F1 were all high and significantly higher than that from chickens receiving IAIV alone (P < 0.01); however, there was no significant difference between the 2 groups (P > 0.05). The AIV-specific SIgA antibody levels in tracheal lavage fluid of all groups (Figure 3B) reached a peak at wk 3 after the first immunization. At 3 and 7 wk after the first immunization, the AIV-specific SIgA level in tracheal lavage fluid from chickens receiving IAIV and CpG-ODN F3 was the highest and even significantly higher than that from chickens receiving IAIV and CpG-ODN F1 (P < 0.01).
with IAIV and CpG-ODN F3 or CpG-ODN F6, the levels of AIV-specific IgG antibody in serum were the highest and significantly higher than that in the chickens receiving IAIV and CpG-ODN F1 at wk 1 after the first immunization (P < 0.01; Figure 4A). At wk 3, 5, and 7 after the first immunization, the AIV-specific IgG antibody levels in the chickens receiving IAIV and CpG-ODN F3 were all not significantly different from that in chickens receiving IAIV and CpG-ODN F1 (P > 0.05; Figure 4A). The HI degree in chickens receiving IAIV and CpGODN (except for CpG-ODN F4) reached peak at wk 4 after the first immunization, whereas that in chickens receiving IAIV alone was always low after the first immunization (Figure 4B).
Level Change of AIV-Specific IgG and HI Antibody
Survival Rate
The levels of AIV-specific IgG antibody in serum from chickens receiving IAIV and CpG ODN were significantly higher than that from chickens receiving IAIV alone (P < 0.01; Figure 4A). After immunization
When chickens were virus challenged at d 7 after booster immunization, the survival rate of chickens receiving CpG-ODN F3 with IAIV was 60% (Figure 5A). When chickens were virus challenged at d 21 after booster immunization, the survival rate of chickens re-
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 12, 2014
Figure 3. The level changes of local avian influenza virus (AIV)-specific secretory IgA (SIgA). The AIV-specific SIgA levels in nasal lavage fluid (A) and tracheal lavage fluid (B) collected at wk 3, 5, and 7 after the first immunization were detected by indirect ELISA. The data were reported as the S/N value calculated by the following formula: S/N = (OD450 of sample − OD450 of bank control)/(OD450 of negative control − OD450 of bank control), where OD450 is the optical density at 450 nm, S refers to sample, and N refers to negative control.. All data are shown as the mean ± SEM. Significant difference between 2 groups was indicated by the use of different capital letters (A–G; P < 0.01).
2872
Fu et al.
ceiving CpG-ODN F3 with IAIV was 70% (Figure 5B). The survival rate of chickens receiving IAIV alone was always much lower (Figure 5).
DISCUSSION The nasal mucosa is an effective site for induction of mucosal immunity because of the low threshold for initiation of an immune response, abundant blood vessels, and the presence of nasal-associated lymphoid tissue. Our previous research indicated that intranasal administration of IAIV with appropriate adjuvant was capable of preventing infectious diseases in poultry (Kang et al., 2012). CpG oligodeoxynucleotide is an efficient mucosal adjuvant, and many reports have demonstrated that co-administration of CpG-ODN with antigens by
mucosal immunization could augment the mucosal and systemic immune responses in mice and other animal models (Fukuiwa et al., 2008; Pun et al., 2009). The immune activity of CpG-ODN is genus-specific. For example, CpG-ODN 1826 is an effective CpG-ODN for BALB/c mice, and CpG-ODN 2006 is a high-efficacy ODN for humans and chickens (Ameiss et al., 2006). In this study, 4 sequences of CpG-ODN were designed based on CpG-ODN 2006, and then the effects of the designed CpG-ODN on IAIV vaccine were investigated in chickens to identify the CpG-ODN with efficient adjuvant effects and lower cost. First, we preliminarily evaluated the immunostimulatory activity of CpG-ODN on chicken splenic lymphocytes. The designed CpG-ODN with distinct sequences and structural characteristics were demonstrated to
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 12, 2014
Figure 4. The level change of avian influenza virus (AIV)-specific IgG and hemagglutination inhibition (HI) antibody. The AIV-specific IgG levels in serum collected at wk 1, 3, 5, and 7 after the first immunization were detected by indirect ELISA (A). The data were reported as S/N value calculated by the following formula: S/n = (OD450 of sample − OD450 of bank control)/(OD450 of negative control − OD450 of bank control), where OD450 is the optical density at 450 nm, S refers to sample, and N refers to negative control. All data are shown as the mean ± SEM. A significant difference between 2 groups was indicated by the use of different capital letters (A–E; P < 0.01). Blood samples were collected every week after the first immunization. The HI titers in serum were assayed by HI tests. Chickens were immunized with inactivated avian H5N1 influenza virus (IAIV) plus different CpG-oligodeoxynucleotide, respectively. All data are shown as the mean ± SEM.
INACTIVATED AVIAN H5N1 INFLUENZA VIRUS
2873
have efficient immunostimulatory effects on the proliferation of splenic lymphocytes. These results in vitro could provide a leading direction for a further animal test in vivo. Cellular immunity in the mucosal site plays a very important role in early immune responses to prevent pathogens from entering the epithelium. It is well known that CpG-ODN can directly activate dendritic cells, macrophages, and B cells to promote the secretion of Th1 cytokines (IL-6, IL-12, TNF-α, and so on), and then these cytokines can further activate natural killer cells to secrete IFN-γ or stimulate T cell to enhance the cytotoxic T lymphocytes responses (Wang et al., 2009). In this study, the expression of IL-6, IL-12, and IFN-γ were all significantly increased after booster immunization with IAIV and the designed CpG-ODN, suggesting that the cellular immunity (Th1 type response) had been boosted effectively. The immunostimulatory activity of CpG-ODN is closely related to its sequence and structural features. The poly-G tails, which can form a tetramer and interact with the scavenger receptor, can enhance cellular uptake and the activity of phosphodiester CpG-ODN in vivo (Dalpke et al., 2002; Dalpke and Heeg, 2004). CpG-ODN F3 with an addition of poly-G strings at the 3′-end on the base of CpG-ODN F1 were used in our study. After immunization with IAIV and CpG-ODN F3, the IFN-γ expression in the nasal cavity and trachea were significantly increased compared with that from chickens receiving IAIV with CpG-ODN F1, suggesting that the poly-G strings enhanced the immunostimulatory activity. Previous research has shown that palindrome sequences including CpG motif or the 3′-end palindrome structure could improve immunostimulatory activity of CpG-ODN in mice models (Du et al., 2007). However, the activity of CpG-ODN F4 with an addition of a palindrome structure at the 3′-end did not show significant enhance-
ment compared with that of CpG-ODN F1, as did that of CpG-ODN F6, which was a palindrome sequence. We speculated that the palindrome structure of CpGODN might show distinct activity on different animals because it is known that the immune activity of CpGODN is genus-specific. CpG-ODN F5 with a reduction of a CpG motif was a short sequence, and its cost was reduced to a certain extent. However, the cytokines in chickens receiving CpG-ODN F5 were decreased compared with that in the chickens receiving CpG-ODN F1; this confirmed again that the activity of CpG-ODN was decreased after CpG motif reduction. In short, the designed CpG-ODN could efficiently induce the secretion of Th1 cytokines on the local mucosa at the early immune responses, and CpG-ODN F3 showed the most effective activity among the designed CpG-ODN. In addition to cellular immunity, humoral immunity also plays an important role against virus challenge. Mucosal immunization can induce both mucosal and systemic immune response. Therefore, the AIV-specific antibodies in the mucosal sites and in the serum were all monitored in this study. The AIV-specific SIgA in lavage fluid of the nasal cavity and trachea and AIV-specific IgG in serum were all increased significantly after immunization with IAIV plus the designed CpG-ODN. These increased antibodies may protect chickens from AIV infection well. Among all the designed CpG-ODN, CpG-ODN F3 not only had the best enhancement on local mucosal antibody responses but also showed an effective induction of systemic antibody responses. Together, our study indicated that the designed CpGODN, especially CpG-ODN F3, could potently enhance both cellular immunity and humoral immunity. Some studies have reported that the addition of CpG-ODN in vaccines could increase the ability of protection against virus or bacterial challenge (Wang et al., 2003; Taghavi et al., 2009). Finally, we further eval-
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 12, 2014
Figure 5. The survival rate postchallenge chickens were intranasally virus challenged, respectively, at d 7 (A) and 21 (B) after booster immunization. After challenge, chickens were monitored for disease signs and death for 12 d and the survival rate was recorded. IAIV = inactivated avian H5N1 influenza virus; CpG-ODN = CpG oligodeoxynucleotide.
2874
Fu et al.
ACKNOWLEDGMENTS This work was supported by the National Science Grant of P. R. China (no. 31172302) and a Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (Jiangsu, China).
REFERENCES Ameiss, K. A., J. El Attrache, A. Barri, A. P. McElroy, and D. J. Caldwell. 2006. Influence of orally administered CpG-ODNs on the humoral response to bovine serum albumin (BSA) in chickens. Vet. Immunol. Immunopathol. 110:257–267. http://dx.doi. org/10.1016/j.vetimm.2005.10.011. Beutler, B. 2003. Innate immune responses to microbial poisons: Discovery and function of the toll-like receptors. Annu. Rev. Pharmacol. 43:609–628. Brownlie, R., J. Z. Zhu, B. Allan, G. K. Mutwiri, L. A. Babiuk, A. Potter, and P. Griebel. 2009. Chicken TLR21 acts as a functional homologue to mammalian TLR9 in the recognition of CpG oligodeoxynucleotides. Mol. Immunol. 46:3163–3170. http://dx.doi. org/10.1016/j.molimm.2009.06.002. Dalpke, A. H., and K. Heeg. 2004. CpG-DNA as immune response modifier. Int. J. Med. Microbiol. 294:345–354. http://dx.doi. org/10.1016/j.ijmm.2004.07.005. Dalpke, A. H., S. Zimmermann, I. Albrecht, and K. Heeg. 2002. Phosphodiester CpG oligonucleotides as adjuvants: Polyguanosine runs enhance cellular uptake and improve immunostimulative activity of phosphodiester CpG oligonucleotides in vitro and in vivo. Immunology 106:102–112. Du, H. Y., S. Y. Xia, H. F. Song, N. Li, M. M. Shang, J. Zou, Q. Q. Wang, L. Ou, X. Sun, A. G. Ji, and Z. M. Tang. 2007. Structure-efficacy relationships of immunostimulatory activity of CpG-containing oligodeoxynucleotides on mouse spleen cells. Acta Pharmacol. Sin. 28:1637–1644. http://dx.doi.org/10.1111/ j.1745-7254.2007.00628.x. Fukuiwa, T., S. Sekine, R. Kobayashi, H. Suzuki, K. Kataoka, R. S. Gilbert, Y. Kurono, P. N. Boyaka, A. M. Krieg, J. R. McGhee, and K. Fujihashi. 2008. A combination of Flt3 ligand cDNA and CpG ODN as nasal adjuvant elicits NALT dendritic cells for prolonged mucosal immunity. Vaccine 26:4849–4859. http://dx.doi. org/10.1016/j.vaccine.2008.06.091. Heine, H., and E. Lien. 2003. Toll-like receptors and their function in innate and adaptive immunity. Int. Arch. Allergy Immunol. 130:180–192. http://dx.doi.org/10.1159/000069517. Kang, H., H. Wang, Q. Yu, and Q. Yang. 2012. Effect of intranasal immunization with inactivated avian influenza virus on local and systemic immune responses in ducks. Poult. Sci. 91:1074–1080. http://dx.doi.org/10.3382/ps.2011-01817. Keestra, A. M., M. R. de Zoete, L. I. Bouwman, and J. P. M. van Putten. 2010. Chicken TLR21 is an innate CpG DNA receptor distinct from mammalian TLR9. J. Immunol. 185:460–467. http://dx.doi.org/10.4049/jimmunol.0901921. OIE (Office International Des Epizootics). 2005. Manual of diagnostic tests and vaccines for terrestrial animals. http://www.oie.int. Petrovsky, N., and J. C. Aguilar. 2004. Vaccine adjuvants: Current state and future trends. Immunol. Cell Biol. 82:488–496. http:// dx.doi.org/10.1111/j.0818-9641.2004.01272.x. Pfaffl, M. W. 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29:e45. Pun, P. B., A. A. Bhat, T. Mohan, S. Kulkarni, R. Paranjape, and D. N. Rao. 2009. Intranasal administration of peptide antigens of HIV with mucosal adjuvant CpG ODN coentrapped in microparticles enhances the mucosal and systemic immune responses. Int. Immunopharmacol. 9:468–477. http://dx.doi.org/10.1016/j.intimp.2009.01.012. Roh, H. J., H. W. Sung, and H. M. Kwon. 2006. Effects of DDA, CpG-ODN, and plasmid-encoded chicken IFN-gamma on protective immunity by a DNA vaccine against IBDV in chickens. J. Vet. Sci. 7:361–368.
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 12, 2014
uated the immune protective effect of CpG-ODN F3 via virus challenge test. The addition of CpG-ODN F3 could effectively increase the survival rate of chickens. This may demonstrate the potent adjuvant activity of CpG-ODN F3 on the other side. Toll-like receptor, which can recognize pathogen-associated molecular pattern, has played an important role in linking innate immunity with adaptive immunity (Beutler, 2003; Heine and Lien, 2003). In mammals, CpG-ODN as a kind of pathogen-associated molecular pattern can activate and upregulate the expression of TLR9. However, TLR9 is absent during the evolution of the chicken TLR gene family. Toll-like receptor 21 acts as a functional homolog to mammalian TLR9 (Temperley et al., 2008; Brownlie et al., 2009; Keestra et al., 2010), which occurs in a wide variety of tissues throughout the body. In this study, the TLR21 was found to be expressed in the nasal cavity and tracheal tissues of chicken. Moreover, the expression of TLR21 was increased most significantly after immunization with IAIV and CpG-ODN F3, compared with that in chickens receiving IAIV alone. These results suggested that CpG-ODN F3 could activate TLR21 and upregulate the expression of TLR21mRNA efficiently. This could explain why CpG-ODN F3 in our study had efficient adjuvant effects on IAIV vaccine to a certain extent. Additionally, it is well known that the application of CpG-ODN as an adjuvant in avian vaccines is limited due to the production cost. CpG-ODN commonly has 2 backbones, phosphodiester backbone and phosphorothioate backbone. Currently, CpG-ODN with phosphorothioate backbone is the most widely used in in vivo and in vitro studies because phosphorothioate modification makes CpG-ODN more resistant to nuclease degradation. However, after phosphorothioate modification, the production cost of CpG-ODN is increased to a large extent (about 3-fold increase, or even more). In this study, the CpG-ODN F1, CpG-ODN F3, and CpGODN F6 were demonstrated to have efficient immunoadjuvant effects. The number of bases with phosphorothioate modification in CpG-ODN F3 was 8, whereas that was 24 in CpG-ODN F1 and 28 in CpG-ODN F6. Therefore, the cost of CpG-ODN F3 was reduced to a quite large extent compared with CpG-ODN F1 (CpGODN 2006), which is currently in use. This may provide a more affordable alternative, and then promote the application of CpG ODN in poultry vaccines. In conclusion, we demonstrated that the designed CpG-ODN, especially CpG-ODN F3 as the adjuvant of IAIV, could potently enhance mucosal immune response and systemic immune response of chickens. CpG-ODN F3 with efficient adjuvant activity and a big cost advantage over CpG-ODN F1 (CpG-ODN 2006) may be used as a potential nasal adjuvant for inactivated AIV vaccines in chicken. Our study may promote the application of CpG-ODN in poultry vaccines to a certain extent.
INACTIVATED AVIAN H5N1 INFLUENZA VIRUS
Xiang, X. X., X. Q. Zhou, Q. Xie, H. Yu, and H. J. Zhou. 2008. [Effects of CpG-ODN combined with HBsAg on the phenotype, function and the activity of NF-kappa B and AP-1 of monocytederived dendritic cells in chronic hepatitis B patients]. Chin. J. Hepatol. 16:97–100. Xiaowen, Z., Y. Qinghua, Z. Xiaofei, and Y. Qian. 2009. Co-administration of inactivated avian influenza virus with CpG or rIL2 strongly enhances the local immune response after intranasal immunization in chicken. Vaccine 27:5628–5632. http://dx.doi. org/10.1016/j.vaccine.2009.07.023. Yang, C., H. Shi, J. Zhou, Y. Liang, and H. Xu. 2009. CpG oligodeoxynucleotides are a potent adjuvant for an inactivated polio vaccine produced from Sabin strains of poliovirus. Vaccine 27:6558–6563. http://dx.doi.org/10.1016/j.vaccine.2009.08.047. Zhou, F., G. Q. Wang, P. Buchy, Z. P. Cai, H. L. Chen, Z. W. Chen, G. H. Cheng, X. F. Wan, V. Deubel, and P. Zhou. 2012. A triclade DNA vaccine designed on the basis of a comprehensive serologic study elicits neutralizing antibody responses against all clades and subclades of highly pathogenic avian influenza H5N1 viruses. J. Virol. 86:6970–6978. Zuercher, A. W. 2003. Upper respiratory tract immunity. Viral Immunol. 16:279–289.
Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 12, 2014
Scheerlinck, J. P. Y., S. Gekas, H. H. Yen, S. Edwards, M. Pearse, A. Coulter, and P. Sutton. 2006. Local immune responses following nasal delivery of an adjuvanted influenza vaccine. Vaccine 24:3929–3936. http://dx.doi.org/10.1016/j.vaccine.2006.02.032. Taghavi, A., B. Allan, G. Mutwiri, M. Foldvari, A. Van Kessel, P. Willson, L. Babiuk, A. Potter, and S. Gomis. 2009. Enhancement of immunoprotective effect of CpG-ODN by formulation with polyphosphazenes against E. coli septicemia in neonatal chickens. Curr. Drug Deliv. 6:76–82. Temperley, N. D., S. Berlin, I. R. Paton, D. K. Griffin, and D. W. Burt. 2008. Evolution of the chicken Toll-like receptor gene family: A story of gene gain and gene loss. BMC Genomics http:// dx.doi.org/10.1186/1471-2164-9-62. Thompson, A. L., and H. F. Staats. 2011. Cytokines: The future of intranasal vaccine adjuvants. Clin. Dev. Immunol. http:// dx.doi.org/10.1155/2011/289597. Wang, X., P. Jiang, S. Deen, J. Wu, X. Liu, and J. Xu. 2003. Efficacy of DNA vaccines against infectious bursal disease virus in chickens enhanced by coadministration with CpG oligodeoxynucleotide. Avian Dis. 47:1305–1312. Wang, Y. M., C. Q. Shan, S. X. Ming, Y. Liu, Y. C. Du, and G. T. Jiang. 2009. Immunoadjuvant effects of bacterial genomic DNA and CpG oligodeoxynucleotides on avian influenza virus subtype H5N1 inactivated oil emulsion vaccine in chicken. Res. Vet. Sci. 86:399–405. http://dx.doi.org/10.1016/j.rvsc.2008.09.006.
2875