Effects of DNA adduct structure and distribution on the mutagenicity and genotoxicity of two platinum anticancer drugs

J. Mol. Biol. (1994) 236, 1034-1048

Effects of DNA Adduct Structure and Distribution on the Mutagenicity and Genotoxicity of Two Platinum Anticancer Drugs Kevin J. Yarema’*‘, Jennifer M. Wilson1$2,Stephen J. Lippard’ and John M. Essigmann1*2t ‘Department of Chemistry and ZDizCsion of Toxicology Whitaker College of Health Sciences and Te&nology Massachusetts Institute of Technology, Cambridge, MA 02139,

CJ.8.A.

cis-Diamminedichloroplatinum(T1) (cis-DDP) and cis,tra%s,cis-ammine(cyclohexylamine)dibutyratodichloroplatinum(IV) (ACDDP) are anticancer drugs that bind to DNA, forming replication blocking adducts. ACDDP, probably manifests its cytotoxicity through the metabolite cis-ammine(cyclohexylamine)dichloroplatinum(II) (ACDP). The biological effects of ACDP and cis-DDP were compared by studying polymerase inhibition in Ltro and mutagenesis and genotoxicity in t~ivo in the duplex genome of bacteriophage M13mpl8 replicated in Escherichia coli. cis-DDP and ACDP adducts were equally genotoxic within the statistical error limits of the analysis. Survival of genomes platinated by either drug, increased by threefold in cells pretreated with U.V. irradiation to induce the SOS functions of the host. In the M13mp18 lacZ’ gene fragment, the mutagenicit,y of ACDP was lower than that of cis-DDP; the difference was approximately twofold at a dose of two adducts per 370 bqe-pair mutational target. Mutagenesis by both compounds was SOS-dependent. The structural basis for lower mutagenicity of ACDP is proposed to be its reduced reactivity at d(ApG) sites. This effect is attributed to an orientational isomerism t,hat precludes t,he formation of one of two possible DNA adducts at d(ApG) residues. The types of mutations induced for both drugs were similar, but they occurred with different distributions. Roth compounds induced primarily G +T transversions at d(GpG) sites whereas G + A transitions and A -P T transversions, many at d(ApG), d(GpNpG), and d(GpG) sites, were also well represented. The mapping of DNA adducts by DNA synthesis inhibition revealed excellent correlation between the location of DNA lesions and the sites of mutations. Analysis of the distribution of mutations and the distribution of potential platination sites revealed no sequence-dependent mutation hotspots; i.e. mutagenesis was random throughout the hcZ region of the M13mp18 bacteriophage genome. These results offer insights into the molecular mechanism of mutagenicity of platinum anticancer drugs. Keywords: cis-diamminedichloroplatinum(IT); M13mp18 la& replication mapping of DNA adducts

1. Introduction cis-Diamminedichloroplatinum(I1) (cis-DDPt or cisplatin (Fig. 1)) is a key component of chemotherapy against testicular, ovarian, bladder, head t Author to whom all correspondence should be addressed. $ Abbreviations used: cis-DDP (cisplatin), ciadiamminedichloroplatinum(I1); ACDDP, cis,trans,cis0022-2836/94/091034-15

$OS.CG/O

mutational

spectrum;

ammine(cyclohexylamine)dibutyratodichloroplatinum(W); ACDP, cis-ammine(cyclohexylamine)dichloroplatinum(I1); RF. replicative form; U.V. ultraviolet; DE;A adducts formed by cis-DDP or ACDP are designated as A*G*, cis-[Pt(R,)(R,){d(ApO) -X7 (l), -pr’7 (2)}]; G*G*, ciu-[Pt(R,)(R2){d(GpG) -EJ7 (l), -N7 (2)}]; G*NG*, ciu-[Pt(R,)(R,){d(Gpn,pO) -N7 (I), -K7 (3)}], where for tie-DDP R, = R, = -NH, and R, = any nucleotide; for ACDP R, = -NH,, R, = -NH&H,, , and R3 = any nucleotide. 1034 0

1994 Academic

Press

Limited

Genotoxicity and Mutagenicity

Cl

H3N\p< W’

%I

cis-DDP

WJ, ,C’ lP’,Cl NH1 ACDP

W,

,O

” ,/s 3

0

carboplatin

a

NH2

Cl ‘P;’

NH/ 2

‘Cl

[Pt(dach)ClJ

0

ACDDP

iproplatin

Figure 1. Structures of platinum compounds discussed in this paper.

and neck, and lung cancers. Although one of the most successful anticancer drugs yet developed, cisDDP has several toxic side effects in humans. Its clinical efficacy is further diminished by both intrinsic and acquired resistance in tumor cells. A class of platinum(IV) complexes, ammine/amine platinum(IV) dicarboxylates, has recently been introduced in an attempt to overcome some of the drawbacks of cis-DDP and other related platinum(I1) analogues (Fig. 1) (Kelland et al., 1992). These new platinum(IV) compounds are orally absorbed and therefore may afford an equally efiective, less toxic treatment with greater ease of administration. Moreover, these compounds are active against cis-DDP resistant cell lines (Kelland et al., 1992). One amminelamine platinum(IV) dicarboxylate, cis,trane,ci.v-ammine(cyclohexylamine)dibutyratodichloroplatinum(IV) (ACDDP), has recently been introduced in clinical trials. The of the platinum(IV) increased effectiveness compounds may be attributed, at least in part, to their high lipophilicity, which facilitates transport through the cell membrane, resulting in increased intracellular drug accumulation (Kelland et al., 1992). Once inside a cell, platinum(I1) compounds lose their chloride ions through hydrolysis and bind to DNA (Lippard, 1978) forming a variety of stable adducts (Eastman, 1983; Fichtinger-Schepman et al., 1985). cia-DDP adducts inhibit DNA replication in vitro (Pinto & Lippard, 1985; Comess et al., 1992), and in bacterial (Alazard et al., 1982) and mam-

of Platinum

Drugs

1035

malian cells (Ciccarelli et al., 1985; Heiger-Bemay et al., 1999), and it is presumably by this mechanism that they effect the cytotoxicity that causes the antitumor activity of the drug, Platinum(IV) compounds, being more inert to ligand substitution reactions (Hartley, 1973), most likely function as prodrugs that are reduced intracel]ularly (Eastman, 1987; Gibbonset al., 1989), forming reactive p]atinum(II) species (Blatter et al., 1984; van der Veer et al., 1986). At least six platinum(I1) metabolites of ACDDP are produced in this manner (Kelland et al., 1992), one of which is cti-ammine(cyc]ohexy]amine)dichloroplatinum(II) (ACDP). This mets,bolite binds DNA in vitro to form a spectrum bf adducts similar to that exhibited by cis-DDP but with significantly fewer adducts at d(ApG) sites and about double the number at d(GpNpG) sites (Hartwig & Lippard, 1992). Because these adduots block DNA replication in vitro (Hartwig & Lippard, 1992), it seems likely that ACDDP ultimately ma& fests its cytotoxic (and potentially chemotherapeutic) effects by the same mechanisms employed by cis-DDP. In the present study we have examined the toxicity of the drugs in u&o by assessing the genotoxicity of their DNA adducts in bacteriophage M13mp18 RF genomes in E. coli. The appearance of second malignancies in patients treated with c&v-DDP is an important concern with all platinum-based chemotherapeutic regimens. c&r-DDP is a mutagen in mammalian cells (Wienke et al., 1979; Johnson et al., 1980) and, upon SOS-induction, also in bacteria (Beck & Brubaker, 1975; Benedict et al., 1977). It is also carcinogenic in rodents (Leopold et al., 1979). The carcinogenicity of cti-DDP in humans is presumed but it has not been conclusively established because the compound is typically administered in conjunction With other anticancer drugs, some of which are also suspected human carcinogens (Greene, 1992). The possibility that cis-DDP is carcinogenic provides the rationale for evaluating the mutagenicity, and implied carcinogeticity, of all new platinum drugs. Accordingly, one of the major goals of this study ~88 to compare the mutagenicity and mutational spectra of ACDP and &-DDP by using the &z& /I-galactosidase a-complementation forward mutational assay irk E. ccli.

2. Materials (a)

and

Methods

ii2tZtWid8

Enzymes were purchased from New England Biolabs unless otherwise noted. The E. coli cell lines used Were DL7 (AB1157; lacAUlf39, uur+ (Lssko d & 1988)) and GW5109, (JM103, Pl-, from G. Walker, NIT). The ohgodeoxynucleotides used as primers were purehssed from New England Biolabs or synthesized by the Bio~lymers L&, MIT, and purified by polyacrylamide gel eleotrophoresis (PAGE). Sequencing reagents were obtained from United States Biochemical Corporation (Sequermse) or New England Biolabs (CircumVent& ~[a-3sS]dA!I?PWaS purehssed from Amersham. tie-DDP WEB ~WC~WW@@IU Sigma and ACDP WM syntheeieed 88 described ,@I.,: & Lippard, 1992).

Cr’enotoxicity

1036

rind 111tctngmiritg

Platination of Ml3mpl8 RF DSA was achieved b> incubat,ing 25pg of DiYA in 5OO pi solutions 0f 3 1~131 NaCl. l mM Na,HPO, (pH 74) wit.h ris-I)l)l’ or A(‘D1’. or without eit.her drug. for I6 h at NY’. The platination reactions were terminated b.v the addition of h’a(‘l to a final concentration of 0.5 M. Unbound platinum was removed by ethanol-precipitating t,he DNA and washing twice with 809, (v/v) ethanol. Levels of platinum bound to DKA were determined by flameless atomic absorption spectroscopy on a Varian AA I475 instrument rcluiI)I)ed with a CTA95 graphite furnace. (c)

Tran.$ornmtion 0J E. t~actrriophngr

coli with ,U ISnlplS IlS.4

E. co/i DL7 cells were grown in IOU ml hatches in Luria-Bertani broth (Maniatis rt nl.. 1989) to a density of approximately 10s cells/ml. Portions of t,hr cell cultures were exposed to U.V. Huen~s of 40 *J/m’ as desc*ribrd 1~~ Lasko et nl. (1988) to induce the SOS responset. Bacterial cells from each 100 ml culture were harvrstrd by crntrifugation at 4OOOg for 5 min at 4°C’. resuspended in I00 ml of chilled water. and recentrifuged at HOOOg for IO min. The cells were then resuspended in 40 ml of water and a final centrifugation was done at 13.OOO g for IO min. The cells were resuspended in water to give a final volume of 1.0 ml and kept on icp until needed. unmodified genomes as well as the M13mpl8 RF DSA pIatinatrd with various levels of ri.s-DDP and AC’DI’ were usrd to t,ransform thr prepared E. coli cultures by electroporation. An aliquot of the cell suspension (* IO’ viable cells in 120 /.d) was mixed with IO ~1 (IO ng) of DSA and transferred to a prechillrd electroporation ruvettr. (‘ells were rlrctroI~oratrd in a BTX Electra Cell Manipulator 600 at 50 /tF. I ?!I R. at 11.5 or %5 kV/cm for SOS non-induced or SOS-induced samples. respectively: 1 ml of SOC medium (Hanahan. 1985) was mixed with t,he &I suspension following rlrctroporation. A port.ion of the transformed bacteria was plated immediately in the presence of E. roli (:\V5lOO cells. isopropylthio-j?-n-galact,oside (TPTC:). and 5-bromo4-chloro-3-indoyl-fi-o-galactoside (S-gal: Messing. 1983) to obtain independent infective centers. which \verp counted to obtain survival data or were isolatrcl fol sequencing analysis. The remainder of the transformrd bacteria was incubated for 2 h at 37°C’ to allow for phagr replicat,ion. followed by centrifugation at 17.OOOg for IO min to pellet the cells. The I’hage-containing supernatant was stored at 4°C’ and later plated with t:W.ilOO cells, IPTG and X-gal t.o obtain mutation frrquency data. (d) A xsay of ~h~u/ucto~sirtr~.wrrctivity Cultures (IO ml) of E. coli GW5100 (2 x IO’ cells) were infected with IO” wild-type or mutant Ml3mpl8 phage t The optimal U.V. dose used to pretreat the host E. coli to induce the SOS response necessary for the mutagenic processing of platinum DNA adducts waS determined by transfecting highly modified ( > 5O adducts per Ml3mpl8 RF genome) DNA into bacterial cells irradiated by U.V. with a range of fluences. The mutation frequency increased in a U.V. dose dependent manner up to -30 J/m2 and remained constant t0 -60 J/m2. Cell survival decreased rapidly above 50 J/m’; therefore cells used in these experiments were irradiated with 40 J/m2 to be above the lower threshold of mutagenicity while retaining a high level of survival (-60 to 75%) of the host cells.

of I’lnti?t~r

m I)rtrgs

all,l incaubatrtl for ()..5 II at 37 “(I. I I’T(: ~‘11s atltlt’tl to a final ~onc*entration of 2 11111and incubation c*ontinurd f0l (j() min. (‘PI] extracts \vcrc I)reI)ar(4 I)? tllr Ill~thd Of \vickner pt cl/. (1972). fl-(~alactositlasr activity \VilS mpaSured by using t.he OSI’(: (o-nitroI)hrnol-B-I1-galac~topyranosidr) assay (Xlaniatis (4 171.. 1989) or in a11 Asia> red /3-I)-galii(*to(‘I’R( : (chlorophenol employing pyranoside) as the c~hromophorr (Eustic*r rt III.. 1992). (c)

/ffPnt;~r/ft;r,,/

/II/d .src//lPwin~/ of

u//ttunt.s

JIutations that lrtl to the disruption of thla %-(~omI+mpntation process in tl1r Inc.% mutational assay g!;IV(’ ris(b to phrnotypic-ally itlrntitiablt~ plaqurs. .\llttant anti wiltItype plaqups tvcrt‘ distin~uishrtl by thr intrnsity of thta blur chromophorr produc4 I)y B-galac,tositl;isr c+avapc* of S-pal. Putative mutants \vcrp replated to vrrif:\. ~~lirnotypic* Imrity (Kunkrl. I!M). Sin~lc~-str;1t1tlr,tl I)S.\ tIprived from mutant plaques \vas isolatt~(l illIll srcju~n~*e(l according to t,hr method of Sanger PI nl. (1977) hy using primers P6:3:31 ancl PG.527 (Fig. 2). Mutations that occqlrred more than once in an individual plr~troI)~)r~ltion sample were not srored to ensure that each mutant sc.orrcI repreSented an independent rrent.

Replication mapping to drtrrminr to locations of I)SA adducts was performt4 hy using a sing!lr I*yc.lr moditic*ation of thermal c*yrling mrthodologyf (Bubley rt rrl.. 1991: $ The sreondary structure of cloubIr-stranclrtl 11 13111~118RF penomrs required that adduc*t maI)I)ing rsperimrnts hr I1~rformrd by using a sinplr thermal cycle. The signal from sing!lr cycle reactions was conslderab1y weaker than from the multicvclr reac+ions rmployrd hy othrrs who have used this met hodolqq (Bublry at nl.. 19!Jl: Murray 4 ftl.. 1992). Multiq& methodology. despite bring usrd hy the ahovr investigators. is inappropriate for atlduct mapping experiments. The I1roblrms involved can be untlerstootl by ~otisidrring that there are 2 populations of I)NA fragments produc*ed in each cyc+: those c*ausrtl I)) srcsondary structure and those resulting fro111 adducts. In successive cycles. fragments produced in previous ~yrlrs can reanneal to the ~Il3mpl8 template 1)S.A. serve as primers. and he further rxtrndrd. A fragment produced by an adduct termination site is unlikrly to rranneal to another template with an adduct at tl1r same site. Further extension of this fragment results in the lOSS of the adduct termination site information generatrd in previous cycles. (‘onvrrsply. aII tpmplatp molecules have the same secondary structure. allowing thesr stops to accumulate during each cyc.lr. The net effect of this process is that fragments genrrated b? Secondary structure termination sites acacumulatr 0v~1 I5 to 20 cycles. obscuring the fragments produc*rd at adduct termination sites in the last c.yc+. and the feL+ that have persisted from previous cy&eS. DNA fragments of up to I.50 bases in length wpre difficult to visualize by autoradiography on X-ray film. but could be seen after expovure to a phosphor imaging plate (Amemiya & Miyahara, 1988) and analysis with 11 Molecular Dynamics PhosphorImager. Fragments longer than ZOO bases gave stronger signals. hut were difipult to align at. base resolution on the concurrently run sequencing ladder. These rrst,rietions rrcIuirpt1 that the /ur%’ region be mapped by using primers offset by IOO to I50 nu&0tidrs. generating at least :! Sets ,,f

A(’

JI~rra~ et al.. 1992). These experiments were done b> using Vent,(eso-) DNA I’olymerase (Sew England Biolahs) with tive 511Sml~1H RF IjS.4 sami)les (unmodilied. ris-l)l)l’ at 1 I.6 and X4 atltlrlc,ts/pellonIr. and .A(‘I)I’

at

(idi atid

450

atltl~lc~ts/~enol~~~)

and

the

priniers

listed in Fig. 2. Ty)ical reaction c*onditions were 0.1 ~mol RF teml)late I)SA. 3 pm01 primer. 20 /l(‘i [~-~~SJtlr\Tl’. IO IllhI K('1. IO m&l (XH,)2S0,. ‘LOm.\I Tris. HC’I (pH 8%). .i m,\I 11gM)4. (PI (jC, (V/V) Trit(m S. 60 /tJI tlr\TP. 300 /CV tl(“~l’. (KiTI’ and tlTTP. with 5 units of Venta(exo-) IIN;;\ polymerase. Reactions were carried out

in a (‘oy TempC’ycler II wit.b a 2 min 95°C denaturation step. a 1 min 55°C’ annealing step. a I min 72°C’ primer extension step followed by denaturation at 95°C’. In I’arallel. unmodified M13111p18 RF DS.4 was sequenced by using (‘irc~um\‘ent (Sew England Biolabs) thermal c*ycle dideos?nrc~leotitle 1)NA sequencing methodology. The IjS.4 fragments generated in these reactions were separated by using denaturing PA(:E and quantitativel) fragments for every nucleotide position. Fragments having fewer than I50 haves could be aligned preciseI> with the sequencing ladder and were used to determine location of the termination sites. Longer fragments corresynding to the same termination sites. but generated by a more distant Primer. were used to tlrtermine the intensity of the termination site b> I’hosphorlmager quan’titation. The Pattern of termination sites \vas similar for 11X.4 platinated at eithe,r lo\v (I 1% adducts per genome for ris-DI11’ or 6% adducts Iler gcqlome for ;\(‘I)P) or high (354 or 450 adtluc+s I,er grr~ome, respectively) levels. The majm tliti’erencr \vas that the genumes containing fewer adducts gave risr to a greater amount of high molecular weight material c+orresponding to fragments of more than 500 nucleotides in length. Conversely. the genonles I)latinated with the higher levels of drug produced almost no fragments above 100 bases in length. C’onsecIuentIy shorter fragments were more abundant and gave enhan& signal intensity: therefore, only the more highly motlitied YampIes were subjected to rigorous quantitation.

analyzed with a Molecular Dynamics PhosphorImager. The values for the termination sites were normalized by the method described for Fig. 2 to take into account t,he additional [a-‘%]d,1TP molecaules incorporated into longer fragments.

3. Results (a) Survival

of plntiwum-nrodi$ed

genomes

A kev goal of these studies was to compare the genotosicities of ria-DDP and absorption spectroscopy indicated

ACDP. Atomic that almost all of the drug present in solution bound to DNA during the 16 hour platination treatment. Adduct levels are given in Table 1. In a plaque-forming assay, transformation efficiencies of E. coli DL7 with unmodi-

tied II13mplt)

were 1 x 10’ to IX 109 non-SOS-induced for samples and slightly lower (from 1 x 10s to 5~ 108

transformantslpg

transformants/~g

RF DNA DNA

DXA)

for SOS-induced

samples.

Increasing levels of platination reduced the number of infective centers in a dose-dependent manner for genomes modified with either platinum compound. The toxicity of cis-DDP was 3.3 adducts per lethal hit whereas the comparable value for ACDP was 5.2 (Fig. 3(a)); the difference was not statistically significant (1’ < 0.05). When the host DL7 cells were pretreated

to induce

the SOS

response. survival relative to unmodified increased approximately threefold for modified with either drug (Fig. 3(b)).

with

u.v. irradiation

genomes genomes

(b) Identijcatl:o?~ of ,mu.tawts and dete,rminution mutation

of

frequency

The mutational assay used in this study is based on t,he ability of the la&’ peptide fragment encoded by the M13mp18 viral genome to serve as an

1038

Genotoxicity

and Mutagenicity

(6331)

,, Ban11

(6237)

,, XbaI

(6256)

., Hind11 ,, Pat1

(63641 (6270)

,, SphI BglI

(6276)

W),,-:

‘... :., :., ‘.., :.,

Drugs

a-donor t,o complement the host bacterial Ml.5 Ju-otein, the a-acceptor, to producae a functional P-galastosidase (Le
(a) ,, EcoRI

of Platinum

,:’ ,I (.’ ,:’

(b)

(c) J,acZ’ mu.tational

100 Distance

200 from

300

primer

Figure 2. Method for quantitation of termination sites in the replication mapping of the cis-DDP and ACDP DKA adducts. (a) M13mpl8 RF genomes were digested with the restriction enzymes shown to generate a set of linearized DNA fragments. A mixture, containing equimolar ratios of each digestion product, was prepared and subjected to primer extension reactions with each of the primers shown to generate several sets of primer-extended fragments of defined length (based on the distance from the primer to restriction site). The fragments generated by each primer were separated by denaturing PAGE and quantitated by use of a Molecular Dynamics PhosphorImager. Primers complementary to the ( - ) strand are designated with an M and those complementary to the (+ ) strand with a P; the number represents the 5’-nucleotide position that the primer anneals to in the M13mp18 genome. The lengths of the primers are: M6207, 19mer; M6086, 2Omer; M6209, 16mer; P6331, 15mer; P6479, 17mer; P6527, 15mer. (b) The intensity of

spectra of cis-I)I)l’ modi$ed DNA

and ‘4 (‘DP

Mutations in the la&’ region identified by altered P-galactosidase activity were characterized by J)NA sequencing. A total of 303 independent mutants were identified by sequencing: 142 from ACDP-modified DNA, 115 from cis-J)J)P-modified DNA, and 46 from unmodified control genomes. Most of the mutations induced by either drug were single base substitutions with a smaller number of single base deletions or insertions, as shown in Figure 5. Spontaneous mutations arising from unmodified DNA are shown in Figure 6. A few samples had multiple substitutions or large deletions or both; these mutants are described in Table 3. A summary of all mutations by tyJ>e is given in Table 4. Mutational spectra for the platinum compounds were derived from genomes with an average of 1.85 ciu-DDP or 2.36 ACDP adducts in the 370 nucleotide target in the la&’ DNA sequence (Fig. 5). At these adduct levels, the mutation frequency was approximately eight- and fivefold higher than the spontaneous mutation frequency for cis-I)I)P and ACDP modified genomes, respectively. The reported

termination sites increased aa a function of distance from the primer due to additional incorporation of [a-“SldATP. Although this increase is a function of the thymidine content of the strand undergoing replication (the radiolabeled dATP is incorporated opposite T residues), a linear curve (y = -@118+550 x JO-‘x, RZ = 0886, determined by Cricket Graph (Cricket Software)) fit the data well and was used to normalize the intensity of the adduct induced termination sites.

Genotoxicity

and Mutagenicity

of Platinum

Drugs

1039

Table 2 mutation

Location.

and enhanced

Mutation

Position

fl-galactosidase Number ohserved

activity

of dark

Fold j-gal enhanremcntt

(‘onsequence for peptide structure

n.d. (‘f;

deletion

(Y:

+ TA

6416-6418

1

6418

(Y: +TA (K’ + TA

642 I 6442

(if' - AT (:f’+TA

6459 8472

blue mutants

n.d.

I 2 3 I 1 2 I I

Met + Ile (1st coding Frameshift stop codon Gin + stop

residue) -+ causing at 6434 rodon

Qln --t stop (:lu -+ stop

rodon rodon

Trp + stop Glu + stop

codon codon

t Enhancement is expressed relative to the average activity determined for 6 independent wild-type samples. $ The first nucleotide of each pair is derived from the viral (+) strand, the second from the (-) strand of the hl13mplX ItF genome: n.d.. not determined.

“induced” spectra, therefore, would be expected to be comprised of 80 to 9Oq6 true adduct-induced mutants and 10 to 2076 spontaneous mutants. The spontaneous mutational spectrum was significantly different than the induced spectra of either platinum drug. Considering single base changes, the induced spectra had twice as many transversions as transitions in contrast, to the spontaneous spectrum, which had almost. a 3: 1 ratio of transit.ions to tranversions. CG + TA transitions comprised

almost half of the spontaneous mutations. In addition, the spontaneous spectrum had relatively more deletions and multiple base changes than the induced spectra. Seven of the 16 spontaneous mutations were two specific large deletions, specifically from position 5970 to 6172 and from 6250 to 6396. The 6250-6396 deletion comprises the same region that is absent from the 1Ml5 a-acceptor protein; similar mutations have been observed in other 1ac.Z’ mutational assays and are attributable to

1

\ \

\

\

\ \

\ . Adducts per . lethal hit: c&DDE o ool

!)ACDF:,

3.33 f 2.04 5.22kzf7

0

20

\\

-I 40

ACDP:

0

16.3f

5.7 I

1

20

I

40

\

\

\

\ 1 60

Adducts per M13mp18 RF genome Figure

and ACDP-modified Ml3mp18 RF genomes in the to induce the SOS pretreated with U.V. irradiation M13mp18 RF genomes; each data point represents marginsare 95% confidence level (SD. x 1.96). Adducts per lethal were calculated from curve fit lines generated by Cricket Graph. SOS-induced determined Error

3.

Survival cells relative

of cis-DDP

or (b) cells to unmodified given for the

plaque-forming assay in (a) non response. Survival values were the average of 6 to 9 replicates. hit (37% survival level) values

/I Genotoxicity

rind

T//

/

/

I

~Vutngenirity

oj

I’lntinrrm

I)ruq.~

Table 3

/I

/

//

/I

cis- DDP

1 L

/

//

/’ Cl

ACDP

0

1

2

Adducts per 370 nucleotide IacZ’ mutational target region of the M13mp18 genome Figure level

in

4. Mutation frequencv as a function t.he 370 nucleotide DE\‘.% sequence of

R,F genomes that forms mutations in the InrZ’ region

the of

target r-is-DDI’

(n)-modified M13mp18 RF genomes. represents 6 to 8 and 13 to I6 replicates with cis-DDI’ and AC’DI’. respectively. 450 mutant plaques were identified for at each level of drug. The error bars confidence intervals (S.D. x 1.96).

for (0)

of adduct hll3mpl8 cletec~tal~le or .A(‘I)I’

Each data point for IIS. modified Typically. I50 to genomrs modified represent So,,

recombination with the F’ episome of the host bacterium (LeC’lerc et al., 1981). The 5970-6172 deletion is also possibly due to a recombination event suggesting that these large deletions. although observed in the drug induced spectra (at much lower freyuencies). are the result of spontaneous events and not a consequence of the cisDDP or ACDP DNA adducts.

(d)

Replication

mnppiny

of plntinum

ndducts

The use of a DKA polymerase to detect the positions of adducts in DNA showecl, as expected. that DNA modification predominantly occurred at d(GpG) sites, especially at runs of three or more G residues and, to a lesser extent, at d(ApGpU), sites. for both drugs. Weaker termination sites were detected at d(ApG), d(GpNpG). and a variety of other sites as graphically displayed in Figure 5. Phosphorlmager yuantitation of strong termination sites yielded accurate information on the relative abundance of G*G* and. to a lesser extent. A*G*

and (:*X(:*.

adducts. Two factors c*omplic~atetl the evaluation of weak termination sites. First, the limitation of the single c*yc*le met hotlolog> used in the adduct mapping experiments resulted in the weaker hincling sites giving signals harely ahovc* t~ackgrc~untl. making yuantitation of some of t hescb sites cliffic~ult. The sec~mcl and more intractal)lc obstac4e was the observation that many potent ial adduct format,ion sites overlap. The problem is esemplified by the ( + ) strand seyuence from fi3!C to 639X: .‘,‘-~I((:I)A~)(:I’(:)-:~‘. This seyuence has the potential to form an A*(:*. (:*X(:*. or (i*(:* acltluct. 1)NA polymerases can halt when encountering the first (~3’) nucleoticlr of a platinum atltluc+, but do so more often at the se~ontl (5’) nuc~leotitlr or even at the nucleoticle 5’ to the atltluc4 ((‘onirss et nl., 1992). (‘onseyuently. the uncertainty of where the acltluc*t would form in this seyuence c~mplrtl with the variability of where the polymerase ~~~ultl stop when encountering a given atlduc*t. leads to the conc4usion that a termination site c~orresponding to the adenine of position 6396. for example. c~~ulcl be attributed to any one of the three possible atlcluc4s. cluantitjative

4. Discussion The great suc’c’ess of cis-I)I)I’ for the treatment of testicular cancer has resultecl in a very signific*ant increase in the application of this drug to combat a wide variety of human coancers. One drawhack to the more general application of this drug is mutagenicity. Because mutagenicity c~n~lcl play an initiating role in the generation of second tumors in canc’er patients, there is a need to understand the

CAP binding 6110

site

operator

6120

6190 -10

promoter

- (N-terminal

overlap)

6210 ribosome binding site

(b)

IacZ’ coding

sequence

polylinker

cloning

region

Fig. 5. structural basis for the mutagenic activity of this drug. This work has compared the penotoxicity. mutagenicity. and I)?r;A binding properties of ri.sDDP with A(~I the biologically ac.tive metabolite of A(‘DDP, lvhich is a promising new platinum(I\‘) drug. Both compounds were equally tosic. in E. fwli and prodric~ed qualitatively simllnr mutational spectra. The level of mutagenicity, however, was twofold lower for AC’l>P as c*onipared to cis-DDP, an effect that can be explained bv the inability of A(‘DP to form one of t,he orientational isomers of a premutagenic DNA adduct.

The plaque-forming a.bility in I’Z.co/i of M13mp18 RF DNA modified with either ris-DDP or A(‘DP

was reduced in a dose dependent manner. The levels of grnot,osiGty. 3.3 and 5.2 adducts per lethal hit for ris-DDP and ACIDP, respectively, are comparable to replirat,ion blocking lesions formed by other agents t,hat damage DNA (Mizusawa et al., 1981; Roberts & Strike, 1981: Husain et al.. 1985). These results are in agreement with in oitro primer extension experiments. which revealed that cis-DDP and ACDP adducts block DNA replication to a similar extent, with ris-DDP being slightly more inhibitory (Hartwig & Lippard. 1992). Pretreatment of the host E. coli cells wit.h u.v. irradiation to induce the SOS response increased the i,n viva survival of M13mp18 genomes platinated with either drug by approximately threefold. The similar SOS-dependent survival increases seen for DNA modified with either compound suggests that E. coli processes DNA adducts formed by both cis-DDP and ACDP in a comparable manner.

1042

Genotoxicity

A +c

*A AA

and

Mutagenicity

of Platinum

Drugs

AC

(d)

Figure 5. Mutational and adduction spectra for the IacZ’ region of M 13mpl8 RF DNA. The la& region is represented in 4 segments: (a) upstream regulatory region; (b) 29 residue la&’ peptide coding sequence that forms the R;-terminal overlap with the Ml5 a-acceptor protein; (c) la&’ peptide coding sequence corresponding to the 31 residue (93 bp) deletion in MIS; (d) 30 residues of the la&’ peptide coding sequence that forms part of the 54 residue C-terminal overlap with Ml.5 Bars indicate relative adduct levels, mutations are designated by letters, and arrows are intended to provide visual clarity in defining the location of mutations occurring at sites without measurable addurts. Mutations were assigned to the (+ ) or (-) strand based on adduct position and known sites of platinum-induced mutations. Mutations potentially attributable to adducts in either strand, or not clearly arising from either strand, are indicated in bold italic form. Adducts and mutations representing the cis-DDP spectra are shown above the strands. and the ACDP spectra are located below the strands. Deletions are indicated by A, insertions by + ; underlined sequences represent any one of the possible bases that was deleted when a deletion mutation occurred at runs of identical nucleotides. Adduct ciistrihutions were not determined for positions > 6450 in the (+ ) strand, The T-T at positions 6247-6249 indicates a d((:p(;p(;) + d(TpGpT) double mutation.

Genotoxicity

and MutagenGity

of Platinum

Drugs

1043

Table 4 IacZ’ mutation

spectra MI3mp18

of cis-DDP RF DNA

Mutation

and ACDP-platinated and unmodi$ed listed by types of mutations

&DDP

Single-base substitutions

Spontaneous

93t

74

Transversions (X’ + TAf ( ‘( : --t AT AT --. TA T.-l + AT (X’ *(‘(i (‘(: -b (X’ AT -. t ‘(: TA + t:t’

61 22 2.‘3 0.9 13 I.7 0.9

20 13 2.1

Transitions ( ‘( ; * T A ( :( ’ -+ AT TA w t ‘(:

32 “0 H-7 2.6

54 43 2” 2.2

0.9

6.5

AT

--t CC’

Other mutations Single base insertion Single base deletion Miscellaneous~

7 0.9 0.9 ;-yy

43

26 I1 15

t Sumhers given are percentages of the total I I5 ris-DDP. I42 At’DP and 46 spontaneous mutations identified. $ The tirst nucleotide of each pair is derived from the viral (+) strand, the second from the (-) strand of the B113mpl8 RF genome. For the induced mutations. the sequence context of the mutat.ion. combined with the adduc*t mappinp data showing the location of the platinum DNA adducts. allowed assirrnment of the mutation to one strand or the other as shown in Figure 5. ~‘~Iis~rllanrous mutations are listed in Table 3

(13) AC’DP

is less mu.ta.genic

thn

cis-DDP

in

vivo

In E. coli, many replication-blocking lesions are only mutable in the presence of the SOS induced l’muD’, I’mu(l, and RecA* proteins. These proteins mediate error-prone bypass of DNA adducts, contrihuting to an increase in survival upon induction of the SOS response. Since an SOS-dependent survival increase was observed for cis-DDP and ACDP. the mutagenicity of both drugs in the Ia& mutational assay was anticipated. The level of mutagenicity induced by ACDP, however, was twofold lower than that observed for cis-DDP. The spectra of adducts formed by cis-DDP and ACDP suggest a mechanism to explain why the compounds are similarly toxic but have quantitatively different mutagenicities. The major adduct formed by both compounds occurs at d(GpG) sites; approximately 65% of the total adducts for cisDDP and 5476 for ACDP occur at these sites. There is ample evidence to indicate that the G*G* adduct, at least for cis-DDP, is highly toxic in r)iuo (Bradley et al., 1993) and could account for the similar toxicities experienced by both compounds, The A*G* adduct, however, is about three times more prevalent in the cis-DDP adduct spectrum than in that of ris-DDP (8% ~VPISUS 25%; Hartwig & Lippard, 1992) and could account for the different mutagenicities of the two compounds. Site-specific mutagenesis studies have suggested that the cis-DDP A*G* adduct is five to ten times more mutagenic

than the G*G* adduct (Burnouf et al., 1990; Bradley ef al., 1993; K. Yarema, unpublished results). Since the highly mutagenic A*G* adduct is more abundant in t,he cis-DDP adduct spectrum, the finding that the overall mutagenicity of cis-DDP is higher than for ACDP is understandable. A molecular rationale has been developed to explain the diminished ability of ACDP to form the A*G* adduct, which appears to be a dominant contributor to the mutational spectra of platinum compounds. The asymmetry of the ACDP complex gives rise to an orientational isomerism when the complex forms 1,2-intrastrand crosslinks with DNA (Hartwig $ Lippard, 1992). As illustrated in Figure 7(a), wit,h d(GpG) adducts, the cyclohexylamine ligand can point either toward the 5’ or the 3’ guanosine residue and hence both orientational isomers form upon binding to DNA. It is noteworthy that one of the isomers (II) potentially forms a favorable hydrogen bond between the cyclehexylamine moiety of the drug and the O-6 of guanine. Formation of the analogous isomer (IV, Fig. 7(b)) does not occur, apparently because the cyclohexylamine moiety sterically clashes with the exocyclic amino group of the 5’ adenine. As a consethe ACDP drug forms fewer adducts at $iizi sites (Hartwig BELippard, 1992). In view of the relatively high mutagenicity of the A*G* adduct, discussed above, ACDP was expected to be the less mutagenic of the two platinum drugs investigated.

Genotoricity

1044 6130

6150

6140

.

.

MutngeGcity

nnd

of Platinum

Drugs

6170

6180

6160

.

.

.

6190

6200

.

.

.

(+)5'-cAcTcATTAGGcAccCCAGC~ACAC~A~CTTCCGGCTCGTA~~GTGTGG~T~~AGCGGAT~C~~TCACAC (-)3'-G~~TccG~GGGTCCeAAATGTGAAI\TACGAAGGTGTG T A

TT AA

6210 .

6220 .

6230 .

6240 .

6250 .

6260 .

6270 .

6280 .

6290 .

AGGAAACAGcTAn;ACCATGA'ITACGAATPCGAGCTCGGTACCC~ATCCTCTAGAGTCGACC~CAGGCA~C~GC~GGCACTGG TAGGAGATCTCAGCTGGACGTCCGTACGTTCGAACCGTGACC TfXTlTGTCGATACTGGTACTAATGCTTGAGCGG 14 T 1 AG AG TA C C AC

6300 .

6310 .

6330 .

6320 .

6340 .

6350 .

6370 .

6360 .

ccGTCGmTAcAACGTCGTGACn;GGAAAACCCTGGCG?TAGCAGCACATCCCCC~CGCCAGCTGGCGTA GACCGCAATGGGTTGAATTAGCGGAACGTCGTGTA Lag GGCAGCAAAATG~CA~TGA~XlfZGG L .L c AA T C TGT TTT G T A G ACA AAA T A

TAAAGCGGTCGACCGY AC G

T A

T A

6380 .

T A

AC G

T A

6390

.

6400 .

6410 .

6420 .

6430 .

6440 .

ATAGCGAAGAGGCCCGCACCGATCGCCC?TCCCAACAGTTCCGGCAC-3'(+) TATCGCTTCTCCGGGCGn;GCTAGCGGGAAGGGTTGTCAAGGCCGTG-5'(-) 1 J. J. Ll L11 L T T T TA TT T T AA A AT AA A A T A

6450 .

1 T A

6460 .

6470 .

1 C G

I T A

T A

T A

Figure 6. Spontaneous mut.ational possible base-pair deleted when the spontaneous mutations are described

spectra for single l)asc* changes. deletion occurred at runs of identical in Table 1

The results discussed above suggested that cisDDP is more mutagenic than AClDP owing to its ability to react at d(ApG) sites more frequently. This expectation implies that mutations would be observed more frequently at d(ApG) sites for cixDDP as compared wit,h ACDP. We tested this prediction by comparing the mutational spectra of the two drugs. By comparison with ACDP, cis-DDP appears to induce an excess in the frequency of mutations at d(ApG) sites. The differential is evident in Table 5, where only those mutations whose origin is unambiguously assignable to specific sequence contexts is considered. The mutations at d(ApG) sites from ciu-DDP were threefold more frequent than those of ACDP. These data support the hypothesis that the greater mutagenicity of cisDDP (Fig. 4) may, at least in part, be attributed t,o the A*G* adduct. (c) Similarities and difSeerence.9 in the mutational specificity of cis-DDP and ACTDP Overall, the types of mutations induced by both cis-DDP and ACDP were similar. Indeed, of the 257 induced mutations, 86 (43 for each drug) were identical mutations that occurred at the same sites for both compounds. Furthermore, mutations observed

L’nderlinrd nuclrotidrs.

srcluwws I)rlrtions

relwrsrnt any one of the arr intlic~atrtl I,y A. Othrl

for both cis-I~l)I’ and A~!l)P in the present stud) (Table 4) have been detected previously for l)NA site specifically (Burnouf et nl.. 1990: ISradley et 01.. 1993) or randomly (Brouwer et r/l.. 1981. 1982: de Boer 8: Glickman. 1989, 1992) moditied wit.h c-is-

Table 5 Mutatio?ls

indu.ced by DNA adducts cis-DDP and AUDI-’ cis-DDP

Adclurt

sun1t,rr

formed

h;y

A(‘I)P o.

Numt~er

o.

Only 29 of 115 rib-DDP and 44 of the 112 A(‘I>P-induced mutatmnn are included in t,his Table because the majority of mutants could not be unambiguously assigned to a particular adduct. For example. a d(UpApGpU) sequence could accommodate a G*NG*. A*G*. or G*G* adduct, making it dificult to assign a mutation occurring in this sequence to a specific adduct. It should be noted that, due to the limited size of this data set. the trends observed in this Table may not extend to the entire mutational spectra.

Gvnofosicity

and Mutagenicity

of Platinwn

Drugs

I045

(a) d(GpG) ACDP adducts: /’ II

Favorable H-bonding interaction

I

HOG$N-/-~Hh 3

/, N .

c,

I

II

I,“,

I’

,,P

/--

,+I” NH2

I

NH,

Unfavorable steric interaction

(b) d(ApG) ACDP adducts:

HO

\NH2

NH3

\

-0-E-O 0 OH

III

IV

Figure 7. Orientational sequences orientational interaction (adapted

isomerism of (a) d(GpG) and (b) d(ApG) adducts formed by ACDP. which can bind to d(GpG) the cyclohexylamine moiety oriented in either the 3’ (I) or 5’ (II) direction. In contrast. the 3 isomer (TIT) preferentially forms at d(ApG) sequences as the 5’ isomer (IV) forms an unfavorable steric hetween the cyrlohesyIam;ne moiety of M’DP and the exocyclic amino group of the 5’ adenine residue from Hartwig & Lippard (1992)). with

IIDP. The remaining 7% cis-DDP and 99 ACIDI’ induced mutations were similar in nature (Table 5) but occurred at different sites. The differences that do exist in the mutational spectra of ris-DDP and ACDP are attributable to two factors. First. the molecular processing of cisDDP and A(‘DP DNA adducts is affected by the

cyclohexyl substituent of ACDP. For example, Hartwig & Lippard (1992) report different termination site preferences for polymerases encountering site-specifically prepared cis-DDP and ACDP G*G* adducts although, quantitatively, the replication blockage effected by each adduct is similar (92% for the cis-DDP G*G* adduct compared to 85 to 90%

1046

Genotoxicity

and Mutagenicity

for the ACDP G*G* adduct). The results of the present study suggest similar behavior in the mutagenicity of these adducts; the overall mutational specificity is very similar for both drugs although the precise sites where the mutations occur vary. A second factor contributing to the differences in the mutational spectra is the variability in the distribution of adducts formed by cis-DDP and ACDP. Although the overall DNA binding is very similar for both drugs (Fig. 5), differences do occur. Considering that the sequence specificity of DKA binding is determined by a combination of steric and hydrogen bonding effects influenced by the substituents attached to the platinum atom (Green et al., 1992), the cyclohexyl ring of ACDP can subtly affect the DNA bmding spectrum of this compound. As discussed earlier, the ability of ACDP to form orientational isomers (Fig. 7) could contribute to the observed diminution in A*G* crosslinks compared to the cis-DDP binding spectrum. (d) Correlation

of sites of adduct formation ,mutational spectra

with

The spontaneous mutational spectrum generated from unmodified DNA was significant,ly different from the cis-DDP and ACDP induced spectra. indicating that specific platinum adducts, not random DNA damage, were responsible for the mutagenicity associated with the modified DNA samples. Replication mapping of adducts was done to demonstrate that platinum adducts were present at the sites where mutations occurred to reinforce further the mechanistic link between these DNA lesions and the induced mutational events. As can be seen in Figure 5, most of the observed mutations occur at sites of platinated nucleotides. A fraction of the mutants, (23 cis-DDP and 25 ACDP), however, occur at nucleotides that apparently are not modified. These mutants are the result of one of two factors. First, at many potential sites of modification, the level of platination, although detectable, was too weak to quantitate and was therefore not included in Figure 5. Such sites include the cis-DDP induced mutants at 6147 in the (-) strand. Seven cis-DDP and 12 ACDP-induced mutants fit in this category. Second, approximately 12 to 20% of the mutants in the drug-induced spectra are spontaneous in origin, and would not be expected to occur at drug-modified sites. An example of this chss of mutants can be observed near 6310 where similar mutations are seen in the cis-DDP, ACDP. and spontaneous mutation spectra. Considering these factors, we view the correlation between the sites of adduct formation and the actual location of mutations to be excellent. (e) Sequence

dependence of adduct formation and mutagenesis

Another goal of the replication ments was to determine whether binding or mutational hotspots

mapping experithere were DNA for cis-DDP and

of Platinum

Drugs

0 q

Actual

n

Distribution

Expected

adduct adduct

distribution distribution

of mutations

ct z

z. % d 2 kl ii

Figure 8. Comparison of the predicted and actual adduct distributions with the distributions of mutations in the various segments of the larz’ region of M13mpl8 RF DNA. The predicted adduct distributions (data were pooled for both drugs as no signifieant differences were discernible at the level of this analysis) were determined based on the known binding preferences of r-is-DDP (Mob at d(GpC) sites, -%qb at d(ApG) sites. - 109, at d(Gph’pG) sites and -1 “/b at other sites) and AC’DP (54qb at d(GpG) sites, 89b at d(ApG) sites and IO to Igo,, at d(GpXpG) sites) to DNA. The region referred to as other represents the DNA sequence between the various regulatory elements upstream of the /a&’ peptide coding region.

ACDP in the la&’ sequence of M 13mplX. More specifically, are the DNA binding and mutagenic properties of these drugs sequence dependent! The replication mapping experiments revealed that adduct formation was stochastically determined for the major G*G* adduct. The observed adduct spectra (Fig. 5) matched the distribution predicted from the known binding preferences of these drugs (Fig. !3? open and shaded bars). The adduct distribution experiments, however, did not. have sufficient sensitivity to allow a rigorous comparison of the relative number and sites of A*G* and other infrequently occurring adducts formed by cis-DDP and ACDP. This point notwithstanding, it is reasonable to predict that the minor adducts also would be stochastically distributed in the la&’ region of the M13mp18 RF genomes. The data in Figure 5 clearly indicate that some sites suffer significantly more mutations than others with similar adduct levels. By contrast, several highly modified sites have few, if any, mutations. The sites of enhanced, or diminished, mutagenicity are closely correlated with the functional specificity

Cenotozicity

and Mutagenicity

of the far%’ DNA secluence. Figure 8 shows that some regions of the lacz’ sequence, such as the CAP binding site, -35 promoter, ribosome binding site, and 93 nucleotide sequence corresponding to t,he deletion in the MI5 a-acceptor protein are mutat,ionally hypersensitive. Conversely, other regions of the 1acZ’ secluence such as the sequences between the regulatory elements in the promoter/operator region and the sequences encoding the N and C’-terminal overlapping regions of the 1acZ’ peptide fragment are not critical for /I-galactosidase activity and suffer relatively few mutations (Fig. 8). Furthermore, mutations were twoto threefold more prevalent at the first and second positions of codons compared to the wobble position, which can oft,en accommodate base changes without affecting the amino acid composition. These factors lead us to conclude that cis-DDP and ACDP are not sequencedependent mutagens in this system. Taking into account t.he adduct spectra (Fig. 5), mutations occur at a comparable rate throughout the ent.ire IacZ’ region of the M13mp18 genome. (f) (‘orwludity remnrks and implications of these results for platinum-ba,sed drug design The similar t.oxicities and types of mutations arising from cis-DDP and AClDP modified DNA suggest that these effects are primarily a consequence of the st,ructural distortion (duplex unwinding and bending) that platinum binding imposes on DNA and not due to the ligands att.ached to the platinum atom. By contrast, the lower quantitative mutagenicity of AC’DP indicates that the ligands do play an important role in mediating t,he effects of platinum compounds. The influence of the ligands, however, occurs before DNA binding, as evidenced by the ability of the cyclohexyl ring of ACDP to direct against the formation of the highly mutagenic A*G* adduct. These results demonstrate a rational approach for lowering the mutagenicity, and t,herefore the potential carcinogenicity. of platinum-based anticancer drugs. We thank D. K. Treiber for helpful discussions and for caritical reading of the manuscript. Funding was provided by Xational Institutes of Health grants CA 52127 (to J.M.E.) and CA 34992 (to S.J.L.). References Alazard. R., Germanier, M. & Johnson. i\;. P. (1982). ‘Mechanism of toxirity of platinum(I1) compounds in repair-deficient strains of Escherirhin coli. Mutaf. Rrs. 93. 327-337. Amemiya. Y. 8 Miyahara. .J. (1988). Imaging plate illuminates many fields. Nature (London), 336. 89-W. Beck. I). .J. & Brubaker. R. R. (1975). Mutagenic properties of cis-platinum(I1) diamminodichloride in h’srhychprirhia coli. icf ulaf. Reu. 27, 181-189. Benedict, W. F.. Baker. M. S.. Haroun, L., Choi. E. & Ames. B. i%. (1977). Mutagenicity of cancer rhemotherapeutic agents in the SalnLonella/microsome test. (‘cm-rrr Rex 37. 2209-2213.

of Platinum

Drugs

1047

Blatter. E. E.. Vollano, J. F., Krishnan. B. S. & Dabrowiak. J. C. (1984). Interaction of the antitumor agents ci.q.cis.lranu-PtIV(~H~)Cl~(OH), and cia.cis.Iran~-PtIVI(C’H,),CH8H212CI,(OH), and their reduction products with PM2 DXA. Biochemistry. 23. 48 17-4820. Bradley. L. J. S.. Yarema, K. J.. Lippard. S. J. 8: Essigmann. ,J. ICI. (1993). Mutagenicity and genotoxicity of the major DNA adduct of the antitumor drug ci.u-diamminedichloroplatinum(I1). Biochemistry, 32, 982-988. Brouwer. .J.. van de Putte. P.. Fichtinger-Schepman, A. M. .J. & Reedijk. J. (1981). Base-pair substitution hotspots in GAG and GCG nucleotide sequences in Exherichia coli K- 12 induced by cis-diamminedichloroplatinum(I1). Proc. Nal. Acad. Sci., U.S.A. 78. 7010-7014. Brouwer. J.. Fichtinger-Schepman. A. M. J., van de Putte, P. & Reedijk. J. (1982). Influence of temperature on platinum binding to DNA, cell killing, and mutat.ion induction in Exherichia coli K-12 cells treated with cis-diamminedichloroplatinum(I1). r’ancer Res. 42. 2416-2419. Bublry. G. .J.. Ashburner, B. P. t Teicher. B. A. (1991). I pectrum ci of cis-diamminedichloroplatinum(TI)induced mutations in a shuttle vector propagated in human cells. illol. Carcinog. 4. 397-406. Burnouf. D., Gauthier. C.. Chottard, J. C. & Fuchs. R. P. P. (1990). Single d(ApG) cis-diamminedichloroplatinum(I1) adduct-induced mutagenesis in Escherichia coli. Pror. *Vat. Acad. Sci., C1.S.A. 87, 6087-609 I. (Trcarelli, R. B.. Solomon. M. J., Varshavsky, A. & Lippard. S. J. (1985). In z&o effects of cis- and transdiamminedichloroplatinum(11) on SV40 chromosomes: differential repair. DiXA-protein cross-linking, and inhibition of replication. Biochemist y, 24, 7533-7540. Comess. K. M.. Burstyn. J. S.. Essigmann, J. M. & Lippard. S. J. (1992). Replication inhibition and translesion synthesis on templates containing sitespecifically placed cis-diamminedichloroplatinum(I1) DNA adducts. Biochemistry, 31, 3975-3990. de Boer, ,J. G. t Blirkman, B. W. (1989). Sequence speciticity of mutation induced by the anti-tumor drug cisplatin in the CHO aprt gene. Carcinogenesis, 10, 1363-1367. de Boer. J. Q. t Glickman. B. W. (1992). Mutations recovered in the Chinese hamster aprt gene after exposure to rarboplatin: a comparison with cisplatin. (‘nrcin.ogenesis, 13. 15-17. Decuyper-Debergh, D., Piette, J. & Van de Vorst, A. (1987). Singlet oxygen-induced mutations in Ml3 la& phage DNA. EMBO J. 6, 3155-3161. Eastman, A. (1983). Characterization of the adducts in DNA by cis-diamminedichloroproduced platinum(I1) and cti-dichloro(ethylenediamine) platinum(T1). Biochemistry, 22, 3927-3933. Eastman. A. (1987). Glutathione-mediated activation of platinum(IV) complexes. B&hem. anticancer Pharmacol. 36. 41773178. Eustice, D. C.. Feldman. P. A., Colberg-Poley, A. M., Buckery, R. M. & Xeubauer. R. H. (1992). A sensitive method for the detection of /3-galactosidase in transfected mammalian cells. Biotechniques, 11, 739-742. Fichtinger-Schepman, A. M., van der Veer, J. L., den Hartog, J. H., Lohman. P. H. & Reedijk, J. (1985). Adducts of the antitumor drug cis-diamminedichloro-

1048

Genotoxicity

and

Mu.tagenicity

of

platinum(I1) with DNA: formation. identificat,ion. and quantitation. Biochemistry, 24, 707-7 13. Gibbons, G. R.. Wyrick, S. & Chaney. S. G. (1989). Rapid reduction of tetrachJoro(o.L-lru&y)J ,2-diaminocyclohexanepJatinum(IV) (Tetraplatin) in RPMI I640 tissue culture medium. ca?Lcer Reu. 49. 1402-1407. Green, M.. Garner. M. & Orton. D. M. (1992). C’isplatinthe last five years. Trans. Met. Chem. 17. 164-167. Greene, M. H. (1992). Is cisplatin a human carcinogen? J. Nat. Cancer Inst. 84, 306-312. Hanahan. D. (1985). DNA Cloning: A Practical Approach. IRL Press. Oxford. Hartley, F. R. (1973). The (‘herniatry of Platinum and Palladium. Applied Science Publishers. London. Hartwig, J. F. & Lippard. S. ,J. (1992). DKA binding properties of cis-[Pt(XH,)(C,H,,NH,)CJ,]. a metabolite of an orally active platinum anticancer drug. J. Amer. Chem. Sot. 114. 5646-5654. Heiger-Bernays. W. J., Essigmann. J. M. & Lippard, S. J. (1990). Effect of the antitumor drug cia-diamminrdichJoropJatinum(I1) and related platinum complexes on eukaryotir DNA replication. Biockniatry. 29. 8461-8466. Husain, I., Chaney, S. G. & Sanrar. A. (1985). Repair of cti-platinum-D)niA adducts by ABC exinurlease ill vivo and in vitro. J. Bacterial. 163, 817-823. Johnson. Ej. P., Hoeschele, J. D.. Rahn. R. 0.. O’SeiJl. J. P. & Hsie, A. W. (1980). Mutagenicity. cytotoxicity, and DNA binding of pJatinum(II)-chloroamines in Chinese hamster ovary cells. t’ancer Res. 40, 1463-1468. Kelland. L. R.. Murrer. B. A.. Abel. 6.. Giandomeniro. C. M.. Mistry. P. & Harrap. K. R. (1992). Ammine/ amine platinum(IV) dicarboxylates: a novel class of platinum complex exhibiting seJect.ive cyt,otoxicity to intrinsically cisplatin-resistant human carcinoma cell lines. Cancer Res. 52, 822-828. Kunkel. T. A. (1984). Mutational specificity of dellurination. Proc. Nat. Acad. Sri.. l~.S.A. 81. 1494-1498. Lasko, D. D., Harvey. S. c’., Malaikal, S. B., Kadlubar. F. F. & Essigmann, J. M. (1988). Specificity of mutagenesis by 4-aminobiphenyl. A possible role for N-(deoxyadenosin-8-yJ)-4-aminobiphenyl as premutational lesion. .J. Riol. (‘hem. 263: 15429-15435. LeCJerc. J. E.. Istock, Ku’. L., Saran. B. R. & Allen. R.. Jr (1984). &Sequence analysis of ultraviolet-induced mutations in MJ3larZ hybrid phage Dh’X. .J. MO/.

Plntinunr

I1r~y.q

LeoJ>oJd. \V. R.. Miller. E. (‘. & .\JiJlrr. J. .A. (1!)7!)). (‘itrc,inogenicit,~ of antitumor ris-J)Jati~~um(II) roordination comJ)Jexes in the mouse antl rat. (‘nnwr Res.

41. 913-918. I,iJ)pard. S. .J. J~olynuc~Jeoticlr

(‘hrnr.

( 1978). Platinum structure and

(Received 26 April

by

of

~)rolws

drugs.

Jrc.

1ZP.S.11. “I J-217.

Maniat.is. T.. Fritsch. 3lolecular Cloning. Cold Spring Harbor Harbor, NY. Messing. .I. (1983). Xew

fhzynrot.

E. F. & Sambrook. J. (1989). .A Laboratory M anrta.1. 2nd edit.. Laboratory Press. Cold Spring M I3 vrrtors

for

cbloning.

.I/rlhoffs

101. “O-78.

Mizusawa, H.. Lee. (‘. H. Sr Kakefutla. T. (1981). Alteration of plasmit 1)X.&mediated transformation mutat,ion intlucrd by covalent bintlinp and of brnzo~a]J~~re~~e-7.8-~Ji~~~~Jro~liol-9.JO-osidr in Escherichia roli. ,Mrttal. Rrs. 82. 47-57. Murray. V.. Motyka. H.. England. I’. R.. \1’ickham. (:.. Lee, H. H.. Jknny. W. A. 8r McFatJyrn. \\‘. I). (1992). The use of Ta(J J)SA J)oJymerasr to tlrtrrminr t.he sequence specificity of J)R;A damage caused 1,) cis-diamminedic~hJoroJ~Jatinum(11). a~ritlinr-trthrlrtl platinum(I1) diammine m~n~~Jext=s or two cu~aJogurs. .J. Riol. (‘hem. 267. 1880518HO9. Pinto. A. I,. 8: LipJ)ard. S. .J. (1985). SrcJilrncr-deJ)e’“(Jent termination of in vi/w DSA synthesis J,y cis- and fmns-diamminedichJoroJ~Jatinun~ (II). Pror. SO/. Acad. Sri.. f’.S..-l. 82. 4616-4619. Roberts. R. .J. & Strike. I’. (1981). Efficiency of EF:srhrrir/rin roli repair processes on uv-damagrtl transforming J)Jasmid DSA. Plasnrid. 5. 21%EO. Sangrr, F., Sicklen. S. 8i (‘oulson. A. R. (1977). 1)X.-\ secJurncing with c,hain-trrminatic,n inhibitors. Proc.. .Val. .Arad. Sri.. 1 ‘.S..q 74. W63&.i467. van der Veer. .J. I,.. J’eters. A. R. & Rerdijk. .J. (1986). Reaction J>roducts from J~latinum(I\‘) amine romJ)ounds and 5’-CM1 are mainly J,is(:i’-(:JJJ’)pJatinum(I1) amine adducts. .J. Inory. Hiochenr. 26. 137-142. Wickner. \V.. Brutlag. I).. Schrkman. R. & Kcwnl~rr~. A. (1972). RSA svnthrsis initiates in vitro ronversion of Ml3 DSA to -its rrplicativr form. Pi-w. .\‘nl. .-If&/. Nri.. l’.S.A. 69. 965-969. \Virnkr. .I. K., (‘ervenka. .J. PI J’aulus. H. (J97!)). hlutagenic activity of anticancer agent ris-dicahlorodiamminr platinum-II. Mtrlal. 1fp.s. 68. 6!)-75.

Biol. 180, 217-237. Edited

c*omJ)Jrsrs: antitumor

R.

Schleif

1993; accepted 12 November

199.3)