- Email: [email protected]
Effects of heavy metals on the bioaccumulation, excretion and gut microbiome of black soldier fly larvae (Hermetia illucens)
Ecotoxicology and Environmental Safety 192 (2020) 110323
Contents lists available at ScienceDirect
Ecotoxicology and Environmental Safety journal homepage: www.elsevier.com/locate/ecoenv
Effects of heavy metals on the bioaccumulation, excretion and gut microbiome of black soldier fly larvae (Hermetia illucens)
T
Nan Wua,1, Xiaobo Wangb,1, Xiaoyan Xub,∗, Ruijie Caib, Shiyu Xiea a b
College of Engineering and Technology, Tianjin Agricultural University, Tianjin, 300384, China College of Agronomy and Resource and Environment, Tianjin Agricultural University, Tianjin, 300384, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Black soldier fly Intestinal microbiota Feces Heavy metals Accumulation
The black soldier fly larvae (BSFL) have become a promising candidate for waste disposal and are an ideal feed source for animal nutrition. The uptake of heavy metals could influence the growth of BSFL, but the effects of heavy metal pressures on the gut microbiota of BSFL are largely uncharacterized. Here, we examine the influences of Cu and Cd on the growth and gut microbiota of BSFL as well as the distribution of accumulated heavy metals in the larvae and their feces. Exposure to Cu (from 100 to 800 mg/kg) and Cd (from 10 to 80 mg/kg) did not significantly inhibit the weight gain of BSFL. With elevated exposure doses, the contents of both Cu and Cd accumulated in the bodies and feces of BSFL were remarkably increased. In the BSFL feces, Cu mainly existed as residues, while Cd mainly existed as either water-soluble states (in the low-exposure groups) or residues (in the high-exposure groups). Cd was more readily enriched (47.1%–91.3%) than Cu (< 30%) in vivo. More importantly, exposure to Cu and Cd remarkably altered the gut microbiota of BSFL, particularly in the phyla Proteobacteria, Firmicutes and Bacteroidetes. High exposure to the metals (i.e., Cu-800 and Cd-80 groups) substantially decreased the abundances of most of the dominant families, but significantly stimulated the enrichment of Brucellaceae, Enterobacteriaceae, Alcaligenaceae, Campylobacteraceae, and Enterococcaceae. Moreover, the bacterial diversity in the BSFL gut was significantly reduced following high exposure to the metals. These results may fill a gap in our knowledge of the effects of heavy metals on the intestinal microbiome of BSFL.
1. Introduction
black soldier fly larvae (BSFL) (Hermetia illucens (L.) (Diptera: Stratiomyidae)) have become a strikingly good candidate for bioconversion and common commercially available protein sources. The BSFL can be reared with various organic wastes including animal manure (Wynants et al., 2019). However, heavy metals existing in organic wastes may accumulate in the larvae and prepupae of black soldier flies and consequently in the food chain (Diener et al., 2015). Heavy metals have been identified as a potential hazard in various insects destined for animal feed (Schrogel and Watjen, 2019). There have been several studies examining the accumulation of heavy metals in BSFL and further affecting their growth and development (Biancarosa et al., 2018; Cai et al., 2018a; Diener et al., 2015; Gao et al., 2017; van der FelsKlerx et al., 2016). Concurrently, these results suggested that the accumulation patterns of heavy metals in the bodies of BSFL varied distinctively depending on metal types and exposure concentrations. Here, Cu and Cd were chosen as the target heavy metals for tests, since Cu and Cd can be easily found in animal manures and usually exhibit high concentrations.
The increasing quantities of animal manure have posed critical environmental problems in China. For the purposes of growth promotion and disease prevention, the excessive addition of heavy metals to animal feed commonly occurs in intensive animal production (Li et al., 2010; Zhu et al., 2013). Excessive heavy metals in feed are likely to be excreted in animal manures. A survey of animal manures from different farms in China revealed that the typical contents of Cu and Cd in pig manures were 642.1 mg/kg and 15.1 mg/kg, respectively (Zhang et al., 2012). These animal manures containing high levels of heavy metals, if left untreated, can have long-term negative implications for the environment. Thus, it is imperative to address the issue of livestock manure disposal. Apart from conventional technologies for manure treatment, biotransformation relying on saprophagous insects has become a promising sustainable approach for the management of livestock manure (Rehman et al., 2019). Among numerous saprophagous insects, the
∗
Corresponding author. E-mail address: [email protected] (X. Xu). 1 These authors contributed equally to this work. https://doi.org/10.1016/j.ecoenv.2020.110323 Received 26 November 2019; Received in revised form 25 January 2020; Accepted 9 February 2020 0147-6513/ © 2020 Elsevier Inc. All rights reserved.
Ecotoxicology and Environmental Safety 192 (2020) 110323
N. Wu, et al.
The collected feces of BSFL were air-dried and ground to sieve through 1 mm mesh. The extraction process of different forms of heavy metals was continuous, according to Chen's method (Chen, 2007) with a minor modification. (i) Water-soluble fraction: approximately 1.5 g of feces were leached using 12 mL of deionized water for 30 min with continuous agitation at room temperature. The solution was centrifuged at 6000 rpm for 10 min, and the supernatant was filtered through a 0.45 μm membrane to obtain the water-soluble fraction. (ii) Acid-soluble fraction: after being rinsed by deionized water, the feces were then leached using 12 mL of 0.1 mol/L HCl for 120 min with continuous agitation at room temperature. The other steps were the same as those mentioned above. (iii) Alkaline-soluble fraction: after being rinsed, the feces were then leached using 12 mL of 0.15 mol/L NaOH for 120 min. The other steps were the same as those mentioned above. (iv) Residual fraction: after being rinsed, the residual feces were finally digested in a 9 mL mixture of HCl, HNO3 and H2O2 (6:2:1, v/v/v) by a microwave digestion system (Mars 5, CEM Corp, Matthews, NC, USA). Recovery experiments were performed by spiking the standard solutions to the samples, and the recoveries of Cu and Cd were between 88% and 106%. The heavy metal concentrations of all the samples were determined using an atomic absorption spectrophotometer (AAS) (TAS-986AFG, PERSEE, Beijing, China). The standard solutions were prepared using Merck single-element standards for AAS (Merck Millipore, Darmstadt, Germany). For quality control, blanks were always run with the samples to test contamination and the reliability of data was ensured with repeated analysis of samples (n = 3). The limits of detection for Cu and Cd were 0.01 mg/kg, and the limits of quantitation for Cu and Cd were 0.03 mg/kg.
In insects, the excretion of excessive heavy metals via feces is considered an efficient way to reduce the metal concentrations accumulated in vivo (Jiang et al., 2018). However, very few studies have focused on the heavy metals excreted by BSFL or the different states of metals in their feces. These insect feces, as the byproducts of biotransformation process, can be used as organic fertilizers. It is crucial to elucidate various heavy metal forms in insect feces, considering that the bioavailabilities of different forms of metals are quite distinctive. The gut microbiota is a crucial contributor to functions of host health, metabolism and immunity, such as nutrient absorption by host (Zhu et al., 2018). Environmental contaminants may alter the composition of animal intestinal microbiota, and the patterns of shifts in gut microbiome can be quite different relying on the biological species and pollutant types (Cai et al., 2018b; Ma et al., 2019). Studies have shown that various heavy metals could affect the BSFL development; however, the influences of heavy metals on the intestinal microbiota of BSFL have never been investigated to the best of our knowledge. In view of the abovementioned points, this study is intended to investigate (i) the effects of heavy metals (Cu and Cd) on BSFL growth; (ii) the different forms (water-soluble, acid-soluble, alkali-soluble and residual states) of metals in BSFL feces; (iii) the accumulation percentages of metals in BSFL bodies and feces; and (vi) the shift in gut microbiota of BSFL affected by exposure to metals. 2. Materials and methods 2.1. Test organisms and exposure treatment Five-day-old BSFL were obtained from the BSFL breeding room in Research Center of Organic Waste Resource Utilization in Tianjin Agricultural University, Tianjin, China. Prior to the current experiment, the neonate larvae were fed with wheat bran moistened with deionized water (75% water content) and maintained at 30 ± 2 °C. A coppercontaining compound (CuSO4) and a cadmium-containing compound (CdSO4) were purchased from Guangfu Fine Chemical Research Institute, Tianjin, China. The compounds were dissolved in deionized water to prepare Cu (1000 mg/L) and Cd (100 mg/L) solutions as mother liquors for the subsequent experiments. Wheat bran obtained from Lida Flour Co., Ltd., Tianjin, China, was used as the diet. Wheat bran spiked with Cu (100, 200, 400 and 800 mg/kg dry wheat bran, referred to as Cu-100, Cu-200, Cu-400 and Cu-800, respectively) was obtained by thorough mixing of the wheat bran with an appropriate volume of Cu solution. Similarly, for the Cd study, the concentrations were 10, 20, 40 and 80 mg/kg dry wheat bran, referred to as Cd-10, Cd-20, Cd-40 and Cd-80, respectively. The selected concentrations of Cu and Cd for exposure tests are within the range of metal concentrations reported in contaminated manures or commercial organic fertilizers (Gao et al., 2017; Zhu et al., 2013). Additionally, the same volume of deionized water without added heavy metals was mixed with the wheat bran as a control. Each treatment was carried out in three replicates. For each replicate, 20 g BSFL were put into the plastic containers (each 21 × 15.5 × 10 cm) and fed daily with the wheat bran spiked with or without metals. The BSFL were kept at 30 ± 2 °C with 65 ± 5% relative humidity. Feeding stopped when the BSFL reached harvest sizes (total feeding period was 10 days). The BSFL and feces were separated by manual sieving (with 3 mm mesh).
2.3. DNA extraction and high-throughput sequencing analysis To investigate the community profile in the BSFL guts under the exposure to heavy metals, a total of five representative larvae samples from the control group (CK), the low-exposure groups (Cu-100 and Cd10) and the high-exposure groups (Cu-800 and Cd-80) were analyzed by high-throughput sequencing. Prior to DNA extraction, the collected BSFL were starved for 12 h to empty their digestive contents. The larvae were rinsed with sterilized water after cleaning with alcohol. To meet the minimum amount of DNA, the gut of approximately 30 larvae were dissected and pooled for each larval sample, and then stored at −80 °C prior to DNA extraction. Total DNA was extracted using the PowerSoil DNA Isolation Kit (MoBio Laboratories, Carlsbad, CA, USA). Purity and quality of the DNA were checked on 0.8% agarose gels. The gut DNA samples were analyzed by sequencing the V3–V4 regions of the 16 S rRNA genes (Cai et al., 2018b) on an Illumina MiSeq PE300 platform (Allwegene Co., Ltd, Beijing, China). Primer sets for the amplification reactions were 338 F (GTACTCCTACGGGAGGCAGCA) and 806 R (GTGGACTACHVGGGTWTCTAAT). The extraction of highquality sequences was first performed using the QIIME package (version 1.8.0), as described in the methods published previously (Luo et al., 2018). The sequences were clustered into operational taxonomic units (OTUs) at a similarity level of 97%, to generate rarefaction curves and to calculate the richness and diversity indices. The Ribosomal Database Project (RDP) Classifier tool was used to classify all sequences into different taxonomic groups. 2.4. Data statistical analysis Averages and standard deviations of all data were determined using Microsoft Excel, 2010. Differences among samples were analyzed using ANOVA by SPSS version 19.0 software package. Significant differences were detected at the 0.05 level. Principal coordinate analysis (PCoA) based on Bray-Curtis distance was conducted to determine the betadiversity of different bacterial communities in each treatment using QIIME. Spearman correlation analysis was performed between heavy metal concentrations and bacterial taxa.
2.2. Heavy metal analysis The total fresh weight of the collected BSFL in each container was weighted. A portion of the BSFL were then dried at 105 °C for subsequent metal analysis. After being ground to sieve through 0.25 mm mesh, 0.5 g of sample was digested in a 10 mL mixture of HNO3 and H2O2 (4:1, v/v) by a microwave digestion system (Mars 5, CEM Corp, Matthews, NC, USA) for 25 min. 2
Ecotoxicology and Environmental Safety 192 (2020) 110323
N. Wu, et al.
Fig. 1. The total fresh weight of BSFL in each container following exposure to Cu (a) and Cd (b), and the contents of Cu (c) and Cd (d) accumulated in the bodies of BSFL. Error bars represent standard error of triplicate. Columns marked by the same small letter do not vary significantly (P > 0.05).
3. Results and discussion
folds in the Cu treatments compared to those in the control (21.8 mg/ kg, P < 0.05). Cd contents were not detected in the control. In the lowexposure groups (Cd-10 and Cd-20), the corresponding concentrations were comparable (P > 0.05), at approximately 2 mg/kg. Compared with the Cd-10 group, the Cd concentrations in the high-exposure groups (Cd-40 and Cd-80) were significantly augmented by 3.6- and 15.3-folds, respectively (P < 0.05). The bioaccumulation factor (BAF) (metal concentration in the body divided by its concentration in the feed) was calculated according to Diener et al. (2015), as shown in Table S1. The BAFs of Cu ranged from 0.69 to 1.65, which were comparable to those values found in the fruit fly larvae (0.35–0.78) (Kazimirova and Ortel, 2000). With elevated Cu concentrations, an apparent decline in the BAFs for Cu was observed in the larvae. When the exposure concentration increased to 400 mg/kg or higher, the BAFs for Cu were smaller than 1. This phenomenon might be attributed to the self-protection mechanism of insects under the pressure of high concentrations of heavy metals. For example, Crawford et al. (1996) reported that grasshoppers could maintain a certain level of copper in the body through excretion. In the current work, BSFL could excrete Cu (section 3.3), and the concentrations of Cu in the BSFL feces were higher than those in their bodies, indicating that Cu was not retained by BSFL. However, under exposure to a high level of dietary Cu, this excretion mechanism had a limited capacity and a considerable amount of Cu accumulated in the BSFL bodies (up to 549.0 mg/kg). This value was much higher than the allowed limits for Cu (200 mg/kg) in animal feed in China (GB26419-2010). It is well known that Cd can be highly accumulated within various dipterans including BSFL (van der Fels-Klerx et al., 2016), since Cd2+ can be readily absorbed by cells through Ca2+ channels due to its similarity to Ca2+ (Braeckman et al., 1999). Here, the BAFs of Cd (from 0.10 to 0.32) were lower than those (BAFs > 1) reported in other BSFL studies (Biancarosa et al., 2018; Diener et al., 2015; Gao et al., 2017; van der Fels-Klerx et al., 2016). This inconsistency may be due to the higher exposure levels of Cd used in the present work, triggering a self-
3.1. Effects of Cu and Cd on the BSFL growth Fig. 1 illustrates the changes in the BSFL body weights under exposure to Cu and Cd at different concentrations. The weight of the BSFL fed with Cu-contaminated diets slightly increased compared to that of the control (122.6 ± 12.4 g) and reached a peak value (135.2 ± 5.1 g) under exposure to 400 mg/kg Cu (Fig. 1a). After that, an obvious decline in body weight occurred in the high-exposure group (Cu-800). But no significant differences in weight were observed between the Cu-exposure groups and the control (P > 0.05). A similar phenomenon was found in the Cd treatments. The BSFL weight was the largest (135.6 ± 16.8 g) when exposed to Cd at 20 mg/kg (Fig. 1b). No remarkable differences were observed among the Cd treatments and the control (P > 0.05). It is well known that Cu is a necessary trace element for the normal growth and reproduction of animals. This may explain why the addition of a certain dose of Cu (e.g. 400 mg/kg) stimulated the body weights of BSFL, although this variation was not significant. In the present work, neither Cu nor Cd significantly inhibited the weight gain of BSFL, and no death was observed during the experimental period. The results indicate that BSFL could endure Cu and Cd exposure at the examined levels. Similarly, BSFL have been reported to be highly tolerant to diets spiked with combined heavy metals (Cai et al., 2018a). These findings further revealed that the weight gain of BSFL was mainly interfered with Pb, Ni, B, and Hg rather than Cu, Cd or other metals.
3.2. Cu and Cd accumulated in the bodies of BSFL Dietary Cu and Cd could be transferred into the bodies of BSFL. With elevated exposure doses, the contents of both Cu and Cd accumulated in BSFL were remarkably increased (Fig. 1 c-d). The concentrations of Cu in vivo were significantly increased from approximately 7.6- to 25.23
Ecotoxicology and Environmental Safety 192 (2020) 110323
N. Wu, et al.
(section 3.4), supporting that this metal readily accumulated in BSFL. Accumulated Cd could affect the pupation rates of BSFL and delay pupation (Gao et al., 2017). In this work, high concentrations of Cd in BSFL (up to 25.3 mg/kg) were observed in certain exposure groups and exceeded the EU threshold value for Cd (2 mg/kg) in animal feed (Diener et al., 2015). This may pose a potential risk to animals or humans via food chains when using the harvested insects as feed sources, and thus merits considerable attention. 3.3. Cu and Cd in different forms in the feces of BSFL The concentrations of both Cu and Cd in various forms in the BSFL feces obviously grew with the increase in the tested concentrations (Fig. 2). The total concentrations of Cu in feces significantly climbed up from about 5.6- to 42.6-folds (182.3–1382.5 mg/kg) in the Cu-exposure groups compared to the control (32.4 mg/kg, P < 0.05). Regardless of whether the diets were spiked with Cu, the residual states were the primary forms (54.2%–71.7%) of Cu in feces. The acid-soluble forms occupied the smallest proportions (3.0%–8.7%) for all the samples except the Cu-800 group. The percentages of the other two fractions (water-soluble and alkali-soluble states) were generally comparable. Cd was not detected in feces in the control, similar to the findings for the BSFL bodies (Fig. 1d). When fed with Cd-contaminated diets, the total concentrations of Cd in feces evidently increased (up to 25.3 mg/ kg) compared with the control. In the low-exposure groups (Cd-10 and Cd-20), only the water-soluble states of Cd were observed in feces. Conversely, in the high-exposure groups (Cd-40 and Cd-80), residues became the dominant forms ranging from 39.8% to 67.6%, followed by the acid-soluble (20.0%–30.7%), water-soluble (8.5%–20.5%) and alkali-soluble (3.8%–9.0%) states. The existing forms of heavy metals in animal manures are mainly related to the chemical properties of heavy metals and the characteristics of manures. Here, we found that in most cases, the heavy metals mainly existed as residues in the BSFL feces after transformation. Our findings generally coincide with other studies concerning heavy metals in animal manures (Sungur et al., 2016; Wu et al., 2017). Chen, (2007) reported that heavy metals in residual and alkali-soluble forms (i.e., the complex state of humic acid) are “inert” for plants‚ while those in water-soluble and acid-soluble states (i.e., the complex state of fulvic acid) exhibit higher bioavailability for plants.
Fig. 2. (a) Cu and (b) Cd contents in different forms in BSFL feces. Error bars represent standard error of triplicate. Columns marked by the same small letter do not vary significantly (P > 0.05).
protection mechanism of BSFL. Additionally, the dietary availability of Cd might contribute to this difference (Biancarosa et al., 2018). Nevertheless, we found that Cd concentrations in the larvae were higher than those in the feces (section 3.3), which concurs with the findings of others (Diener et al., 2015; van der Fels-Klerx et al., 2016). Moreover, the retention of Cd in the BSFL bodies was strikingly high
3.4. Distributions of Cu and Cd in the bodies and feces of BSFL Fig. 3 depicts the accumulative percentages of Cu and Cd in the bodies and feces of BSFL. The distribution of heavy metals occurred to varying extents depending on metal type and exposure concentrations.
Fig. 3. The distributions of Cu and Cd in the bodies and feces of BSFL. 4
Ecotoxicology and Environmental Safety 192 (2020) 110323
N. Wu, et al.
(Adonis test, P < 0.005), particularly in the phyla Proteobacteria, Firmicutes and Bacteroidetes, according to LEfSe analysis (Fig. 5). In addition, principal coordinates analysis (PCoA) highlights that under high exposure to Cu, the BSFL gut microbiome was clustered separately from the other treatments in dimension 1, representing 68.49% of the total variation, and the microbial community from the Cd-80 group was separated from those of the other treatments in the second dimension (explaining 16.91% of the total variation) (Fig. 6a). The results further confirm that the BSFL microbiome was considerably altered due to high exposure to heavy metals, but this alteration diminished when under low exposure to metals, according to the similar clustering patterns of the samples from the CK, Cu-100 and Cd-10 groups. No significant difference in Chao1 index was observed among different groups Fig. S4), implying that the species richness of gut microbiota was not affected by metal exposure. However, Shannon index (Fig. 6b) indicates that significantly lower gut diversity was found in the Cu-800 or Cd-80 groups (P < 0.05) compared with that in the control. This variation was also confirmed by the Simpson index (Fig. S5), implying that high concentrations of Cu or Cd disturbed multiple members of the normal gut microbiota. Similar result has been reported from another animal experiment, in which the diversity of the gut microbiota declined in response to heavy metal exposure (Wang et al., 2019). The shift of gut community structure following exposure to heavy metals is further supported by Venn diagrams which reveal that only 28.9% (458) and 35.0% (579) of the OTUs detected were shared between the CK and Cu-exposed treatments, and between the CK and Cd-exposed treatments, respectively (Fig. 6c). The shift in the gut microbiota was further demonstrated in detail by examination at the phylum and family levels (Fig. 4). For example, the relative abundance of Proteobacteria increased significantly from 20.7% in CK to 67.0% in Cu-800 group (P < 0.01), but the proportions of Bacteroidetes and Firmicutes substantially declined from 33.6% to 18.9% (P < 0.05) and from 19.1% to 9.9% (P < 0.01), respectively (Fig. 4a). Moreover, a sharp decrease in Actinobacteria was also found in Cu-800 group (from 24.3% to 3.5%, P < 0.05). As for Cd (Fig. 4a), a similar variation trend was observed for Proteobacteria (increased to 45.7%, P < 0.01), Bacteroidetes (decreased to 19.2%, P < 0.05) and Firmicutes (decreased to 6.7%, P < 0.01) in Cd-80 group compared with CK. But high exposure to Cd did not trigger significant growth of Actinobacteria. It is noteworthy that low exposure to Cu or Cd did not cause significant changes in the abundances of these phyla. The phylum Proteobacteria is considered a signature of microbial dysbiosis in the gut microbiota (Wang et al., 2019). The increased proportion of Proteobacteria following high exposure to metals indicates that the gut microbiota was disturbed by Cu and Cd, which coincides with the observation of the earthworm gut exposed to As (Wang et al., 2019). Moreover, it is well established that Bacteroidetes and Firmicutes play vital roles in the lipid metabolism of mammals, suggesting that a change in the abundances of Bacteroidetes and Firmicutes might affect the body weight of animals (Zhu et al., 2018). Accordingly, the decrease in the abundances of Bacteroidetes and Firmicutes might contribute to the mild reduction in BSFL body weight in Cu-800 group (Fig. 1a). At family level, the observed increase in Proteobacteria in Cu-800 group was largely attributed to the dramatic enrichment in the families Brucellaceae, Enterobacteriaceae and Alcaligenaceae (increased by 1462, 11 and 234 times, respectively, P < 0.01) (Fig. 4b). Enterococcaceae, belonging to phylum Firmicutes, was also pronouncedly enriched (increased by 10 times, P < 0.01) in Cu-800 group compared to CK. On the contrary, the other main families in Cu-800 group substantially declined by 91%–99%, except for Porphyromonadaceae and Lactobacillaceae (decreased by 32% and 25%, respectively). Similarly, high exposure to Cd caused a reduction in the abundances of most families, decreasing by 32%–81%. However, Campylobacteraceae (phylum Proteobacteria) was significantly enriched in Cd-80 group (from 13.7% to 36.4%, P < 0.01) compared with that in the CK. Interestingly, high exposure to Cd also resulted in the growth of three families
For Cu, the corresponding proportions accumulated in the BSFL bodies were less than 30% in all the tested groups. The percentages of Cu in the bodies increased in the low-exposure group (Cu-100) and then decreased with the rise of exposure concentrations. The distribution of Cd in the control was not given due to the absence of Cd in the bodies and feces of BSFL. In the Cd-exposure groups, the accumulative percentages of Cd (47.1%–91.3%) in the bodies were evidently higher than those in the Cu-exposure groups, indicating that Cd was more readily enriched in vivo. Both the current work and previous studies (Biancarosa et al., 2018; Schmitt et al., 2019) concur that Cd is highly accumulative in BSFL. Additionally, there was a dramatic decline in the accumulative proportions in BSFL bodies with the increased Cd concentrations, possibly explained by the self-protection mechanism (e.g., through excretion) of insects (Crawford et al., 1996; Postma et al., 1996). Previous studies reported that the excretion of heavy metals via insect feces and exuvia was an efficient approach to mitigate internal metal concentrations (Jiang et al., 2018). The results illustrated the strikingly different accumulation patterns of Cu and Cd in the BSFL, further supporting the concept that the bioaccumulation of heavy metals occurred to a varying extent dependent on metal types, insect species, and development stages (Schrogel and Watjen, 2019). It should be noted that BSFL seem to possess stronger bioaccumulation capacities for Cd than for other heavy metals (e.g., Zn, Cr, As, Pb, and Hg), according to numerous studies (Biancarosa et al., 2018; Bulak et al., 2018; Diener et al., 2015; Gao et al., 2017). This reminds us of the need to focus on the potential risks associated with Cd when using BSFL as animal feed, especially for those BSFL fed with metal-contaminated animal manures. 3.5. Characterization of the BSFL gut microbiota The structure and composition of the bacterial community of the BSFL gut microbiota in five representative treatments (CK, Cu-100, Cu800, Cd-10 and Cd-80) were elucidated by high-throughput sequencing analysis. A total of 909,178 high quality sequences were obtained across all samples, which were sorted into 9,489 OTUs with at least 25,982 sequences and 463 OTUs in each sample. Bacteroidetes (average 33.6%), Actinobacteria (24.3%), Proteobacteria (20.7%) and Firmicutes (19.1%) were the most dominant phyla in BSFL gut (Fig. 4a), which were also observed as the core microbiota of BSFL gut in previous studies (Cai et al., 2018c; Wynants et al., 2019). Other phyla with low abundances (< 1%), such as RsaHf231, Fusobacteria and Acidobacteria, were also reported in BSFL gut fed with similar diets (Cai et al., 2018c). Moreover, > 98% of the Bacteroidetes was Bacteroidia, which was the predominant class (Fig. S1). The other three dominant classes were Actinobacteria (23.8%), Clostridia (14.7%) and Epsilonproteobacteria (13.7%). Bacteroidales (33.1%) and Micrococcales (18.4%) were the two dominant orders in BSFL gut (Fig. S2). Additionally, Porphyromonadaceae (25.3%), Beutenbergiaceae (18.2%) and Campylobacteraceae (13.7%) were the top three families (Fig. 4b). Among them, the Porphyromonadaceae family could possibly act as a BSFL gut biomarker (Jiang et al., 2019). There were 10 genera with relative abundances > 1% (Fig. S3). Salana, Parabacteroides and Campylobacter were the most abundant genera, accounting for 18.1%, 14.6% and 13.6% of the total bacteria, respectively. A previous study indicated that Dysgonomonas belonging to the phylum Bacteroidetes, was the predominant genus in BSFL gut (Jiang et al., 2019), but only a small proportion of Dysgonomonas (2.3%) was observed in this study. This might be related to the diets and cultivation conditions, given that the external environment and diet play key roles in shaping the gut microbiome (Ma et al., 2019). 3.6. Effects of Cu and Cd on the BSFL gut microbiota The result of high-throughput sequencing revealed that Cu or Cd exposure remarkably altered the microbial community of the BSFL gut 5
Ecotoxicology and Environmental Safety 192 (2020) 110323
N. Wu, et al.
Fig. 4. (a) Composition (mean, n = 3) of BSFL gut microbiota at phylum level among different treatments. Error bars represent standard error of triplicate. Columns marked by the same small letter do not vary significantly (P > 0.05). (b) The BSFL gut microbiota at family level. Bacterial OTUs counted below 1% of the total number of reads were categorized into ‘Other’.
loss. Spearman correlation analysis (Fig. 7) revealed that certain families, namely Desulfovibrionaceae, Comamonadaceae, Actinomycetaceae, Family_XI, Bacteroidaceae, and Lachnospiraceae, had strong negative relationships with Cu and Cd accumulated in the BSFL bodies or excreted feces. This implies that these bacteria in the BSFL gut may have some potential as indicators of environmental pollution with Cu and Cd. Additionally, most families showed similar variation tendencies in response to both Cu and Cd pressures, but some of them exhibited opposite trends under different metal stresses. For instance, Enterococcaceae were likely to better adapt to the Cu-exposure environment, but might not tolerate the stress of Cd, while Campylobacteraceae exhibited the opposite tendency. It is generally recognized that contaminants can influence the
(Brucellaceae, Enterobacteriaceae and Alcaligenaceae, increased by 53, 2 and 12 times, respectively) that were also significantly enriched in Cu800 group. Among the families significantly enriched following high exposure to metals, some family members may be related to potentially pathogenic bacteria. For instance, Brucellaceae are gram-negative bacteria which might cause brucellosis, one of the most widely distributed zoonoses worldwide (Casabuono et al., 2017). In addition, Enterobacteriaceae are reported to be associated with animal health and disease (Linton and Hinton, 1988). Campylobacter, accounting for the major proportion of Campylobacteracea (Fig. S3), might also be related to Campylobacter infections in both poultry and humans. This implies that exposure to Cu and Cd possibly increased the risk of BSFL suffering from an illness and thereby showing some symptoms, such as weight 6
Ecotoxicology and Environmental Safety 192 (2020) 110323
N. Wu, et al.
Fig. 5. Bacterial lineages with significantly different representation in BSFL gut. Panel shows Cladograms generated by LEfSe indicating enrichment of taxa among different treatments. Yellow nodes represent the taxa with no significant differences. Red, green, blue, purple, and cyan nodes represent the taxa which play an important role in the CK, Cd-10, Cd-80, Cu-100 and Cu-800 groups, respectively. Each successive circle is one step lower phylogenetically (phylum, class, order, family, and genus). The taxa alphabetically in the figure are displayed in the legend. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)
growth and development of animals by inducing changes in gut microbiota to alter the hosts' physiology, such as influencing the immune system, nutrient digestion and absorption, systemic glucose and lipid metabolism of the hosts (Ma et al., 2019). Although Cu and Cd at the examined levels did not significantly inhibit the weight gain of BSFL in this study, the diversity and composition of the gut microbiota were pronouncedly influenced by the heavy metals. It is speculated that the gut microbiota can rapidly shape resistance to contaminants, thereby protecting the host from harm. For instance, it has been reported that the bacterial community in BSFL gut could change considerably within short term to tolerate and digest tetracycline (Cai et al., 2018c).
the abundances of most of the dominant families, but significantly favored the enrichment of Brucellaceae, Enterobacteriaceae, Alcaligenaceae, Campylobacteraceae, and Enterococcaceae. Furthermore, the gut microbiota of BSFL was significantly shifted and the gut bacterial diversity pronouncedly declined, following high exposure to metals rather than low exposure. Overall, BSFL exhibited a relatively high tolerance to Cu and Cd, but oral exposure to the metals still disturbed the normal existence of the microorganisms in BSFL gut, even though no significant variation was observed in their weight gain.
4. Conclusions
Nan Wu: Formal analysis, Writing - original draft. Xiaobo Wang: Formal analysis. Xiaoyan Xu: Conceptualization, Methodology. Ruijie Cai: Methodology. Shiyu Xie: Methodology.
CRediT authorship contribution statement
The body weights of BSFL were not significantly inhibited by dietary Cu or Cd within the concentration ranges studied. With elevated exposure doses, the concentrations of both Cu and Cd accumulated in BSFL bodies and their feces were dramatically increased. In the feces of BSFL, Cu mainly existed as residues, but Cd mainly existed as either water-soluble states (in the low-exposure groups) or residues (in the high-exposure groups). It is noteworthy that Cd accumulated more readily (47.1%–91.3%) than Cu (< 30%) in the BSFL bodies. Highthroughput sequencing analysis indicated that Bacteroidetes, Actinobacteria, Proteobacteria and Firmicutes were the most dominant phyla in BSFL gut. High exposure to Cu and Cd substantially decreased
Acknowledgements This work was supported by the National Key Research and Development Program of China (2018YFD0500205), the National Natural Science Foundation of China (21607114), and Tianjin Science and Technology Plan Project (19ZYYFSN00010, 18ZXYENC00130). We appreciated the help from Dr. Guohao ZU during the anatomical process of insects. 7
Ecotoxicology and Environmental Safety 192 (2020) 110323
N. Wu, et al.
Fig. 6. (a) Principal coordinates analysis (PCoA) based on Bray-Curtis distance and (b) Shannon diversity indices in BSFL gut microbiome in different treatments. (c) Venn diagrams displaying the number of microbial OTUs in BSFL gut shared among different treatments. Fig. 7. Spearman correlation analysis between heavy metals and the abundances of main families across all groups (Body: metal concentrations accumulated in BSFL body; Fece: total concentrations of metals in BSFL feces). Blue and red colors represent positive and negative correlations. *P < 0.05, **P < 0.01. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)
Appendix A. Supplementary data
4051–4062. Cai, M., Ma, S., Hu, R., Tomberlin, J.K., Yu, C., Huang, Y., Zhan, S., Li, W., Zheng, L., Yu, Z., Zhang, J., 2018c. Systematic characterization and proposed pathway of tetracycline degradation in solid waste treatment by Hermetia illucens with intestinal microbiota. Environ. Pollut. 242, 634–642. Casabuono, A.C., Czibener, C., Del Giudice, M.G., Valguarnera, E., Ugalde, J.E., Couto, A.S., 2017. New features in the lipid A structure of Brucella suis and Brucella abortus Lipopolysaccharide. J. Am. Soc. Mass Spectrom. 28 (12), 2716–2723. Chen, H.M., 2007. The Preliminary Study on Existing Forms of Cadmium in Organic Fertilizers and Their Bioavailability. Master thesis. Southwest University, Chongqing, China. Crawford, L.A., Lepp, N.W., Hodkinson, I.D., 1996. Accumulation and egestion of dietary copper and cadmium by the grasshopper Locusta migratoria R & F (Orthoptera: acrididae). Environ. Pollut. 92 (3), 241–246. Diener, S., Zurbrügg, C., Tockner, K., 2015. Bioaccumulation of heavy metals in the black soldier fly, Hermetia illucens and effects on its life cycle. J. Insect. Food Feed. 1 (4), 261–270. Gao, Q., Wang, X., Wang, W., Lei, C., Zhu, F., 2017. Influences of chromium and cadmium on the development of black soldier fly larvae. Environ. Sci. Pollut. Res. 24 (9), 8637–8644. Jiang, C.L., Jin, W.Z., Tao, X.H., Zhang, Q., Zhu, J., Feng, S.Y., Xu, X.H., Li, H.Y., Wang, Z.H., Zhang, Z.J., 2019. Black soldier fly larvae (Hermetia illucens) strengthen the metabolic function of food waste biodegradation by gut microbiome. Microb. Biotechnol. 12 (3), 528–543. Jiang, D., Dong, X.W., Yan, S.C., 2018. Heavy Metal accumulation/excretion in and food
Supplementary data to this article can be found online at https:// doi.org/10.1016/j.ecoenv.2020.110323. References Biancarosa, I., Liland, N.S., Biemans, D., Araujo, P., Bruckner, C.G., Waagbø, R., Torstensen, B.E., Lock, E.J., Amlund, H., 2018. Uptake of heavy metals and arsenic in black soldier fly (Hermetia illucens) larvae grown on seaweed-enriched media. J. Sci. Food Agric. 98 (6), 2176–2183. Braeckman, B., Smagghe, G., Brutsaert, N., Cornelis, R., Raes, H., 1999. Cadmium uptake and defense mechanism in insect cells. Environ. Res. 80 (3), 231–243. Bulak, P., Polakowski, C., Nowak, K., Waśko, A., Wiącek, D., Bieganowski, A., 2018. Hermetia illucens as a new and promising species for use in entomoremediation. Sci. Total Environ. 633, 912–919. Cai, M., Hu, R., Zhang, K., Ma, S., Zheng, L., Yu, Z., Zhang, J., 2018a. Resistance of black soldier fly (Diptera: Stratiomyidae) larvae to combined heavy metals and potential application in municipal sewage sludge treatment. Environ. Sci. Pollut. Res. 25 (2), 1559–1567. Cai, M., Ma, S., Hu, R., Tomberlin, J.K., Thomashow, L.S., Zheng, L., Li, W., Yu, Z., Zhang, J., 2018b. Rapidly mitigating antibiotic resistant risks in chicken manure by Hermetia illucens bioconversion with intestinal microflora. Environ. Microbiol. 20 (11),
8
Ecotoxicology and Environmental Safety 192 (2020) 110323
N. Wu, et al.
mycotoxins and metals. Foods 8 (8), 288. Sungur, A., Soylak, M., Yilmaz, S., Ozcan, H., 2016. Heavy metal mobility and potential availability in animal manure: using a sequential extraction procedure. J. Mater. Cycles Waste Manag. 18 (3), 563–572. van der Fels-Klerx, H.J., Camenzuli, L., van der Lee, M.K., Oonincx, D.G., 2016. Uptake of cadmium, lead and arsenic by Tenebrio molitor and Hermetia illucens from contaminated substrates. PLoS One 11 (11), e0166186. Wang, H.T., Chi, Q.Q., Zhu, D., Li, G., Ding, J., An, X.L., Zheng, F., Zhu, Y.G., Xue, X.M., 2019. Arsenic and sulfamethoxazole increase the incidence of antibiotic resistance genes in the gut of earthworm. Environ. Sci. Technol. 53 (17), 10445–10453. Wu, S., Shen, Z., Yang, C., Zhou, Y., Li, X., Zeng, G., Ai, S., He, H., 2017. Effects of C/N ratio and bulking agent on speciation of Zn and Cu and enzymatic activity during pig manure composting. Int. Biodeterior. Biodegrad. 119, 429–436. Wynants, E., Frooninckx, L., Crauwels, S., Verreth, C., De Smet, J., Sandrock, C., Wohlfahrt, J., Van Schelt, J., Depraetere, S., Lievens, B., Van Miert, S., Claes, J., Van Campenhout, L., 2019. Assessing the microbiota of black soldier fly larvae (Hermetia illucens) reared on organic waste streams on four different locations at laboratory and large scale. Microb. Ecol. 77 (4), 913–930. Zhang, F., Li, Y., Yang, M., Li, W., 2012. Content of heavy metals in animal feeds and manures from farms of different scales in northeast China. Int. J. Environ. Res. Publ. Health 9 (8), 2658–2668. Zhu, D., An, X.L., Chen, Q.L., Yang, X.R., Christie, P., Ke, X., Wu, L.H., Zhu, Y.G., 2018. Antibiotics disturb the microbiome and increase the incidence of resistance genes in the gut of a common soil collembolan. Environ. Sci. Technol. 52 (5), 3081–3090. Zhu, Y.G., Johnson, T.A., Su, J.Q., Qiao, M., Guo, G.X., Stedtfeld, R.D., Hashsham, S.A., Tiedje, J.M., 2013. Diverse and abundant antibiotic resistance genes in Chinese swine farms. Proc. Natl. Acad. Sci. U.S.A. 110 (9), 3435–3440.
utilization of Lymantria dispar larvae fed with Zn- or Pb-stressed Populus alba berolinensis leaves. Environ. Entomol. 47 (5), 1329–1336. Kazimirova, M., Ortel, J., 2000. Metal accumulation by Ceratitis capitata (Diptera) and transfer to the parasitic wasp Coptera occidentalis (Hymenoptera). Environ. Toxicol. Chem. 19 (7), 1822–1829. Li, Y.X., Xiong, X., Lin, C.Y., Zhang, F.S., Li, W., Han, W., 2010. Cadmium in animal production and its potential hazard on Beijing and Fuxin farmlands. J. Hazard Mater. 177 (1–3), 475–480. Linton, A.H., Hinton, M.H., 1988. Enterobacteriaceae associated with animals in health and disease. Soc. Appl. Bacteriol. Symp. Ser. 17, 71–85. Luo, G., Rensing, C., Chen, H., Liu, M., Wang, M., Guo, S., Ling, N., Shen, Q., 2018. Deciphering the associations between soil microbial diversity and ecosystem multifunctionality driven by long-term fertilization management. Funct. Ecol. 32 (4), 1103–1116. Ma, J., Zhu, D., Chen, Q.L., Ding, J., Zhu, Y.G., Sheng, G.D., Qiu, Y.P., 2019. Exposure to tetracycline perturbs the microbiome of soil oligochaete Enchytraeus crypticus. Sci. Total Environ. 654, 643–650. Postma, J.F., van Nugteren, P., Buckert-de Jong, M.C., 1996. Increased cadmium excretion in metal-adapted populations of the midge chironomus riparius (diptera). Environ. Toxicol. Chem. 15 (3), 332–339. Rehman, K., Rehman, R., Somroo, A., Cai, M., Zheng, L., Xiao, X., Rehman, A., Rehman, A., Tomberlin, J., Yu, Z., Zhang, J., 2019. Enhanced bioconversion of dairy and chicken manure by the interaction of exogenous bacteria and black soldier fly larvae. J. Environ. Manag. 237, 75–83. Schmitt, E., Belghit, I., Johansen, J., Leushuis, R., Lock, E.J., Melsen, D., Shanmugam, R.K.R., Van Loon, J., Paul, A., 2019. Growth and safety assessment of feed streams for black soldier fly larvae: a case study with aquaculture sludge. Animals 9, 189. Schrogel, P., Watjen, W., 2019. Insects for food and feed-safety aspects related to
9
Contents lists available at ScienceDirect
Ecotoxicology and Environmental Safety journal homepage: www.elsevier.com/locate/ecoenv
Effects of heavy metals on the bioaccumulation, excretion and gut microbiome of black soldier fly larvae (Hermetia illucens)
T
Nan Wua,1, Xiaobo Wangb,1, Xiaoyan Xub,∗, Ruijie Caib, Shiyu Xiea a b
College of Engineering and Technology, Tianjin Agricultural University, Tianjin, 300384, China College of Agronomy and Resource and Environment, Tianjin Agricultural University, Tianjin, 300384, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Black soldier fly Intestinal microbiota Feces Heavy metals Accumulation
The black soldier fly larvae (BSFL) have become a promising candidate for waste disposal and are an ideal feed source for animal nutrition. The uptake of heavy metals could influence the growth of BSFL, but the effects of heavy metal pressures on the gut microbiota of BSFL are largely uncharacterized. Here, we examine the influences of Cu and Cd on the growth and gut microbiota of BSFL as well as the distribution of accumulated heavy metals in the larvae and their feces. Exposure to Cu (from 100 to 800 mg/kg) and Cd (from 10 to 80 mg/kg) did not significantly inhibit the weight gain of BSFL. With elevated exposure doses, the contents of both Cu and Cd accumulated in the bodies and feces of BSFL were remarkably increased. In the BSFL feces, Cu mainly existed as residues, while Cd mainly existed as either water-soluble states (in the low-exposure groups) or residues (in the high-exposure groups). Cd was more readily enriched (47.1%–91.3%) than Cu (< 30%) in vivo. More importantly, exposure to Cu and Cd remarkably altered the gut microbiota of BSFL, particularly in the phyla Proteobacteria, Firmicutes and Bacteroidetes. High exposure to the metals (i.e., Cu-800 and Cd-80 groups) substantially decreased the abundances of most of the dominant families, but significantly stimulated the enrichment of Brucellaceae, Enterobacteriaceae, Alcaligenaceae, Campylobacteraceae, and Enterococcaceae. Moreover, the bacterial diversity in the BSFL gut was significantly reduced following high exposure to the metals. These results may fill a gap in our knowledge of the effects of heavy metals on the intestinal microbiome of BSFL.
1. Introduction
black soldier fly larvae (BSFL) (Hermetia illucens (L.) (Diptera: Stratiomyidae)) have become a strikingly good candidate for bioconversion and common commercially available protein sources. The BSFL can be reared with various organic wastes including animal manure (Wynants et al., 2019). However, heavy metals existing in organic wastes may accumulate in the larvae and prepupae of black soldier flies and consequently in the food chain (Diener et al., 2015). Heavy metals have been identified as a potential hazard in various insects destined for animal feed (Schrogel and Watjen, 2019). There have been several studies examining the accumulation of heavy metals in BSFL and further affecting their growth and development (Biancarosa et al., 2018; Cai et al., 2018a; Diener et al., 2015; Gao et al., 2017; van der FelsKlerx et al., 2016). Concurrently, these results suggested that the accumulation patterns of heavy metals in the bodies of BSFL varied distinctively depending on metal types and exposure concentrations. Here, Cu and Cd were chosen as the target heavy metals for tests, since Cu and Cd can be easily found in animal manures and usually exhibit high concentrations.
The increasing quantities of animal manure have posed critical environmental problems in China. For the purposes of growth promotion and disease prevention, the excessive addition of heavy metals to animal feed commonly occurs in intensive animal production (Li et al., 2010; Zhu et al., 2013). Excessive heavy metals in feed are likely to be excreted in animal manures. A survey of animal manures from different farms in China revealed that the typical contents of Cu and Cd in pig manures were 642.1 mg/kg and 15.1 mg/kg, respectively (Zhang et al., 2012). These animal manures containing high levels of heavy metals, if left untreated, can have long-term negative implications for the environment. Thus, it is imperative to address the issue of livestock manure disposal. Apart from conventional technologies for manure treatment, biotransformation relying on saprophagous insects has become a promising sustainable approach for the management of livestock manure (Rehman et al., 2019). Among numerous saprophagous insects, the
∗
Corresponding author. E-mail address: [email protected] (X. Xu). 1 These authors contributed equally to this work. https://doi.org/10.1016/j.ecoenv.2020.110323 Received 26 November 2019; Received in revised form 25 January 2020; Accepted 9 February 2020 0147-6513/ © 2020 Elsevier Inc. All rights reserved.
Ecotoxicology and Environmental Safety 192 (2020) 110323
N. Wu, et al.
The collected feces of BSFL were air-dried and ground to sieve through 1 mm mesh. The extraction process of different forms of heavy metals was continuous, according to Chen's method (Chen, 2007) with a minor modification. (i) Water-soluble fraction: approximately 1.5 g of feces were leached using 12 mL of deionized water for 30 min with continuous agitation at room temperature. The solution was centrifuged at 6000 rpm for 10 min, and the supernatant was filtered through a 0.45 μm membrane to obtain the water-soluble fraction. (ii) Acid-soluble fraction: after being rinsed by deionized water, the feces were then leached using 12 mL of 0.1 mol/L HCl for 120 min with continuous agitation at room temperature. The other steps were the same as those mentioned above. (iii) Alkaline-soluble fraction: after being rinsed, the feces were then leached using 12 mL of 0.15 mol/L NaOH for 120 min. The other steps were the same as those mentioned above. (iv) Residual fraction: after being rinsed, the residual feces were finally digested in a 9 mL mixture of HCl, HNO3 and H2O2 (6:2:1, v/v/v) by a microwave digestion system (Mars 5, CEM Corp, Matthews, NC, USA). Recovery experiments were performed by spiking the standard solutions to the samples, and the recoveries of Cu and Cd were between 88% and 106%. The heavy metal concentrations of all the samples were determined using an atomic absorption spectrophotometer (AAS) (TAS-986AFG, PERSEE, Beijing, China). The standard solutions were prepared using Merck single-element standards for AAS (Merck Millipore, Darmstadt, Germany). For quality control, blanks were always run with the samples to test contamination and the reliability of data was ensured with repeated analysis of samples (n = 3). The limits of detection for Cu and Cd were 0.01 mg/kg, and the limits of quantitation for Cu and Cd were 0.03 mg/kg.
In insects, the excretion of excessive heavy metals via feces is considered an efficient way to reduce the metal concentrations accumulated in vivo (Jiang et al., 2018). However, very few studies have focused on the heavy metals excreted by BSFL or the different states of metals in their feces. These insect feces, as the byproducts of biotransformation process, can be used as organic fertilizers. It is crucial to elucidate various heavy metal forms in insect feces, considering that the bioavailabilities of different forms of metals are quite distinctive. The gut microbiota is a crucial contributor to functions of host health, metabolism and immunity, such as nutrient absorption by host (Zhu et al., 2018). Environmental contaminants may alter the composition of animal intestinal microbiota, and the patterns of shifts in gut microbiome can be quite different relying on the biological species and pollutant types (Cai et al., 2018b; Ma et al., 2019). Studies have shown that various heavy metals could affect the BSFL development; however, the influences of heavy metals on the intestinal microbiota of BSFL have never been investigated to the best of our knowledge. In view of the abovementioned points, this study is intended to investigate (i) the effects of heavy metals (Cu and Cd) on BSFL growth; (ii) the different forms (water-soluble, acid-soluble, alkali-soluble and residual states) of metals in BSFL feces; (iii) the accumulation percentages of metals in BSFL bodies and feces; and (vi) the shift in gut microbiota of BSFL affected by exposure to metals. 2. Materials and methods 2.1. Test organisms and exposure treatment Five-day-old BSFL were obtained from the BSFL breeding room in Research Center of Organic Waste Resource Utilization in Tianjin Agricultural University, Tianjin, China. Prior to the current experiment, the neonate larvae were fed with wheat bran moistened with deionized water (75% water content) and maintained at 30 ± 2 °C. A coppercontaining compound (CuSO4) and a cadmium-containing compound (CdSO4) were purchased from Guangfu Fine Chemical Research Institute, Tianjin, China. The compounds were dissolved in deionized water to prepare Cu (1000 mg/L) and Cd (100 mg/L) solutions as mother liquors for the subsequent experiments. Wheat bran obtained from Lida Flour Co., Ltd., Tianjin, China, was used as the diet. Wheat bran spiked with Cu (100, 200, 400 and 800 mg/kg dry wheat bran, referred to as Cu-100, Cu-200, Cu-400 and Cu-800, respectively) was obtained by thorough mixing of the wheat bran with an appropriate volume of Cu solution. Similarly, for the Cd study, the concentrations were 10, 20, 40 and 80 mg/kg dry wheat bran, referred to as Cd-10, Cd-20, Cd-40 and Cd-80, respectively. The selected concentrations of Cu and Cd for exposure tests are within the range of metal concentrations reported in contaminated manures or commercial organic fertilizers (Gao et al., 2017; Zhu et al., 2013). Additionally, the same volume of deionized water without added heavy metals was mixed with the wheat bran as a control. Each treatment was carried out in three replicates. For each replicate, 20 g BSFL were put into the plastic containers (each 21 × 15.5 × 10 cm) and fed daily with the wheat bran spiked with or without metals. The BSFL were kept at 30 ± 2 °C with 65 ± 5% relative humidity. Feeding stopped when the BSFL reached harvest sizes (total feeding period was 10 days). The BSFL and feces were separated by manual sieving (with 3 mm mesh).
2.3. DNA extraction and high-throughput sequencing analysis To investigate the community profile in the BSFL guts under the exposure to heavy metals, a total of five representative larvae samples from the control group (CK), the low-exposure groups (Cu-100 and Cd10) and the high-exposure groups (Cu-800 and Cd-80) were analyzed by high-throughput sequencing. Prior to DNA extraction, the collected BSFL were starved for 12 h to empty their digestive contents. The larvae were rinsed with sterilized water after cleaning with alcohol. To meet the minimum amount of DNA, the gut of approximately 30 larvae were dissected and pooled for each larval sample, and then stored at −80 °C prior to DNA extraction. Total DNA was extracted using the PowerSoil DNA Isolation Kit (MoBio Laboratories, Carlsbad, CA, USA). Purity and quality of the DNA were checked on 0.8% agarose gels. The gut DNA samples were analyzed by sequencing the V3–V4 regions of the 16 S rRNA genes (Cai et al., 2018b) on an Illumina MiSeq PE300 platform (Allwegene Co., Ltd, Beijing, China). Primer sets for the amplification reactions were 338 F (GTACTCCTACGGGAGGCAGCA) and 806 R (GTGGACTACHVGGGTWTCTAAT). The extraction of highquality sequences was first performed using the QIIME package (version 1.8.0), as described in the methods published previously (Luo et al., 2018). The sequences were clustered into operational taxonomic units (OTUs) at a similarity level of 97%, to generate rarefaction curves and to calculate the richness and diversity indices. The Ribosomal Database Project (RDP) Classifier tool was used to classify all sequences into different taxonomic groups. 2.4. Data statistical analysis Averages and standard deviations of all data were determined using Microsoft Excel, 2010. Differences among samples were analyzed using ANOVA by SPSS version 19.0 software package. Significant differences were detected at the 0.05 level. Principal coordinate analysis (PCoA) based on Bray-Curtis distance was conducted to determine the betadiversity of different bacterial communities in each treatment using QIIME. Spearman correlation analysis was performed between heavy metal concentrations and bacterial taxa.
2.2. Heavy metal analysis The total fresh weight of the collected BSFL in each container was weighted. A portion of the BSFL were then dried at 105 °C for subsequent metal analysis. After being ground to sieve through 0.25 mm mesh, 0.5 g of sample was digested in a 10 mL mixture of HNO3 and H2O2 (4:1, v/v) by a microwave digestion system (Mars 5, CEM Corp, Matthews, NC, USA) for 25 min. 2
Ecotoxicology and Environmental Safety 192 (2020) 110323
N. Wu, et al.
Fig. 1. The total fresh weight of BSFL in each container following exposure to Cu (a) and Cd (b), and the contents of Cu (c) and Cd (d) accumulated in the bodies of BSFL. Error bars represent standard error of triplicate. Columns marked by the same small letter do not vary significantly (P > 0.05).
3. Results and discussion
folds in the Cu treatments compared to those in the control (21.8 mg/ kg, P < 0.05). Cd contents were not detected in the control. In the lowexposure groups (Cd-10 and Cd-20), the corresponding concentrations were comparable (P > 0.05), at approximately 2 mg/kg. Compared with the Cd-10 group, the Cd concentrations in the high-exposure groups (Cd-40 and Cd-80) were significantly augmented by 3.6- and 15.3-folds, respectively (P < 0.05). The bioaccumulation factor (BAF) (metal concentration in the body divided by its concentration in the feed) was calculated according to Diener et al. (2015), as shown in Table S1. The BAFs of Cu ranged from 0.69 to 1.65, which were comparable to those values found in the fruit fly larvae (0.35–0.78) (Kazimirova and Ortel, 2000). With elevated Cu concentrations, an apparent decline in the BAFs for Cu was observed in the larvae. When the exposure concentration increased to 400 mg/kg or higher, the BAFs for Cu were smaller than 1. This phenomenon might be attributed to the self-protection mechanism of insects under the pressure of high concentrations of heavy metals. For example, Crawford et al. (1996) reported that grasshoppers could maintain a certain level of copper in the body through excretion. In the current work, BSFL could excrete Cu (section 3.3), and the concentrations of Cu in the BSFL feces were higher than those in their bodies, indicating that Cu was not retained by BSFL. However, under exposure to a high level of dietary Cu, this excretion mechanism had a limited capacity and a considerable amount of Cu accumulated in the BSFL bodies (up to 549.0 mg/kg). This value was much higher than the allowed limits for Cu (200 mg/kg) in animal feed in China (GB26419-2010). It is well known that Cd can be highly accumulated within various dipterans including BSFL (van der Fels-Klerx et al., 2016), since Cd2+ can be readily absorbed by cells through Ca2+ channels due to its similarity to Ca2+ (Braeckman et al., 1999). Here, the BAFs of Cd (from 0.10 to 0.32) were lower than those (BAFs > 1) reported in other BSFL studies (Biancarosa et al., 2018; Diener et al., 2015; Gao et al., 2017; van der Fels-Klerx et al., 2016). This inconsistency may be due to the higher exposure levels of Cd used in the present work, triggering a self-
3.1. Effects of Cu and Cd on the BSFL growth Fig. 1 illustrates the changes in the BSFL body weights under exposure to Cu and Cd at different concentrations. The weight of the BSFL fed with Cu-contaminated diets slightly increased compared to that of the control (122.6 ± 12.4 g) and reached a peak value (135.2 ± 5.1 g) under exposure to 400 mg/kg Cu (Fig. 1a). After that, an obvious decline in body weight occurred in the high-exposure group (Cu-800). But no significant differences in weight were observed between the Cu-exposure groups and the control (P > 0.05). A similar phenomenon was found in the Cd treatments. The BSFL weight was the largest (135.6 ± 16.8 g) when exposed to Cd at 20 mg/kg (Fig. 1b). No remarkable differences were observed among the Cd treatments and the control (P > 0.05). It is well known that Cu is a necessary trace element for the normal growth and reproduction of animals. This may explain why the addition of a certain dose of Cu (e.g. 400 mg/kg) stimulated the body weights of BSFL, although this variation was not significant. In the present work, neither Cu nor Cd significantly inhibited the weight gain of BSFL, and no death was observed during the experimental period. The results indicate that BSFL could endure Cu and Cd exposure at the examined levels. Similarly, BSFL have been reported to be highly tolerant to diets spiked with combined heavy metals (Cai et al., 2018a). These findings further revealed that the weight gain of BSFL was mainly interfered with Pb, Ni, B, and Hg rather than Cu, Cd or other metals.
3.2. Cu and Cd accumulated in the bodies of BSFL Dietary Cu and Cd could be transferred into the bodies of BSFL. With elevated exposure doses, the contents of both Cu and Cd accumulated in BSFL were remarkably increased (Fig. 1 c-d). The concentrations of Cu in vivo were significantly increased from approximately 7.6- to 25.23
Ecotoxicology and Environmental Safety 192 (2020) 110323
N. Wu, et al.
(section 3.4), supporting that this metal readily accumulated in BSFL. Accumulated Cd could affect the pupation rates of BSFL and delay pupation (Gao et al., 2017). In this work, high concentrations of Cd in BSFL (up to 25.3 mg/kg) were observed in certain exposure groups and exceeded the EU threshold value for Cd (2 mg/kg) in animal feed (Diener et al., 2015). This may pose a potential risk to animals or humans via food chains when using the harvested insects as feed sources, and thus merits considerable attention. 3.3. Cu and Cd in different forms in the feces of BSFL The concentrations of both Cu and Cd in various forms in the BSFL feces obviously grew with the increase in the tested concentrations (Fig. 2). The total concentrations of Cu in feces significantly climbed up from about 5.6- to 42.6-folds (182.3–1382.5 mg/kg) in the Cu-exposure groups compared to the control (32.4 mg/kg, P < 0.05). Regardless of whether the diets were spiked with Cu, the residual states were the primary forms (54.2%–71.7%) of Cu in feces. The acid-soluble forms occupied the smallest proportions (3.0%–8.7%) for all the samples except the Cu-800 group. The percentages of the other two fractions (water-soluble and alkali-soluble states) were generally comparable. Cd was not detected in feces in the control, similar to the findings for the BSFL bodies (Fig. 1d). When fed with Cd-contaminated diets, the total concentrations of Cd in feces evidently increased (up to 25.3 mg/ kg) compared with the control. In the low-exposure groups (Cd-10 and Cd-20), only the water-soluble states of Cd were observed in feces. Conversely, in the high-exposure groups (Cd-40 and Cd-80), residues became the dominant forms ranging from 39.8% to 67.6%, followed by the acid-soluble (20.0%–30.7%), water-soluble (8.5%–20.5%) and alkali-soluble (3.8%–9.0%) states. The existing forms of heavy metals in animal manures are mainly related to the chemical properties of heavy metals and the characteristics of manures. Here, we found that in most cases, the heavy metals mainly existed as residues in the BSFL feces after transformation. Our findings generally coincide with other studies concerning heavy metals in animal manures (Sungur et al., 2016; Wu et al., 2017). Chen, (2007) reported that heavy metals in residual and alkali-soluble forms (i.e., the complex state of humic acid) are “inert” for plants‚ while those in water-soluble and acid-soluble states (i.e., the complex state of fulvic acid) exhibit higher bioavailability for plants.
Fig. 2. (a) Cu and (b) Cd contents in different forms in BSFL feces. Error bars represent standard error of triplicate. Columns marked by the same small letter do not vary significantly (P > 0.05).
protection mechanism of BSFL. Additionally, the dietary availability of Cd might contribute to this difference (Biancarosa et al., 2018). Nevertheless, we found that Cd concentrations in the larvae were higher than those in the feces (section 3.3), which concurs with the findings of others (Diener et al., 2015; van der Fels-Klerx et al., 2016). Moreover, the retention of Cd in the BSFL bodies was strikingly high
3.4. Distributions of Cu and Cd in the bodies and feces of BSFL Fig. 3 depicts the accumulative percentages of Cu and Cd in the bodies and feces of BSFL. The distribution of heavy metals occurred to varying extents depending on metal type and exposure concentrations.
Fig. 3. The distributions of Cu and Cd in the bodies and feces of BSFL. 4
Ecotoxicology and Environmental Safety 192 (2020) 110323
N. Wu, et al.
(Adonis test, P < 0.005), particularly in the phyla Proteobacteria, Firmicutes and Bacteroidetes, according to LEfSe analysis (Fig. 5). In addition, principal coordinates analysis (PCoA) highlights that under high exposure to Cu, the BSFL gut microbiome was clustered separately from the other treatments in dimension 1, representing 68.49% of the total variation, and the microbial community from the Cd-80 group was separated from those of the other treatments in the second dimension (explaining 16.91% of the total variation) (Fig. 6a). The results further confirm that the BSFL microbiome was considerably altered due to high exposure to heavy metals, but this alteration diminished when under low exposure to metals, according to the similar clustering patterns of the samples from the CK, Cu-100 and Cd-10 groups. No significant difference in Chao1 index was observed among different groups Fig. S4), implying that the species richness of gut microbiota was not affected by metal exposure. However, Shannon index (Fig. 6b) indicates that significantly lower gut diversity was found in the Cu-800 or Cd-80 groups (P < 0.05) compared with that in the control. This variation was also confirmed by the Simpson index (Fig. S5), implying that high concentrations of Cu or Cd disturbed multiple members of the normal gut microbiota. Similar result has been reported from another animal experiment, in which the diversity of the gut microbiota declined in response to heavy metal exposure (Wang et al., 2019). The shift of gut community structure following exposure to heavy metals is further supported by Venn diagrams which reveal that only 28.9% (458) and 35.0% (579) of the OTUs detected were shared between the CK and Cu-exposed treatments, and between the CK and Cd-exposed treatments, respectively (Fig. 6c). The shift in the gut microbiota was further demonstrated in detail by examination at the phylum and family levels (Fig. 4). For example, the relative abundance of Proteobacteria increased significantly from 20.7% in CK to 67.0% in Cu-800 group (P < 0.01), but the proportions of Bacteroidetes and Firmicutes substantially declined from 33.6% to 18.9% (P < 0.05) and from 19.1% to 9.9% (P < 0.01), respectively (Fig. 4a). Moreover, a sharp decrease in Actinobacteria was also found in Cu-800 group (from 24.3% to 3.5%, P < 0.05). As for Cd (Fig. 4a), a similar variation trend was observed for Proteobacteria (increased to 45.7%, P < 0.01), Bacteroidetes (decreased to 19.2%, P < 0.05) and Firmicutes (decreased to 6.7%, P < 0.01) in Cd-80 group compared with CK. But high exposure to Cd did not trigger significant growth of Actinobacteria. It is noteworthy that low exposure to Cu or Cd did not cause significant changes in the abundances of these phyla. The phylum Proteobacteria is considered a signature of microbial dysbiosis in the gut microbiota (Wang et al., 2019). The increased proportion of Proteobacteria following high exposure to metals indicates that the gut microbiota was disturbed by Cu and Cd, which coincides with the observation of the earthworm gut exposed to As (Wang et al., 2019). Moreover, it is well established that Bacteroidetes and Firmicutes play vital roles in the lipid metabolism of mammals, suggesting that a change in the abundances of Bacteroidetes and Firmicutes might affect the body weight of animals (Zhu et al., 2018). Accordingly, the decrease in the abundances of Bacteroidetes and Firmicutes might contribute to the mild reduction in BSFL body weight in Cu-800 group (Fig. 1a). At family level, the observed increase in Proteobacteria in Cu-800 group was largely attributed to the dramatic enrichment in the families Brucellaceae, Enterobacteriaceae and Alcaligenaceae (increased by 1462, 11 and 234 times, respectively, P < 0.01) (Fig. 4b). Enterococcaceae, belonging to phylum Firmicutes, was also pronouncedly enriched (increased by 10 times, P < 0.01) in Cu-800 group compared to CK. On the contrary, the other main families in Cu-800 group substantially declined by 91%–99%, except for Porphyromonadaceae and Lactobacillaceae (decreased by 32% and 25%, respectively). Similarly, high exposure to Cd caused a reduction in the abundances of most families, decreasing by 32%–81%. However, Campylobacteraceae (phylum Proteobacteria) was significantly enriched in Cd-80 group (from 13.7% to 36.4%, P < 0.01) compared with that in the CK. Interestingly, high exposure to Cd also resulted in the growth of three families
For Cu, the corresponding proportions accumulated in the BSFL bodies were less than 30% in all the tested groups. The percentages of Cu in the bodies increased in the low-exposure group (Cu-100) and then decreased with the rise of exposure concentrations. The distribution of Cd in the control was not given due to the absence of Cd in the bodies and feces of BSFL. In the Cd-exposure groups, the accumulative percentages of Cd (47.1%–91.3%) in the bodies were evidently higher than those in the Cu-exposure groups, indicating that Cd was more readily enriched in vivo. Both the current work and previous studies (Biancarosa et al., 2018; Schmitt et al., 2019) concur that Cd is highly accumulative in BSFL. Additionally, there was a dramatic decline in the accumulative proportions in BSFL bodies with the increased Cd concentrations, possibly explained by the self-protection mechanism (e.g., through excretion) of insects (Crawford et al., 1996; Postma et al., 1996). Previous studies reported that the excretion of heavy metals via insect feces and exuvia was an efficient approach to mitigate internal metal concentrations (Jiang et al., 2018). The results illustrated the strikingly different accumulation patterns of Cu and Cd in the BSFL, further supporting the concept that the bioaccumulation of heavy metals occurred to a varying extent dependent on metal types, insect species, and development stages (Schrogel and Watjen, 2019). It should be noted that BSFL seem to possess stronger bioaccumulation capacities for Cd than for other heavy metals (e.g., Zn, Cr, As, Pb, and Hg), according to numerous studies (Biancarosa et al., 2018; Bulak et al., 2018; Diener et al., 2015; Gao et al., 2017). This reminds us of the need to focus on the potential risks associated with Cd when using BSFL as animal feed, especially for those BSFL fed with metal-contaminated animal manures. 3.5. Characterization of the BSFL gut microbiota The structure and composition of the bacterial community of the BSFL gut microbiota in five representative treatments (CK, Cu-100, Cu800, Cd-10 and Cd-80) were elucidated by high-throughput sequencing analysis. A total of 909,178 high quality sequences were obtained across all samples, which were sorted into 9,489 OTUs with at least 25,982 sequences and 463 OTUs in each sample. Bacteroidetes (average 33.6%), Actinobacteria (24.3%), Proteobacteria (20.7%) and Firmicutes (19.1%) were the most dominant phyla in BSFL gut (Fig. 4a), which were also observed as the core microbiota of BSFL gut in previous studies (Cai et al., 2018c; Wynants et al., 2019). Other phyla with low abundances (< 1%), such as RsaHf231, Fusobacteria and Acidobacteria, were also reported in BSFL gut fed with similar diets (Cai et al., 2018c). Moreover, > 98% of the Bacteroidetes was Bacteroidia, which was the predominant class (Fig. S1). The other three dominant classes were Actinobacteria (23.8%), Clostridia (14.7%) and Epsilonproteobacteria (13.7%). Bacteroidales (33.1%) and Micrococcales (18.4%) were the two dominant orders in BSFL gut (Fig. S2). Additionally, Porphyromonadaceae (25.3%), Beutenbergiaceae (18.2%) and Campylobacteraceae (13.7%) were the top three families (Fig. 4b). Among them, the Porphyromonadaceae family could possibly act as a BSFL gut biomarker (Jiang et al., 2019). There were 10 genera with relative abundances > 1% (Fig. S3). Salana, Parabacteroides and Campylobacter were the most abundant genera, accounting for 18.1%, 14.6% and 13.6% of the total bacteria, respectively. A previous study indicated that Dysgonomonas belonging to the phylum Bacteroidetes, was the predominant genus in BSFL gut (Jiang et al., 2019), but only a small proportion of Dysgonomonas (2.3%) was observed in this study. This might be related to the diets and cultivation conditions, given that the external environment and diet play key roles in shaping the gut microbiome (Ma et al., 2019). 3.6. Effects of Cu and Cd on the BSFL gut microbiota The result of high-throughput sequencing revealed that Cu or Cd exposure remarkably altered the microbial community of the BSFL gut 5
Ecotoxicology and Environmental Safety 192 (2020) 110323
N. Wu, et al.
Fig. 4. (a) Composition (mean, n = 3) of BSFL gut microbiota at phylum level among different treatments. Error bars represent standard error of triplicate. Columns marked by the same small letter do not vary significantly (P > 0.05). (b) The BSFL gut microbiota at family level. Bacterial OTUs counted below 1% of the total number of reads were categorized into ‘Other’.
loss. Spearman correlation analysis (Fig. 7) revealed that certain families, namely Desulfovibrionaceae, Comamonadaceae, Actinomycetaceae, Family_XI, Bacteroidaceae, and Lachnospiraceae, had strong negative relationships with Cu and Cd accumulated in the BSFL bodies or excreted feces. This implies that these bacteria in the BSFL gut may have some potential as indicators of environmental pollution with Cu and Cd. Additionally, most families showed similar variation tendencies in response to both Cu and Cd pressures, but some of them exhibited opposite trends under different metal stresses. For instance, Enterococcaceae were likely to better adapt to the Cu-exposure environment, but might not tolerate the stress of Cd, while Campylobacteraceae exhibited the opposite tendency. It is generally recognized that contaminants can influence the
(Brucellaceae, Enterobacteriaceae and Alcaligenaceae, increased by 53, 2 and 12 times, respectively) that were also significantly enriched in Cu800 group. Among the families significantly enriched following high exposure to metals, some family members may be related to potentially pathogenic bacteria. For instance, Brucellaceae are gram-negative bacteria which might cause brucellosis, one of the most widely distributed zoonoses worldwide (Casabuono et al., 2017). In addition, Enterobacteriaceae are reported to be associated with animal health and disease (Linton and Hinton, 1988). Campylobacter, accounting for the major proportion of Campylobacteracea (Fig. S3), might also be related to Campylobacter infections in both poultry and humans. This implies that exposure to Cu and Cd possibly increased the risk of BSFL suffering from an illness and thereby showing some symptoms, such as weight 6
Ecotoxicology and Environmental Safety 192 (2020) 110323
N. Wu, et al.
Fig. 5. Bacterial lineages with significantly different representation in BSFL gut. Panel shows Cladograms generated by LEfSe indicating enrichment of taxa among different treatments. Yellow nodes represent the taxa with no significant differences. Red, green, blue, purple, and cyan nodes represent the taxa which play an important role in the CK, Cd-10, Cd-80, Cu-100 and Cu-800 groups, respectively. Each successive circle is one step lower phylogenetically (phylum, class, order, family, and genus). The taxa alphabetically in the figure are displayed in the legend. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)
growth and development of animals by inducing changes in gut microbiota to alter the hosts' physiology, such as influencing the immune system, nutrient digestion and absorption, systemic glucose and lipid metabolism of the hosts (Ma et al., 2019). Although Cu and Cd at the examined levels did not significantly inhibit the weight gain of BSFL in this study, the diversity and composition of the gut microbiota were pronouncedly influenced by the heavy metals. It is speculated that the gut microbiota can rapidly shape resistance to contaminants, thereby protecting the host from harm. For instance, it has been reported that the bacterial community in BSFL gut could change considerably within short term to tolerate and digest tetracycline (Cai et al., 2018c).
the abundances of most of the dominant families, but significantly favored the enrichment of Brucellaceae, Enterobacteriaceae, Alcaligenaceae, Campylobacteraceae, and Enterococcaceae. Furthermore, the gut microbiota of BSFL was significantly shifted and the gut bacterial diversity pronouncedly declined, following high exposure to metals rather than low exposure. Overall, BSFL exhibited a relatively high tolerance to Cu and Cd, but oral exposure to the metals still disturbed the normal existence of the microorganisms in BSFL gut, even though no significant variation was observed in their weight gain.
4. Conclusions
Nan Wu: Formal analysis, Writing - original draft. Xiaobo Wang: Formal analysis. Xiaoyan Xu: Conceptualization, Methodology. Ruijie Cai: Methodology. Shiyu Xie: Methodology.
CRediT authorship contribution statement
The body weights of BSFL were not significantly inhibited by dietary Cu or Cd within the concentration ranges studied. With elevated exposure doses, the concentrations of both Cu and Cd accumulated in BSFL bodies and their feces were dramatically increased. In the feces of BSFL, Cu mainly existed as residues, but Cd mainly existed as either water-soluble states (in the low-exposure groups) or residues (in the high-exposure groups). It is noteworthy that Cd accumulated more readily (47.1%–91.3%) than Cu (< 30%) in the BSFL bodies. Highthroughput sequencing analysis indicated that Bacteroidetes, Actinobacteria, Proteobacteria and Firmicutes were the most dominant phyla in BSFL gut. High exposure to Cu and Cd substantially decreased
Acknowledgements This work was supported by the National Key Research and Development Program of China (2018YFD0500205), the National Natural Science Foundation of China (21607114), and Tianjin Science and Technology Plan Project (19ZYYFSN00010, 18ZXYENC00130). We appreciated the help from Dr. Guohao ZU during the anatomical process of insects. 7
Ecotoxicology and Environmental Safety 192 (2020) 110323
N. Wu, et al.
Fig. 6. (a) Principal coordinates analysis (PCoA) based on Bray-Curtis distance and (b) Shannon diversity indices in BSFL gut microbiome in different treatments. (c) Venn diagrams displaying the number of microbial OTUs in BSFL gut shared among different treatments. Fig. 7. Spearman correlation analysis between heavy metals and the abundances of main families across all groups (Body: metal concentrations accumulated in BSFL body; Fece: total concentrations of metals in BSFL feces). Blue and red colors represent positive and negative correlations. *P < 0.05, **P < 0.01. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)
Appendix A. Supplementary data
4051–4062. Cai, M., Ma, S., Hu, R., Tomberlin, J.K., Yu, C., Huang, Y., Zhan, S., Li, W., Zheng, L., Yu, Z., Zhang, J., 2018c. Systematic characterization and proposed pathway of tetracycline degradation in solid waste treatment by Hermetia illucens with intestinal microbiota. Environ. Pollut. 242, 634–642. Casabuono, A.C., Czibener, C., Del Giudice, M.G., Valguarnera, E., Ugalde, J.E., Couto, A.S., 2017. New features in the lipid A structure of Brucella suis and Brucella abortus Lipopolysaccharide. J. Am. Soc. Mass Spectrom. 28 (12), 2716–2723. Chen, H.M., 2007. The Preliminary Study on Existing Forms of Cadmium in Organic Fertilizers and Their Bioavailability. Master thesis. Southwest University, Chongqing, China. Crawford, L.A., Lepp, N.W., Hodkinson, I.D., 1996. Accumulation and egestion of dietary copper and cadmium by the grasshopper Locusta migratoria R & F (Orthoptera: acrididae). Environ. Pollut. 92 (3), 241–246. Diener, S., Zurbrügg, C., Tockner, K., 2015. Bioaccumulation of heavy metals in the black soldier fly, Hermetia illucens and effects on its life cycle. J. Insect. Food Feed. 1 (4), 261–270. Gao, Q., Wang, X., Wang, W., Lei, C., Zhu, F., 2017. Influences of chromium and cadmium on the development of black soldier fly larvae. Environ. Sci. Pollut. Res. 24 (9), 8637–8644. Jiang, C.L., Jin, W.Z., Tao, X.H., Zhang, Q., Zhu, J., Feng, S.Y., Xu, X.H., Li, H.Y., Wang, Z.H., Zhang, Z.J., 2019. Black soldier fly larvae (Hermetia illucens) strengthen the metabolic function of food waste biodegradation by gut microbiome. Microb. Biotechnol. 12 (3), 528–543. Jiang, D., Dong, X.W., Yan, S.C., 2018. Heavy Metal accumulation/excretion in and food
Supplementary data to this article can be found online at https:// doi.org/10.1016/j.ecoenv.2020.110323. References Biancarosa, I., Liland, N.S., Biemans, D., Araujo, P., Bruckner, C.G., Waagbø, R., Torstensen, B.E., Lock, E.J., Amlund, H., 2018. Uptake of heavy metals and arsenic in black soldier fly (Hermetia illucens) larvae grown on seaweed-enriched media. J. Sci. Food Agric. 98 (6), 2176–2183. Braeckman, B., Smagghe, G., Brutsaert, N., Cornelis, R., Raes, H., 1999. Cadmium uptake and defense mechanism in insect cells. Environ. Res. 80 (3), 231–243. Bulak, P., Polakowski, C., Nowak, K., Waśko, A., Wiącek, D., Bieganowski, A., 2018. Hermetia illucens as a new and promising species for use in entomoremediation. Sci. Total Environ. 633, 912–919. Cai, M., Hu, R., Zhang, K., Ma, S., Zheng, L., Yu, Z., Zhang, J., 2018a. Resistance of black soldier fly (Diptera: Stratiomyidae) larvae to combined heavy metals and potential application in municipal sewage sludge treatment. Environ. Sci. Pollut. Res. 25 (2), 1559–1567. Cai, M., Ma, S., Hu, R., Tomberlin, J.K., Thomashow, L.S., Zheng, L., Li, W., Yu, Z., Zhang, J., 2018b. Rapidly mitigating antibiotic resistant risks in chicken manure by Hermetia illucens bioconversion with intestinal microflora. Environ. Microbiol. 20 (11),
8
Ecotoxicology and Environmental Safety 192 (2020) 110323
N. Wu, et al.
mycotoxins and metals. Foods 8 (8), 288. Sungur, A., Soylak, M., Yilmaz, S., Ozcan, H., 2016. Heavy metal mobility and potential availability in animal manure: using a sequential extraction procedure. J. Mater. Cycles Waste Manag. 18 (3), 563–572. van der Fels-Klerx, H.J., Camenzuli, L., van der Lee, M.K., Oonincx, D.G., 2016. Uptake of cadmium, lead and arsenic by Tenebrio molitor and Hermetia illucens from contaminated substrates. PLoS One 11 (11), e0166186. Wang, H.T., Chi, Q.Q., Zhu, D., Li, G., Ding, J., An, X.L., Zheng, F., Zhu, Y.G., Xue, X.M., 2019. Arsenic and sulfamethoxazole increase the incidence of antibiotic resistance genes in the gut of earthworm. Environ. Sci. Technol. 53 (17), 10445–10453. Wu, S., Shen, Z., Yang, C., Zhou, Y., Li, X., Zeng, G., Ai, S., He, H., 2017. Effects of C/N ratio and bulking agent on speciation of Zn and Cu and enzymatic activity during pig manure composting. Int. Biodeterior. Biodegrad. 119, 429–436. Wynants, E., Frooninckx, L., Crauwels, S., Verreth, C., De Smet, J., Sandrock, C., Wohlfahrt, J., Van Schelt, J., Depraetere, S., Lievens, B., Van Miert, S., Claes, J., Van Campenhout, L., 2019. Assessing the microbiota of black soldier fly larvae (Hermetia illucens) reared on organic waste streams on four different locations at laboratory and large scale. Microb. Ecol. 77 (4), 913–930. Zhang, F., Li, Y., Yang, M., Li, W., 2012. Content of heavy metals in animal feeds and manures from farms of different scales in northeast China. Int. J. Environ. Res. Publ. Health 9 (8), 2658–2668. Zhu, D., An, X.L., Chen, Q.L., Yang, X.R., Christie, P., Ke, X., Wu, L.H., Zhu, Y.G., 2018. Antibiotics disturb the microbiome and increase the incidence of resistance genes in the gut of a common soil collembolan. Environ. Sci. Technol. 52 (5), 3081–3090. Zhu, Y.G., Johnson, T.A., Su, J.Q., Qiao, M., Guo, G.X., Stedtfeld, R.D., Hashsham, S.A., Tiedje, J.M., 2013. Diverse and abundant antibiotic resistance genes in Chinese swine farms. Proc. Natl. Acad. Sci. U.S.A. 110 (9), 3435–3440.
utilization of Lymantria dispar larvae fed with Zn- or Pb-stressed Populus alba berolinensis leaves. Environ. Entomol. 47 (5), 1329–1336. Kazimirova, M., Ortel, J., 2000. Metal accumulation by Ceratitis capitata (Diptera) and transfer to the parasitic wasp Coptera occidentalis (Hymenoptera). Environ. Toxicol. Chem. 19 (7), 1822–1829. Li, Y.X., Xiong, X., Lin, C.Y., Zhang, F.S., Li, W., Han, W., 2010. Cadmium in animal production and its potential hazard on Beijing and Fuxin farmlands. J. Hazard Mater. 177 (1–3), 475–480. Linton, A.H., Hinton, M.H., 1988. Enterobacteriaceae associated with animals in health and disease. Soc. Appl. Bacteriol. Symp. Ser. 17, 71–85. Luo, G., Rensing, C., Chen, H., Liu, M., Wang, M., Guo, S., Ling, N., Shen, Q., 2018. Deciphering the associations between soil microbial diversity and ecosystem multifunctionality driven by long-term fertilization management. Funct. Ecol. 32 (4), 1103–1116. Ma, J., Zhu, D., Chen, Q.L., Ding, J., Zhu, Y.G., Sheng, G.D., Qiu, Y.P., 2019. Exposure to tetracycline perturbs the microbiome of soil oligochaete Enchytraeus crypticus. Sci. Total Environ. 654, 643–650. Postma, J.F., van Nugteren, P., Buckert-de Jong, M.C., 1996. Increased cadmium excretion in metal-adapted populations of the midge chironomus riparius (diptera). Environ. Toxicol. Chem. 15 (3), 332–339. Rehman, K., Rehman, R., Somroo, A., Cai, M., Zheng, L., Xiao, X., Rehman, A., Rehman, A., Tomberlin, J., Yu, Z., Zhang, J., 2019. Enhanced bioconversion of dairy and chicken manure by the interaction of exogenous bacteria and black soldier fly larvae. J. Environ. Manag. 237, 75–83. Schmitt, E., Belghit, I., Johansen, J., Leushuis, R., Lock, E.J., Melsen, D., Shanmugam, R.K.R., Van Loon, J., Paul, A., 2019. Growth and safety assessment of feed streams for black soldier fly larvae: a case study with aquaculture sludge. Animals 9, 189. Schrogel, P., Watjen, W., 2019. Insects for food and feed-safety aspects related to
9