Effects of domestic sewage from different sources on greenhouse gas emission and related microorganisms in straw-returning paddy fields

Journal Pre-proof Effects of domestic sewage from different sources on greenhouse gas emission and related microorganisms in straw-returning paddy fields

Mengyao Li, Lihong Xue, Beibei Zhou, Jingjing Duan, Zhu He, Xugang Wang, Xiaofeng Xu, Linzhang Yang PII:

S0048-9697(20)30917-7

DOI:

https://doi.org/10.1016/j.scitotenv.2020.137407

Reference:

STOTEN 137407

To appear in:

Science of the Total Environment

Received date:

28 November 2019

Revised date:

29 January 2020

Accepted date:

16 February 2020

Please cite this article as: M. Li, L. Xue, B. Zhou, et al., Effects of domestic sewage from different sources on greenhouse gas emission and related microorganisms in strawreturning paddy fields, Science of the Total Environment (2020), https://doi.org/10.1016/ j.scitotenv.2020.137407

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

© 2020 Published by Elsevier.

Journal Pre-proof

Title Page Effects of domestic sewage from different sources on greenhouse gas emission and related microorganisms in straw-returning paddy fields Mengyao Li a, b,1, Lihong Xue a, *, Beibei Zhou c, Jingjing Duan a, Zhu He a

, Xugang Wang b, Xiaofeng Xu b, Linzhang Yang a Institute of Agricultural Resources and Environment, Jiangsu Academy of Agricultural Sciences,

of

a

Nanjing 210014, China

School of agriculture, Henan University of Science and Technology, Luoyang 471023, China

c

College of Environment and Ecology, Jiangsu Open University, Nanjing, Jiangsu 210017, China

lP

*Corresponding author contract

re

-p

ro

b

na

Corresponding author: Lihong Xue

Address: Institute of Agricultural Resources and Environment, Jiangsu Academy of

Jo ur

Agricultural Sciences, Nanjing 210014, China E-mail: [email protected]

Journal Pre-proof

Abstract Reusing domestic sewage for crop irrigation is a promising practice, particularly in developing countries, since it is a substitute for chemical fertilizer and reduces water contamination. More attention was paid to the effect of sewage irrigation on crop yield and soil nutrients, but little attention was paid to greenhouse gas (GHG)

of

emission from straw-returning paddy fields. In this study, a soil column monitoring

ro

experiment was conducted to assess the effects of untreated domestic sewage (dominated with ammonia) and treated domestic sewage (dominated with nitrate)

-p

irrigation on methane (CH4), nitrous oxide (N2O) emission, and related soil

re

microorganisms in straw-returning paddy fields. Results showed that straw-returning

lP

dramatically promoted CH4 emission but had little effect on N2O emission. Both

na

untreated and treated domestic sewage irrigation decreased CH4 emission of straw-returning paddy whether nitrogen fertilizer applied or not. The mitigating effect

Jo ur

of treated sewage irrigation on CH4 emission irrigation was greater than untreated sewage irrigation. CH4 emission had a significant correlation with the abundance of soil methanogens and methanogens/methanotrophs. N2O emission increased with untreated or treated domestic sewage irrigation, although the total N input, including the N carried by sewage water, was the same for all treatments. No significant correlation between N2O and denitrification functional genes was found in this study. Treated domestic sewage irrigation reduced the global warming potential (GWP) by 66.7%, but untreated domestic sewage had no evident influence on the GWP. Results indicated that treated domestic sewage irrigation could significantly inhibit CH4

Journal Pre-proof

emission and the GWP by decreasing the ratio of methanogens to methanotrophs, and is promising in mitigating GWP from straw-returned paddy fields. Keywords: Sewage irrigation; Straw-returning; Methane (CH4); Nitrous oxide

Jo ur

na

lP

re

-p

ro

of

(N2O); Soil microorganism

Journal Pre-proof

1. Introduction Climate change and water pollution have caused the global environment to deteriorate. With continuous

industrial development,

human activities are

accompanied by greenhouse gas (GHG) emission, such as carbon dioxide (CO2), methane (CH4), and nitrous oxide (N2O)(Petit et al., 1999). GHG emission has

of

increased global temperatures, and climate anomalies have caused frequent natural

ro

disasters, alternating droughts, and floods, posing serious threats to agricultural

-p

production(Djalante, 2019). The paddy field is one of the important GHG emission sources. To improve the yield, paddy fields are mostly flooded, then drained, and

re

frequent water changes cause the soil to release a large amount of N2O(Painter, 2013).

lP

As an environmental protection measure, straw-returning can prevent air pollution

na

caused by straw burning; however, it increased CH4(Li et al., 2018; Ma et al., 2007) and N2O emission from rice paddies by 2–11-fold and 13.1%–45.5%(Huang et al.,

Jo ur

2019; Wu et al., 2018), accompanied by increased soil nutrient content and physical properties(Bu et al., 2020). Therefore, for environment-friendly agricultural development, controlling the GHG emission caused by straw-returning in rice fields is crucial. There are more than 4000 existing sewage treatment plants in China, and the tailwater produced can be up to 1.7 × 108 m3 per day. The tailwater from a sewage treatment plant is still rich in nutrients, such as nitrogen and phosphorus, which is much higher than the national surface water environment quality standard in China (GB3838-2002). Therefore, the direct charge of domestic sewage tailwater could

Journal Pre-proof

cause eutrophication and threaten the water environment(Xu et al., 2019). Furthermore, due to the lack of sewage treatment facilities in some rural areas, a large amount of domestic sewage has not been properly treated and are directly discharged into the nearby river, causing serious water pollution(Wang et al., 2019). To use the resource, sewage irrigation is a new type of irrigation method, in which abundant

of

microorganisms can regulate the straw decomposition process, promote degradation of organic acids(Zhang et al., 2008), and relieve the adverse effect on rice seedling

ro

growth at the initial stage of straw-returning. Ibekwe et al. showed that the number of

-p

nitrifying bacteria, nitrogen-fixing bacteria, and potential pathogens in the soil after

re

domestic sewage irrigation was significantly higher than it was in clear water

lP

irrigation(Ibekwe et al., 2018). Xu et al. found that domestic sewage rich in ammonia

na

nitrogen can reduce CH4 emission by 24.5%–26.6% and reduce N2O emission by 37.0%–39.0% in straw-returning paddy fields(Xu et al., 2017a). Abundant ammonium in

untreated

domestic

Jo ur

nitrogen

sewage

can

improve

the

quantity

of

ammonia-oxidizing bacteria (AOA), accelerate the mineralization of organic nitrogen in straw, and promote the conversion of NH4+-N to NO3−-N and NO2−-N, which reduces NH3 volatility by reducing the NH4+-N concentration in floodwater(Lydmark et al., 2007; Otawa et al., 2006). However, domestic sewage from different sources has a significant difference in nitrogen form, mainly ammonium in untreated domestic sewage but mainly nitrate in treated domestic sewage(Hong et al., 2019; Yang et al., 2019). Furthermore, the microorganism community also changes when domestic sewage is treated in a sewage treatment plant. Could treated domestic sewage still

Journal Pre-proof

mitigate GHG emissions? How do soil microorganisms respond to different sewage water? The answers to these questions are still unclear. Therefore, two kinds of sewage water with different N forms were used to irrigate the paddy with straw-returning in 2018–2019. The aims of this study were to (1) clarify the effects of domestic sewage irrigation combined straw-returning with different nitrogen forms on

of

GHG emission, (2) explore the related soil microorganism’s response to sewage

ro

irrigation.

-p

2. Materials and methods

re

2.1. Experimental materials

lP

In 2018, the soil column experiment was performed at the Jiangsu Academy of

na

Agricultural Sciences, Nanjing, Jiangsu Province, China. Nangeng 46 was used in this experiment; the soil was rice-black soil from Yixing. The basic properties of the tested

Jo ur

soil were as follows: pH 5.90, 20.2 g/kg organic matter, 1.72 g/kg total nitrogen (TN), 0.54 g/kg total phosphorus (TP), 23.09 mg/kg available phosphorous, and 159.28 mg/kg available potassium. Two kinds of domestic sewage were used for daily irrigation in this experiment; untreated domestic sewage was taken from the septic tank of the Jiangsu Academy of Agricultural Sciences, and treated domestic sewage was taken from Chengdong sewage treatment plant in Nanjing. The physical and chemical properties of domestic sewage are shown in Table 1.

2.2. Experimental design

Eight treatments with three replicates were set up: Six treatments for

Journal Pre-proof

straw-returning, including three kinds of irrigation water: untreated domestic sewage (W1), treated domestic sewage (W2), and tap water (T), and two N rates of which chemical N fertilization (N1) and without N fertilizer (N0) under straw-returning. The other two treatments for straw removal with tap water irrigation with and without N fertilizer are set as control. That is, SW1N1 (straw-returning + untreated domestic

of

sewage irrigation + urea), SW1N0 (straw-returning + untreated domestic sewage irrigation), SW2N1 (straw-returning + treated domestic sewage irrigation + urea), (straw-returning

+

treated

domestic

sewage

ro

SW2N0

irrigation),

STN1

-p

(straw-returning + tap water irrigation + urea), STN0 (straw-returning + tap water

re

irrigation), TN1 (tap water irrigation + urea), and TN0 (tap water irrigation without

lP

straw and urea).

na

The TN input amount was consistent at 240 kg/ha for N1, including the N from fertilizer and sewage. The nitrogen fertilizer was applied three times as basal, tillering,

Jo ur

and panicle fertilizer with a ratio of 30%, 30%, and 40%. Then, 72 kg/ha urea was applied as base fertilizer, except for TN0. The actual amount of urea applied as tillering and panicle fertilizer was deducted from the amount of nitrogen brought by domestic sewage irrigation (Table 2). Phosphorous and potassium fertilizers were the same for all treatments that were applied as base fertilizer in all treatments for 65 kg/ha P2O5 and 100 kg/ha k2O. Wheat straw was chopped to approximately 3–5 cm in length, and incorporated into the soil for all treatments, except for TN0 and TN1. The amount of straw-returning was 630 kg/ha.

Journal Pre-proof

2.3. Gas collection and measurement

The static gas chamber method was used to collect CH4 and N2O gas samples during the rice-growing season(Moseman-Valtierra et al., 2011). The chamber was an enclosed, dark, static cylinder 100 cm high with a 32 cm inner diameter. A circulating fan was equipped to ensure complete gas mixing, and a hole was used to collect the

of

gas sample on the chamber. Gas samples were taken from each static chamber’s

ro

headspace at 1, 2, 3, 5, and 7 days after each fertilization and then were taken once a

-p

week at the other stages throughout the whole season. When collecting the gas sample,

re

the chamber was placed in the groove of the basin over the paddy rice, and water was added to the groove to keep the inside of the chamber sealed. Gas samples were

lP

collected at 0, 10, 20, and 30 min after the chamber was sealed and the chamber

Jo ur

20 mL vacuum bottles.

na

temperature was recorded by 50 mL polypropylene syringes, which were injected in

Gas samples were analyzed using a gas chromatograph (GC-7890B; Agilent Technologies, Santa Clara, CA, USA) equipped with a flame ionization detector and an electron capture detector(Zou et al., 2009). CH4 and N2O fluxes in the chamber were determined via regressions of concentration and time(Hirota et al., 2004). The seasonal total CH4 and N2O emissions were calculated by the integral equation(Hong et al., 2019).

2.4. Soil collection and soil DNA extraction

A fresh soil sample (0–20 cm) was used to measure the copy number of

Journal Pre-proof

microbial related functional genes using a three-point sampling method at 21d and 83d after rice transplanting. The soil samples were stored at -30℃ and prepared to extract DNA. Soil microbial genomic DNA was extracted using the Fast DNA® Spin Kit for Soil kit (MP Biomedicals, Santa Ana, CA) according to the manufacturer's instructions. The extracted soil DNA was dissolved in 100μl TE buffer, quantified by microscale spectrophotometer (Thermo Scientific™ NanoDrop™ One) and stored

ro

of

at −20 °C until use.

-p

2.5. Real-time quantitative PCR

methanotrophs,

ammonia-oxidizing

archaea

(AOA)

and

lP

methanogens,

re

Real-time quantitative PCR (qPCR) was used to quantify the abundance of the

ammonia-oxidizing bacteria (AOB) and denitrifying genes (nirK, nirS, and nosZ) on a

na

C1000™ Thermal Cycler equipped with a CFX96™ Real-Time system (Bio-Rad,

Jo ur

USA) and SYBR® Premix Ex Taq™ (TaKaRa, Japan)(Watanabe et al., 2006). The primers used to amplify each target gene in qPCR has shown in Table 3. The plasmid DNA dilution series of 10-fold was set to generate a standard curve covering seven orders of magnitude from 102 to 108 copies of the template per assay. The 20 μL of the reaction mixture was set by using SYBR® Premix Ex TaqTM Kit (TaKaRa) contained 10 μL of SYBR® Premix Ex TaqTM primer set (0.5 μM each) and 1.0 μL of template containing approximately 2-10 ng of DNA(Zhou et al., 2019). Double-distilled Water as the blanks were run to replaced soil DNA extract. Real-time qPCR was performed in triplicate and amplification efficiencies of 97.2-105% were obtained with R2 values

Journal Pre-proof

of 0.974-0.999. The functional gene quantities were calculated according to the following equation(Behrens et al., 2008): 𝐶 = × 𝑉/(𝑣 ×

)

where c is the number of functional gene copies per reaction volume(copies/μl), V is

of

the volume of extracted DNA (μl), v is the volume of DNA per reaction mixture (μl),

ro

and m is the mass of the sample used for extraction (g).

-p

2.6. Data analysis

re

The CH4 and N2O flux was calculated using the following equation(Chen et al.,

lP

2011):

𝐹 = 𝜌 × 𝐻 × (𝛥 /𝛥𝑡) × 273/(273 + 𝑇)

na

where  is the CH4 or N2O density at standard conditions (mg/cm3), H is the height of

Jo ur

the chamber above the water layer (m), c/t is the CH4 or N2O accumulation rate (mg/h), and T is the temperature inside the chamber during sampling. The cumulative CH4 and N2O emission were calculated using the following equation(Cai et al., 2013): 𝑛

𝐶𝑢 𝑢𝑙𝑎𝑡𝑖𝑣𝑒 𝑒 𝑖𝑠𝑠𝑖𝑜𝑛 = ∑(𝐹𝑖 + 𝐹𝑖 + 1)/2 × (𝑡𝑖 + 1 − 𝑡𝑖) × 24 𝑖=1

where F is the CH4 or N2O flux (mg/m2/h), i is the ith measurement, (ti

+ 1–ti)

is the

number of days between two adjacent days of the measurements, and n is the total days of the measurements. The GWP was calculated as CO2 equivalent (CO2-eq) based on a 100-year time

Journal Pre-proof

horizon using the radiative forcing potential of 28 for CH4 and 265 for N2O(Landman, 2010). The GWP of CH4 or N2O was calculated using the following equation:

GWP (kg CO 2  eq ha1 yr 1 )  28  CH 4(kg ha1 )  265  N 2O(kg ha1 ) where CH4 and N2O represent the cumulative CH4 and N2O emission, respectively(Zhang et al., 2012).

of

2.7. Statistical analyses

ro

Two-way analysis of variance for a completely randomized design was used to

-p

test each treatment. Differences were considered statistically significant at P < 0.05 by

re

Duncan’s multiple range test. All statistical analyses were conducted using SPSS

lP

version 17.0 (SPSS, Inc., Chicago, IL, USA). All figures were plotted using Microsoft

na

Excel 2007.

Jo ur

3. Results

3.1. CH4 and N2O emission 3.1.1. CH4 flux

The dynamic change of CH4 emission flux during the whole growth period of rice is shown in Fig 1. The CH4 emission was low and steady during the whole growing season without straw return. However, straw-returning dramatically increased CH4 emission flux during the day after transplanting (DAT) between 3 and 33. Nitrogen fertilizer slightly decreased the CH4 emission flux, the same for straw-removal and straw-returning treatments. Compared to STN0, two kinds of

Journal Pre-proof

domestic sewage irrigation delayed the peak of CH4 emission flux by 46.7% and 30.1%, respectively. Compared to STN1, both W1 (untreated domestic sewage) and W2 (treated domestic sewage) irrigation mitigated the flux of CH4 emission, and the peak of CH4 emission flux was decreased by 6.75 and 28.55 mg/m2/h, respectively.

3.1.2. N2O flux

of

As shown in Fig. 2, the peak of N2O emission was mainly emitted within field

ro

drying. Nitrogen fertilizer had no significant effect on N2O emission without

-p

straw-returning. Straw-returning increased N2O emission flux significantly and

re

enhanced the peak of N2O emission flux after nitrogen fertilizer application (STN1)

lP

by 0.44 mg/m2/h compared to STN0. The average N2O emission flux of each

na

treatment was SW1N1 > SW2N1 > STN1 > STN0 > SW2N0 > TN1 > TN0 > SW1N0. Compared to STN1, W1 and W2 irrigation increased the average N2O emission flux

Jo ur

by 63% and 26%, respectively. The average N2O emission flux under W1 irrigation was minimum among the straw-returning treatment without nitrogen fertilizer. Compared to STN0, W1 and W2 irrigation decreased N2O flux by 133% and 2%, respectively.

3.1.3. Cumulative CH4 and N2O emission

The cumulative emission of CH4 and N2O on different periods is shown in Table 4. The total CH4 emission during the whole growth period without straw-returning was very low, less than 10 kg/ha. Nitrogen fertilizer application significantly reduced

Journal Pre-proof

the CH4 emission. Straw-returning dramatically increased the cumulative CH4 emission mainly concentrated before the field drying (within 35 days of rice transplanting), accounting for 61% of the total CH4 emission on average. before and after field drying. Under straw-returning, nitrogen fertilizer application mitigated the CH4 emission with tap water irrigation (T) and treated domestic sewage irrigation

of

(W2) by 19% and 43%, but slightly increased CH4 emission with untreated domestic sewage irrigation(W1), both W1 and W2 irrigation treatment could decreased the total

ro

CH4 emission no matter with or without nitrogen fertilizer. The total CH4 emission

-p

under no N fertilizer treatments was significantly reduced by 36% for W1 irrigation

re

and 39% for W2 irrigation, and reduced by 12% for W1 irrigation and 58% for W2

lP

irrigation when N fertilizer was applied.

na

In contrast, N2O emission mainly concentrated after field drying, and the cumulative N2O emission after field drying accounted for 88% of the total N2O

Jo ur

emission during the whole growth period on average. Whether nitrogen fertilizer was applied or not, straw-returning increased total N2O emission. W1 and W2 irrigation reduced the cumulative N2O emission under straw-returning treatment without nitrogen fertilizer, among which SW1N0 < SW2N0, but increased the total N2O emission when N fertilizer was applied. The difference in the total N2O emission between STN1 and SW1N1 was significant.

3.1.4. Global warming potential (GWP)

The GWP of CH4 and N2O are shown in Fig.3. Whether nitrogen fertilizer was

Journal Pre-proof

applied or not, straw-returning dramatically increased the GWP. Nitrogen fertilizer application decreased the GWP of rice fields, except for untreated domestic sewage irrigation (W1). Compared with tap water irrigation (T), both untreated(W1) and treated sewage(W2) irrigation decreased the GWP of straw-returned treatments no matter the N fertilizer applied or not. The difference was significant between sewage

of

irrigation and tap water irrigation without N fertilizer but slight between untreated and treated sewage treatment. In comparison with STN1, SW2N1 significantly reduced

-p

ro

the GWP by 67%.

re

3.2. Soil microbial functional genes

lP

3.2.1. Methanogens and methanotrophs

na

CH4 was mainly emitting before field drying, so the data of methanogens and methanotrophs numbers were from the soil samples collected before field drying(21d).

Jo ur

As shown in Fig.4a, nitrogen fertilizer application increased the gene copies of methanogens and methanotrophs in the soil without straw-returning, but decreased the gene copies of methanogens and methanotrophs under straw-returning, irrespective of the irrigation source. Compared with STN0 treatment, W1 and W2 irrigation increased the gene copies of methanogens and methanotrophs in straw-returned and no nitrogen fertilizer treatments. Under straw-returning treatment with nitrogen fertilizer application, gene copies of methanogens and methanotrophs were reduced by W1 irrigation; but increased by W2 irrigation, although the difference was not significant.

Journal Pre-proof

The ratio of methanogens to methanotrophs can directly reflect the impact on CH4 emission in soil. The bigger the ratio of methanogens to methanotrophs is, the stronger the promotion of CH4 emission is. The variation of the ratio of methanogens to methanotrophs was consistent with total cumulative CH4 emission. Nitrogen fertilizer application reduced the ratio of methanogens to methanotrophs no matter the

of

straw returned or not (Fig.4b) Compared to STN0, the ratio of methanogens and methanotrophs increased in untreated domestic sewage irrigation treatment (SW1N0),

ro

while decreased in treated domestic sewage irrigation treatment (SW2N0). For those

-p

straw-returned treatments with nitrogen fertilizer, the mean ratio of methanogens to

re

methanotrophs in SW1N1 treatment was significantly higher than that in STN1, in

lP

contrast, SW2N1 treatment was lower than STN1.

na

3.2.2. Nitrification and denitrification functional gene copies

Jo ur

N2O emission was concentrated after field drying, and then the soil was being draining-flooding-draining, so the data of nitrification and denitrification functional gene copies were from the soil samples collected after field drying(83d). AOA and AOB are closely related to nitrification. As shown in Fig.5, there was no significant difference in AOA gene copies between each treatment. Both AOA and AOB gene copies of SW1N0 were higher than that in STN0. But for SW2N0 treatment, the AOA gene copies were lower than that in STN0, whereas the AOB gene copies were significantly higher. Under straw-returning treatment with nitrogen fertilizer, W2 irrigation replaced part of nitrogen increased both AOA gene copies and AOB gene

Journal Pre-proof

copies. Nitrite reductase (Nir) and N2O reductase (Nos) play a crucial role in denitrification, which could affect soil N2O emission in soil. Under straw-returning treatment without nitrogen fertilizer, the nirS gene copies were reduced by both untreated (SW1N0) and treated (SW2N1) sewage irrigation compared with tap water

of

irrigation (STN0). However, under straw returning with N fertilizer, the nirS gene copies were significantly increased in W2 irrigation treatment (SW2N1) and but

ro

decreased in W1 irrigation treatment (SW1N1). The nirK gene copies of each

-p

treatment were one magnitude lower than that of nirS and nosZ (Fig.6). The

re

application of nitrogen fertilizer increased the number of soils nirK gene copies,

lP

regardless of the kind of irrigation source, whether there was straw-returning or not.

na

W1 and W2 irrigation reduced the gene copies of nirK in both with and without nitrogen fertilizer, which was the greater for W1.

Jo ur

Denitrifying microorganisms that contain nosZ (Nos gene) can restore N2O to N2 so that the abundance of nosZ in the soil can affect N2O emission directly. Nitrogen fertilizer application increased the nosZ gene copies of each treatment, but the difference was not significant (Fig.6c). nosZ gene copies in SW1N0 were higher than those in SW2N0. In contrast, nosZ gene copies in SW1N1 were lower than those in SW2N1 with nitrogen fertilizer.

3.2.3. Correlations of cumulative GHG emission and functional gene copies

The correlation between the cumulative emission of CH4 and N2O and the copy

Journal Pre-proof

number of functional genes is shown in Table 5. The total cumulative emission of CH4 was extremely significantly positively correlated with the gene copies of the ratio of methanogens to methanotrophs. The total cumulative emission of N2O was significantly negatively correlated with the gene copies of AOA. 4. Discussion

of

4.1. Effects of domestic sewage irrigation on CH4 emission from paddy fields with

ro

straw-returning

-p

CH4 is mainly emitted at the start of the base fertilizer until the end of field

re

drying, as the paddy field is in a state of continuous flooding during this period. This

lP

study’s results showed that straw-returning increased CH4 emission significantly whether nitrogen fertilizer applied or not, similar with previous study(Ma et al., 2009).

na

Straw incorporation could improve the soil organic carbon (SOC) and regulate soil

Jo ur

microbial community structure(Hao et al., 2019). A large number of unstable compounds containing high carbon, such as cellulose and hemicellulose, are produced by straw decomposition, which provides sufficient substrate for methanogens and promotes

the conversion of carbonaceous

materials

into CH4 with

soil

respiration(Zhang et al., 2012). Also, the gene copies of methanogens was increased and the gene copies of methanotrophs was decreased when straw returned, as shown in Fig.4a, compared TN1 with STN1. This study also found that domestic sewage irrigation decreased CH4 emission from paddy fields with straw-returning, no matter it was treated or untreated (Table 4).

Journal Pre-proof

Domestic sewage is rich in nutrients such as nitrogen, phosphorus; active ingredients such as bacteria, fungi, actinomycetes and other microorganisms(Cai et al., 2018). In untreated sewage, the nitrogen was mainly existed in ammonia, but the nitrogen form in treated sewage was mainly nitrate after anaerobic treatment, as shown in Table 1. Previous studies have shown that domestic sewage irrigation can increase the number

of

of soil cellulolytic strain, which could prompt straw decomposition(Li et al., 2019). Methanogens are anaerobic microorganism that convert CH4 precursors into CH4

ro

under strictly anaerobic conditions(Dang et al., 2019; Schutz et al., 1989). As shown

-p

in Fig. 4a, untreated domestic sewage and treated domestic sewage irrigation

re

significantly increased the gene copies of methanogens in straw-returned fields

lP

without nitrogen fertilizer and my promoted the CH4 generation. But it also increased

na

the abundance of methanotrophs which maybe related with the nitrogen carried in the sewage irrigation. No matter the nitrogen is in nitrate or ammonia in the sewage, it be transformed into ammonia

Jo ur

finally will

because rice

is

a

kind

of

ammonium-preferring plant. Abd-Elwahed et al. also found that untreated domestic sewage irrigation increased the concentration of NH4+-N in soil(Abd-Elwahed, 2018). High concentration NH4--N and methane facilitate the growth of methanotrophs(Cai et al., 2018). Methanotrophs are obligate aerobic bacteria, with CH4 as the sole carbon source(He et al., 2019) , and about 30% to 90% of the CH4 produced in rice fields are oxidized by methanotrophs before release into the atmosphere(Groot et al., 2003). The final CH4 emission is CH4 production minus CH4 oxidation, so the total CH4 emission

Journal Pre-proof

in the straw-returning without nitrogen fertilizer paddy was significantly reduced by sewage irrigation. When the nitrogen fertilizer applied to the straw-returning paddy fields, the abundance of methanogens and methanotrophs was decreased simultaneously, but the decrease extent is larger for methanogens (Fig.4a), which resulted in the decreased

of

CH4 emission in STN1 treatment (Table 4). When untreated domestic sewage irrigated the straw-returned paddy fields with nitrogen fertilizer, the substrate for

ro

methanogens, mainly the organic acid content, decreased due to the accelerated straw

-p

decomposition(Liu et al., 2018); further both the abundance of methanogens and

re

methanotrophs was depressed (Fig.4b), therefore the CH4 emission in SW1N1 was

lP

less than STN1. If using the treated domestic sewage irrigated the straw-returning

na

paddy fields with nitrogen fertilizer, we found that the influence on methanogens and methanotrophs is just opposite to the untreated domestic sewage irrigation, both the

Jo ur

abundance of methanogens and methanotrophs was promoted, especially for the methanotrophs, almost doubled in SW2N1 when compared to STN1(Fig. 4a), and the treated domestic sewage irrigation reduced the ratio of methanogens and methanotrophs (Fig.4b)(Yuan et al., 2018). Nitrate nitrogen replace ammonium can improve the oxidation of methane(Walkiewicz and Brzezińska, 2019). In addition, the chemical oxygen demand content in the treated domestic sewage is much lower than that in untreated domestic (Table 1). Therefore, the CH4 emission was significantly decreased in SW2N1 treatment, and the effect was more obvious than untreated sewage irrigation (Table 4). Kim et al have indicated that nitrate-nitrogen fertilizer

Journal Pre-proof

applications such as KNO3 significantly reduced methane emissions(Kim et al., 2015), consistent with this study’s result.

4.2. Effects of domestic sewage irrigation on N2O emission from paddy fields with straw-returning

The N2O emission peak was occurred at 31-37 days after transplanting (field

of

drying) and 83 days after transplanting (dry-wet alteration stage) (Fig.2), and the

ro

change of soil moisture can directly affect the reaction process of soil nitrification and

-p

denitrification, causing a large amount of N2O emission, which is consistent with

re

previous studies(Chen et al., 2019; Sánchez-Rodríguez et al., 2018). We can see that

lP

the N2O emission was mainly concentrated after field drying, accounted for more than 70% of the total emissions (Table 4).

na

It is well known that there is a trade-off effect between CH4 and N2O emissions.

Jo ur

In this study, we found that sewage irrigation promoted the N2O emission in straw-returning and nitrogen fertilizer treatment, similar with the result of Zou et al(Ma et al., 2019; Zou et al., 2005). N2O emission was mainly regulated by the nitrification and denitrification process. Nitrification, the conversion of NH4+ to NO3− via NO2−, is thought to be an important pathway of soil N2O emission mainly through the ammonia-oxidizing bacteria (AOA and AOB)(Kim et al., 2010; Xie et al., 2012). As shown in Fig.5, the number of AOA and AOB varied a little with a slight increase in both untreated and treated domestic sewage irrigation treatments with nitrogen fertilizer.

Journal Pre-proof The abundance of nirS was significantly increased in SW2N1 treatment（Fig.6a）. It indicated that both the nitrification process and the denitrification process was promoted, therefore the N2O emission of SW1N1 and SW2N2 was significantly increased (Table 4). We can see that. the abundance of nosZ was also greatly increased in both SW1N1 and SW2N2 treatment (Fig.6c), this may be because that the high

of

N2O emission stimulated the activity and growth of nosZ gene in soil(Wang et al.,

ro

2013; Yoon et al., 2016).

-p

4.3 Effects of domestic sewage irrigation on GWP

re

The GWP data showed that both untreated and treated sewage could reduce the

lP

GWP of straw-returning paddy fields without nitrogen fertilizer, and no difference between untreated and treated sewage water. But the treated sewage irrigation on

na

GWP reduction is greater than untreated sewage when nitrogen fertilizer applied to

Jo ur

straw-returning fields (Fig.3). Considering the severe shortage of water resources has resulted in rapid urbanization, and domestic sewage irrigation in paddy fields is promising(López-Vinent et al., 2020; Reznik et al., 2017; Saliba et al., 2018). Especially in China, paddy fields were widely spread in the countryside, and most of the preceding crop straw was returned to the paddy fields because of the straw-burning ban, which inevitably contributed to the global warming(Zhang et al., 2015; Zhou et al., 2017). Meanwhile, more and more rural sewage was treated to remove the ammonia nitrogen and COD to alleviate the water pollution in recent years by the promotion of China government.(Bahri, 1999) After anaerobic treatment,

Journal Pre-proof

most of the ammonium N in the rural sewage was transformed to nitrate(Chen et al., 2008). If the treated sewage was used to irrigation the straw-returning paddy fields, it can not only avoid the water eutrophication caused by sewage direct discharge to the river but also can replace some nitrogen fertilizer and mitigate GHG emissions. Previous researches showed that 40% of TN and 48% of TP in the sewage treatment

of

tailwater could be removed by paddy field (Abe et al., 2008) and about 31.4-132.9 kg/ha of chemical N fertilizer can be saved(Ma et al., 2016; Xu et al., 2017b). In

ro

China, 5.18×1010 m3 treated sewage was discharged per year in 2014(Jin et al., 2014).

-p

If it can be all recycled to the straw-returning paddy fields, about 3.5×107 kg Eq-CO2

re

could be reduced and about 4724 ton chemical nitrogenous fertilizer could be saved

lP

based on this study’s result. So treated domestic sewage irrigation in straw-returned

na

paddy fields is a promising measure to reduce the risk of global warming and environmental discharges(Agrafioti and Diamadopoulos, 2012). Now, sewage water

Jo ur

irrigation was very common in the world(Arpke and Clerico, n.d.; Attwater et al., 2005; Du Pisani, 2006; Water, 2017). But social-economic factors, environmental factors, technological factors should be taken into account when reusing the treated domestic sewage(Bixio et al., 2008; Sgroi et al., 2018). Although the toxic metals such as Cd, Pb, and Cr and pathogens in the treated-sewage were all very low and can meet the national agricultural irrigation water quality standard in China, and the contents of toxic metals and pathogens in the crops were only in trace quantities and below permissible critical levels even after three decades of sewage irrigation(Minhas et al., 2015; Yadav et al., 2002), attention still should be paid on the proper amount

Journal Pre-proof

and time of sewage irrigation based on the crop types and soil qualities to avoid the risk for food and soil safety. 5. Conclusion Both the untreated and treated domestic sewage irrigation reduced the cumulative CH4 emission but increased the N2O emission in fertilized straw-returned

of

paddy fields. The GWP was decreased by 67% for treated domestic sewage and by 2%

ro

for untreated domestic. However, both the CH4 and N2O emissions in unfertilized

-p

straw-returned paddy fields were found to decreased by untreated or treated domestic

re

sewage. CH4 emission has a significant correlation with the abundance of soil

lP

methanogens and methanogens/methanotrophs while no significant correlation between N2O emission and the abundance of nitrifying and denitrifying bacteria

na

expect for Ammonia-oxidizing archaea. It is promising for treated domestic sewage

Jo ur

irrigation, coupled with straw-returning to alleviate the GWP effect of paddy field while reducing the water pollution.

Acknowledgements

This work was supported by the National Key Research and Development Program of China (No. 2016YFD0801101), the National Major Project of Science and Technology Ministry of China (2017ZX07202-004-03), National Natural Science Foundation of China (D070106) and Jiangsu Agriculture Science and Technology Innovation Fund, China (CX (19)1007).

Reference

Journal Pre-proof

Abd-Elwahed, M.S., 2018. Influence of long-term wastewater irrigation on soil quality and its spatial distribution. Ann. Agric. Sci. 63, 191–199. https://doi.org/10.1016/j.aoas.2018.11.004 Abe, K., Komada, M., Ookuma, A., 2008. Efficiency of removal of nitrogen, phosphorus, and zinc from domestic wastewater by a constructed wetland system

of

in rural areas: a case study. Water Sci. Technol. 58, 2427–2433. https://doi.org/10.2166/wst.2008.570

ro

Agrafioti, E., Diamadopoulos, E., 2012. A strategic plan for reuse of treated

-p

municipal wastewater for crop irrigation on the Island of Crete. Agric. Water

re

Manag. 105, 57–64. https://doi.org/10.1016/j.agwat.2012.01.002

na

solaire.

lP

Arpke, A., Clerico, E., n.d. Water reuse within green buildings: A case study of the

Attwater, R., Booth, S., Guthrie, A., 2005. The role of contestable concepts in

Jo ur

transdisciplinary management of water in the landscape. Syst. Res. Behav. Sci. 22, 185–192. https://doi.org/10.1002/sres.668 Bahri, A., 1999. Agricultural reuse of wastewater and global water management. Water Sci. Technol. 40, 339–346. https://doi.org/10.1016/S0273-1223(99)00516-8 Behrens, S., Azizian, M.F., McMurdie, P.J., Sabalowsky, A., Dolan, M.E., Semprini, L., Spormann, A.M., 2008. Monitoring abundance and expression of ―Dehalococcoides‖ species chloroethene-reductive dehalogenases in a tetrachloroethene-dechlorinating flow column. Appl. Environ. Microbiol. 74,

Journal Pre-proof

5695–5703. https://doi.org/10.1128/aem.00926-08 Bixio, D., Thoeye, C., Wintgens, T., Ravazzini, A., Miska, V., Muston, M., Chikurel, H., Aharoni, A., Joksimovic, D., Melin, T., 2008. Water reclamation and reuse: implementation and management issues. Desalination 218, 13–23. https://doi.org/10.1016/j.desal.2006.10.039

of

Bu, R., Ren, T., Lei, M., Liu, B., Li, X., Cong, R., Zhang, Y., Lu, J., 2020. Tillage and straw-returning practices effect on soil dissolved organic matter, aggregate

ro

fraction and bacteria community under rice-rice-rapeseed rotation system. Agric.

-p

Ecosyst. Environ. 287, 106681. https://doi.org/10.1016/j.agee.2019.106681

re

Cai, L., Chen, T.-B., Zheng, S.-W., Liu, H.-T., Zheng, G.-D., 2018. Decomposition of

lP

lignocellulose and readily degradable carbohydrates during sewage sludge

na

biodrying, insights of the potential role of microorganisms from a metagenomic analysis. Chemosphere 201, 127–136.

Jo ur

https://doi.org/10.1016/j.chemosphere.2018.02.177 Cai, Y., Ding, W., Luo, J., 2013. Nitrous oxide emissions from Chinese maize-wheat rotation systems: A 3-year field measurement. Atmos. Environ. 65, 112–122. https://doi.org/10.1016/j.atmosenv.2012.10.038 Chen, R., Lin, X., Wang, Y., Hu, J., 2011. Mitigating methane emissions from irrigated paddy fields by application of aerobically composted livestock manures in eastern China. Soil Use Manag. 27, 103–109. https://doi.org/10.1111/j.1475-2743.2010.00316.x Chen, S., Hao, T., Goulding, K., Misselbrook, T., Liu, X., 2019. Impact of 13-years of

Journal Pre-proof

nitrogen addition on nitrous oxide and methane fluxes and ecosystem respiration in a temperate grassland. Environ. Pollut. 252, 675–681. https://doi.org/10.1016/j.envpol.2019.03.069 Chen, Y., Cheng, J.J., Creamer, K.S., 2008. Inhibition of anaerobic digestion process: A review. Bioresour. Technol. 99, 4044–4064.

of

https://doi.org/10.1016/j.biortech.2007.01.057 Dang, Q., Tan, W., Zhao, X., Li, D., Li, Y., Yang, T., Li, R., Zu, G., Xi, B., 2019.

ro

Linking the response of soil microbial community structure in soils to long-term

-p

wastewater irrigation and soil depth. Sci. Total Environ. 688, 26–36.

re

https://doi.org/10.1016/j.scitotenv.2019.06.138

lP

Djalante, R., 2019. Key assessments from the IPCC special report on global warming

na

of 1.5 °C and the implications for the Sendai framework for disaster risk reduction. Prog. Disaster Sci. 1, 100001.

Jo ur

https://doi.org/10.1016/j.pdisas.2019.100001 Du Pisani, P.L., 2006. Direct reclamation of potable water at Windhoek’s Goreangab reclamation plant. Desalination 188, 79–88. https://doi.org/10.1016/j.desal.2005.04.104 Groot, T.T., van Bodegom, P.M., Harren, F.J.M., Meijer, H.A.J., 2003. Quantification of methane oxidation in the rice rhizosphere using C-13-labelled methane. Biogeochemistry 64, 355–372. https://doi.org/10.1023/a:1024921714852 Hao, M., Hu, H., Liu, Z., Dong, Q., Sun, K., Feng, Y., Li, G., Ning, T., 2019. Shifts in microbial community and carbon sequestration in farmland soil under long-term

Journal Pre-proof

conservation tillage and straw returning. Appl. Soil Ecol. 136, 43–54. https://doi.org/10.1016/j.apsoil.2018.12.016 He, W., Kim, Y., Ko, D., Yun, S., Jun, S., Yoo, G., 2019. Changes in soil N2O and CH4 emissions and related microbial functional groups in an artificial CO2 gassing experiment. Sci. Total Environ. 690, 40–49.

of

https://doi.org/10.1016/j.scitotenv.2019.06.400 Hirota, M., Tang, Y.H., Hu, Q.W., Hirata, S., Kato, T., Mo, W.H., Cao, G.M., Mariko,

ro

S., 2004. Methane emissions from different vegetation zones in a

-p

Qinghai-Tibetan Plateau wetland. Soil Biol. Biochem. 36, 737–748.

re

https://doi.org/10.1016/j.soilbio.2003.12.009

lP

Hong, Y., Huang, G., An, C., Song, P., Xin, X., Chen, X., Zhang, P., Zhao, Y., Zheng,

na

R., 2019. Enhanced nitrogen removal in the treatment of rural domestic sewage using vertical-flow multi-soil-layering systems: Experimental and modeling

Jo ur

insights. J. Environ. Manage. 240, 273–284. https://doi.org/10.1016/j.jenvman.2019.03.097 Huang, R., Wang, Y., Liu, J., Li, J., Xu, G., Luo, M., Xu, C., Ci, E., Gao, M., 2019. Variation in N2O emission and N2O related microbial functional genes in strawand biochar-amended and non-amended soils. Appl. Soil Ecol. 137, 57–68. https://doi.org/10.1016/j.apsoil.2019.01.010 Ibekwe, A.M., Gonzalez-Rubio, A., Suarez, D.L., 2018. Impact of treated wastewater for irrigation on soil microbial communities. Sci. Total Environ. 622–623, 1603– 1610. https://doi.org/10.1016/j.scitotenv.2017.10.039

Journal Pre-proof

Jin, L., Zhang, G., Tian, H., 2014. Current state of sewage treatment in China. Water Res. 66, 85–98. https://doi.org/10.1016/j.watres.2014.08.014 Kim, S.-W., Miyahara, M., Fushinobu, S., Wakagi, T., Shoun, H., 2010. Nitrous oxide emission from nitrifying activated sludge dependent on denitrification by ammonia-oxidizing bacteria. Bioresour. Technol. 101, 3958–3963.

of

https://doi.org/10.1016/j.biortech.2010.01.030 Kim, S.Y., Veraart, A.J., Meima-Franke, M., Bodelier, P.L.E., 2015. Combined

ro

effects of carbon, nitrogen and phosphorus on CH4 production and

-p

denitrification in wetland sediments. Geoderma 259, 354–361.

re

https://doi.org/10.1016/j.geoderma.2015.03.015

lP

Landman, W., 2010. Climate change 2007: the physical science basis. South African

na

Geogr. J. 92, 86–87. https://doi.org/10.1080/03736245.2010.480842 Li, B., Cao, Y., Guan, X., Li, Y., Hao, Z., Hu, W., Chen, L., 2019. Microbial

Jo ur

assessments of soil with a 40-year history of reclaimed wastewater irrigation. Sci. Total Environ. 651, 696–705. https://doi.org/10.1016/j.scitotenv.2018.09.193 Li, H., Dai, M., Dai, S., Dong, X., 2018. Current status and environment impact of direct straw return in China’s cropland–A review. Ecotoxicol. Environ. Saf. 159, 293–300. https://doi.org/10.1016/j.ecoenv.2018.05.014 Liu, Y., Xue, L., Yang, L., Wang, Y., 2018. Effects of sewage irrigation on growth of rice seedlings and soil environment with straw incorporation. Chinese J. Appl. Ecol. 29, 2739-2745 in Chinese. https://doi.org/10.13287/j.1001－ 9332.201808.034

Journal Pre-proof

López-Vinent, N., Cruz-Alcalde, A., Malvestiti, J.A., Marco, P., Giménez, J., Esplugas, S., 2020. Organic fertilizer as a chelating agent in photo-Fenton at neutral pH with LEDs for agricultural wastewater reuse: micropollutant abatement and bacterial inactivation. Chem. Eng. J. 124246. https://doi.org/10.1016/j.cej.2020.124246

of

Lydmark, P., Almstrand, R., Samuelsson, K., Mattsson, A., Sorensson, F., Lindgren, P.-E., Hermansson, M., 2007. Effects of environmental conditions on the

ro

nitrifying population dynamics in a pilot wastewater treatment plant. Environ.

-p

Microbiol. 9, 2220–2233. https://doi.org/10.1111/j.1462-2920.2007.01336.x

re

Ma, J., Li, X.L., Xu, H., Han, Y., Cai, Z.C., Yagi, K., 2007. Effects of nitrogen

lP

fertiliser and wheat straw application on CH4 and N2O emissions from a paddy

na

rice field. Aust.j.soil Res 45, 359–367. https://doi.org/10.1071/SR07039 Ma, J., Ma, E., Xu, H., Yagi, K., Cai, Z., 2009. Wheat straw management affects CH4

Jo ur

and N2O emissions from rice fields. Soil Biol. Biochem. 41, 1022–1028. https://doi.org/10.1016/j.soilbio.2009.01.024 Ma, Y., Liu, D.L., Schwenke, G., Yang, B., 2019. The global warming potential of straw-return can be reduced by application of straw-decomposing microbial inoculants and biochar in rice-wheat production systems. Environ. Pollut. 252, 835–845. https://doi.org/10.1016/j.envpol.2019.06.006 Ma, Z., Xue, L., Pan, F., Xu, S., Gao, Q., Yang, L., 2016. Utilization of nitrogen in wasterwater low in pollution degree in paddy fields and its effect on reducing fertilizer application in Tai Lake region. J. Ecol. Rural Environ. 32, 570–576.

Journal Pre-proof

https://doi.org/10.11934/j.issn.1637-4831.2016.04.009 Minhas, P.S., Khajanchi, L., Yadav, R.K., Dubey, S.K., Chaturvedi, R.K., 2015. Long term impact of waste water irrigation and nutrient rates: I. Performance, sustainability and produce quality of peri urban cropping systems. Agric. Water Manag. 156, 100–109. https://doi.org/10.1016/j.agwat.2015.03.012

of

Moseman-Valtierra, S., Gonzalez, R., Kroeger, K.D., Tang, J., Chao, W.C., Crusius, J., Bratton, J., Green, A., Shelton, J., 2011. Short-term nitrogen additions can

ro

shift a coastal wetland from a sink to a source of N2O. Atmos. Environ. 45,

-p

4390–4397. https://doi.org/10.1016/j.atmosenv.2011.05.046

re

Otawa, K., Asano, R., Ohba, Y., Sasaki, T., Kawamura, E., Koyama, F., Nakamura, S.,

lP

Nakai, Y., 2006. Molecular analysis of ammonia-oxidizing bacteria community

na

in intermittent aeration sequencing batch reactors used for animal wastewater treatment. Environ. Microbiol. 8, 1985–1996.

Jo ur

https://doi.org/10.1111/j.1462-2920.2006.01078.x Painter, J. author C.N.-070. 449551. 23 B.L.H.D.R.T.E.D. 47070., 2013. Climate change in the media : reporting risk and uncertainty. Petit, J.-R., Jouzel, J., Raynaud, D., Barkov, N.I., Barnola, J.-M., Basile, I., Bender, M., Chappellaz, J., Davis, M., Delaygue, G., 1999. Climate and atmospheric history of the past 420,000 years from the Vostok ice core, Antarctica. Nature 399, 429. https://doi.org/https://www.nature.xiles Reznik, A., Feinerman, E., Finkelshtain, I., Fisher, F., Huber-Lee, A., Joyce, B., Kan, I., 2017. Economic implications of agricultural reuse of treated wastewater in

Journal Pre-proof

Israel: A statewide long-term perspective. Ecol. Econ. 135, 222–233. https://doi.org/10.1016/j.ecolecon.2017.01.013 Saliba, R., Callieris, R., D’Agostino, D., Roma, R., Scardigno, A., 2018. Stakeholders’ attitude towards the reuse of treated wastewater for irrigation in Mediterranean agriculture. Agric. Water Manag. 204, 60–68.

of

https://doi.org/10.1016/j.agwat.2018.03.036 Sánchez-Rodríguez, A.R., Chadwick, D.R., Tatton, G.S., Hill, P.W., Jones, D.L.,

ro

2018. Comparative effects of prolonged freshwater and saline flooding on

-p

nitrogen cycling in an agricultural soil. Appl. Soil Ecol. 125, 56–70.

re

https://doi.org/10.1016/j.apsoil.2017.11.022

lP

Schutz, H., Seiler, W., Conrad, R., 1989. Process involved in formation and emission

na

of methane in rice paddies. Biogeochemistry 7, 33–53. https://doi.org/10.1007/BF00000896

Jo ur

Sgroi, M., Vagliasindi, F.G.A., Roccaro, P., 2018. Feasibility, sustainability and circular economy concepts in water reuse. Curr. Opin. Environ. Sci. Heal. 2, 20– 25. https://doi.org/10.1016/j.coesh.2018.01.004 Walkiewicz, A., Brzezińska, M., 2019. Interactive effects of nitrate and oxygen on methane oxidation in three different soils. Soil Biol. Biochem. 133, 116–118. https://doi.org/10.1016/j.soilbio.2019.03.001 Wang, C., Zhu, G., Wang, Y., Wang, S., Yin, C., 2013. Nitrous oxide reductase gene (nosZ) and N2O reduction along the littoral gradient of a eutrophic freshwater lake. J. Environ. Sci. 25, 44–52. https://doi.org/10.1016/S1001-0742(12)60005-9

Journal Pre-proof

Wang, T., Zhu, B., Zhou, M., 2019. Ecological ditch system for nutrient removal of rural domestic sewage in the hilly area of the central Sichuan Basin, China. J. Hydrol. 570, 839–849. https://doi.org/10.1016/j.jhydrol.2019.01.034 Watanabe, T., Kimura, M., Asakawa, S., 2006. Community structure of methanogenic archaea in paddy field soil under double cropping (rice–wheat). Soil Biol.

of

Biochem. 38, 1264–1274. https://doi.org/10.1016/j.soilbio.2005.09.020 Water, U.N., 2017. The United Nations World Water Development Report 2017:

ro

wastewater the untapped resource.

-p

Wu, D., Wei, Z., Well, R., Shan, J., Yan, X., Bol, R., Senbayram, M., 2018. Straw

re

amendment with nitrate-N decreased N2O/(N2O+N2) ratio but increased soil

lP

N2O emission: A case study of direct soil-born N2 measurements. Soil Biol.

na

Biochem. 127, 301–304. https://doi.org/10.1016/j.soilbio.2018.10.002 Xie, W.-M., Ni, B.-J., Li, W.-W., Sheng, G.-P., Yu, H.-Q., Song, J., 2012. Formation

Jo ur

and quantification of soluble microbial products and N2O production by ammonia-oxidizing bacteria (AOB)-enriched activated sludge. Chem. Eng. Sci. 71, 67–74. https://doi.org/10.1016/j.ces.2011.12.032 Xu, S., Hou, P., Xue, L., Wang, S., Yang, L., 2017a. Treated domestic sewage irrigation significantly decreased the CH4, N2O and NH3 emissions from paddy fields with straw incorporation. Atmos. Environ. 169, 1–10. https://doi.org/10.1016/j.atmosenv.2017.09.009 Xu, S., Hou, P., Xue, L., Wang, S., Yang, L., 2017b. Treated domestic sewage irrigation significantly decreased the CH4, N2O and NH3 emissions from paddy

Journal Pre-proof

fields with straw incorporation. Atmos. Environ. 169, 1–10. https://doi.org/10.1016/j.atmosenv.2017.09.009 Xu, Y., Naidoo, A.R., Zhang, X.-F., Meng, X.-Z., 2019. Optimizing sampling strategy for Chinese National Sewage Sludge Survey (CNSSS) based on urban agglomeration, wastewater treatment process, and treatment capacity. Sci. Total

of

Environ. 696, 133998. https://doi.org/10.1016/j.scitotenv.2019.133998 Yadav, R.K., Goyal, B., Sharma, R.K., Dubey, S.K., Minhas, P.S., 2002.

ro

Post-irrigation impact of domestic sewage effluent on composition of soils, crops

-p

and ground water—A case study. Environ. Int. 28, 481–486.

re

https://doi.org/10.1016/S0160-4120(02)00070-3

lP

Yang, J., Liu, X., Ying, L., Chen, X., Li, M., 2019. Correlation analysis of

na

environmental treatment, sewage treatment and water supply efficiency in China. Sci. Total Environ. 135128. https://doi.org/10.1016/j.scitotenv.2019.135128

Jo ur

Yoon, S., Nissen, S., Park, D., Sanford, R.A., Löffler, F.E., 2016. Nitrous oxide reduction kinetics distinguish bacteria harboring clade I NosZ from those harboring clade II NosZ. Appl. Environ. Microbiol. 82, 3793–3800. https://doi.org/10.1128/AEM.00409-16 Yuan, J., Yuan, Y., Zhu, Y., Cao, L., 2018. Effects of different fertilizers on methane emissions and methanogenic community structures in paddy rhizosphere soil. Sci. Total Environ. 627, 770–781. https://doi.org/10.1016/j.scitotenv.2018.01.233 Zhang, X.-Y., Zhang, G.-B., Ji, Y., Ma, J., Xu, H., Cai, Z.-C., 2012. Straw Application Altered CH4 Emission, Concentration and C-13-Isotopic Signature

Journal Pre-proof

of Dissolved CH4 in a Rice Field. Pedosphere 22, 13–21. https://doi.org/10.1016/s1002-0160(11)60187-2 Zhang, Y.L., Dai, J.L., Wang, R.Q., Zhang, J., 2008. Effects of long-term sewage irrigation on agricultural soil microbial structural and functional characterizations in Shandong, China. Eur. J. Soil Biol. 44, 84–91.

of

https://doi.org/10.1016/j.ejsobi.2007.10.003 Zhang, Z.S., Guo, L.J., Liu, T.Q., Li, C.F., Cao, C.G., 2015. Effects of tillage

ro

practices and straw returning methods on greenhouse gas emissions and net

-p

ecosystem economic budget in rice–wheat cropping systems in central China.

re

Atmos. Environ. 122, 636–644. https://doi.org/10.1016/j.atmosenv.2015.09.065

lP

Zhou, B., Duan, J., Xue, L., Zhang, J., Yang, L., 2019. Effect of plant-based carbon

na

source supplements on denitrification of synthetic wastewater: focus on the microbiology. Environ. Sci. Pollut. Res. 26, 24683–24694.

Jo ur

https://doi.org/10.1007/s11356-019-05454-x Zhou, Y., Zhang, Y., Tian, D., Mu, Y., 2017. The influence of straw returning on N2O emissions from a maize-wheat field in the North China Plain. Sci. Total Environ. 584–585, 935–941. https://doi.org/10.1016/j.scitotenv.2017.01.141 Zou, J., Liu, S., Qin, Y., Pan, G., Zhu, D., 2009. Sewage irrigation increased methane and nitrous oxide emissions from rice paddies in southeast China. Agric. Ecosyst. Environ. 129, 516–522. https://doi.org/10.1016/j.agee.2008.11.006 Zou, J.W., Huang, Y., Jiang, J.Y., Zheng, X.H., Sass, R.L., 2005. A 3-year field measurement of methane and nitrous oxide emissions from rice paddies in China:

Journal Pre-proof

Effects of water regime, crop residue, and fertilizer application. Global

Jo ur

na

lP

re

-p

ro

of

Biogeochem. Cycles 19. https://doi.org/10.1029/2004gb002401

Journal Pre-proof Fig 1. CH4 flux under different treatments. Error bars represent the standard deviation (SD) for three replications.

Fig. 2 N2O flux under different treatments. Error bars represent the standard deviation (SD) for three replications.

of

Fig. 3 GWP of different treatments. Error bars represent the standard deviation (SD) for three replications and different lowercase letters indicate significant differences among the treatments (P<0.05)

ro

Fig. 4 (a) Gene copies of methanogens and methanotrophs under different treatments at 21

-p

days after transplanting. (b) Methanogens/methanotrophs under different treatments at 21 days after transplanting. Error bars represent the standard deviation (SD) for three

re

replications. Different lowercase letters indicate significant differences among the treatments

lP

(P<0.05).

na

Fig. 5 AOA and AOB gene copies under different treatments at 83 days after transplanting. Error bars represent the standard deviation (SD) for three replications. Different lowercase

Jo ur

letters indicate significant differences among the treatments (P<0.05).

Fig. 6 Denitrification functional gene copies under different treatments at 83 days after transplanting: (a) nirS, (b) nirK, and (c) nosZ. Error bars represent the standard deviation (SD) for three replications and different lowercase letters indicate significant differences among the treatments (P<0.05)

Journal Pre-proof Table 1: Properties of the experimental domestic sewage TN

NH4+-N

NO3−-N

TP

COD

(mg/L)

(mg/L)

(mg/L)

(mg/L)

(mg/L)

pH

Untreated domestic water

9.64

28.89

17.71

0.02

2.63

6.9

Treated domestic water

9.85

9.12

1.28

6.49

0.03

28.2

Table 2: Fertilization application of each treatment Basal N application Tiller N application

Panicle N

TN application

application (kg/ha)

(kg/ha)

SW1N1

82

74

SW1N0

10

12

SW2N1

78

78

SW2N0

6

12

STN1

72

STN0

0

TN1

72

TN0

0

84

29

84

240

8

26

72

96

240

0

0

0

72

96

240

0

0

0

-p

7

lP na

240

ro

(kg/ha)

re

(kg/ha)

of

Treatments

Jo ur

SW1N1, straw-returning + untreated domestic sewage irrigation + urea; SW1N0, straw-returning + untreated domestic sewage irrigation; SW2N1, straw-returning + treated domestic sewage irrigation + urea; SW2N0, straw-returning + treated domestic sewage; STN1, straw-returning + tap water irrigation + urea; STN0, straw-returning + tap water irrigation; TN1, tap water irrigation + urea; TN0, tap water irrigation without straw and urea

Journal Pre-proof

Table 3: Primers used for PCR amplification Target gene

Primer

Sequence ((5′ →3′)a

Thermal profile for qPCR

Reference

1106 F 1378 R

TTWAGTCAGGCAACGAGC TGTGCAAGGAGCAGGGAC

95℃ for 10 s, 50 cycles of 95℃ for 10 s, 57℃ for 10 s, 72℃ for 6 s

(Watanabe et al., 2007)

A189 F Mb661 R

GGNGACTGGGACTTCTGG CCGGMGCAACGTCYTTACC

95℃ for 3 min, and 42 cycles of 95℃ for 30 s, 63℃ for 45 s, 72℃ for 30 s

(Feng et al., 2012)

archaeal amoA gene

Arch-amoAF Arch-amoAR

STAATGGTCTGGCTTAGACG GCGGCCATCCATCTGTATGT

94℃ for 1min, and 40 cycles of 94℃ for 10 s, 55℃ for 30 s, 72℃ for 60 s

(Francis et al., 2005)

bacterial amoA gene

amoA-1F amoA-2R

GGGGTTTCTACTGGTGGT CCCCTCKGSAAAGCCTTCTTC

95℃ for 1min, and 40 cycles of 95℃ for 10 s, 57℃ for 30 s, 72℃ for 60 s

(Rotthauwe et al., 1997)

nirK-1F nirK-5R cd3aF R3cd nosZ-F nosZ-R

GGMATGGTKCCSTGGCA GCCTCGATCAGRTTRTGGTT GTSAACGTSAAGGARACSGG GASTTCGGRTGSGTCTTGA CGYTGTTCMTCGACAGCCAG CGSACCTTSTTGCCSTYGCG

16S rRNA pmoA

nirK nirS nosZ a

l a

o J

n r u

f o

o r p

r P

e

95 °C for 5 min, and 40 cycles of 95 °C for 30 s, 58 °C for 40 s, 72 °C for 40 s 95 °C for 2 min, and 40 cycles of 95 °C for 5 s, 62 °C for 40 s, 72 °C for 35 s 95 °C for 1 min, and 40 cycles of 95 °C for 15 s, 62 °C for 15 s, 72 °C for 31 s

Y = C or T; V = A, C, or G; S = C or G; N = A, C, T, or G; D = A, G, or T; M = A or C; K = G or T; R = A or G

(Xu et al., 2014) (Xu et al., 2014) (Xu et al., 2014)

Journal Pre-proof

Table 4: Cumulative CH4 and N2O emission of different treatments Cumulative CH4 emission (kg/ha)

Cumulative N2O emission (kg/ha)

After field drying

Total

Before field drying After field drying

TN0

2.36±1.33 c

6.87±2.27 e

9.23±3.31d

-0.01±0.02 a

0.20±0.43 bc

0.19±0.40 bc

STN0

180.06±9.42 a

138.01±17.90 a

318.08±21.80 a

0.17±0.03 a

1.01±0.33 abc

1.18±0.36 abc

SW1N0

77.71±3.86 bc

124.51±24.99 ab

201.63±21.80 bc

-0.09±0.09 a

-0.33±0.44 c

-0.41±0.49 c

SW2N0

135.81±47.78 ab

58.77±22.78 cd

194.58±69.88 bc

0.19±0.12 a

TN1

0.25±0.71 c

4.56±3.05 e

4.81±2.83 d

STN1

170.26±34.78 a

86.95±9.04 bc

257.20±39.20 ab

SW1N1

148.15±34.23 ab

78.06±1.98 c

226.21±32.34 ab

SW2N1

82.13±15.25 b

26.34±4.23de

of

Before field drying

re

Treatment

0.87±0.15 bc

0.19±0.07 a

0.54±0.06 bc

0.73±0.05 bc

0.14±0.22 a

0.75±0.12 bc

0.89±0.29 bc

0.20±0.08 a

2.79±1.16 a

2.99±1.09 a

0.20±0.15 a

1.87±0.94 ab

2.07±1.07 ab

ro

0.68±0.12 bc

-p

108.47±18.67 cd

Total

lP

Mean ± standard error (n = 3). Different alphabets in the same column mean significant difference at P < 0.05.

MPB/MOB

Cumulative N2O

0.478*

MPB

MOB

AOA

AOB

nirK

nirS

nosZ

0.463*

0.236

-0.0.085

0.301

0.021

-0.035

-0.011

−0.193

−0.444*

−0.355

0.294

−0.112

0.183

Jo ur

Cumulative CH4

na

Table 5: Correlation of cumulative GHG emission and functional gene copies

−0.226

−0.275

Cumulative means the total emission in the rice-growing period. MPB: Methanogens, MOB: Methanotrophs.

*Significant correlation at P < 0.05.

Reference: Feng, Y., Xu, Y., Yu, Y., Xie, Z., Lin, X., 2012. Mechanisms of biochar decreasing methane emission from Chinese paddy soils. Soil Biol. Biochem. 46, 80–88. https://doi.org/https://doi.org/10.1016/j.soilbio.2011.11.016 Francis, C.A., Roberts, K.J., Beman, J.M., Santoro, A.E., Oakley, B.B., 2005. Ubiquity and diversity of ammonia-oxidizing archaea in water columns and sediments of the ocean. Proc.

Journal Pre-proof

Natl. Acad. Sci. U. S. A. 102, 14683–14688. https://doi.org/10.1073/pnas.0506625102 Rotthauwe, J.H., Witzel, K.P., Liesack, W., 1997. The ammonia monooxygenase structural gene amoA as a functional marker: Molecular fine-scale analysis of natural ammonia-oxidizing populations. Appl. Environ. Microbiol. 63, 4704–4712. https://doi.org/10.1128/aem.63.12.4704-4712.1997

of

Watanabe, T., Kimura, M., Asakawa, S., 2007. Dynamics of methanogenic archaeal communities

ro

based on rRNA analysis and their relation to methanogenic activity in Japanese paddy field soils. Soil Biol. Biochem. 39, 2877–2887.

-p

https://doi.org/https://doi.org/10.1016/j.soilbio.2007.05.030

re

Xu, H.-J., Wang, X.-H., Li, H., Yao, H.-Y., Su, J.-Q., Zhu, Y.-G., 2014. Biochar impacts soil

lP

microbial community composition and nitrogen cycling in an acidic soil planted with rape.

Jo ur

na

Environ. Sci. Technol. 48, 9391–9399. https://doi.org/10.1021/es5021058

Journal Pre-proof Declaration of interests

☒ The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Jo ur

na

lP

re

-p

ro

may be considered as potential competing interests:

of

☐The authors declare the following financial interests/personal relationships which

Journal Pre-proof

Highlights

Treated domestic sewage(W2) irrigation significantly decreased CH4 emissions.



Treated domestic sewage significantly decreased methanogens / methanotrophs.



Untreated domestic sewage(W1) significantly increased N2O emissions



W2 and W1 irrigation could reduce the GWP by 66.7% and 2%, respectively.

Jo ur

na

lP

re

-p

ro

of



Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6