Effects of dopamine on growth, carbon metabolism, and nitrogen metabolism in cucumber under nitrate stress

Scientia Horticulturae 260 (2020) 108790

Contents lists available at ScienceDirect

Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti

Effects of dopamine on growth, carbon metabolism, and nitrogen metabolism in cucumber under nitrate stress Guangpu Lan, Congjian Jiao, Gaiqing Wang, Yinhan Sun, Yan Sun

T

⁎

State Key Laboratory of Crop Stress Biology for Arid Areas, College of Horticulture, Northwest A&F University, Yangling, Shaanxi 712100, China

A R T I C LE I N FO

A B S T R A C T

Keywords: Dopamine Nitrate stress Carbon metabolism Nitrogen metabolism

Dopamine, which is a catecholamine neurotransmitter, is widely present in plant organs. The accumulation of soil nitrate limits the growth of plants. We investigated the role of dopamine in regulating the growth, carbon metabolism, and nitrogen metabolism in cucumber (Cucumis sativus L. “Jin You No. 1”) under nitrate stress. Under nitrate stress, plants showed significant reductions in growth, chlorophyll concentrations, chlorophyll fluorescence and gas exchange parameters. However, dopamine markedly alleviated such reductions. Excess nitrate led to an increase in sucrose phosphate synthase, acid invertase, and neutral invertase activity, but decreased sucrose synthase activity. Similarly, the expression of the CsSPS4 gene was also up-regulated and the expression of the CsSUS3 gene was down-regulated under nitrate stress. Dopamine significantly increased the activity and gene expression of these enzymes. The CsNRT1.1 gene was up-regulated under nitrate conditions. Dopamine significantly alleviated the accumulation of nitrate nitrogen and ammonium nitrogen under nitrate conditions. Nitrate reductase activity and the expression of the CsNR1 gene were significantly inhibited due to exposure to excess nitrate. We found that glutamine synthetase activity decreased and glutamate dehydrogenase activity increased after nitrate induction, which indicated that ammonium assimilation relied mainly on glutamate dehydrogenase pathway rather than glutamine synthetase/glutamate synthase cycle under nitrate stress. Dopamine significantly enhanced the activity of enzymes and gene expression of nitrogen metabolism. Our results indicated that dopamine plays an important role in mediating plant growth, carbon metabolism, and nitrogen metabolism.

1. Introduction

Some experiments have shown that catecholamines interact with other hormones. Dopamine can promote the growth of tobacco (Nicotiana tabacum) thin cell layers in media supplemented with indoleacetic acid and kinetin, the growth-promoting effect of dopamine is due to its inhibition of IAA degradation, resulting in higher levels of auxin (Protacio et al., 1992). In previous reports, (Kamisaka, 1979) shown that dopamine, epinephrine, norepinephrine and 3,4-dihydroxymandelic acid enhanced the promoting effect of gibberellin on lettuce (Lactuca saliva L. cv. Grand Rapi) hypocotyl elongation. Dopamine was identified as a strong water-soluble antioxidant, and melanin as its oxidation production was also a potent free radical scavenger (Kulma and Szopa, 2007). Therefore, it is possible that catecholamines regulate plant responses to different stress conditions. For example, at higher NaCl-concentrations, increasing amounts of L-DOPA are detected in the medium. catecholamine influence on plant sugar metabolism (Wichers et al., 1993). Swiedrych et al. (2004a) investigated catecholamine biosynthetic pathway in potato (Solanum. tuberosum L. cv. Desiree) plants exposed to high salt, drought, UV light,

Dopamine (DA), which is a catecholamine neurotransmitter, was first discovered in the mammalian brain. Mieko (1968) discovered that catecholamines were widely present in organs and tissues of 44 plants. Catecholamines also include norepinephrine, adrenaline and its derivatives, and dopamine is the precursor of these substances. Dopamine produces norepinephrine that is catalyzed by dopamine-β-hydroxylase, then phenylethanolamine-N-methyltransferase catalyzes the synthesis of epinephrine by norepinephrine (Zhang and Li, 2008). In plants, the dopamine synthesis substrate is tyrosine. It’s synthesized in two main ways. In the first path, tyrosine hydroxylase (TH) catalyzes the hydroxylation of tyrosine to form dopa and decarboxylation by dopa decarboxylase (DD) forms dopamine; the second path is started by substrate decarboxylation driven by tyrosine decarboxylase (TD) and results in tyramine production, which is then hydroxylated to form dopamine under the action of monoamine hydroxylase (Kulma and Szopa, 2007).

⁎

Corresponding author at: Taicheng Road No. 3, College of Horticulture, Northwest A&F University, Yangling, Shaanxi, 712100, China. E-mail address: [email protected] (Y. Sun).

https://doi.org/10.1016/j.scienta.2019.108790 Received 8 April 2019; Received in revised form 17 August 2019; Accepted 20 August 2019 0304-4238/ © 2019 Published by Elsevier B.V.

Scientia Horticulturae 260 (2020) 108790

G. Lan, et al.

after transplanting, we applied 1 L of dopamine solution to each seedling at a time by root irrigation. After the pretreatment period was completed, we applied 1 L of nitrate solution to each seedling only once by root irrigation. Each treatment was repeated three times for a total of 30 seedlings. On day 30 of the nitrate treatment, growth parameters, chlorophyll fluorescence, and gas exchange parameters were measured. On day 30 of the nitrate treatment, leaves were collected from selected plants in each treatment group to analyze chlorophyll content, nitrate nitrogen, ammonium nitrogen, and enzymes and genes involved in carbon and nitrogen metabolism. All samples were frozen rapidly in liquid nitrogen and stored at −80 °C. The following ten treatments were used: “LN0”: 0 μmol/L DA + 50 mmol/L nitrate (control group); “LN50”: 50 μmol/L DA + 50 mmol/L nitrate; “LN100”: 100 μmol/L DA + 50 mmol/L nitrate; “LN150”: 150 μmol/L DA + 50 mmol/L nitrate; “LN200”: 200 μmol/L DA + 50 mmol/L nitrate; “HN0”: 0 μmol/L DA + 500 mmol/L nitrate; “HN50”: 50 μmol/L DA + 500 mmol/L nitrate; “HN100”: 100 μmol/LDA + 500 mmol/L nitrate; “HN150”: 150 μmol/L DA + 500 mmol/L nitrate; “HN200”: 200 μmol/L DA + 500 mmol/L nitrate.

and cold stress conditions and suggested that catecholamines are involved in plant responses to stress Catecholamines play an important role in regulation of sugar metabolism in plants. The significant increase in glucose and sucrose and the decrease in starch content were characteristic features of TD overexpressed transgenic potato (Solanum tuberosum L. cv. Desiree) tubers (Swiedrych et al., 2004b). Skirycz et al. (2005) transformed potato (Solanum tuberosum L. cv. Desiree) plants with a cDNA encoding human dopamine receptor (HD1) and found that catecholamine regulated key enzyme activities in carbon metabolism and changes in sugar content. Therefore, dopamine may help plants to resist nitrate stress in plants through hormone interaction, antioxidant regulation or carbohydrate metabolism. Nitrogen is an essential macronutrient that affects plant growth and development. Nitrate is the main inorganic nitrogen absorbed and utilized by plants. Unfortunately, extensively applying nitrogen fertilizer for high yield has caused soil salt accumulation annually on Chinese agricultural lands (Yang et al., 2010a). Among them, NO3― was the most abundant anion accumulated in protected soil, which caused secondary salinization (Huang et al., 2011). Excess nitrogen inhibits the growth and development of cultivated crops, and the yield and quality are reduced (Xu et al., 2012a; Nishikawa et al., 2010). Plants are subject to osmotic stress, single salt toxicity, and oxidation reactions due to high concentrations of salt (Xu et al., 2013). This causes plant water stress, which closes the stomata of the leaves to maintain a relatively high water potential in the mesophyll cells (Gao et al., 2014), but this also seriously hinders the entry of CO2 into the mesophyll (Lechno et al., 1997) and reduces the photosynthesis and photosynthetic electron transport in plants (Kalaji et al., 2016). Osmotic adjustment substances in plants include inorganic ions such as K+ and organic substances such as proline and betaine (Mansour and Salama, 2004). When a plant is in a single ionic solution, a single salt toxic phenomenon occurs, that affects plant growth. Under salt stress, this phenomenon also caused the oxidative stress reaction of the plant itself, which led to the accumulation of reactive oxygen species (Liu et al., 2012; Zheng et al., 2016). In China, cucumber (Cucumis sativus L.) is one of the most widely cultivated vegetables. However, soil salinization has severely restricted the development of the cucumber cultivation industry (Yang et al., 2010b). Earlier research demonstrated that dopamine is involved in stress and regulates carbon metabolism in plant (Swiedrych et al., 2004a, b). But little is known about the effects of dopamine and nitrate on physiological mechanisms in cucumber. We hypothesized that dopamine may respond to nitrate stress by regulating carbon metabolism and nitrogen metabolism in cucumber. In order to verify this hypothesis, we employed field-pot trials to determine whether pretreatment with dopamine could alleviate nitrate-induced stress in plants of cucumber. Therefore, we explored plant morphology index, photosynthesis, carbon metabolism, and nitrogen metabolism, looking for the physiological role and mechanism of dopamine against nitrate stress.

2.2. Growth parameters and seedling index On day 30 of the nitrate treatment, shoot heights and stem diameters of each group were measured. The plants were rinsed with deionized water and blotted with absorbent paper. Fresh weight (FW) of roots, stems and leaves was measured. Then plant materials were dried to constant weight in an oven at 70 °C, and dry weights (DWs) were measured. The formula for calculating the seedling index was (stem diameter/shoot height + root DW/shoot DW) × total DW (Liu et al., 2015). 2.3. Calculations of chlorophyll content, chlorophyll fluorescence and gas exchange parameters On day 30 of the nitrate treatment, chlorophyll content was measured according to Hussain et al. (2019). The freshly shredded and mixed leaves were weighed to the nearest 0.1 g. We placed the leaves in 10 mL of 80% acetone and immersed them in the dark overnight. The extract was filtered and the absorbance at wave lengths of 663, 645, and 470 nm was recorded. Then we calculated chlorophyll a, chlorophyll b and carotenoid contents. On day 30 of the nitrate treatment, chlorophyll fluorescence was estimated using a pulse modulated chlorophyll fluorescence meter (PAM 2500, Walz, Germany) on the same leaf. The maximum photochemical quantum yield of PSII (Fv/Fm) was recorded after measuring dark-adapted (25 min) leaves. Effective photochemical quantum yield of PSII (Fv’/Fm’), non-photochemical quenching (qN), coefficient of photochemical quenching (qP), and electron transport rate (ETR) were recorded after measuring lightadapted leaves. On day 30 of the nitrate treatment, the net photosynthesis rate (Pn), stomatal conductance (Gs), intercellular CO2 concentration (Ci) and transpiration rate (Tr) were measured with Li-6400 portable photosynthesis system (LI-COR, USA) between 9:00 am and 11:00 am on sunny days. All photosynthetic measurements were taken at 1000 μmol photons m−2s-1 and at a constant airflow rate of 500 μmol s-1. The concentration of cuvette CO2 was set at 400 μmol CO2 mol-1 air.

2. Materials and methods 2.1. Plant materials and treatments These trials were conducted at the Northwest A&F University, Yangling (34°20′N, 108°24′E), China. We chose about 600 seeds of Cucumis sativus L. “Jin You No. 1” that were uniform. After germination, they were planted in seedling trays. When the cucumber seedlings grew to the second leaf, 300 seedlings of uniform size were selected and planted in plastic pots (35 cm × 25 cm) filled with soil. Dopamine concentration was 0 μmol L−1, 50 μmol L−1, 100 μmol L−1, −1 −1 150 μmol L , or 200 μmol L . Nitrate concentration was 50 mmol·L−1 (normal level), or 500 μmol L−1 (stress level). Nitrate was averagely provided by calcium nitrate and potassium nitrate, which was tested after adapting to greenhouse conditions. On days 5, 7, and 9

2.4. Calculations of sucrose phosphate synthase (SPS), sucrose synthase (SS), and invertase activity We measured the following indicators using leaves collected on 30 day of nitrate stress. The extraction of the enzyme solution was based on the method of Vu et al. (1995) with slight modifications. We ground 2

Scientia Horticulturae 260 (2020) 108790

G. Lan, et al.

centrifuged at 16,000 g for 20 min at 4 °C. The reaction mixture contained 100 mM Tris–HCl buffer (80 mM MgSO4, 20 mM glutamine, 20 mM cysteine and 2 mM ethylene glycol tetraacetic acid; pH 7.4). The above assay mixture with hydroxyl-ammonium chloride was used as a controlled reaction liquid. The chromogenic agent contained 0.2 mM TCA, 0.37 M FeCl3, and 0.6 M HCl. Activity of GS was determined by calculating the A540 of the clathrate generated in the reaction (Zhang et al., 2017). Determination of GDH activity was based on previous methods (Loyola-Vargas and de Jimenez, 1984). The tissues were homogenized with a polytron in 2.5 volumes (w/v) of extraction buffer (50 mM TrisHCl, 5 mM 2-mercaptoethanol, and 1 mM CaC12, pH 8.2, and 5% PVP). The homogenate was filtrated through four layers of muslin and centrifuged at 14,000 g for 30 min. The supernatants were used for the enzyme determinations. The whole procedure was carried out at 4 °C. GDH was assayed according to the method of (Debouba et al., 2006).

0.1 g of fresh leaves in ice-chilled 1.6 mL of 50 mM Hepes-KOH (pH 7.5) buffer, which contained 10% glycerol, 10 mM MgCl2, 2 mM EDTA, 10 mM DTT, 1% Triton X-100, 5% PVPP and 1% BSA. The homogenate was centrifuged at 12,000 g for 10 min at 4 °C, and the supernatant was desalted rapidly by centrifugal filtration on a Sephadex G-25 column. Assays for SPS were performed as reported previously with some modifications (Vu et al., 1995). We mixed 90 μL enzymes extract with 50 μL reaction solution that contained 50 mM Hepes-KOH (pH 7.5), 10 mmol/L DTT, 10 mmol/L UDPG, and 10 mM fructose-6-phosphate (F6P). After reacting at 25 °C for 10 min, the reaction was terminated with 1 mM NaOH (0.14 mL), and then all unreacted F6P was destroyed in boiling water for 10 min. After cooling, 0.5 mL of 0.1% (w/v) resorcinol in 95% ethanol and 1.5 mL of 30% HC1 were added, and the tubes were incubated at 80 °C for 8 min. The absorbance was measured at 520 nm after cooling for 5 min. The assay procedure for SS was similar to that of SPS, except F6P was replaced by fructose. Invertase activity was determined based on previous methods (Ben Mohamed et al., 2010). The extracts were assayed for neutral invertase (NI) by adding 200 μL enzyme preparation to 600 μL of 50 mM Tris–HCl buffer (pH 7.5) and 200 μL of 0.1 M sucrose solution. The reaction was allowed to proceed for 60 min at 40℃ and was stopped by adding 2 mL of dinitrosalicylic acid reagent. The tubes were placed in boiling water for 5 min, cooled to room temperature, and diluted with 5 mL of bidistilled water. The absorbance values were read at 540 nm. The assay for acid invertase (AI) was the same as that described for NI except that Tris–HCl buffer was substituted with acetate buffer (0.1 mM; pH 4.5). The absorbance values were then converted to micrograms of glucose equivalent using a standard calibration curve.

2.8. RNA extraction and quantitative real-time polymerase chain reactions Total RNA was extracted from each sample with a MiniBEST Plant RNA Extraction Kit (TaKaRa, Dalian, China), according to the manufacturer’s instructions. It was then reverse-transcribed into cDNA with a PrimeScript™ RT Master Mix (TaKaRa). The primer sequences for quantitative real-time polymerase chain reaction (qRT-PCR) assays are listed in Table 1. All qRT-PCR procedures were performed with PrimeScriptTMRT Reagent Kits (Takara) and conducted on a CFX96™ realtime PCR detection system (Bio-Rad Laboratories, Inc, Hercules, CA, USA). The PCR conditions were as follows: predenaturing at 94 °C for 5 min, then 40 cycles of 95 °C for 15 s and 60 °C for 60 s. Relative gene expression was measured according to the method of (Livak and Schmittgen, 2001).

2.5. Calculations of nitrate-nitrogen and ammonium-nitrogen concentrations Nitrate nitrogen concentrations were determined using the method of Zhang et al. (2017). We ground 0.5 g fresh samples in 10 mL deionized water and placed in boiling water for 30 min. Afterward, 0.1 mL of the extraction solution was mixed with 0.4 mL of 5% salicylic-H2SO4 to react for 20 min before 9.5 mL of 8% NaOH was added. Absorbance was read at 410 nm after cooling to room temperature. Ammonium nitrogen concentrations were determined using the method of Zhang et al. (2017). We ground 0.5 g fresh samples with 5 mL 10% acetic acid, then diluted to 100 mL with deionized water. We mixed 2 mL of supernatant after filtration with 3 mL of ninhydrin hydrate and 0.1 mL of ascorbic acid. The mixture was placed in boiling water for 15 min and then cooled in an ice bath. Absorbance was read at 580 nm.

2.9. Statistical analysis All data were analyzed by IBM SPSS Statistics 19 and graphed with OriginPro 8.6. Values were presented as the means ± standard deviation. The data were evaluated by one-way ANOVA and Duncan’s multiple range tests, where differences were considered significant at P < 0.05. 3. Results 3.1. Growth parameters After 30 days of induced nitrate stress, the growth of cucumber plants was evaluated directly, which based on shoot height, stem diameter, DW and FW of roots, leaves, and shoots. Then the seedling index is calculated. Under nitrate stress conditions, growth of cucumber plants was significantly inhibited, but pretreatment with exogenous dopamine noticeably alleviated this inhibition. shoot height, stem diameter, and

2.6. Calculation of nitrate reductase (NR) activity NR activity was measured according to the method of Zhang et al. (2017). We ground 0.5 g of fresh leaves in 5 mL of ice-chilled 25 mM phosphate (pH 8.7) buffer that contained 10 mM cysteine and 1 mM EDTA. The homogenate was centrifuged at 4000 rpm for 5 min at 4 °C. We mixed 0.2 mL of supernatant with 0.5 mL of 100 mM KNO3 and 0.3 mL of 2 mg/mL nicotinamide adenine dinucleotide hydrate, and then we placed this in a water bath at 25 °C for 30 min. The reaction was stopped by the addition of 1 mL of 30% trichloroacetic acid. Then, 2 mL of sulfonamide reagent and 2 mL of 1-naphthylamine were added, and this mixture was allowed to sit for 15 min. Absorbance of the supernatant was read at 520 nm.

Table 1 Sequences of primers used in quantitative real-time RT-PCR. Gene

Primer Sequence (5’—3’)

Actin

F: CCACGAAACTACTTACAACTCCATC R: GGGCTGTGATTTCCTTGCTC F: GGACGGTAGAGTAAAGAAGGC R: TATCCCTTTTACTCCATTCA F: GACAGGAACTATGCATTTGGGGAAT R: GCGCAATGTGATGACGACTCTA F: AAGCAAAAAACAAGGAGGAAAGCAC R: CAACTTCCCTTTCTTTTGTTTGTCTT F: AGAGACCGAGAAAAGGCTAACT R: AACTAACTCCCTAAGACGATCG

CsNR1

2.7. Calculations of glutamine synthetase (GS) and glutamate dehydrogenase (GDH) activity

CsNRT1.1 CsSPS4

We ground 1.0 g of fresh samples in a chilled mortar with 50 mM potassium phosphate (pH 8.0) buffer that contained 2 mM MgSO4, 2 mM dithiothreitol, and 0.4 M sucrose. The homogenate was

CsSUS3

3

Scientia Horticulturae 260 (2020) 108790

G. Lan, et al.

Table 2 Effects of exogenous dopamine and nitrate stress on shoot height, stem diameter, and seedling index. Data represent means ± SD of three replicates. Different letters within a panel indicate significant differences among treatments according to Duncan’s multiple range tests (P < 0.05). LN, normal nitrate treatment; HN, high nitrate treatment. Treatment

Shoot height (cm)

Stem diameter (mm)

Seedling index

LN0 LN50 LN100 LN150 LN200 HN0 HN50 HN100 HN150 HN200

126.27 ± 3.58 c 131.63 ± 1.12 c 153.94 ± 1.46 a 148.33 ± 6.28 b 130.10 ± 1.18 c 71.70 ± 0.98 g 82.77 ± 1.74 ef 94.50 ± 4.26 d 87.37 ± 3.65 e 81.33 ± 2.71 f

7.46 8.16 8.57 8.47 7.72 5.71 6.56 6.56 6.72 5.95

2.31 3.22 3.55 4.60 2.30 1.35 1.18 1.69 2.19 1.30

± ± ± ± ± ± ± ± ± ±

0.06 0.05 0.06 0.56 0.30 0.20 0.10 0.38 0.06 0.08

c ab a a bc e d d d e

± ± ± ± ± ± ± ± ± ±

Table 3 Effects of exogenous dopamine and nitrate stress on chlorophyll a, chlorophyll b, and carotenoid. Data represent means ± SD of three replicates. Different letters within a panel indicate significant differences among treatments according to Duncan’s multiple range tests (P < 0.05). LN, normal nitrate treatment; HN, high nitrate treatment.

0.58 c 0.20 b 0.33 b 0.31 a 0.44 c 0.04 d 0.11 d 0.07 cd 0.24 c 0.04 d

seedling index significantly increased after dopamine treatment (Table 2). In addition, stressed plants showed reductions in DW and FW of roots, leaves, and shoots, but pretreatment with dopamine, especially at the 150 mM level, increased the values calculated for these indexes (Fig. 1). Growth parameters were improved significantly by dopamine under normal nitrate conditions. This suggests that exogenous

Treatment

Chlorophyll a (mg·g−1 FW)

LN0 LN50 LN100 LN150 LN200 HN0 HN50 HN100 HN150 HN200

1.44 1.59 1.56 1.51 1.38 1.21 1.42 1.38 1.35 1.19

± ± ± ± ± ± ± ± ± ±

0.004 0.015 0.111 0.017 0.119 0.005 0.051 0.056 0.022 0.122

ab a a ab b c b b bc c

Chlorophyll b(mg·g−1 FW)

Carotenoid(mg·g−1 FW)

0.55 0.59 0.61 0.59 0.55 0.53 0.58 0.57 0.58 0.51

0.24 0.26 0.26 0.25 0.25 0.21 0.19 0.24 0.23 0.21

± ± ± ± ± ± ± ± ± ±

0.011 cd 0.010 ab 0.022 a 0.012 ab 0.007 cd 0.003 de 0.019 abc 0.016 bc 0.019 abc 0.007 e

± ± ± ± ± ± ± ± ± ±

0.018 b 0.001 a 0.016 a 0.003 ab 0.012 ab 0.003 de 0.002 e 0.005 b 0.009 bc 0.002 cd

dopamine significantly offset the decrease in plant growth under nitrate stress.

Fig. 1. Effects of exogenous dopamine and nitrate stress on fresh weight and dry weight of roots, shoots and leaves. Data represent means ± SD of three replicates. Different letters within a panel indicate significant differences among treatments according to Duncan’s multiple range tests (P < 0.05). LN, normal nitrate treatment; HN, high nitrate treatment. 4

Scientia Horticulturae 260 (2020) 108790

G. Lan, et al.

plants were pre-treated with dopamine, following the similar trend detected for SPS (Fig. 3C and D). As can be seen that the activity of SPS, SS, AI, and NI increased after treatment with dopamine.

3.2. Chloroplast pigment and photosynthetic system 3.2.1. Chloroplast pigment Nitrate stress affected the concentration of chloroplast pigment in leaf tissue. Compared with the LN0 plants, pigment concentration decreased 16% (chlorophyll a) and 13% (carotenoid) in HN0 plants, but chlorophyll b did not decrease significantly. We further observed the effect of dopamine on pigmentation. In the LN group, pretreatment with dopamine increased Chlorophyll b and Carotenoid but no effect on chlorophyll a. In the HN group, the dopamine addition plants shown increase in chloroplast pigment (Table 3).

3.3.2. Expression of CsSUS3 and CsSPS4 We studied the expression of two genes, CsSUS3 and CsSPS4, that regulate activity of SS and SPS. Under stress conditions, the expression of CsSUS3 was significantly down-regulated, but the expression of CsSPS4 was significantly up-regulated in the HN0 when compared with the LN0 (Fig. 4). After treatment with dopamine, the expression of CsSUS3 and CsSPS4 were up-regulated markedly in LN and HN plants. The expression of CsSPS4 in HN50, HN100, HN150, and HN200 was significantly up-regulated (by 0.39 fold, 1.41 fold, 1.68 fold, and 1.06 fold) more than in the HN0 (Fig. 4A), and a similar trend was found for the expression of CsSUS3 in HN group when plants were pre-treated with dopamine (Fig. 4B).

3.2.2. Chlorophyll fluorescence parameters We monitored chlorophyll fluorescence parameters to determine how they might be affected by dopamine supplementation and nitrate stress. Stress led to decreases in Fv/Fm, Fv’/Fm’, qP, and ETR but an increase in qN. We further observed the effects of dopamine pretreatment on the HN and LN groups. In the LN group, the addition of dopamine showed increase in Fv’/Fm’, qP, and ETR, but reductions in qN. In addition to reducing the value for qN, the pretreatment with dopamine increased the values calculated for other indexes when compared with HN0 in the HN group (Table 4). These results indicated that dopamine effectively alleviated the inhibition of chlorophyll fluorescence parameters by nitrate stress, and the optimum concentration was 150 μmol L−1.

3.4. Nitrate metabolism 3.4.1. Concentrations of nitrate nitrogen and ammonium nitrogen The nitrate-nitrogen concentration of HN0 was significantly higher (increased by 82%) than in LN0. Dopamine pretreatment had no effect on nitrate-nitrogen concentrations under normal conditions. Under stress conditions, nitrate-nitrogen concentration in HN100 and HN150 were 30% and 14% lower, respectively, than in HN0 (Fig. 5A). The ammonium-nitrogen concentration of HN0 was significantly higher than in LN0. However, the application of dopamine prior to nitrate stress helped to reverse that response. For example, concentrations in LN100, LN150, and LN200 were lower than in LN0, and plants showed lower in those levels by the addition of dopamine than the non-dopamine plants in HN group (Fig. 5B). This demonstrated that the dopamine pretreatment major inhibited the accumulation of nitrate nitrogen and ammonium nitrogen.

3.2.3. Gas exchange parameters In exposure to nitrate stress, the Pn, Ci, Gs and Tr of HN0 were lower than LN0. This response was demonstrated that these indexes of stressed plants was significantly inhibited. After treatment with dopamine, gas exchange parameters were increased markedly in LN and HN plants. In the HN group, HN50, HN100, HN150, and HN200 were markedly higher (by 0.74 fold, 1.16 fold, 1.14 fold, and 0.98 fold, respectively) than HN0 for Pn (Fig. 2A). In addition, values for Ci, Gs, and Tr were increase by the addition of dopamine, following the similar trend detected for Pn (Fig. 2B-D).

3.4.2. Nitrate reductase, glutamine synthetase, and glutamate dehydrogenase The activity of NR when exposed to nitrate conditions was significantly lower (by 28%) than when at normal conditions. We further observed the effect of dopamine pretreatment on NR activity. Compared with the LN0, LN100 was significantly increased (22%), but obvious decreases in LN200 (25%). NR activity was markedly higher after dopamine pretreatment than non-dopamine plants in HN group (Fig. 6A). Stress led to a significant decrease in GS activity. Furthermore, GS activity was higher by the addition of dopamine than the nondopamine plants in LN and HN group ((Fig. 6B). GDH activity was not significantly different after dopamine pretreatment in the LN group. However, HN150 increased by 33% compared with HN0 after dopamine pretreatment in the HN group (Fig. 6C).

3.3. Carbon metabolism 3.3.1. Enzyme activity during carbon metabolism We observed the effect of dopamine on enzyme activity during carbon metabolism. After high-nitrate treatment, SPS activity was markedly increased. Dopamine pretreatment led to a further increase in SPS activity when plants were exposed to high-nitrate conditions (Fig. 3A). SS activity was reduced by 12% in HN0 when compared with LN0. This demonstrated that stress significantly inhibited the SS activity. However, exogenous dopamine helped to reverse that response (Fig. 3B). Both NI and AI activity was markedly higher in the HN0 than in the LN0. Furthermore, NI and AI activity was further increased when

Table 4 Effects of exogenous dopamine and nitrate stress on maximum photochemical quantum yield of PSII, effective photochemical quantum yield of PSII, non-photochemical quenching, coefficient of photochemical quenching, and electron transport rate. Data represent means ± SD of three replicates. Different letters within a panel indicate significant differences among treatments according to Duncan’s multiple range tests (P < 0.05). LN, normal nitrate treatment; HN, high nitrate treatment. Treatment

Fv/Fm

LN0 LN50 LN100 LN150 LN200 HN0 HN50 HN100 HN150 HN200

0.786 0.792 0.788 0.790 0.775 0.771 0.775 0.784 0.786 0.766

± ± ± ± ± ± ± ± ± ±

Fv’/Fm’ 0.003 ab 0.004 a 0.003 ab 0.001 ab 0.003 c 0.005 cd 0.004 c 0.001 b 0.001 ab 0.004 d

0.59 0.60 0.65 0.64 0.62 0.55 0.58 0.60 0.61 0.57

± ± ± ± ± ± ± ± ± ±

qN 0.010 c 0.008 bc 0.003 a 0.004 a 0.012 b 0.002 e 0.001 cd 0.011 bc 0.001 b 0.014 d

0.18 0.17 0.13 0.13 0.14 0.26 0.23 0.23 0.18 0.22

5

qP ± ± ± ± ± ± ± ± ± ±

0.013 de 0.023 def 0.028 g 0.003 fg 0.002 efg 0.018 a 0.025 ab 0.012 ab 0.003 cd 0.011 bc

0.80 0.85 0.86 0.84 0.86 0.76 0.82 0.81 0.83 0.84

ETR ± ± ± ± ± ± ± ± ± ±

0.003 d 0.001 ab 0.004 a 0.004 ab 0.006 a 0.001 e 0.003 c 0.004 cd 0.001 c 0.016 b

27.67 28.33 30.00 29.67 28.33 25.00 26.67 27.33 28.00 27.00

± ± ± ± ± ± ± ± ± ±

0.58 bcd 0.58 b 0.00 a 0.58 a 0.58 b 1.00 e 0.58 d 0.58 bcd 0.00 bc 1.00 cd

Scientia Horticulturae 260 (2020) 108790

G. Lan, et al.

Fig. 2. Effects of exogenous dopamine and nitrate stress on net photosynthetic rate, intercellular CO2 concentration, stomatal conductance, and transpiration rate. Data represent means ± SD of three replicates. Different letters within a panel indicate significant differences among treatments according to Duncan’s multiple range tests (P < 0.05). LN, normal nitrate treatment; HN, high nitrate treatment.

(Fig. 7B).

3.4.3. Expression of CsNRT1.1 and CsNR1 After treatment with dopamine, the expression of CsNRT1.1 and CsNR1 were up-regulated markedly in LN and HN plants. For example, the expression of CsNRT1.1 in HN50, HN100, HN150, and HN200 was significantly up-regulated 0.30 fold, 0.69 fold, 1.17 fold, and 0.19 fold more, respectively, than in HN0 (Fig. 7A). Under stress conditions, expression of CsNR1 was down-regulated significantly more than under normal conditions. However, the gene expression level in HN group was significantly up-regulated (by 0.77 fold in HN50, 1.72 fold in HN100, 2.26 fold in HN150, and 4.20 fold in HN200) than that in HN0

4. Discussion This study was to determine the effects of exogenous dopamine on cucumber growth, carbon metabolism, and nitrogen metabolism under nitrate stress. Although it has been reported that dopamine can help plants resist stress (Gomes et al., 2014; Li et al., 2015; Liang et al., 2017), its effects on growth, carbon metabolism, and nitrogen metabolism under nitrate stress have hardly been studied. Dopamine, which Fig. 3. Effects of exogenous dopamine and nitrate stress on sucrose phosphate synthase, sucrose synthase, neutral invertase, and acid invertase. Data represent means ± SD of three replicates. Different letters within a panel indicate significant differences among treatments according to Duncan’s multiple range tests (P < 0.05). LN, normal nitrate treatment; HN, high nitrate treatment.

6

Scientia Horticulturae 260 (2020) 108790

G. Lan, et al.

Fig. 4. Effects of exogenous dopamine and nitrate stress on relative expression of CsSPS4 and CsSUS3. Data represent means ± SD of three replicates. Different letters within a panel indicate significant differences among treatments according to Duncan’s multiple range tests (P < 0.05). LN, normal nitrate treatment; HN, high nitrate treatment.

the disruption of chlorophyll biosynthesis result in cytotoxic effects, which are caused by the accumulation of metabolic intermediates (Hoertensteiner, 2013; Mochizuki et al., 2010). The contents of chlorophyll biosynthesis precursors in the leaves of cucumber seedlings exposed to salt stress significantly decreased and chlorophyll b degradation gene expression was induced by salt stress (Yuan et al., 2018). Turan and Tripathy (2015) considered that decrease of Chlorophyll and carotenoid contents may be attributed to decreased activities of chlorophyll biosynthetic pathway enzymes due to downregulation of their protein abundance and/or gene expression in salt-stressed seedlings. Chlorophyll a, chlorophyll b and carotenoids were lower in nitratestressed plants, which mean that plant photosynthesis was inhibited. Exogenous dopamine significantly increased pigment content, which indicated that dopamine alleviated the negative effects of nitrate stress on chloroplast pigments, and that 100–150 μM dopamine was most effective. Abdelkader et al. (2012) indicated that rice (Oryza sativa cv. Giza 79) plants treated with dopamine and grown under salt stress conditions had achieved up-regulation in the pigment. We speculated that dopamine may alleviate the obstruction of stress on the chlorophyll biosynthesis pathway and prevent the degradation of chlorophyll.4.2.2. Chlorophyll fluorescence parameters Chlorophyll fluorescence kinetics has a unique role in the photosystem's absorption, transmission, dissipation, and distribution of light energy during leaf photosynthesis (Baker, 2008). Plant response to stress can be expressed quickly by chlorophyll fluorescence parameters. (Al-Taweel et al., 2007) suggested that salt stress enhanced photoinhibition by inhibiting repair of PSII. In addition, salt stress also reduces transfer efficiency of the energy absorbed from the antenna chlorophyll a to the reaction center of the PSII and/or damages or dissociates light-harvesting protein (Athar et al., 2015). Through the study of chlorophyll fluorescence parameters, it is clear that salt stress reduced energy trapping efficiency by damaging oxygen evolving

is one of the catecholamines, plays an important role in plants. Although the accumulation of nitrate caused a decrease in the physiological parameters of cucumber, dopamine significantly alleviated this inhibition, which we report for the first time here. 4.1. Growth parameters Plant morphology, dry weight, and fresh weight are general parameters that can reflect the effects of stress on growth. We found that plant shoot height, stem diameter, dry weight, and fresh weight of roots, leaves and shoots decreased significantly in a nitrate environment. Previous studies have found that DW and FW of shoot and root decreased after excess NO3− treatment (Xu et al., 2012b). Liang et al. (2018) also reported that under nitrate stress, the growth index of DW and FW of tomato (Lycopersicon esculentum L.) decreased significantly. However, we noticed that dopamine pretreatment effectively alleviated this negative effect. Exogenous dopamine significantly increased plant height, stem diameter, DW and FW under nitrate stress, and 100–150 μM dopamine was the most effective dose. These studies demonstrated that dopamine can alleviate the inhibition of growth in nitrate stress. Previous literature described the interaction of catecholamines with other hormones in plants. Dopamine might inhibit the degradation of indole acetic acid and maintain a higher level of auxin in plant tissues (Protacio et al., 1992). Kamisaka (1979) found that catecholamines and their derivatives enhanced the promotion of gibberellic acid on the lettuce (Lactuca sativa L.) hypocotyl elongation. 4.2. Chloroplast pigment and photosynthetic system 4.2.1. Chloroplast pigment Chlorophyll concentration is related to the level of photosynthesis of plants. Chlorophyll biosynthesis pathway was obstructed by salt stress,

Fig. 5. Effects of exogenous dopamine and nitrate stress on concentrations of nitrate nitrogen and ammonium nitrogen. Data represent means ± SD of three replicates. Different letters within a panel indicate significant differences among treatments according to Duncan’s multiple range tests (P < 0.05). LN, normal nitrate treatment; HN, high nitrate treatment.

7

Scientia Horticulturae 260 (2020) 108790

G. Lan, et al.

However, these inhibition effects were alleviated significantly when dopamine was used before the induction of nitrate and, again, a treatment of dopamine of 100–150 μM was most effective. These results are similar to those of Li et al. (2015) who reported that exogenous application of dopamine caused an increase in chlorophyll content and Fv/Fm in salt stress. 4.2.2. Gas exchange parameters The Pn, Gs, Ci, and Tr of cucumber were measured. Values for these parameters were significantly reduced after nitrate induction. Stomatal limitation and non-stomatal limitation were the factors that affected net photosynthetic rate (Ding et al., 2011). As mentioned above, the decrease in chlorophyll content and chlorophyll fluorescence parameters under nitrate stress was due to non-stomatal limitation. The decrease in intercellular CO2 concentration and stomatal conductance under stress confirmed that the stomatal opening became smaller, which was due to stomatal limitation. The increased photosynthetic limitation in salinity stress leaves was related to both osmotic stress and ion stress (Chen et al., 2015). Low osmotic potential introduced by salt stress caused an obvious increase in stomatal limitation and mesophyll limitation, and the accumulation of ions enhanced the mesophyll limitation (Wang et al., 2018). The transpiration rate is closely related to water absorption and stomatal opening of plants (Carminati et al., 2017). Stress conditions can significantly inhibit photosynthesis in plants. Previous studies have shown that dopamine pretreatment improved photosynthetic performance of stressed plants under salt stress (Li et al., 2015). Dopamine can modulate photosynthetic reduction of oxygen (Kulma and Szopa, 2007). It mediates that superoxide allows oxygen reduction to participate in energy transduction in photosynthesis (Allen, 2003). However, the mechanism by which exogenous dopamine protects PSII function and photosynthesis is still unclear. 4.3. Carbon metabolism 4.3.1. Sucrose synthase SS was a key enzyme in sucrose metabolism and was responsible for the reversible reaction of sucrose decomposition and synthesis. SS was involved in the synthesis of starch and fiber, nitrogen fixation and stress response (Fang et al., 2017). The SS in the cytoplasm provides the product of sucrose decomposition for energy metabolism and starch synthesis of the cell, and provides a precursor for the synthesis of cellulose when it is bound to the plasma membrane (Ruan et al., 2003). SS activity was significantly inhibited by salinity (Ben Salah et al., 2009; Palma et al., 2013; Lopez et al., 2006). We also observed a decrease in SS activity under nitrate conditions. This might indicate that nitrate stress inhibits sucrose decomposition catalyzed by SS and cellulose synthesis. We used qRT-PCR to analyze the expression of the CsSUS3 gene. SS gene functions are diversified and complex (Tong et al., 2018). It plays an important role in the stress response (Wang et al., 2014). The expression of the CsSUS3 gene was down-regulated under nitrate stress, which was consistent with the change in SS. Pretreatment of dopamine prior to nitrate induction resulted in a smaller reduction, and 150 μM was the most effective dose. Previous research suggested that the catecholamines are involved in starch mobilization and the increase in norepinephrine is accompanied by changes in carbohydrate metabolism (Swiedrych et al., 2004b).

Fig. 6. Effects of exogenous dopamine and nitrate stress on nitrate reductase, glutamine synthetase, and glutamate dehydrogenase. Data represent means ± SD of three replicates. Different letters within a panel indicate significant differences among treatments according to Duncan’s multiple range tests (P < 0.05). LN, normal nitrate treatment; HN, high nitrate treatment.

complex, over reduction of Quinone A resulting in occurrence of chronic photoinhibition (Athar et al., 2015). Other abiotic stresses such as heavy metal, which interfere with the synthesis of chlorophyll and destroy the photosynthetic system in plants (Larsson et al., 1998; Dezhban et al., 2015). Zhang and Liu (2018) have shown that Fv/Fm, Fv’/Fm’, qP, and NPQ were significantly decreased under cesium accumulation. In exposure to nitrate stress, values of Fv/Fm, Fv’/Fm’, qP, and ETR were lower, and values for qN were higher. This indicated that stress inhibits the capture and utilization of light energy and the rate of electron transfer, and increases the heat dissipation of light energy.

4.3.2. Sucrose phosphate synthase SPS catalyzed the formation of sucrose 6-phosphate by fructose 6phosphate and UDP-glucose, and sucrose phosphate phosphatase hydrolyzed sucrose 6-phosphate to sucrose (Hashida et al., 2016). The catalysis of sucrose synthesis by SPS is actually irreversible. We observed that SPS activity increased under nitrate conditions. SPS activity appeared to be regulated by the strongly nitrogen-dependent sourcesink relation, which increased with nitrogen fertilization (Isopp et al., 2000). Seger et al. (2015) also found that SPS activity was consistently 8

Scientia Horticulturae 260 (2020) 108790

G. Lan, et al.

Fig. 7. Effects of exogenous dopamine and nitrate stress on relative expression of CsNRT1.1 and CsNR1. Data represent means ± SD of three replicates. Different letters within a panel indicate significant differences among treatments according to Duncan’s multiple range tests (P < 0.05). LN, normal nitrate treatment; HN, high nitrate treatment.

CLC, and SLAC/SLAH) have been found (O’Brien et al., 2016). Excess nitrogen accumulation in plant when the supplied nitrogen exceeds its assimilation capacity (Roosta and Schjoerring, 2007). We found that the expression of the NRT1.1 gene was up-regulated under nitrate stress. That is, nitrate induced the expression of transporters, which led to the accumulation of nitrate nitrogen in plants. Ammonium was produced during nitrate assimilation, nitrogen fixation, deamination of amino acids, and photorespiration (Roosta and Schjoerring, 2007). Therefore, a nitrate environment also led to the accumulation of ammonium nitrogen, which was consistent with the results of (Zhang et al., 2017). However, the concentrations of nitrate nitrogen and ammonium nitrogen were reduced by dopamine pretreatment. These findings indicated that exogenous dopamine enhanced nitrogen assimilation in plants.

higher under a high nitrogen regimen, which may be due to nitrogen assimilation that results SPS in a more active dephosphorylation form (Huber, 2007). This involves the 14-3-3 protein, which is phosphorylation-dependent binding protein. Enzymatic activity was regulated by 14-3-3 proteins by phosphorylation to complete the formation of a binding site for the inhibitory protein, which then binds to form an inactive complex (Athwal and Huber, 2002). CsSPS4 played a role in accelerating SS and export in sucrose-transporting plants (Li et al., 2018). The expression of the CsSPS4 gene was up-regulated in a nitrogen environment by qRT-PCR, which was consistent with changes in SPS activity. In this study, dopamine increased SPS activity and upregulated the CsSPS4 gene in the HN and LN groups. Skirycz et al. (2005) transformed potato (Solanum tuberosum L. cv. Desiree) plants with a cDNA encoding human dopamine receptor (HD1) and found an increase in SPS activity. This might also depend on the phosphorylation regulation of the enzyme.

4.4.2. Enzyme activity during nitrate metabolism NR performs a key role in the metabolism of the nitrogen cycle by reducing nitrate to nitrite (Coelho and Romao, 2015). We found that NR activity in HN groups declined markedly, which was possibly due to a feedback inhibition of concentrations of nitrate nitrogen (Zhang et al., 2017; Fu et al., 2018). The 14-3-3 proteins and phosphorylation-dependent binding proteins bind to NR which results in an inactive complex formation (Athwal and Huber, 2002). Xu et al. (2016) showed that excess nitrate induced 14-3-3 proteins and decreased NR. 14-3-3 proteins might be involved in nitrate stress response by interacting with H+-ATPase and NR. Furthermore, 14-3-3 proteins also regulated the activity of SPS (Zuk et al., 2005). Therefore, in this study, nitrogen assimilation may have results in a more active dephosphorylation form of SPS. In addition, we analyzed the expression of the CsNR1 gene by qRT-PCR. The expression of the CsNR1 gene was significantly downregulated under nitrate stress, which was consistent with the change in NR. Li et al. (2012) reported that NR activity and the expression of CsNR in leaves were significantly down-regulation under the high-nitrate condition. However, we found that dopamine increased NR activity and CsNR1 gene expression in the HN and LN groups. The relationship between dopamine and 14-3-3 proteins needs further study. Ammonium assimilation reactions are catalyzed by the GDH and the glutamine synthetase/glutamate synthase (GS/GOGAT) cycle (Bolay et al., 2018). GS carries out the first step in inorganic N incorporation into amino acids by transferring ammonium to glutamate to form glutamine. GDH catalyzes a reversible enzymatic reaction that involved the assimilation of ammonium into glutamate and the deamination of glutamate into 2-oxoglutarate and ammonium (Lancien et al., 2000). Due to the high affinity for NH4+ and the dependence on ATP, the GS/ GOGAT pathway is mainly dependent on normal conditions, while the GDH pathway with low affinity for NH4+ and independent of ATP is important in the condition of ATP supply limitation (Helling, 1998). We found that GS activity decreased and GDH activity increased after

4.3.3. Invertase activity Exposure to nitrate led to enhanced invertase activity, which indicated that sucrose decomposition under nitrate stress was mainly dependent on invertase rather than SS. Acid invertase is mainly soluble in vacuoles, and alkaline invertase mainly accumulates in cytoplasm. Sucrose hydrolysis plays an important role in responding to environmental stress. Abiotic stress such as drought stress (Koenigshofer and Loeppert, 2015), salt stress (Fernandes et al., 2004) cold (L. He et al., 2018; X. He et al., 2018) and osmotic stress (Vargas et al., 2007) caused an increase in invertase activity. The activity of invertase increased markedly under drought and cold stress resulting in the accumulation of hexoses (glucose and fructose) that contributed significantly to osmotic adjustment(Vargas et al., 2007). Decomposition of sucrose under salt stress ensured that continuous supply of ATP and NAD(P)H required to avoid or repair salt damages (Fernandes et al., 2004). High levels of invertase catalyze the irreversible hydrolysis of sucrose to glucose and fructose under nitrate stress, which results in a decrease in sucrose content. Dopamine also effectively increased invertase activity in the HN and LN groups, and we found that 100–150 μM dopamine was best. This indicated that dopamine promoted sucrose decomposition in response to nitrate stress. 4.4. Nitrate metabolism 4.4.1. Concentrations of nitrate nitrogen and ammonium nitrogen After nitrate treatment, the concentration of nitrate nitrogen and ammonium nitrogen in plants increased significantly. Nitrate is the main source of inorganic nitrogen absorbed by plants. Nitrate uptake by plants is an active, H+-coupled process facilitated through the high and low-affinity transport systems (Migocka et al., 2013). So far, nitrate transporters that belong to four different families (NRT1/PTR, NRT2, 9

Scientia Horticulturae 260 (2020) 108790

G. Lan, et al.

nitrate induction, which indicated that ammonium assimilation relied mainly on the GDH pathway rather than GS/GOGAT under nitrate stress. In addition, we also observed that dopamine promoted the activity of these two enzymes in the LN and HN groups. This indicated that dopamine promoted ammonium assimilation in plants.

e977704. Hashida, Y., Hirose, T., Okamura, M., Hibara, K., Ohsugi, R., Aoki, N., 2016. A reduction of sucrose phosphate synthase (SPS) activity affects sucrose/starch ratio in leaves but does not inhibit normal plant growth in rice. Plant Sci. 253, 40–49. He, L., Yu, L., Li, B., Du, N., Guo, S., 2018. The effect of exogenous calcium on cucumber fruit quality, photosynthesis, chlorophyll fluorescence, and fast chlorophyll fluorescence during the fruiting period under hypoxic stress. BMC Plant Biol. 18 (180). He, X., Wei, Y., Kou, J., Xu, F., Chen, Z., Shao, X., 2018. PpVIN2, an acid invertase gene family member, is sensitive to chilling temperature and affects sucrose metabolism in postharvest peach fruit. Plant Growth Regul. 86 (2), 169–180. Helling, R.B., 1998. Pathway choice in glutamate synthesis in Escherichia coli. J. Bacteriol. 180 (17), 4571–4575. Hoertensteiner, S., 2013. Update on the biochemistry of chlorophyll breakdown. Plant Mol. Biol. 82 (6), 505–517. Huang, S., Wang, Y., Jin, J., Tang, J., 2011. Status of salinity, pH and nutrients in soils in main vegetable production regions in China. Plant Nutr. Fertil. Sci. 17 (04), 906–918. Huber, S.C., 2007. Exploring the role of protein phosphorylation in plants: from signalling to metabolism. Biochem. Soc. Trans. 35 (1), 28–32. Hussain, S., Iqbal, N., Brestic, M., Raza, M.A., Pang, T., Langham, D.R., Safdar, M.E., Ahmed, S., Wen, B., Gao, Y., Liu, W., Yang, W., 2019. Changes in morphology, chlorophyll fluorescence performance and Rubisco activity of soybean in response to foliar application of ionic titanium under normal light and shade environment. Sci. Total Environ. 658, 626–637. Isopp, H., Frehner, M., Long, S.P., Nösberger, J., 2000. Sucrose‐phosphate synthase responds differently to source‐sink relations and to photosynthetic rates: lolium perenne L. Growing at elevated pCO2 in the field. Plant Cell Environ. 23 (6), 597–607. Kalaji, H.M., Jajoo, A., Oukarroum, A., Brestic, M., Zivcak, M., Samborska, I.A., Cetner, M.D., Lukasik, I., Goltsev, V., Ladle, R.J., 2016. Chlorophyll a fluorescence as a tool to monitor physiological status of plants under abiotic stress conditions. Acta Physiol. Plant. 38, 1024. Kamisaka, S., 1979. Catecholamine stimulation of the gibberellin action that induces lettuce hypocotyl elongation. Plant Cell Physiol. 20 (7), 1199–1207. Koenigshofer, H., Loeppert, H., 2015. Regulation of invertase activity in different root zones of wheat (Triticum aestivum L.) seedlings in the course of osmotic adjustment under water deficit conditions. J. Plant Physiol. 183, 130–137. Kulma, A., Szopa, J., 2007. Catecholamines are active compounds in plants. Plant Sci. 172 (3), 433–440. Lancien, M., Gadal, P., Hodges, M., 2000. Enzyme redundancy and the importance of 2oxoglutarate in higher plant ammonium assimilation. Plant Physiol. 123 (3), 817–824. Larsson, E.H., Bornman, J.F., Asp, H., 1998. Influence of UV-B radiation and Cd2+on chlorophyll fluorescence, growth and nutrient content in Brassica napus. J. Exp. Bot. 49 (323), 1031–1039. Lechno, S., Zamski, E., TelOr, E., 1997. Salt stress-induced responses in cucumber plants. J. Plant Physiol. 150 (1-2), 206–211. Li, C., Sun, X., Chang, C., Jia, D., Wei, Z., Li, C., Ma, F., 2015. Dopamine alleviates saltinduced stress in Malus hupehensis. Physiol. Plant. 153 (4), 584–602. Li, Q., Wang, X., Ma, L., Wei, M., Shi, Q., Yang, F., 2012. Molecular characterization of a cucumber nitrate reductase (CsNR) gene under NO3− stress. Mol. Biol. Rep. 39 (4), 4283–4290. Li, X., Du, J., Guo, J., Wang, H., Ma, S., Lu, J., Sui, X., Zhang, Z., 2018. The functions of cucumber sucrose phosphate synthases 4 (CsSPS4) in carbon metabolism and transport in sucrose- and stachyose-transporting plants. J. Plant Physiol. 228, 150–157. Liang, B., Li, C., Ma, C., Wei, Z., Wang, Q., Huang, D., Chen, Q., Li, C., Ma, F., 2017. Dopamine alleviates nutrient deficiency-induced stress in Malus hupehensis. Plant Physiol. Biochem. 119, 346–359. Liang, Y., Zheng, P., Li, S., Li, K., Xu, H., 2018. Nitrate reductase-dependent NO production is involved in H2S-induced nitrate stress tolerance in tomato via activation of antioxidant enzymes. Sci. Hortic. Amsterdam 229, 207–214. Liu, J., Wang, W., Wang, L., Sun, Y., 2015. Exogenous melatonin improves seedling health index and drought tolerance in tomato. Plant Growth Regul. 77 (3), 317–326. Liu, S.G., Zhu, D.Z., Chen, G.H., Gao, X., Zhang, X.S., 2012. Disrupted actin dynamics trigger an increment in the reactive oxygen species levels in the Arabidopsis root under salt stress. Plant Cell Rep. 31 (7), 1219–1226. Lopez, M., Herrera-Cervera, J.A., Lluch, C., Tejera, N.A., 2006. Trehalose metabolism in root nodules of the model legume Lotus japonicus in response to salt stress. Physiol. Plant. 128 (4), 701–709. Mansour, M., Salama, K., 2004. Cellular basis of salinity tolerance in plants. Environ. Exp. Bot. 52 (2), 113–122. Mieko, K., 1968. Fluorescence histochemical study on serotonin and catecholamine in some plants. Jpn. J. Pharmacol. 2 (18), 162–168. Migocka, M., Warzybok, A., Kobus, G., 2013. The genomic organization and transcriptional pattern of genes encoding nitrate transporters 1 (NRT1) in cucumber. Plant Soil 364 (1-2), 245–260. Mochizuki, N., Tanaka, R., Grimm, B., Masuda, T., Moulin, M., Smith, A.G., Tanaka, A., Terry, M.J., 2010. The cell biology of tetrapyrroles: a life and death struggle. Trends Plant Sci. 15 (9), 488–498. Nishikawa, Y., Kondo, H., Ito, H., Kitamura, H., Wada, K., 2010. Relationship between nitrate ion concentrations in petiole juice measured by the handy reflecting photometer and vine growth and fruit quality of ‘Kyoho’ grapes. Hortic. Res. (Japan) 9 (1), 73–79. O’Brien, J.A., Vega, A., Bouguyon, E., Krouk, G., Gojon, A., Coruzzi, G., Gutierrez, R.A., 2016. Nitrate transport, sensing, and responses in plants. Mol. Plant 9 (6), 837–856. Palma, F., Tejera, N.A., Lluch, C., 2013. Nodule carbohydrate metabolism and polyols involvement in the response of Medicago sativa to salt stress. Environ. Exp. Bot. 85, 43–49.

5. Conclusion In this study, we discussed the effects of dopamine on cucumber growth, carbon metabolism and nitrogen metabolism under nitrate stress. We found that treatment of cucumber seedlings with dopamine prior to the induction of nitrate stress inhibited the negative effects on plants by increasing the activity of carbon metabolism, nitrogen metabolism-related enzymes, and the expression of related genes. At the same time, dopamine also improved photosynthesis and fluorescence parameters and increased chlorophyll content. The most suitable concentration of dopamine was 100–150 μM. Acknowledgments This work was supported by the earmarked fund for China Agricultural Research System (CARS-24). We would like to thank Thomas A. G avin, Professor Emeritus, Cornell University, for help with editing this paper. References Abdelkader, A.F., El-khawas, S., El-Sherif, N.A.S.E., Hassanein, R.A., Emam, M.A., Hassan, R.E., 2012. Expression of aquaporin gene (Os PIP1-3) in salt-stressed rice (Oryzasativa L.) plants pre-treated with the neurotransmitter (dopamine). Plant Omics 5 (6), 532–541. Allen, J.F., 2003. Superoxide as an obligatory, catalytic intermediate in photosynthetic reduction of oxygen by adrenaline and dopamine. Antioxid Redox Sign. 5 (1), 7–14. Al-Taweel, K., Iwaki, T., Yabuta, Y., Shigeoka, S., Murata, N., Wadano, A., 2007. A bacterial transgene for catalase protects translation of D1 protein during exposure of salt-stressed tobacco leaves to strong light. Plant Physiol. 145 (1), 258–265. Athar, H.U.R., Zafar, Z.U., Ashraf, M., 2015. Glycinebetaine improved photosynthesis in canola under salt stress: evaluation of chlorophyll fluorescence parameters as potential indicators. J. Agron. Crop. Sci. 201 (6), 428–442. Athwal, G.S., Huber, S.C., 2002. Divalent cations and polyamines bind to loop 8 of 14-3-3 proteins, modulating their interaction with phosphorylated nitrate reductase. Plant J. 29 (2), 119–129. Baker, N.R., 2008. Chlorophyll fluorescence: a probe of photosynthesis in vivo. Annu. Rev. Plant Biol. 59, 89–113. Ben Mohamed, H., Vadel, A.M., Geuns, J.M.C., Khemira, H., 2010. Biochemical changes in dormant grapevine shoot tissues in response to chilling: possible role in dormancy release. Sci. Hortic. Amsterdam 124 (4), 440–447. Ben Salah, I., Albacete, A., Andujar, C.M., Haouala, R., Labidi, N., Zribi, F., Martinez, V., Perez-Alfocea, F., Abdelly, C., 2009. Response of nitrogen fixation in relation to nodule carbohydrate metabolism in Medicago ciliaris lines subjected to salt stress. J. Plant Physiol. 166 (5), 477–488. Bolay, P., Muro-Pastor, M.I., Florencio, F.J., Klahn, S., 2018. The distinctive regulation of cyanobacterial glutamine synthetase. Life (Basel, Switzerland) 8 (4). Carminati, A., Passioura, J.B., Zarebanadkouki, M., Ahmed, M.A., Ryan, P.R., Watt, M., Delhaize, E., 2017. Root hairs enable high transpiration rates in drying soils. New Phytol. 216 (3), 771–781. Chen, T.W., Kahlen, K., Stützel, H., 2015. Disentangling the contributions of osmotic and ionic effects of salinity on stomatal, mesophyll, biochemical and light limitations to photosynthesis. Plant Cell Environ. 38 (8), 1528–1542. Coelho, C., Romao, M.J., 2015. Structural and mechanistic insights on nitrate reductases. Protein Sci. 24 (12), 1901–1911. Dezhban, A., Shirvany, A., Attarod, P., Delshad, M., Matinizadeh, M., Khoshnevis, M., 2015. Cadmium and lead effects on chlorophyll fluorescence, chlorophyll pigments and proline of Robinia pseudoacacia. J. Forestry Res. 26 (2), 323–329. Fang, J., Zhu, X., Jia, H., Wang, C., 2017. Research advances on physiological function of plant sucrose synthase. J. Nanjing Agric. Univ. 05, 759–768. Fernandes, F.M., Arrabaca, M.C., Carvalho, L., 2004. Sucrose metabolism in Lupinus albus L. Under salt stress. Biol. Plant. 48 (2), 317–319. Fu, Y., Zhang, Z., Yuan, S., 2018. Putative Connections between nitrate reductase SNitrosylation and NO synthesis under pathogen attacks and abiotic stresses. Front. Plant Sci. 9 (474). Gao, Z., Han, J., Mu, C., Lin, J., Li, X., Lin, L., Sun, S., 2014. Effects of saline and alkaline stresses on growth and physiological changes in oat (Avena sativa L.) seedlings. Not Bot Hortic. Agrobo 42 (2), 357–362. Gomes, B.R., Siqueira-Soares, R.D.C., Dos Santos, W.D., Marchiosi, R., Soares, A.R., Ferrarese-Filho, O., 2014. The effects of dopamine on antioxidant enzymes activities and reactive oxygen species levels in soybean roots. Plant Signal. Behav. 9 (12),

10

Scientia Horticulturae 260 (2020) 108790

G. Lan, et al.

Wang, X., Wang, W., Huang, J., Peng, S., Xiong, D., 2018. Diffusional conductance to CO2 is the key limitation to photosynthesis in salt-stressed leaves of rice (Oryza sativa). Physiol. Plant. 163 (1), 45–58. Wichers, H.J., Visser, J.F., Huizing, H.J., Pras, N., 1993. Occurence of L-DOPA and dopamine in plants and cell cultures of Mucuna pruriens and effects of 2,4-D and NaCl on these compounds. Plant Cell Tiss. Org. 33 (3), 259–264. Xu, H., Sun, X., Shi, Q., Yang, F., Yang, X., Wang, X., 2012a. Physiological responses of two cucumber cultivars to nitrate stress. J. Plant Nutr. 35 (14), 2167–2179. Xu, H., He, X., Wang, K., Chen, L., Li, K., 2012b. Identification of early nitrate stress response genes in spinach roots by suppression subtractive hybridization. Plant Mol. Biol. Rep. 30 (3), 633–642. Xu, H., Sun, X., Yang, X., Shi, Q., Wang, X., 2013. Physiological responses to nitrate stress of transgenic tobacco plants harbouring the cucumber mitogen-activated protein kinase gene. Turk. J. Bot. 37 (1), 130–138. Xu, H., Zhao, X., Guo, C., Chen, L., Li, K., 2016. Spinach 14-3-3 protein interacts with the plasma membrane H+-ATPase and nitrate reductase in response to excess nitrate stress. Plant Physiol. Biochem. 106, 187–197. Yang, X., Wang, X., Wei, M., Hikosaka, S., Goto, E., 2010a. Response of ammonia assimilation in cucumber seedlings to nitrate stress. J. Plant Biol. 53 (3), 173–179. Yang, X., Wang, X., Wei, M., Yang, F., Shi, Q., 2010b. Changes of nitrate reductase activity in cucumber seedlings in response to nitrate stress. Agric. Sci. China 9 (2), 216–222. Yuan, R.N., Shu, S., Guo, S.R., Sun, J., Wu, J.Q., 2018. The positive roles of exogenous putrescine on chlorophyll metabolism and xanthophyll cycle in salt-stressed cucumber seedlings. Photosynthetica 56 (2), 557–566. Zhang, R., Sun, Y., Liu, Z., Jin, W., Sun, Y., 2017. Effects of melatonin on seedling growth, mineral nutrition, and nitrogen metabolism in cucumber under nitrate stress. J. Pineal Res. 62 (4), e12403. Zhang, Y., Liu, G., 2018. Effects of cesium accumulation on chlorophyll content and fluorescence of Brassica juncea L. J. Environ. Radioactiv. 195, 26–32. Zheng, P., Bai, X., Long, J., Li, K., Xu, H., 2016. Nitric oxide enhances the nitrate stress tolerance of spinach by scavenging ROS and RNS. Sci. Hortic. Amsterdam 213, 24–33. Zuk, M., Weber, R., Szopa, J., 2005. 14-3-3 Protein down-regulates key enzyme activities of nitrate and carbohydrate metabolism in potato plants. J. Agric. Food Chem. 53 (9), 3454–3460.

Protacio, C.M., Dai, Y.R., Lewis, E.F., Flores, H.E., 1992. Growth-stimulation by catecholamines in plant tissue/organ cultures. Plant Physiol. 98 (1), 89–96. Roosta, H.R., Schjoerring, J.K., 2007. Effects of ammonium toxicity on nitrogen metabolism and elemental profile of cucumber plants. J. Plant Nutr. 30 (10-12), 1933–1951. Ruan, Y.L., Llewellyn, D.J., Furbank, R.T., 2003. Suppression of sucrose synthase gene expression represses cotton fiber cell initiation, elongation, and seed development. Plant Cell 15 (4), 952–964. Seger, M., Gebril, S., Tabilona, J., Peel, A., Sengupta-Gopalan, C., 2015. Impact of concurrent overexpression of cytosolic glutamine synthetase (GS1) and sucrose phosphate synthase (SPS) on growth and development in transgenic tobacco. Planta 241 (1), 69–81. Skirycz, A., Widrych, A., Szopa, J., 2005. Expression of human dopamine receptor in potato (Solanum tuberosum) results in altered tuber carbon metabolism. BMC Plant Biol. 5 (1). Swiedrych, A., Lorenc-Kukula, K., Skirycz, A., Szopa, J., 2004a. The catecholamine biosynthesis route in potato is affected by stress. Plant Physiol. Biochem. 42 (7-8), 593–600. Swiedrych, A., Stachowiak, J., Szopa, J., 2004b. The catecholamine potentiates starch mobilization in transgenic potato tubers. Plant Physiol. Biochem. 42 (2), 103–109. Tong, X., Wang, Z., Ma, B., Zhang, C., Zhu, L., Ma, F., Li, M., 2018. Structure and expression analysis of the sucrose synthase gene family in apple. J. Integr. Agric. 17 (4), 847–856. Turan, S., Tripathy, B.C., 2015. Salt-stress induced modulation of chlorophyll biosynthesis during de-etiolation of rice seedlings. Physiol. Plant. 153 (3), 477–491. Vargas, W.A., Pontis, H.G., Salerno, G.L., 2007. Differential expression of alkaline and neutral invertases in response to environmental stresses: characterization of an alkaline isoform as a stress-response enzyme in wheat leaves. Planta 226 (6), 1535–1545. Vu, J., Niedz, R.P., Yelenosky, G., 1995. Activities of sucrose metabolism enzymes in glycerol-grown suspension cultures of sweet orange (Citrus sinensis L Osbeck). Environ. Exp. Bot. 35 (4) 455-455. Wang, H., Sui, X., Guo, J., Wang, Z., Cheng, J., Ma, S., Li, X., Zhang, Z., 2014. Antisense suppression of cucumber (Cucumis sativus L.) sucrose synthase 3 (CsSUS3) reduces hypoxic stress tolerance. Plant Cell Environ. 37 (3), 795–810.

11