Effects of histone deacetylation inhibition on neuronal differentiation of embryonic mouse neural stem cells

Neuroscience 143 (2006) 939 –951

EFFECTS OF HISTONE DEACETYLATION INHIBITION ON NEURONAL DIFFERENTIATION OF EMBRYONIC MOUSE NEURAL STEM CELLS V. BALASUBRAMANIYAN, E. BODDEKE, R. BAKELS, B. KÜST, S. KOOISTRA, A. VENEMAN AND S. COPRAY*

Neural stem cells (NSCs) in the CNS are characterized by their capacity for self-renewal and for generating neurons, astrocytes, or oligodendrocytes during embryogenesis but also (at specific locations) in the adult brain (Gage, 2000). The differentiation pathway toward one of these cell types is the outcome of an interplay between molecular cues from the cell’s microenvironment and the intracellular machinery regulating gene transcription. The gene transcription process underlying neural differentiation is mediated by transcriptional activators and repressors: some genes have to be transcribed in a sequential, temporal, or continuous fashion while others have to be silenced (He and Rosenfeld, 1991). Various epigenetic mechanisms play a crucial role in the regulation of these transcription events (for a reviews see Hsieh and Gage, 2004). A major mechanism to regulate the accessibility of DNA sequences on the chromosome for transcription is the modulation of chromatin structure by histone acetylation. In this mechanism, the amino terminal end of the nucleosomal histones is subjected to acetylation controlled by histone acetyl transferases (HATs) and histone deacetylases (HDACs). Acetylation of lysine in the histone tail by HATs causes chromatin relaxation and decompaction allowing access to promotor DNA sequences for transcriptional activators. Reversely, histone deacetylation by HDACs causes chromatin compaction and consequently gene repression (for reviews see (Grozinger and Schreiber, 2002; Lehrmann et al., 2002; Marks et al., 2003; Peterson, 2002)). Histone deacetylation processes have been shown to be involved in the repression of neuronal genes in non-neuronal cells: HDAC 1 and 2 in combination with co-repressors CoREST, N-CoR, and mSin3A are recruited by REST, a repressor element-1 binding site (RE1) -silencing transcription factor (Chong et al., 1995), also known as neuron-restrictive silencer factor (NRSF) (Schoenherr and Anderson, 1995a; Schoenherr et al., 1996); REST blocks the transcription of neuronal target genes by binding to RE1/neuron-restrictive silencer element (NRSE) present in regulatory regions of a number of neuronal genes (Ballas et al., 2001; Huang et al., 1999; Lunyak et al., 2002, 2004; Schoenherr and Anderson, 1995b); activation of REST/NRSF target genes in NSCs has been shown to be sufficient to cause neuronal differentiation (Su et al., 2004). The significance of chromatin rearrangement via HDACs, either coupled or uncoupled to REST activity, in the process of neuronal differentiation has been demonstrated in culture experiments with neuroblastoma (Neuro2a) and neural progenitor cells using pharmacological inhibitors of HDACs. Inhibition of HDACs in Neuro2a cells by trichostatin A (TSA) modified the levels of expression of HDACs

Department of Medical Physiology, University Medical Center Groningen, University of Groningen, A. Deusinglaan 1, 9713 AV Groningen, The Netherlands

Abstract—Neural stem cells (NSCs) are multipotent cells that have the capacity for self-renewal and for differentiation into the major cell types of the nervous system, i.e. neurons, astrocytes and oligodendrocytes. The molecular mechanisms regulating gene transcription resulting in NSC differentiation and cell lineage specification are slowly being unraveled. An important mechanism in transcriptional regulation is modulation of chromatin by histone acetylation and deacetylation, allowing or blocking the access of transcriptional factors to DNA sequences. The precise involvement of histone acetyltransferases and histone deacetylases (HDACs) in the differentiation of NSCs into mature functional neurons is still to be revealed. In this in vitro study we have investigated the effects of the HDAC inhibitor trichostatin A (TSA) on the differentiation pattern of embryonic mouse NSCs during culture in a minimal, serum-free medium, lacking any induction or growth factor. We demonstrated that under these basic conditions TSA treatment increased neuronal differentiation of the NSCs and decreased astrocyte differentiation. Most strikingly, electrophysiological recordings revealed that in our minimal culture system only TSA-treated NSC-derived neurons developed normal electrophysiological membrane properties characteristic for functional, i.e. excitable and firing, neurons. Furthermore, TSAtreated NSC-derived neurons were characterized by an increased elongation and arborization of the dendrites. Our study shows that chromatin structure modulation by HDACs plays an important role in the transcriptional regulation of the neuronal differentiation of embryonic NSCs particularly as far as the development of functional properties are concerned. Manipulation of HDAC activity may be an important tool to generate specific neuronal populations from NSCs for transplantation purposes. © 2006 IBRO. Published by Elsevier Ltd. All rights reserved. Key words: epigenetic modification, trichostatin A, neurons, astrocytes, chromatin modulation. *Corresponding author. Tel: ⫹31-50-3632785; fax: ⫹31-50-3632751. E-mail address: [email protected] (S. Copray). Abbreviations: ChAT, choline acetyltransferase; EGF, epidermal growth factor; FGF, fibroblast growth factor; GFAP, glial fibrillary acidic protein; HAT, histone acetyl transferase; HDAC, histone deacetylase; MAP, microtubule-associated protein; NeuroD, neurogenic differentiation transcription factor; NRSE, neuron-restrictive silencer element; NRSF, neuron-restrictive silencing factor; NSC, neural stem cell; NSE, neuron specific enolase; PBS, phosphate-buffered saline; PFA, paraformaldehyde; REST, repressor element-1 binding site-silencing transcription factor; RE1, repressor element-1 binding site; S.E.M., standard error of the mean; TH, tyrosine hydroxylase; TSA, trichostatin A; VPA, valproic acid.

0306-4522/06$30.00⫹0.00 © 2006 IBRO. Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.neuroscience.2006.08.082

939

940

V. Balasubramaniyan et al. / Neuroscience 143 (2006) 939 –951

(Ajamian et al., 2004), induced cell cycle exit for neuronal differentiation (Inokoshi et al., 1999), and activated the tyrosine hydroxylase (TH) promotor (Kim et al., 2003). Recently, Hsieh et al. (2004b) demonstrated that inhibition of HDACs in multipotent adult rat hippocampal progenitor cells promoted the neuronal fate, mediated at least partly through the induction of neurogenic transcription factors including neurogenic differentiation transcription factor (NeuroD). The role of HDACs in neuronal differentiation of embryonic NSCs is still obscure. In a previous study, we have cultured mouse embryonic NSCs in a minimal, serum-free medium (Balasubramaniyan et al., 2004). Under these conditions approximately 20% of the NSCs differentiated into neurons, expressing the basic morphological characteristics of neurons. However, none of these neurons developed proper electrophysiological properties and lacked appropriate voltage-dependent channels characteristic for a functional neuron. It was concluded that the gene transcription programs for the morphological and the electrophysiological differentiation of an embryonic mouse NSC into a neuron are independently regulated. In the present study we aimed to investigate the role of HDACs in neuronal differentiation of embryonic NSCs in vitro, in particular their involvement in electrophysiological differentiation and full neuronal maturation of embryonic NSCs. To that purpose, we have exposed mouse embryonic NSCs in vitro to the HDAC inhibitor, TSA and analyzed its effect on morphological and electrophysiological aspects of neuronal differentiation.

EXPERIMENTAL PROCEDURES All experiments were carried out in accordance with the U.S. National Institutes of Health Guide for the Care and Use of Experimental Animals; for the collection of embryonic neural stem cells from anesthetized mice, a minimum number of animals was used. Every effort was made to minimize animal suffering.

Cell culture NSCs were isolated from mouse embryonic whole brain (E14) and cultured according to Reynolds et al. (1992) with minor modifications. Briefly, a whole brain was minced into small pieces, incubated with 0.05% trypsin EDTA for 30 min at room temperature and mechanically triturated through a 26-gauge needle. Cells were cultured in serum-free neurobasal media supplemented with: human recombinant epidermal growth factor (EGF) (20 ng/ml, Invitrogen, Breda, The Netherlands), bFGF (20 ng/ml, Invitrogen), B27 (Life Technologies-BRL, Breda, The Netherlands), penicillin– streptomycin 1% (Sigma, Zwijndrecht, The Netherlands), L-glutamine 1%, glutamax 1% in T25 (Nunc, Roskilde, Denmark) culture flasks in a humidified 5% CO2/95% air incubator at 37 °C. Within 5–7 days the cells grew as free floating neurospheres. Floating neurospheres were collected by centrifugation and passaged after mechanical dissociation with a fire-polished Pasteur pipette every 3– 4 days.

NSC differentiation For differentiation, neurospheres (passages 2–5) were mechanically dissociated and 15,000 –20,000 viable NSCs were plated onto poly-L-lysine (10 ␮g/ml, Sigma)/laminin (5 ␮g/ml, Sigma) -coated 12 mm glass coverslips in serum-free neurobasal me-

dium. Serum-free neurobasal medium was supplemented with glutamine, glutamax, B27, and penicillin/streptomycin as described above. A number of these cultures were treated with specific HDAC inhibitor TSA (Sigma) during the first 24 h. For determining dose dependency cells were treated with doses ranging from 0.1, 1, to 10 ng/ml of TSA. To test the toxic effect of TSA on NSCs, cells were treated with 10 ng/ml of TSA for 24 h and fixed with 4% paraformaldehyde (PFA) at 24 h or 96 h. Viable cells were identified and counted using Hoechst nuclear staining. In all the experiments, media were refreshed once in 2 days. After a culture period of 8 days, cells were fixed with 4% PFA and processed for immunohistochemistry.

Immunohistochemistry Cells were washed three times with pre-heated (37 °C) 0.1 M phosphate-buffered saline (PBS) and then fixed with 4% PFA in 0.1 M PBS (pH 7.4) for 15 min, followed by washing with PBS. Subsequently, the cells were pre-incubated with blocking solution containing 1% normal goat serum (Vector Laboratories, Burlingame, CA, USA), 10% BSA and 0.25% Triton X-100 in 0.1 M PBS for 30 min, followed by overnight incubation at 4 °C with the following primary antibodies: anti-nestin (1:200, Chemicon, Hampshire, UK), anti-choline acetyltransferase (ChAT, 1:500; Chemicon), anti-GABA (1:500; Chemicon), anti-TH (1:500; Chemicon), anti-glial fibrillary acidic protein (GFAP, 1:200; Chemicon), anti-O4 (1:200, Chemicon), anti-␤-tubulin III (1:200, Sigma-Aldrich), anti-neuron specific enolase (NSE, 1:100; Sigma-Aldrich) and anti-acetylated H3 (1:500; Upstate, Lake Placid, NY, USA), and anti-microtubule-associated protein 2abc (MAP2abc, 1:500; Chemicon; this MAP2 antibody shows by far the greatest immunoreactivity with the HMW-MAP2 (MAP2A and MAP2B) and only to a much less extent with MAP2C). After overnight incubation with primary antibodies, cells were washed with PBS and incubated with FITC- or CY3-conjugated goat anti-rabbit or mouse IgG antibodies (Jackson Laboratories, Bar Harbor, ME, USA) for two hour at room temperature. To visualize nuclei, cells were counterstained with Hoechst 3342, nuclear staining (Sigma). Finally, coverslips were mounted on glass slides with anti-fading fluorescent mounting media (Vectashield, The Netherlands) and examined under a Zeiss fluorescent microscope.

Western blot analysis Changes in histone acetylation in the NSCs due to the TSA treatment were confirmed by Western blot analysis. Briefly, undifferentiated neurospheres were treated with or without TSA (10 ng/ml) for 24 h. Cells were washed twice with ice-cold PBS and lysed on ice with Triton Extraction Buffer (TEB:PBS containing 0.5% Triton-X 100 v/v,2 mM phenylmethyl sulfonyl fluoride (PMSF) and 0.02%v/v sodium azide) for 10 min. After lysis, acid soluble proteins were extracted overnight at 4 °C with 2 N HCl. Equal amounts of cells (1⫻106) were separated electrophoretically on 15% SDS–polyacrylamide gels and transferred to Hybond-ECL nitrocellulose membrane (Amersham Biosciences, Dübendorf, Switzerland). The membranes were blocked with 10% non-fat dry milk in PBS and incubated with the primary antibody (anti-acetyl H3 1:5000, anti-␥-tubulin 1:5000 Sigma) overnight, followed by a 2-h incubation with the appropriate horseradish peroxidase– conjugated antibody (Amersham Biosciences). Specific bands were visualized by ECLTM Western Blotting Detection System.

Quantitative morphological analysis of neurite formation Neuronal (MAP2abc-positive) cells were randomly selected for morphometric analysis according to a protocol previously described for cultured Purkinje neurons (Schrenk et al., 2002). Neu-

V. Balasubramaniyan et al. / Neuroscience 143 (2006) 939 –951

941

Table 1. Primers used in quantitative RT-PCR analysis Gene

Acc no

Forward primer (5=-3=)

Backward primer (5=-3=)

Product size

mChAT mNav1.2 mGAP43 mSCG10 mNeuro D mHMBS mBeta actin mGUS

NM_009891 AJ810516 NM_008083 NM_025285 NM_010894 XM129404 X03672 J03047

TGGGTCTCTGAATACTGGCTGA ATCTGCCTCAACATGGTGAC ACCATGCTGTGCTGTATGAG ATGGCGGAGGAGAAGCTGAT TACGGCACCATGGACAGCTC CCGAGCCAAGGACCAGGATA AGACCTCTATGCCAACACAG CGCATGTTCAGTGAGGAGTA

GGGCTAGAGTTGACTGGCAGG GGTGAACAGGACGATGAACA GCAGCCTTATGAGCCTTATC CTTGTTCCTGCGAACCTCTG GGCTGGTGCAGTCAGTTAGG CTCCTTCCAGGTGCCTCAGA TAGGAGCCAGAGCAGTAATC CTCTCCGACCACGTATTCTT

71 105 107 126 108 107 95 90

rons were photographed with a high-resolution charge-coupled device camera at a 200⫻ magnification. The images were analyzed using a morphometric program supplied by ANALYSIS Soft Imaging System (Munster, Germany). The following parameters were determined from the micrographs: (i) the number of primary dendrites, (ii) the number of dendritic branching points, (iii) the length of the longest dendrite (i.e. distance between the most distal dendrite end and cell body), and (iv) the total dendritic tree area. Independent experiments were performed and repeated four times. For each condition, 60 cells were used for morphometric analysis. Results were expressed as mean⫾standard error of mean (S.E.M.).

Quantitative real-time PCR NSCs were incubated with or without TSA (10 ng/ml) for 24 h, washed with PBS, and lysed in guanidinium isothiocyanate/mercaptoethanol (GTC) buffer. Total RNA was extracted according to Chomczynski and Sacchi (1987). Concentration and purity of RNA was determined by measuring the absorbance at 260 nm and 280 nm using a spectrophotometer (Spectramax 250, Molecular Devices, Sunnyvale, CA, USA). One microgram of total RNA was transcribed into cDNA using M-MLV reverse-transcriptase (Gibco, Carlsbad, CA, USA). Real-time PCR was performed using the iCycler (Bio-Rad, Veenendaal, and The Netherlands) and the iQ SYBR Green supermix (Bio-Rad). Mouse ␤-actin (X03672), ␤-glucoronidase (GUS, J03047) and hydroxymethylbilane synthase (HMBS, XM129404) primers (see Table 1) were used for normalization to housekeeping genes. Neuron-specific gene analysis was performed by use of a set of gene specific primers (see Table 1). Like the housekeeping gene primers, neuronal gene specific primers were designed by the use of the Primer Designer program (Scientific and Educational Software, version 3.0). The comparative Ct method (amount of target amplicon X in sample S, normalized to a reference R and related to a control sample C, calculated by 2⫺[(CtX,S⫺CtR,S)⫺(CtX,C⫺CtR,C)]) was used to determine the fold difference between TSA-treated samples and controls. Results are the averaged data of a minimum of three independent experiments and are given as means⫾S.E.M.

Electrophysiological recordings The differentiated cells in the poly-L-lysine/laminin-coated coverslips were placed in a measuring chamber attached to a microscope (Axioskop 2 FS, Zeiss, Oberkochen, Germany). Membrane currents and voltages were measured using an Axopatch 200 B amplifier (Axon Instruments, Foster City, CA, USA) using the whole-cell patch clamp technique. Pipettes were pulled from borosilicate glass (Clarke, UK) and were filled with a solution containing: K-gluconate 140 mM, KCl 10 mM, Hepes 10 mM, MgCl2 4, 1,2-bis (2-aminophenoxy)-ethane-N,N,N=,N=-tetraacetic acid (BAPTA) 0.1 mM, Na2ATP 2 mM (280 –290 mOsm). The pH was adjusted to 7.40. The bathing solution contained NaCl 130 mM, KCl 3 mM, MgCl2 2 mM, CaCl2 2 mM, NaH2PO4 1.25 mM, NaHCO3 26 mM and glucose 10 mM (mOsm 330). The pH was

adjusted to 7.40. When used with these solutions, the pipettes had initial resistances of 5– 8 M⍀. Membrane currents were recorded at room temperature (20 –22 °C) with the amplifier in voltage clamp mode. Currents were low-pass filtered at 2 kHz and sampled at 50 kHz using a Digidata 1320 AD converter (Axon Instruments). Series resistance and leak currents were compensated using p/4 protocols. The junction potential was corrected with the pipette in the bath solution. After measuring the membrane currents, the amplifier was switched to current clamp mode. Following measurement of the resting membrane potential, the membrane potential was set to ⫺70 mV using steady injected current through the patch pipette. Input resistance was measured using small depolarizing current steps. The membrane time constant was calculated from a single exponential fit of the voltage response to the hyperpolarizing current pulse. Voltage clamp step protocols were generated and data analyzed using Pclamp software (Axon Instruments) as well as locally developed programs. Unless stated otherwise, values are expressed as average⫾S.D.

RESULTS Histone acetylation promotes neuronal differentiation of embryonic NSCs NSCs were cultured on poly-L-lysine/laminin-coated glass coverslips in basic differentiation medium. Differentiated cells were fixed after 8 days and subjected to immunohistochemistry. Besides anti-NSE and anti-␤-tubulin III, we used MAP2abc antibody as a marker for neurons, GFAP antibody for astrocytes, and O4 for oligodendrocytes. Based on the single staining for these markers (i.e. no co-staining with nestin) and the cell typical morphology, culturing of NSCs in basic differentiation medium resulted in approximately 42% astrocytes, 15% neurons, and a few oligodendrocytes (⬍1%). Generally, those cells that remained negative for the above markers, could be stained positive for the nestin antibody, which is supposed to identify them as undifferentiated NSCs; however, about half of the nestin-positive cells also expressed GFAP either indicating a subpopulation of undifferentiated NSCs or a subpopulation of early glial precursors. To investigate whether this basic differentiation pattern would be influenced by histone acetylation events, we employed the HDAC inhibitor TSA. To test the toxicity of TSA, differentiating NSCs were exposed during 24 h to 10 ng/ml TSA (the highest concentration used in our experiments). After 24 and 96 h cells were fixed, and stained for apoptosis. No significant cell loss due to the TSA treatment was observed. We confirmed the HDAC inhibition by the TSA treatment in the NSC’s by Western blot (Fig. 1a)

942

V. Balasubramaniyan et al. / Neuroscience 143 (2006) 939 –951

exposure to TSA (1 and 10 ng/ml). After the recording sessions the neuronal identity of these cells was confirmed using immunostaining for neuron-specific cytoskeletal proteins (MAP2, ␤-tubulin-III) and NSE.

control

Passive membrane properties. The membrane resistance of neurons that differentiated in the absence of TSA was 802⫾606.8 M⍀ (n⫽15); the membrane resistance of those that differentiated after exposure to TSA was 623⫾352 m⍀ (n⫽12). The membrane time constant for these cells was 9.1⫾4.7 ms and membrane capacitance averaged 9.1⫾2.4 pF.

γ-tubulin

B

C

+TSA

- TSA

Fig. 1. HDAC-inhibition of NSCs by TSA. (A) Western blot analysis of treated and untreated neurospheres with acetylated H3 specific antibodies. Equal loading was verified by staining with the ␥-tubulin antibody. (B, C) NSC’s immunostained for acetyl-H3 (FITC, green in B and C) after 24 h of differentiation with (B) and without (C) TSA treatment (10 ng/ml). TSA clearly increased the amount of acetylated H3. For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.

and immunocytochemical analysis (Fig. 1b– c). Next, we cultured NSCs with different concentrations of TSA (0.1 ng/ml, 1 ng/ml and 10 ng/ml) for 24 h. After this incubation, cultures were refreshed with basic neurobasal medium, with a medium change every 2 days. After 8 days, the cells were fixed and processed for immunohistochemistry as described above for the NSCs cultured without TSA. Analysis of the immunostaining pattern of the differentiated cell types revealed that histone deacetylation inhibition by TSA increased neuronal differentiation (Fig. 2a). This effect was dose-dependent, with the highest percentage of neurons (25%) generated by 10 ng/ml of TSA; these data were independent of whether MAP2abc or ␤-tubulin III was used as neuronal marker. In contrast, TSA seemed to block the differentiation of NSCs into astrocytes, although this effect was only significant at a dose of 1 ng/ml TSA (Fig. 2b). We did not observe an effect of TSA on the number of NSCs that differentiated into oligodendrocytes; both culture with and without TSA resulted in only 1% O4-positive oligodendrocytes. However, the O4-positive cells developing after exposure to TSA were smaller and had fewer and shorter processes (data not shown). TSA induces electrophysiological maturation of NSC-derived neurons In order to determine the involvement of histone acetylation/deacetylation on gene transcription underlying the development of electrical membrane properties of NSC-derived neurons, cells identified by their neuron-like appearance were used for patch clamp experiments after 8 days of culture in basic medium without or with previous 24 h

Inward currents. No inward currents were detected in any of the neurons (n⫽46) that differentiated after 8 days in basic culture conditions without exposure to TSA. However, most of the neurons that differentiated from NSCs after exposure to TSA (18/19) demonstrated a rapidly inactivating inward current upon depolarization (Fig. 3) of

A 30

Map2abc positive cells (%)

acetylated histone H3

** *

25 20 15 10 5 0 control

50

GFAP positive cells (%)

TSA

A

0.1ng/ml

1ng/ml

10ng/ml

B

40

*

30 20 10 0 control

0.1ng/ml

1ng/ml

10ng/ml

Fig. 2. Quantification of differentiation of mouse embryonic brain NSCs after 7 days of differentiation. NSCs were treated with different concentrations of TSA for the first 24 h. (A) Yield of neurons expressed as percentage of MAP2abc positive cells. (B) Quantification of number of astrocytes stained positive for GFAP. For each experiment MAP2abc positive or GFAP-positive cells were counted in 10 randomized microscopic fields. Bars indicate the mean value (⫾S.E.M.) for at least three independent experiments. Significant differences with control group are marked in (A) * for P⬍0.0008, ** for P⬍0.0001, t-test and in (B) * for P⬍0.001, t-test.

V. Balasubramaniyan et al. / Neuroscience 143 (2006) 939 –951 1000

943

A A

pA 800 600 400 200 0 0

10

20

30

40

50

60

70

80

-200

90

100 msec

-400 -600 -800

B

100 0

-100

-50

-100

Vhold (mV) 0

50

-200

peak current, no prepulse

-300

persistent current, no prepulse

-400 -500 -600 -700

pA

200

pA

C C

150 100 50 0 0

20

40

60

80

100

120

140

msec

-50 -100 Fig. 3. (A) Whole-cell voltage clamp recording of a neuron derived from mouse embryonic brain NSCs differentiated for 7 days after TSA treatment (1 ng/ml for the first 24 h). Currents were recorded using a voltage clamp protocol consisting of voltage steps from ⫺70 to ⫹30 mV in 10 mV increments (duration 60 ms). (B) I–V relation for the inward current of the recorded neuron (peak current, diamonds; non-inactivating “persistent” current, squares). (C) Recording of non-inactivating inward current for another cell (also treated with 1 ng/ml TSA) using the same voltage-clamp protocol (voltage steps up to ⫺40 mV).

412⫾222 pA; the activation voltage was ⫺30.8⫾6.0 mV. For five cells, tetrodotoxin was added to the bath solution (final concentration 1 ␮M). In all tested cases, the rapidly

inactivating inward current was blocked. This effect was reversible, although the current did not return to the preTTX amplitude in any of the cells (Fig. 4a). Thus, it was

944

V. Balasubramaniyan et al. / Neuroscience 143 (2006) 939 –951

pA

A

800 600 400 200 c ontrol

0

TTX

15

20

25

30

35

40

-200

45

50

w as h

msec

-400 -600 -800

mV

B

40 20 0 -20 -40 -60 -80 0

1000

2000

3000

4000

5000

msec Fig. 4. Neurons derived from mouse embryonic brain NSCs treated with TSA developed appropriate electrophysiological properties 7 days after TSA treatment (1 ng/ml for the first 24 h). (A) Inward current induced by a depolarizing step from ⫺70-0 mV is TTX sensitive. Control⫽continuous line; TTX 5.10⫺7 M⫽2nd continuous line; wash⫽interrupted line. (B) In current clamp mode, the cell’s membrane potential was held at ⫺70 mV by injecting a steady holding current through the pipette. The cell was activated with a 500 ms pulse of depolarizing current. Same cell as in Fig. 3A.

concluded that the inward current was carried by sodium ions. Ten of the 19 TSA-treated NSC-derived neurons that demonstrated inward currents were also able to generate action potentials. The average resting membrane potential of these cells was ⫺35.9⫾10.2 mV. For these cells the amplitude of the action potentials were 36.6⫾13.4 mV, the duration at half-maximal amplitude was 3.2⫾1.6 ms and the voltage threshold was ⫺26.0⫾2.6 mV. The electrophysiological characteristics (inward currents, activation potential, membrane potential) of the neurons developing after TSA treatment are almost identical to the ones recorded for E14 neurons, previously described (Balasubramaniyan et al., 2004). Six of the TSA-treated NSC-derived

neurons were able to fire repetitively (Fig. 4b) when stimulated with 500 ms or 3 s pulses. Twelve TSA-treated NSC-derived neurons showed a non-inactivating inward current, which was already activated at ⫺58⫾4 mV (Fig. 3c). This included the one cell that did not show rapid inactivating inward current. The underlying conductance was not investigated, but it is likely to be carried by Ca2⫹ or Na⫹ ions. The amplitude of this current could not be determined, as it was masked by outward currents as these were activated (see below). Outward currents. Neurons that developed from NSCs without TSA exposure displayed a non-inactivat-

V. Balasubramaniyan et al. / Neuroscience 143 (2006) 939 –951

A

945

C pA 610 410 210 10 0

10

20

30

40

50

60

70

-190

20 msec

80

100

90

msec

-390 -590

B

D

pA Transient

Im

DR

-80

10 msec

-60

-40

700 600 500 400 300 200 100 0 -20 -100 0

20

40

Vhold (mV)

Fig. 5. Cells derived from NSCs cultured without previous TSA treatment do not generate inward currents. Two whole-cell recordings showing only outward currents in response to a voltage clamp protocol consisting of voltage steps from ⫺70 to ⫹30 mV in 10 mV steps. The outward currents were either non-inactivating (A) or also consisted of a transient component (B). Cells derived from NSCs cultured after TSA treatment were able to generate inward in addition to outward currents (C). In a cell cultured after TSA treatment, the outward current consisted of two components: a non-inactivating one and a transient one. For this current, an I–V curve was generated (D) for peak current (diamond) and for the steady state current (rectangle).

ing potassium current sometimes together with a transient one (Fig. 5). The transient current was observed in 8 of 46 cells, was activated at ⫺33.6⫾8.5 mV and showed a maximal current amplitude of 1463.5⫾689.4 pA. The remaining 38 cells only demonstrated the noninactivating potassium current, which activated at ⫺30⫾8.5 mV and had a maximal current amplitude of 1375.2⫾796.7 pA. TSA-treated NSC-derived neurons showed a similar transient outward current as observed in a minority of the nontreated neurons. The activation voltage and current amplitude were only determined for those cells having no “persistent” inward current, which has a counteracting effect on the outward current. Thus, the transient outward current activated at ⫺34⫾9 mV (n⫽8) and had an amplitude of 780⫾447 pA (n⫽8). Like most of the TSA-untreated neurons, TSA-treated NSCderived neurons also demonstrated a non-inactivating outward current. However, the non-inactivating outward current in the TSA-treated NSC-derived neurons activated at ⫺37⫾9

mV (n⫽11) and had a much smaller maximal amplitude of 479⫾187 pA (n⫽11; only analyzed for those cells without “persistent” inward current). Most of the TSA-treated NSCderived neurons had both types of outward currents (n⫽13) (Fig. 5). The conductances underlying these currents were not investigated further, but it seems likely that they were both carried by K⫹ ions. TSA stimulates dendritic outgrowth of NSC-derived neurons Approximately 25% of the NSCs cultured in basal differentiation medium differentiated into neurons upon addition of TSA. Under the experimental conditions employed in this study, inhibition of histone deacetylation by TSA not only influenced the percentage of neuronal differentiation, but also the morphology of the neurons (Fig. 6a– b). The MAP2abc-positive neurons in TSAtreated cultures developed significantly longer dendrites

946

V. Balasubramaniyan et al. / Neuroscience 143 (2006) 939 –951

A

B

B’

300

C **

250

**

**

200 150 100 50

4000

14 12

** **

10 8 6 4 2 0

** **

1000

0

Number of primary dendrites

Number of branching dendrites

**

16

**

2000

control 0.1ng/ml 1ng/ml 10ng/ml

D

E

3000

0

18

+ TSA

+ TSA Dendritic area (µm2)

Longest dendrite (µm)

- TSA

control 0.1ng/ml 1ng/ml 10ng/ml

5

F

4 3 2 1 0

control 0.1ng/ml 1ng/ml 10ng/ml

control 0.1ng/ml 1 ng/ml 10 ng/ml

Fig. 6. Inhibition of histone deacetylation during first 24 h of culture of mouse embryonic brain NSCs changed the neuronal outgrowth. (A, B) Neurons immunostained for MAP2abc (Cy3: red) and Hoechst nuclear staining (blue) after 7 days of culture without (A) and with TSA treatment (B; 1 ng; B=: 10 ng/ml). B= shows a single isolated typical neuron differentiated from NSC after TSA treatment. Scale bar⫽50 ␮m. (C–F) Quantitative morphometric analysis of the arborization and dendritic outgrowth of mouse embryonic brain NSCs derived neurons after 7 days of culture after treatment with different concentrations of TSA (first 24 h) and in control conditions. (C) Length of longest dendrite. (D) Number of branching dendrites. (E) Dendritic area. (F) Number of primary dendrites. Bars represent mean value⫾S.E.M. (n⫽3). Significant differences with control are marked ** for P⬍0.0001, t-test. For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.

(Fig. 6c), with significantly more branching points (Fig. 6d), resulting in a greater dendritic area (Fig. 6e) than under control conditions. All these effects were dosedependent, the highest effect being obtained at a concentration of 10 ng/ml TSA. However, the number of primary dendrites of the NSC-derived neurons was not affected by TSA treatment (Fig. 6f). TSA promotes cholinergic differentiation of NSCs In order to determine whether histone acetylation is involved in determining the neurotransmitter phenotype of embryonic NSC-derived neurons, we have immuno-

stained the neurons that differentiated after culture with or without TSA exposure for the following neuronal markers: TH (as a marker for dopaminergic neurons), GABA (as a marker for GABA-ergic neurons) and ChAT (a marker for cholinergic neurons). Less than 1% of the NSC-derived neurons showed a GABA-ergic or dopaminergic phenotype, either with or without TSA exposure. However, about 15% of the neurons that developed from the NSCs in basic TSA-less medium were cholinergic (Fig. 7a); this number increased to approximately 25% of the neurons when NSCs were cultured after exposure to 1 or 10 ng/ml TSA (Fig. 7b).

A

- TSA

ChaT+ (% of neurons)

V. Balasubramaniyan et al. / Neuroscience 143 (2006) 939 –951

30

B

25 20 15 10 5 0

A’

*

947

control

0.1ng/ml 1ng/ml 10ng/ml

+ TSA

Fig. 7. Inhibition of histone deacetylation promotes cholinergic differentiation of mouse embryonic NSCs. (A, A=) NSCs immunostained for ChAT (Cy3; red) as a marker for cholinergic neurons and counterstained with a nuclear stain Hoechst (blue) 7 days after treatment without (A) or with TSA (10 ng/ml) (A=). Scale bar⫽50 ␮m. (B) Quantification of cholinergic differentiation of mouse embryonic brain NSCs after TSA treatment (10 ng/ml) and under control conditions. TSA treatment increases the specific differentiation of NSC-derived neurons into a cholinergic phenotype (expressed as the percentage of neurons that is ChAT-positive) in a dose-dependent way. Values are expressed as percentage mean value⫾S.E.M. (n⫽3). Significant difference with control group is marked * for P⬍0.001, t-test. For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.

Mechanism of TSA-induced neuronal differentiation of NSCs In order to investigate whether the HDAC inhibition effects on neuronal differentiation of the embryonic mouse NSCs did involve neuronal genes that are known to contain the RE1 binding site in their promotor region and whose transcription is controlled by REST, we have analyzed the mRNA expression of TSA-treated and -untreated NSCs with the use of quantitative RT-PCR. We used primers for the following relevant REST dependent genes suggested by Schoenherr et al. (1996) and Hsieh et al. (2004b) for NeuroD, SCG10 (a neuronal growth associated protein) and Nav1.2 (a sodium channel type). In addition, we compared the expression of another (REST-independent) neuronal growth-associated protein GAP43 in TSA-treated and -untreated NSCs. Despite the significant effects on neuronal differentiation and in particular on the development of neuronal membrane properties and dendrite outgrowth, we were able to detect an upregulation of NeuroD, SCG10, and Nav1.2, but this upregulation was small and not significant. However, a significant fourfold upregulation of GAP43 expression was observed in the NSC-derived neurons developing after TSA treatment (Fig. 8a). In addition we have analyzed the TSA dependent increase in mRNA ChAT expression with quantitative RT-PCR on TSA-treated and untreated NSCs. The results showed a twofold increase in ChAT mRNA after TSA treatment (Fig. 8b).

DISCUSSION Our in vitro experiments show that epigenetic modification of HDAC activity influences the differentiation pattern of NSCs derived from embryonic mouse brain. Inhibiting HDAC activity by TSA during embryonic NSC in vitro differentiation significantly stimulated neuronal lineage progression, but seemed to block astrocyte differentiation. Whereas neurons differentiating from embryonic NSCs in basic, serum-less medium without TSA treatment completely lacked voltage-dependent sodium channels and remained functionally immature (Balasubramaniyan et al., 2004), histone hyperacetylation due to TSA resulted in the transcription and translation of the genetic program encoding the excitability and firing properties of a mature neuron. The electrophysiological characteristics (inward currents, activation potential, membrane potential) of the neurons developing after TSA treatment appeared to be identical to those of E14 neurons, as previously described (Balasubramaniyan et al., 2004). Histone hyperacetylation also stimulated the dendritic outgrowth of the mouse embryonic NSC-derived neurons and promoted a cholinergic neurotransmitter phenotype. Our findings on the effect of HDAC inhibition on embryonic NSCs are generally in line with recent observations on HDAC inhibition by valproic acid (VPA) in adult hippocampal neural progenitor cells (Hsieh et al., 2004b). Indeed, in both the embryonic neural stem and

948

V. Balasubramaniyan et al. / Neuroscience 143 (2006) 939 –951

A Relative expression of GAP43 mRNA

6

*

5 4 3 2 1 0 control

TSA

B Relative expression of ChAT mRNA

3 2.5 2 1.5 1 0.5 0 control

TSA

Fig. 8. Graphic representation of the results of quantitative RT-PCR comparing the relative GAP43 (A) expression and ChAT (B) in NSCderived neurons after 24 h TSA treatment and under control conditions. Results are average of three independent experiments⫾S.E.M.

the adult neural progenitor cell populations, hyperacetylation promoted neuronal differentiation while inhibiting astrocyte differentiation. However, besides significant differences in HDAC inhibition activity between TSA and VPA (e.g. Kramer et al., 2003), differences in intrinsic properties and in vitro behavior between our mouse embryonic NSCs and the rat adult hippocampal neural progenitors of Hsieh et al. (2004b) seem to account for

some of the differences observed after HDAC activity manipulation. In the culture procedure of Hsieh et al. (2004b) adult hippocampal neural progenitor cells selfrenew with the mitogen fibroblast growth factor (FGF)-2 without the formation of neurospheres. These adult hippocampal cells differentiate into neurons, oligodendrocytes, and astrocytes only after stimulation with exogenous factors: retinoic acid plus forskolin for neurons, IGF-1 for oligodendrocytes, and LIF plus BMP for astrocytes (Gage et al., 1995; Hsieh et al., 2004a; Palmer et al., 1997); in the absence of FGF-2 or the specific differentiation induction factors, the rat adult neural hippocampal progenitor cells do not differentiate and do not survive. Inhibition of HDAC activity appears to be an essential step for neuronal differentiation of these rat adult neural hippocampal progenitor cells in vitro, since VPA treatment could almost entirely mimic the neurogenic effect of retinoic acid plus forskolin (Hsieh et al., 2004b). According to Hsieh et al., the transcription factor NeuroD plays a major role in this process since the expression of NeuroD was upregulated after HDAC inhibition. Moreover, forced overexpression of NeuroD in the rat adult neural hippocampal progenitor cells mimicked the induction and suppression of neuronal and glial differentiation, respectively. In contrast to the rat adult hippocampal progenitor cells, our mouse embryonic NSCs were cultured as aggregates, neurospheres, in the presence of the mitogens FGF-2/EGF. After dissociation and withdrawal of the mitogens, these NSCs survived and showed an intrinsic differentiation induction pattern into neurons, astrocytes and oligodendrocytes in minimal culture conditions. So apparently, in contrast to the rat adult hippocampal progenitor cells, neurons can differentiate from embryonic NSCs independent of HDAC inhibition. However, these neurons remained functionally immature since they only expressed two types of potassium channels but no voltage-activated sodium and calcium channels responsible for neuronal excitability and action potential firing properties. Our results suggest that inhibition of histone deacetylation is required for the transcription of the genes encoding these channels in embryonic mouse NSCs. The main candidate for such a channel gene determining the excitability and firing properties of neurons is the one encoding the sodium channel type Nav1.2. This neuronal gene is known to contain the RE1/NRSE binding site in its promoter region (Chong et al., 1995) and its transcription is thought to be controlled by REST/NRSF. However, in our quantitative RT-PCR analysis, we were unable to detect a significant upregulation in the expression of this gene in the TSA-treated embryonic NSCs in comparison to the untreated NSCs. The absence of HDAC-dependency of the REST gene Nav1.2 seems to be in accordance with what has been described for some other NSC types. Belyaev et al. (2004) reported that the REST dependent Nav1.2 gene in JTC-19 cells is actively transcribed independently of histone deacetylation (or DNA methylation) (Belyaev et al., 2004). Also in mouse cortical progenitors, REST indeed has been shown to occupy

V. Balasubramaniyan et al. / Neuroscience 143 (2006) 939 –951

the Nav1.2 gene but appeared to have no effect on its expression, reflecting regulation by additional mechanisms (Ballas et al., 2005). So, how come TSA treatment of our embryonic NSCs resulted in the formation of functional Nav1.2 channels in contrast to untreated NSCs? An explanation for this may be found in the processes and proteins that are involved in the transfer of the Nav1.2 channel proteins/components to the membrane, their incorporation into the plasma membrane and the final clustering to become functional active channels. It seems likely that the expression of the proteins involved in this functional maturation of the Nav1.2 channel is HDAC-dependent. In addition, of course, it could be that other (HDAC-dependent) non Nav1.2 channel types are involved in the development of the membrane properties of functional embryonic neurons. Besides the Nav1.2 gene, we were also unable to detect an upregulation of NeuroD and SCG10, two other known REST/NRSF-dependent neuronal genes, after HDAC inhibition by TSA in the embryonic mouse NSCs. There could be several explanations for the fact that these known REST dependent neuronal genes do not seem to be influenced by HDAC inhibition in embryonic NSCs compared with for instance hippocampal progenitors, neuroblastoma cells and NSC lines. Firstly, it has been clearly demonstrated that the level of REST exhibits a large, stage-dependent variability within these neuron-generating cells and that it is the level of intranuclear REST (⫽balance between synthesis and proteosomal degradation) that is crucial in REST-mediated signaling and so in determining the neuronal fate choice. Secondly, the level of REST appears to be strongly influenced by extracellular factors, for instance IGF-1 (Di Toro et al., 2005). In addition, HDAC itself appears to be involved in the transcriptional repression of REST (Ballas et al., 2005). Thirdly, the recruitment capacity of REST to form a repressor complex is highly variable and cell type- and stage-dependent. REST does not use/ recruit in all cell types only HDAC or DNA-methyltransferases to repress transcription (as exemplified above for the Nav1.2 gene); other mechanisms have been forwarded, e.g. dsRNA. Moreover, it should be noted that inhibition of the repressor activity of REST/NRSF by TSA is not automatically sufficient to activate REST/ NRSF-dependent target genes (Chen and Townes, 2000). Activation of these genes requires either relief from other repression mechanisms and/or the presence of other promoter/enhancer-specific positive activators (Immaneni et al., 2000). Apparently, our embryonic NSCs do not fulfill these specific conditions, whereas rat adult hippocampal progenitor cells do (Hsieh et al., 2004b). Our neuronal differentiation experiments after TSA treatment with the embryonic NSCs suggest a somewhat different role for NeuroD (and SCG10) in the neuronal differentiation in comparison to the hippocampal progenitors. Inhibition of HDAC by TSA also appeared to affect the neurotransmitter phenotype of the neurons that developed from the embryonic mouse NSCs. In contrast to Kim et al.

949

(2003), who reported that treatment with TSA can induce the TH promoter activity in both non-neuronal and neuronal cell lines, we were unable to detect dopaminergic neurons after histone hyperacetylation in the mouse embryonic NSCs. However, inhibition of HDAC promoted the induction of a cholinergic neuron type. Previously it has been shown that HDAC inhibition by TSA can increase ChAT activity in cultured rat sympathetic neurons (Chireux et al., 1996) as well as in human neuroblastoma cells (Casper and Davies, 1989a,b). Recently it has been shown that the promoter region of ChAT contains the RE1/NRSF binding site (Hersh and Shimojo, 2003); so in contrast to the NeuroD, Nav1.2 and SCG10 genes, inhibition of the repressor activity of REST/NRSF by TSA did induce ChAT expression and increased the number of ChAT positive neurons differentiating from the embryonic NSCs. Surprisingly, inhibition of HDAC activity during differentiation of embryonic mouse NSCs significantly stimulated the outgrowth and branching of freshly formed dendrites (strictly speaking the term neurites should be used in this early stage). Dendrite elongation and arborization is ultimately regulated by microtubule and actin-binding proteins determining the rate of polymerization and depolymerization of these cytoskeletal elements. Many local environmental cues, including patterns of activity and molecules such as neurotrophins, semaphorins, cell adhesion molecules, Notch, and glial-derived factors have been shown to modulate the polymerizing activities of these proteins (for reviews see (Jan and Jan, 2003; McAllister, 2000)). Regulators of cytoskeletal elements (e.g. the Rho family of small GTPases), components of signal transduction pathways (CamKII), as well as transcriptional regulators (CREB) have been identified in recent years as mediators of this modulating activity (McAllister, 2000). Stimulation of dendritic outgrowth in NSC-derived neurons in our experiments may have been a direct effect of TSA on HDAC6 which has been shown to promote acetylation of microtubuli in tumor cell lines (Hubbert et al., 2002); acetylation stabilizes microtubuli polymerization promoting process elongation at the account of branching. The fact that both elongation and arborization of dendrites was stimulated seems to exclude this possibility. Our quantitative RT-PCR analysis shows that HDACs control the transcription of the gene encoding for GAP43, the most prominent growth-associated protein crucial for neurite/dendrite outgrowth (Benowitz and Routtenberg, 1997). The upregulation of GAP43 expression by TSA observed in our embryonic mouse NSCs may have stimulated the dendrite outgrowth of the developing neurons. The increase in the number of neurons that differentiate from NSCs after TSA treatment (at least at a concentration of 1 ng/ml) seemed to be at the expense of astrocyte differentiation and not of oligodendrocyte differentiation. The number of oligodendrocytes that develop under our culture conditions is low and not influenced by TSA. However, the O4-positive cells developing after exposure to TSA were smaller, had fewer and shorter processes and never reached a mature stage. This is in accordance with observations by MarinHusstege et al. (2002), who found that HDAC activity is

950

V. Balasubramaniyan et al. / Neuroscience 143 (2006) 939 –951

necessary for the progression of early oligodendrocyte progenitor cells into mature oligodendrocytes.

CONCLUSION In conclusion, our study shows that chromatin structure modulation plays an important role in the regulation of several aspects of embryonic mouse NSC differentiation, in particular neuronal differentiation and electrophysiological maturation. Manipulating HDAC activity may offer an important tool to develop protocols for obtaining specific populations of neuronal cell types from NSCs and to elucidate the gene transcription mechanisms underlying specific NSC differentiation. Acknowledgments—We gratefully acknowledge Natalia Gounko for assistance with the morphometric analysis of the neurons.

REFERENCES Ajamian F, Salminen A, Reeben M (2004) Selective regulation of class I and class II histone deacetylases expression by inhibitors of histone deacetylases in cultured mouse neural cells. Neurosci Lett 365:64 – 68. Balasubramaniyan V, de Haas AH, Bakels R, Koper A, Boddeke HW, Copray JC (2004) Functionally deficient neuronal differentiation of mouse embryonic neural stem cells in vitro. Neurosci Res 49: 261–265. Ballas N, Battaglioli E, Atouf F, Andres ME, Chenoweth J, Anderson ME, Burger C, Moniwa M, Davie JR, Bowers WJ, Federoff HJ, Rose DW, Rosenfeld MG, Brehm P, Mandel G (2001) Regulation of neuronal traits by a novel transcriptional complex. Neuron 31:353–365. Ballas N, Grunseich C, Lu DD, Speh JC, Mandel G (2005) REST and its corepressors mediate plasticity of neuronal gene chromatin throughout neurogenesis. Cell 20:645– 657. Belyaev ND, Wood IC, Bruce AW, Street M, Trinh JB, Buckley NJ (2004) Distinct RE-1 silencing transcription factor-containing complexes interact with different target genes. J Biol Chem 279: 556 –561. Benowitz L, Routtenberg A (1997) GAP-43: an intrinsic determinant of neuronal development and plasticity. Trends Neurosci 20:84 –91. Casper D, Davies P (1989a) Mechanism of activation of choline acetyltransferase in a human neuroblastoma cell line. Brain Res 478: 85–94. Casper D, Davies P (1989b) Stimulation of choline acetyltransferase activity by retinoic acid and sodium butyrate in a cultured human neuroblastoma. Brain Res 478:74 – 84. Chen WY, Townes TM (2000) Molecular mechanism for silencing virally transduced genes involves histone deacetylation and chromatin condensation. Proc Natl Acad Sci U S A 97:377–382. Chireux M, Espinos E, Bloch S, Yoshida M, Weber MJ (1996) Histone hyperacetylating agents stimulate promoter activity of human choline acetyltransferase gene in transfection experiment. Brain Res Mol Brain Res 39:68 –78. Chomczynski P, Sacchi N (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156 –159. Chong JA, Tapia-Ramirez J, Kim S, Toledo-Aral JJ, Zheng Y, Boutros MC, Altshuller YM, Frohman MA, Kraner SD, Mandel G (1995) REST: a mammalian silencer protein that restricts sodium channel gene expression to neurons. Cell 80:949 –957. Di Toro R, Baiula M, Spampinato S (2005) Expression of the repressor element-1 silencing transcription factor (REST) is influenced by insulin-like growth factor-I in differentiating human neuroblastoma cells. Eur J Neurosci 21:46 –58.

Gage FH (2000) Mammalian neural stem cells. Science 287:1433–1438. Gage FH, Coates PW, Palmer TD, Kuhn HG, Fisher LJ, Suhonen JO, Peterson DA, Suhr ST, Ray J (1995) Survival and differentiation of adult neuronal progenitor cells transplanted to the adult brain. Proc Natl Acad Sci U S A 92:11879 –11883. Grozinger CM, Schreiber SL (2002) Deacetylase enzymes: biological functions and the use of small-molecule inhibitors. Chem Biol 9:3–16. He X, Rosenfeld MG (1991) Mechanisms of complex transcriptional regulation: implications for brain development. Neuron 7:183–196. Hersh LB, Shimojo M (2003) Regulation of cholinergic gene expression by the neuron restrictive silencer factor/repressor element-1 silencing transcription factor. Life Sci 72:2021–2028. Hsieh J, Aimone JB, Kaspar BK, Kuwabara T, Nakashima K, Gage FH (2004a) IGF-I instructs multipotent adult neural progenitor cells to become oligodendrocytes. J Cell Biol 164:111–122. Hsieh J, Nakashima K, Kuwabara T, Mejia E, Gage FH (2004b) Histone deacetylase inhibition-mediated neuronal differentiation of multipotent adult neural progenitor cells. Proc Natl Acad Sci U S A 101:16659 –16664. Hsieh J, Gage FH (2004) Epigenetic control of neural stem cell fate. Curr Opin Genet Dev 14:461– 469. Huang Y, Myers SJ, Dingledine R (1999) Transcriptional repression by REST: recruitment of Sin3A and histone deacetylase to neuronal genes. Nat Neurosci 2:867– 872. Hubbert C, Guardiola A, Shao R, Kawaguchi Y, Ito A, Nixon A, Yoshida M, Wang XF, Yao TP (2002) HDAC6 is a microtubuleassociated deacetylase. Nature 417:455– 458. Immaneni A, Lawinger P, Zhao Z, Lu W, Rastelli L, Morris JH, Majumder S (2000) REST-VP16 activates multiple neuronal differentiation genes in human NT2 cells. Nucleic Acids Res 28:3403–3410. Inokoshi J, Katagiri M, Arima S, Tanaka H, Hayashi M, Kim YB, Furumai R, Yoshida M, Horinouchi S, Omura S (1999) Neuronal differentiation of neuro 2a cells by inhibitors of cell cycle progression, trichostatin A and butyrolactone I. Biochem Biophys Res Commun 256:372–376. Jan YN, Jan LY (2003) The control of dendrite development. Neuron 40:229 –242. Kim HS, Park JS, Hong SJ, Woo MS, Kim SY, Kim KS (2003) Regulation of the tyrosine hydroxylase gene promoter by histone deacetylase inhibitors. Biochem Biophys Res Commun 312: 950 –957. Kramer OH, Zhu P, Ostendorff HP, Golebiewski M, Tiefenbach J, Peters MA, Brill B, Groner B, Bach I, Heinzel T, Gottlicher M (2003) The histone deacetylase inhibitor valproic acid selectively induces proteasomal degradation of HDAC2. EMBO J 22:3411–3420. Lehrmann H, Pritchard LL, Harel-Bellan A (2002) Histone acetyltransferases and deacetylases in the control of cell proliferation and differentiation. Adv Cancer Res 86:41– 65. Lunyak VV, Burgess R, Prefontaine GG, Nelson C, Sze SH, Chenoweth J, Schwartz P, Pevzner PA, Glass C, Mandel G, Rosenfeld MG (2002) Corepressor-dependent silencing of chromosomal regions encoding neuronal genes. Science 298:1747–1752. Lunyak VV, Prefontaine GG, Rosenfeld MG (2004) REST and peace for the neuronal-specific transcriptional program. Ann N Y Acad Sci 1014:110 –120. Marin-Husstege M, Muggironi M, Liu A, Casaccia-Bonnefil P (2002) Histone deacetylase activity is necessary for oligodendrocyte lineage progression. J Neurosci 22:10333–10345. Marks PA, Miller T, Richon VM (2003) Histone deacetylases. Curr Opin Pharmacol 3:344 –351. McAllister AK (2000) Cellular and molecular mechanisms of dendrite growth. Cereb Cortex 10:963–973. Palmer TD, Takahashi J, Gage FH (1997) The adult rat hippocampus contains primordial neural stem cells. Mol Cell Neurosci 8: 389 – 404. Peterson CL (2002) HDAC’s at work: everyone doing their part. Mol Cell 9:921–922.

V. Balasubramaniyan et al. / Neuroscience 143 (2006) 939 –951 Reynolds BA, Tetzlaff W, Weiss S (1992) A multipotent EGF-responsive striatal embryonic progenitor cell produces neurons and astrocytes. J Neurosci 12:4565– 4574. Schoenherr CJ, Anderson DJ (1995a) The neuron-restrictive silencer factor (NRSF): a coordinate repressor of multiple neuron-specific genes. Science 267:1360 –1363. Schoenherr CJ, Anderson DJ (1995b) Silencing is golden: negative regulation in the control of neuronal gene transcription. Curr Opin Neurobiol 5:566 –571.

951

Schoenherr CJ, Paquette AJ, Anderson DJ (1996) Identification of potential target genes for the neuron-restrictive silencer factor. Proc Natl Acad Sci U S A 93:9881–9886. Schrenk K, Kapfhammer JP, Metzger F (2002) Altered dendritic development of cerebellar Purkinje cells in slice cultures from protein kinase Cgamma-deficient mice. Neuroscience 110:675– 689. Su X, Kameoka S, Lentz S, Majumder S (2004) Activation of REST/ NRSF target genes in neural stem cells is sufficient to cause neuronal differentiation. Mol Cell Biol 24:8018 – 8025.

(Accepted 24 August 2006) (Available online 3 November 2006)