- Email: [email protected]
Effects of hot air and methyl jasmonate treatment on the metabolism of soluble sugars in peach fruit during cold storage
Postharvest Biology and Technology 113 (2016) 8–16
Contents lists available at ScienceDirect
Postharvest Biology and Technology journal homepage: www.elsevier.com/locate/postharvbio
Effects of hot air and methyl jasmonate treatment on the metabolism of soluble sugars in peach fruit during cold storage Lina Yua , Hongxing Liub , Xingfeng Shaoa,* , Fang Yua , Yanzhen Weia , Zhiming Nib , Feng Xua , Hongfei Wanga a b
Department of Food Science and Engineering, Ningbo University, Ningbo 315211, PR China Key Laboratory of Healthy & Intelligent Kitchen System Integration, Ningbo Fotile Kitchenware Co., Ltd., Ningbo 315326, PR China
A R T I C L E I N F O
A B S T R A C T
Article history: Received 20 July 2015 Received in revised form 23 October 2015 Accepted 25 October 2015 Available online xxx
Soluble sugar metabolism affects the quality and chilling resistance of postharvest peach fruit. Although hot air (HA) and methyl jasmonate (MeJA) treatments are often effective in reducing chilling injury (CI), little is known about the relationship between sugar metabolism and HA or MeJA treatments in peach fruit. In this study, peach fruit was treated with hot air at 37 C for 3 days or MeJA vapor at 10 mmol/L for 24 h before storage at 5 C. Soluble sugar content, gene expression and enzyme activities associated with sugar metabolism were measured. Both treatments resulted in an initial increase, then a decrease in sucrose content over the course of storage time. Sucrose levels at every time point, but one, throughout the experiment were significantly higher than in control fruit, paralleled by higher gene expression and activity of SPS (sucrose phosphate synthase) and lower expression and activity of AI (acid invertase). HAtreated fruit had the highest sucrose content at the end of storage and the mildest CI symptoms. All treated fruit had higher sorbitol content and lower levels of SDH (sorbitol dehydrogenase) gene expression than control fruit. After 21 days in cold storage, sucrose content had decreased sharply in the control group, hexose content was not markedly affected, perhaps due to the increased expression of PFK (phosphofructokinase), resulting in more glucose entering the Embden–Meyerhof–Parnas pathway (EMP). These results suggest that the increase in sucrose observed during cold storage, associated with higher SPS and lower AI levels, enhances the chilling tolerance observed in HA- and MeJA-treated fruit. ã 2015 Elsevier B.V. All rights reserved.
Keywords: Prunus persica Hot air Methyl jasmonate Sugar metabolism
1. Introduction Because peaches (Prunus persica L. Batsh) ripen and deteriorate quickly at ambient temperature, cold storage is used to slow the ripening process and the development of decay. Peaches are however sensitive to low temperature, and symptoms of chilling injury (CI) develop within 1 or 2 weeks when fruit is stored at 2– 5 C; these symptoms include wooliness, flesh browning, reddening and leatheriness (Lurie and Crisosto, 2005). Hot air treatment (HA), an environmentally friendly technology, has proven to be an effective method for reducing CI in peach fruit by enhancing antioxidant system activity, stimulating the accumulation of heat shock proteins, and maintaining membrane integrity (Cao et al., 2010; Murray et al., 2007; Wang et al., 2014). Methyl jasmonate (MeJA), a natural plant regulatory compound, can trigger defense
* Corresponding author. Fax: +86 574 87608347. E-mail address: [email protected] (X. Shao). http://dx.doi.org/10.1016/j.postharvbio.2015.10.013 0925-5214/ ã 2015 Elsevier B.V. All rights reserved.
mechanisms against chilling stress and plays an important role in alleviating CI in peaches (Meng et al., 2009) by enhancing cell membrane integrity and antioxidant system activity (Cao et al., 2009), increasing the polygalacturonase/pectin methylesterase ratio (Jin et al., 2009) and increasing the content of proline and g-aminobutyric acid (Cao et al., 2012). Sugars, including soluble sugars and sugar alcohols, are significant sources of energy, contribute to the quality and taste of fruits (Cai et al., 2015), and affect fruit stress resistance (Der Agopian et al., 2011). Puig et al. (2015) put forward that sugar partitioning and demand during cold storage may play a role in the tolerance mechanism of peach fruit. The soluble sugars in peach fruit include sucrose, sorbitol, glucose and fructose. Sucrose is well known as the major carbohydrate in peach fruit, and it is hypothesized that high sucrose and glucose content can alleviate CI symptoms in peaches (Abidi et al., 2015). Wang et al. (2013) demonstrated that sucrose plays a more important role than glucose or fructose in protecting peach fruit and alleviating CI during cold stress. Jiang et al. (2013) have suggested that sucrose is
L. Yu et al. / Postharvest Biology and Technology 113 (2016) 8–16
more important than hexose in protecting grape branches from cold injury under low temperature conditions. In potato (Solanumtuberosum L.) microtubers and field-grown tubers, higher sucrose levels were observed at 4 C than at 10 C (Pathirana et al., 2008). Sucrose regulates osmotic pressure (Anchordoguy et al., 1987), stabilizes cell membrane structure (Oliver et al., 2002), activates the anti-oxidization system to eliminate free radicals (Nishizawa et al., 2008), and regulates metabolic pathways (Lalonde et al., 1999). Researchers have demonstrated that HA treatment can modify sugar metabolism in postharvest fruit at chilling and non-chilling temperatures. Lara et al. (2009) showed that during storage at ambient temperature, peach fruit treated at 39 C for 3 days prior to storage has significantly decreased sucrose content and increased levels of reducing sugars, compared to non HA treated peach fruit. Shao et al. (2013) found that heat treatment increased levels of reducing sugars in loquat fruit under chilling stress. Holland et al. (2002) demonstrated that heat treatment prevents the decline of sucrose content in citrus fruit stored at chilling temperature. In toto, research indicates that sucrose is a necessary factor in heat-induced chilling tolerance. In addition, treatment with MeJA at low concentrations significantly increases the sucrose content in two guava fruit cultivars during storage for various times at 5 C, followed by two days at 25 C (GonzálezAguilar et al., 2004). To our knowledge, no studies have focused on the effect of HA and MeJA treatments on sugar metabolism in peaches exposed to low temperatures. Therefore, the objective of our study was to examine the effect of HA and MeJA treatments on sugar content in peach fruit and associated changes in gene expression and enzyme activity during cold storage. 2. Materials and methods 2.1. Plant material and experimental design Peach fruits (Prunus persica L. Batsch) were harvested from a commercial orchard in Fenghua, Zhejiang Province, China. Fruits were immediately transported to our laboratory, selected for uniformity of color and the absence of physical damage, and randomly divided into three groups (HA treated, MeJA treated and non-treated control) of 105 peaches each. The first group was heattreated at 37 C for 3 days, after which fruits were stored at 5 C for 5 weeks. The second group was treated with 10 mmol/L MeJA (Sigma-Aldrich, Madrid, Spain) vapor in a sealed container for 24 h at 5 C. After treatment, the container was opened and ventilated for 1 h, and then fruits were stored at 5 C for 5 weeks. The last group (control) was stored at 5 C for 5 weeks immediately after selection. After cold storage for 0, 7, 14, 21, 28, or 35 days, CI indexes were assessed immediately after removal from cold storage, and then samples of five fruits from each replicate were mixed and frozen immediately in liquid nitrogen, and then stored at –80 C. Each treatment was replicated three times and the experiments were conducted twice. 2.2. Evaluation of CI index Internal browning (IB) is the visual characteristic symptom of CI. CI was assessed the visually IB on five fruits from each replicate after cutting the fruits along their axial diameters. The severity of CI was scored on a scale ranging from 0 to 4: 0 = none of IB, 1 = slight, 2 = moderate, 3 = moderately severe, 4 = severe. The results were expressed as the CI index, calculated using the following formula: CI index = [(CI score)(number of fruits with that CI score)]/(4 total number of fruits in each treatment).
9
2.3. Measurement of soluble sugars The method of Shao et al. (2013) was used to determine the soluble sugar content of the frozen fruit. Briefly, 5 g frozen peach tissue was ground with 0.5 ml of solution I [5.48% (w/v) zinc acetate: glacial acetic acid (97:3)] and 0.5 ml solution II [potassium ferrocyanide 2.65% (w/v)]. The homogenate was diluted to 25 ml with deionized water and passed through a 0.2 mm filter. Soluble sugars were measured using a high performance liquid chromatography (HPLC) system (Model 2695, Waters, USA), an X BrigeTM Amide Column (3.5 mm, 4.6 250 mm, USA), and a refractive index (RI) detector (Model 2414, Waters, USA). A sample of 20 ml was injected into the HPLC system for analysis. Acetonitrile/water (80:20, v/v) was used as the solvent at a flow rate of 1 ml min1 at 35 C. 2.4. RNA isolation and real-time PCR analysis Total RNA from frozen peach samples was isolated from 2 g of tissue according to the method described by Meisel et al. (2005). First, samples were subjected to several extractions with chloroform:isoamyl alcohol (24:1) to remove protein. Samples were then treated with RNase-free DNase (TaKaRa, Japan) to eliminate genomic DNA, following the manufacturer’s instructions. RNA integrity was assessed by agarose electrophoresis. The concentration of DNA-free RNA was determined using a spectrophotometer (NanoDrop 1000, Thermal, USA). RNA samples were stored at –80 C. First-strand cDNA was synthesized from 2 mg of treated total RNA using the SYBR PrimeScript RT-PCR kit II reverse transcriptase (TaKaRa, Japan) following the manufacturer’s instructions. The cDNA was diluted 10-fold with DEPC treated water and stored at –20 C prior to RT-qPCR analysis. Relative gene expression levels were determined by RT-qPCR using the SYBR Green kit II (Takara, Japan) as a fluorescent reporter. RT-qPCR primers sequences are shown in Table 1, which was according to the design of Wang et al. (2013) and the P. persica expressed sequence tag (EST) database (TIGR Plant Transcript Assemblies; http://plantta.Tigr.org) (Childs et al., 2007). These gene included: AI (GenBank ID KC905744), NI1 (GenBank ID AM409095), NI2 (GenBank ID XM_007221355), SS (GenBank ID JQ412752), SPS (GenBank ID JQ412751), SDH (GenBank ID AB025969), PFK (GenBank ID KC700019) and G6PDH (GenBank ID XM_007215059). PCR reactions were performed in a total volume of 20 ml, which included 1.6 ml of cDNA, 0.8 ml of each primer (10 mM), 10 ml of SYBR Green kit II, and 6.8 ml of RNase-free water. The real-time PCR program was initiated with a preliminary step of 2 min at 95 C, followed by 40 cycles of 94 C for 15 s, 55 C for 20 s and 72 C for 20 s. Relative gene expression was calculated using the ‘Comparative 2DDCT’ method (Livak and Schmittgen, 2001). Translation elongation factor 2 (TEF2, JQ732180.1) was used as an internal control, and cycle threshold (Ct) numbers were extracted for both the reference and target genes. Each RNA sample Table 1 Real-time PCR primer sequences for genes related to sugar metabolism. Gene
Forward primer sequence (50 –30 )
Reverse primer sequence (50 –30 )
AI NI/1 NI/2 SS SPS SDH PFK G6PDH TEF2
TCATACGCCCATACCACCAG TGCTCTGGAGTATGAAGAATGG CTATGACACCAAAAGGGGTAGG ATGAGGAGAAGGCTGAGATGAAG TTGAGGCTACAGGAAAGGAAAG GCAGACTTTGTTGTTCAAGAGC TCTTGCATCGACGAACCAGC GGTCCAGCAGAAGCCGATG TGAAGGAGAGGGAAGGTGAAAG
CGAAATCGGAATCGAATAGC ATCCACTGCCTTTTGTGCTAAC GCTTTCTTCTTGGGTTAGCACT CAAGTAGCGAATGTTGGAAGTC GGACGCTCCTCTGAATGAATAG TCATGTCAGGGCAGAGATTG AAGCCGTAAGTCATGTCACCTTG CGTTATGGTATATGGCACACACTG TGAAGGAGAGGGAAGGTGAAAG
10
L. Yu et al. / Postharvest Biology and Technology 113 (2016) 8–16
was run in triplicate and repeated in three independent sets of treatments for at total nine replicates per gene per sample. 2.5. AI and SPS activities AI activity was determined according to the method of Sun et al. (2011). 1 g of frozen mesocarp tissue was homogenized with 5 ml of 100 mM sodium phosphate buffer (pH 7.5), containing 5 mM MgCl2, 1 mM ethylenediaminetetraacetic acid (EDTA), 2.5 mM dithiothreitol (DTT), and 0.1% (v/v) Triton X-100. The homogenates were centrifuged at 10,000 g for 20 min at 4 C, and the supernatants were diluted 1:5 with distilled water. AI activity was assayed in mixture of 100 mM sodium citrate buffer (pH 4.5), 1% (m/v) sucrose and crude enzyme extract. The mixture was incubated at 34 C for 30 min, then boiled for 5 min to stop the reaction. SPS activity was measured according to the method of Solomakhin and Blanke (2010). Briefly, a reaction mixture
containing 100 mM HEPES-NaOH (pH 8.0), 10 mM uridinediphosphate (UDP)-glucose, 5 mM fructose-6-phosphate, 15 mM glucose6-phosphate, 15 mM MgCl2 and crude extract was incubated for 30 min at 34 C. The reaction was terminated by adding 5 M NaOH and then placed in boiling water for 10 min. 2.6. Statistical analysis Experiments were performed using a completely randomized design. Statistical analyses were calculated over two factors, treatment and storage time, and performed with SAS software (version 8.2, SAS Institute, Cary, NC, USA). Real-time PCR expression analysis was performed with Microsoft Excel (Microsoft, WA, USA). Figures were drawn using OriginPro 8.1G (Microcal Software Inc., Northampton, MA, USA). Differences between means were assessed by Duncan’s multiple range tests with a significance threshold of 0.05.
Fig. 1. Effect of HA and MeJA treatments on CI in peach fruit stored at 5 C for 35 days. (A) CI indexes are shown as the means SE of triplicate assays. Different lowercase letters indicate significant difference using Duncan’s multiple range test at each time point. (B) Five representative peaches sampled from each treatment group at week 5.
L. Yu et al. / Postharvest Biology and Technology 113 (2016) 8–16
3. Results 3.1. The CI index Peaches exhibited CI symptoms after storage for 28 days, although treatment with HA or MeJA significantly (p < 0.05) reduced CI over non-treated controls (Fig. 1A). After 35 days of storage, the CI index of control peaches was 0.74, while those treated with HA or MeJA had indexes of 0.18 and 0.43, respectively (Fig. 1B). The CI index of HA treated fruit was significantly (p < 0.05) lower than that of MeJA treated fruit.
11
highest values. Compared with the control, MeJA significantly reduced glucose content only over the first 14 days, although had no significant effect on fructose during the storage period. HA treatment significantly (p < 0.05) reduced glucose and fructose content relative to the control group at days 14 and 21. The sorbitol content in all fruits was increased at day 7, and then generally decreased thereafter (Fig. 2D). The treated groups exhibited higher sorbitol levels than the control group, and HA treatment yielded significantly (p < 0.05) higher values at day 21 and after. Although the sorbitol content of HA treatment increased after 21 days of cold storage, there was no significant difference (p > 0.05) at 21, 28 and 35 days.
3.2. Changes in sucrose, glucose, fructose and sorbitol content 3.3. Transcription of genes involved in soluble sugar metabolism Sucrose is the predominant soluble carbohydrate in peach fruit at harvest. As shown in Fig. 2A, the sucrose content in peaches treated with HA or MeJA significantly increased during the first two weeks of storage and then decreased thereafter. In contrast, sucrose content in the control group steadily decreased during the storage period, and was consistently significantly (p < 0.05) lower than that observed in treated peaches except for the MeJA group at day 21. At later times, the sucrose content of the HA group was significantly (p < 0.05) higher than that of the MeJA group, which is consistent with the lower CI index in HA group (Fig. 1A). Hexose (glucose and fructose) content generally increased for all groups (Fig. 2B and C), with the control group showing the
For all groups, the AI transcript levels increased rapidly early in storage, peaked at 21 days, and then decreased (Fig. 3A). In the control and MeJA groups the peak AI levels were over one thousand times higher than the levels observed at the beginning of the experiment (day 0). Except at day 21, AI transcript levels in peaches treated with MeJA were lower (p < 0.05) than those observed in the control group. Peaches treated with HA exhibited the lowest transcript levels at all time points, with a peak value one half that of the other groups. NI/1 transcript levels for both treatment groups was reduced relative to the control, except for the MeJA treated group at day 21
Fig. 2. Effect of HA and MeJA treatments on (A) sucrose, (B) glucose, (C) fructose, and (D) sorbitol content in peach fruit stored at 5 C over a 5-week period. Values are the means SE of triplicate assays. Different lowercase letters indicate significant difference using Duncan’s multiple range test at each time point.
12
L. Yu et al. / Postharvest Biology and Technology 113 (2016) 8–16
Fig. 3. Effect of HA and MeJA treatments on transcript levels for genes involved in sucrose metabolism in peach fruit stored at 5 C. (A) AI; (B) NI/1; (C) NI/2; (D) SS; (E) SPS; (F) SDH. Values are the means SE of triplicate assays. Different lowercase letters indicate significant difference using Duncan’s multiple range test at each time point.
(Fig. 3B). The lowest levels were exhibited in the HA group during the first 21 days storage. NI/2 transcript levels in the control and MeJA treated fruit shared a similar profile, increasing early during storage then decreasing. MeJA treatment appeared to shift the peak of NI/2 transcript to later in storage (day 21 versus day 14 for control). In contrast, the NI/2 transcript levels in HA treated fruit decreased early in storage then increased until day 28 before decreasing again (Fig. 3C).
Untreated fruit, along with MeJA-treated fruit, displayed a similar pattern of SS transcription increasing until day 21 and then decreasing (Fig. 3D). SS levels in the MeJA group were significantly (p < 0.05) lower than in the control except at day 21, and levels in the HA group were markedly (p < 0.05) lower than in the control after 7 days storage. For all groups the transcript levels of SPS peaked at day 7 then decreased (Fig. 3E). Transcript levels in the HA- and MeJA-treated
L. Yu et al. / Postharvest Biology and Technology 113 (2016) 8–16
groups were higher than in the control, except at day 35 (HA group) and day 28 (MeJA group). The SDH transcription pattern was similar for all groups as well, peaking at day 7 then sharply decreasing. SDH transcript levels were equivalent in all groups except on day 7, when the levels in the HA and MeJA groups were significantly lower than in the control. 3.4. Activities of AI and SPS In all peaches, AI or SPS activities initially increased and then decreased during cold storage (Fig. 4). For AI, peak values for the treated groups were 1.2 times higher than in fruit immediately after harvest, while the peak values for the control group were 1.67 times higher than immediately after harvest (Fig. 4A). HA and MeJA treatment significantly (p < 0.05) reduced AI activity relative to the control during the experiment. In contrast, both treatments significantly (p < 0.05) enhanced SPS activity (Fig. 4B). The peak values for the HA and MeJA groups were 7.4 and 6.6 times higher than in fruit immediately after harvest, respectively. 3.5. Expression of PFK and G6PDH during storage In non-treated fruit PFK transcript increased steadily for 28 days reaching a peak value 14.5 times higher than in fruit immediately after harvest, before declining (Fig. 5A). Treatment with either HA or MeJA shifted the peak value to day 21 and significantly decreased the PFK transcription. The lowest levels were observed in the HA-treated group. For control and MeJA treated fruit, G6PDH transcript levels increased early in storage, reaching peak levels at day 7, then decreasing. In contrast, G6PDH levels in HA treated fruit was significantly reduced early in storage but increased steadily after day 14. MeJA treated fruit also showed an increase in G6PDH transcript levels after day 21 (Fig. 5B). 4. Discussion Peach fruit is sensitive to low temperature and highly susceptible to CI during cold storage. A number of studies confirm that HA and MeJA treatments alleviate CI, many varieties such as ‘Jiubao’ (Meng et al., 2009), ‘Yulu’ (Wang et al., 2013), ‘Baifeng’ (Jin et al., 2009) and ‘Feicheng’ (Zhu et al., 2010) exhibit CI symptoms (IB and mealiness) after 3 weeks. In our study we observed CI
13
symptoms in treated peaches after 4 weeks of cold storage. HA and MeJA treatments clearly delay and reduce the CI index in this variety as well (Fig. 1A). Browning potential of peaches depends on the level of phenolic compounds and polyphenol oxidase (PPO) activity present in the fruit. When the membrane permeability changes, phenolic compounds and PPO interact, leading to tissue deterioration or senescence (Lurie and Crisosto, 2005). The cell membrane is the primary structure affected by low temperature; the membrane changes from the gel to liquid crystalline phase at chilling temperature, which increases the risk that the semi-permeability of the cell membrane will be lost (Jin et al., 2014). At chilling temperature, membrane fatty acid peroxidation, electrolyte leakage and lipid peroxidation are responsible for the loss of membrane integrity (Aghdam and Bodbodak, 2013; Wongsheree et al., 2009). Sugar metabolism, including sucrose metabolism and hexose metabolism, is necessary to contribute the antioxidant compounds that are crucial for the protection of fruit cells against oxidative chilling stress (Couée et al., 2006). In loquat fruit, increased levels of reducing sugars induce the ascorbate– glutathione cycle and are associated with higher resistance to CI (Cao et al., 2013; Shao et al., 2013). However, sucrose is more important than hexose in protecting grape branches from CI at low temperature (Jiang et al., 2013), a finding that has also been confirmed in tomato seedlings (Qi et al., 2011). Steponkus (1984) suggests that sucrose functions as an antioxidant, provides protection to membranes against leakage and protein inactivation, and has a higher antioxidant capacity than glucose (Couée et al., 2006). The effect of cold stress on sugar can reflect the stress imposed to the peach fruit (Puig et al., 2015). Sucrose is the primary sugar in peach fruit (Brooks et al., 1993). The degradation of sucrose is accompanied by increases in glucose and fructose during the ripening process (Borsani et al., 2009). Abidi et al. (2015) have suggested that peach cultivars with high levels of sucrose and glucose exhibit reduced CI during cold storage, and Wang et al. (2013) have demonstrated that higher levels of sucrose contribute to membrane stability and enhance chilling tolerance in peach fruit. In carambola fruit, a significant increase in sucrose content was observed at 2 C and 10 C (but not at 20 C), and was associated with a physiological response of tissues to CI (PerezTello et al., 2001). Holland et al. (2002) demonstrated that heat treatment prevents a decline in sucrose content in citrus fruit stored at chilling temperature, suggesting that sucrose is a
Fig. 4. Effect of HA and MeJA treatments on (A) AI activity and (B) SPS activity in peach fruit stored at 5 C. Values are the means SE of triplicate assays. Different lowercase letters indicate significant difference using Duncan’s multiple range test at each time point.
14
L. Yu et al. / Postharvest Biology and Technology 113 (2016) 8–16
Fig. 5. Effect of HA and MeJA treatments on (A) PFK and (B) G6PDH transcript levels in peach fruit stored at 5 C. Values are the means SE of triplicate assays.
necessary factor for the heat-induced chilling tolerance. Our results show that sucrose content significantly increases over the first 7–14 days in peaches treated with HA or MeJA before decreasing (Fig. 2A) and is accompanied by a reduced CI index (Fig. 1). HA-treated peaches exhibit the highest sucrose content by the end of storage and the least CI symptoms. These results indicate that sucrose is closely related to CI in peach fruit. Among sucrose metabolizing enzymes, invertase, including AI and NI, as well as SS-cleavage, are responsible for the accumulation of reducing sugars (Sturm and Tang, 1999). Additionally, SSsynthesis and SPS are involved in catalyzing sucrose biosynthesis (Guo et al., 2002). Wang et al. (2013) reported that enhanced AI, NI/1-2, and SS transcription, and decreased SPS/1 transcription, lead to a sharp reduction in sucrose in peaches stored at 5 C. Sun et al. (2011) found that peach fruit treated with 10 mmol/l NO maintain a high level of sucrose and lower levels of reducing sugars. These changes, which are associated with an increase in SPS activity and a decrease in AI, NI and SS-cleavage activities, effectively prolong the storage period of fruit. Itai and Tanahashi (2008) demonstrated that treating Japanese pears with 1-MCP inhibits AI gene expression, accelerates the accumulation of SPS1 transcript levels during cold storage, and is associated with a reduction in sucrose loss and the accumulation of glucose and fructose. In grape branches, the increase of hexose is due to enhanced AI activity and the accumulation of sucrose is mostly due to the elevation of SPS activity (Jiang et al., 2013). Cai et al. (2015) showed that SPS played an important role in controlling sucrose flux through metabolic pathways. The complete genomic sequence of the model higher plant Arabidopsis reveals four SPS genes (Lutfiyya et al., 2007). Itai and Tanahashi (2008) considered SPS/1 has SPS activity, the accumulation of the SPS/1 transcript contributed to the inhibition of sucrose loss in Japaness pear. The SPS gene measured in this study is SPS/1. HA and MeJA treatments enhanced the transcript and activities of SPS (Figs. 3 E and Fig. 44B), which contribute to the increase in sucrose content in peaches observed during cold storage. There were four putative genes of NI in peach, and a significant increase in the levels of NI/2 and NI/3, while decrease the level of NI/1 and NI/4 were detected during the post-harvest ripening process (Borsani et al., 2009). However, Wang et al. (2013) reported that among NI/1-4 enhanced NI/1-2 transcription lead to a sharp reduction in sucrose in peaches stored at 5 C. In present study, HA and MeJA treatments reduced NI/1-2 transcript levels, which contributed to the higher sucrose content in peach fruit during cold storage.
AI is classified into three main types, cell wall-bound invertase, vacuolar invertase and apoplastic invertase. The latter two types are referred to as soluble acid invertase (SAI). SAI plays an important role in functions related to sucrose metabolism and presumably hydrolyzes sucrose to supply reducing sugars necessary for cell growth and development (Tang et al., 1999; Tymowska-Lalanne and Kreis, 1998). Sucrose deposited in the vacuole is cleaved by vacuolar invertase. Yamada et al. (2007) isolated cDNA clones for SAI from Japanese pear fruit and found that two isoforms of vacuolar invertase, especially AI/2, have important functions during development. Transcription levels of the vacuolar invertase gene StvacINV1 increase sharply, even thousands times, in potato tubers stored under low-temperature sweetening conditions. Suppression of StvacINV1 inhibits sucrose decomposition, which is related to lower reducing sugar content (Liu et al., 2011). The AI gene measured in this study is also a vacuolar invertase. The transcript level of AI exhibited the highest rate of increase and highest level attained among the sucrose catabolism genes we tested (Fig. 3A). Compared with fruit immediately after harvest, AI transcript levels in control and MeJA-treated fruit increased about 1400 fold, and increased more than 700 fold in HA-treated fruit. AI transcription increases rapidly in response to low temperature and affects sucrose catabolism. The reduction in sucrose loss observed in HA- and MeJA-treated fruit is associated with a reduction in AI transcript levels. Therefore, changes in AI transcript levels probably play the predominant role in modulating soluble sugar metabolism during cold storage. It may be important that AI activity does not increase as rapidly as the level of AI transcription (Fig. 4A). This phenomenon has been noted in potato tubers in cold storage (Ou et al., 2013). The weak correlation between AI activity and gene expression may be related to an invertase inhibitor (Liu et al., 2013). Liu et al. (2013) suggested that the protease inhibitor gene, St-Inh, reduced AI activity in cold-stored potatoes. Investigation of the inhibitor protein may help explain the difference between AI activity and AI gene expression in peach fruit under cold stress. Sorbitol is the main sugar alcohol in peach fruit. Sorbitol is converted into fructose by sorbitol dehydrogenase (SDH) (Itai and Tanahashi, 2008). Sorbitol content of harvested peach fruits increased at the first 7 days and decreased later. The increase of sorbitol may be related with peach fruits still have the ability of synthesis, which compound sorbitol by hexose phosphate pool in the cytosol (Wang et al., 2013). HA and MeJA treatments reduce transcript levels of SDH (Fig. 3F), which delays sorbitol content loss
L. Yu et al. / Postharvest Biology and Technology 113 (2016) 8–16
Fig. 6. Model for regulation by HA and MeJA on soluble sugar metabolism in peach fruit stored at cold temperature (5 C).
(Fig. 2D). The oxidation of hexose occurs via the Embden– Meyerhof–Parnas (EMP) and pentose phosphate pathways (PPP). Phosphofructokinase (PFK) and glucose-6-phosphate dehydrogenase (G6PDH) are the main enzymes that regulate EMP and catalyze the first irreversible reaction of PPP, respectively (Kruger and Hammond, 1988; Sagisaka, 1972). In most tissues, glucose is predominantly metabolized by EMP rather than by PPP (Couée et al., 2006). Energy is produced via EMP, which is associated with cell membrane integrity (Jin et al., 2014). Fig. 6 showed the possible regulation mechanism by HA and MeJA on soluble sugar metabolism in peach fruit stored at cold temperature. For treated fruits, the lower expression and activity of AI and the higher expression and activity of SPS, which resulted in less sucrose converted into hexose. Meanwhile, the lower PFK and G6PDH transcript levels observed in treated peach fruit, especially PFK, suggest that less glucose was routed into EMP. Although more sucrose converted into hexose in control group, higher PFK transcript levels led more hexose feed to EMP. Thus, the hexose content of treated and untreated fruit during cold storage was indistinguishable (Fig. 2B and C). In conclusion, cold storage causes a decrease in sucrose and an increase in hexose in peach fruit. HA and MeJA treatments were effective in alleviating CI during cold storage by reducing the magnitude of these changes (Fig. 6). The enhancement of chilling tolerance by these treatments may be due to the increase in sucrose content, which is a consequence of higher SPS and lower AI levels. Changes in AI transcript levels probably play the predominant role in modulating soluble sugar metabolism during cold storage. Acknowledgments This study was supported by the Nature Science Foundation of Zhejiang Province (No. LR15C200002), the National Science Foundation of China (No. 31000825), the Key Laboratory of Healthy & Intelligent Kitchen System Integration of Zhejiang Province (No. 2014E10014) and the K. C. Wong Magna Fund at Ningbo University. References Abidi, W., Cantin, C.M., Jimenez, S., Gimenez, R., Moreno, M.A., Gogorcena, Y., 2015. Influence of antioxidant compounds, total sugars and genetic background on the chilling injury susceptibility of a non-melting peach (Prunus persica (L.) Batsch) progeny. J. Sci. Food Agric. 95, 351–358. Aghdam, M.S., Bodbodak, S., 2013. Physiological and biochemical mechanisms regulating chilling tolerance in fruits and vegetables under postharvest salicylates and jasmonates treatments. Sci. Hortic. 156, 73–85. Anchordoguy, T.J., Rudolph, A.S., Carpenter, J.F., Crowe, J.H., 1987. Modes of interaction of cryoprotectants with membrane phospholipids during freezing. Cryobiology 24, 324–331. Borsani, J., Budde, C.O., Porrini, L., Lauxmann, M.A., Lombardo, V.A., Murray, R., Andreo, C.S., Drincovich, M.F., Lara, M.V., 2009. Carbon metabolism of peach fruit after harvest: changes in enzymes involved in organic acid and sugar level modifications. J. Exp. Bot. 60, 1823–1837.
15
Brooks, S.J., Moore, J.N., Murphy, J.B., 1993. Quantitative and qualitative changes in sugar content of peach genotypes [Prunus persica (L.) Batsch.]. J. Am. Soc. Hortic. Sci. 118, 97–100. Cai, X., Wang, H., Pang, G., 2015. Flux control analysis of a lactate and sucrose metabolic network at different storage temperatures for Hami melon (Cucumis melo var. saccharinus). Sci. Hortic. 181, 4–12. Cao, S., Zheng, Y., Wang, K., Jin, P., Rui, H., 2009. Methyl jasmonate reduces chilling injury and enhances antioxidant enzyme activity in postharvest loquat fruit. Food Chem. 115, 1458–1463. Cao, S., Hu, Z., Zheng, Y., Lu, B., 2010. Synergistic effect of heat treatment and salicylic acid on alleviating internal browning in cold-stored peach fruit. Postharvest Biol. Technol. 58, 93–97. Cao, S., Cai, Y., Yang, Z., Zheng, Y., 2012. MeJA induces chilling tolerance in loquat fruit by regulating proline and g-aminobutyric acid contents. Food Chem. 133, 1466–1470. Cao, S., Yang, Z., Zheng, Y., 2013. Sugar metabolism in relation to chilling tolerance of loquat fruit. Food Chem. 136, 139–143. Childs, K.L., Hamilton, J.P., Zhu, W., Ly, E., Cheung, F., Wu, H., Rabinowicz, P.D., Town, C.D., Buell, C.R., Chan, A.P., 2007. The TIGR plant transcript assembies database. Nucleic Acids Res. 35, D846–D851. Couée, I., Sulmon, C., Gouesbet, G., El Amrani, A., 2006. Involvement of soluble sugars in reactive oxygen species balance and responses to oxidative stress in plants. J. Exp. Bot. 57, 449–459. Der Agopian, R.G., Peroni-Okita, F.H.G., Soares, C.A., Mainardi, J.A., do Nascimento, J. R.O., Cordenunsi, B.R., Lajolo, F.M., Purgatto, E., 2011. Low temperature induced changes in activity and protein levels of the enzymes associated to conversion of starch to sucrose in banana fruit. Postharvest Biol. Technol. 62, 133–140. González-Aguilar, G.A., Tiznado-Hernández, M.E., Zavaleta-Gatica, R., Martı’nezTéllez, M.A., 2004. Methyl jasmonate treatments reduce chilling injury and activate the defense response of guava fruits. Biochem. Biophys. Res. Commun. 313, 694–701. Guo, J., Jermyn, W.A., Turnbull, M.H., 2002. Carbon assimilation, partitioning and export in mature cladophylls of two asparagus (Asparagus officinalis) cultivars with contrasting yield. Physiol. Plant. 115, 362–369. Holland, N., Menezes, H.C., Lafuente, M.T., 2002. Carbohydrates as related to the heat-induced chilling tolerance and respiratory rate of ‘Fortune’ mandarin fruit harvested at different maturity stages. Postharvest Biol. Technol. 25, 181–191. Itai, A., Tanahashi, T., 2008. Inhibition of sucrose loss during cold storage in Japanese pear (Pyrus pyrifolia Nakai) by 1-MCP. Postharvest Biol. Technol. 48, 355–363. Jiang, H., Li, W., He, B., Gao, Y., Lu, J., 2013. Sucrose metabolism in grape (Vitis vinifera L.) branches under low temperature during overwintering covered with soil. Plant Growth Regul. 72, 229–238. Jin, P., Wang, K., Shang, H., Tong, J., Zheng, Y., 2009. Low-temperature conditioning combined with methyl jasmonate treatment reduces chilling injury of peach fruit. J. Sci. Food Agric. 89, 1690–1696. Jin, P., Zhu, H., Wang, L., Shan, T., Zheng, Y., 2014. Oxalic acid alleviates chilling injury in peach fruit by regulating energy metabolism and fatty acid contents. Food Chem. 161, 87–93. Kruger, N.J., Hammond, J.B., 1988. Molecular comparison of pyrophosphate- and ATP-dependent fructose 6-phosphate 1-phosphotransferases from potato tuber. Plant Physiol. 86, 645–648. Lalonde, S., Boles, E., Hellmann, H., Barker, L., Patrick, J.W., Frommer, W.B., Ward, J. M., 1999. The dual function of sugar carriers: transport and sugar sensing. Plant Cell 11, 707–726. Lara, M.V., Borsani, J., Budde, C.O., Lauxmann, M.A., Lombardo, V.A., Murray, R., Andreo, C.S., Drincovich, M.F., 2009. Biochemical and proteomic analysis of ‘Dixiland’ peach fruit (Prunus persica) upon heat treatment. J. Exp. Bot. 60, 4315– 4333. Liu, X., Zhang, C., Ou, Y., Lin, Y., Song, B., Xie, C., Liu, J., Li, X., 2011. Systematic analysis of potato acid invertase genes reveals that a cold-responsive member, StvacINV1, regulates cold-induced sweetening of tubers. Mol. Genet. Genom. 286, 109–118. Liu, X., Cheng, S., Liu, J., Ou, Y., Song, B., Zhang, C., Lin, Y., Li, X., Xie, C., 2013. The potato protease inhibitor gene, St-Inh, plays roles in the cold-induced sweetening of potato tubers by modulating invertase activity. Postharvest Biol. Technol. 86, 265–271. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2DDCT. Methods 25, 402–408. Lurie, S., Crisosto, C.H., 2005. Chilling injury in peach and nectarine. Postharvest Biol. Technol. 37, 195–208. Lutfiyya, L.L., Xu, N., D’Ordine, R.L., Morrell, J.A., Miller, P.W., Duff, S.M.G., 2007. Phylogenetic and expression analysis of sucrose phosphate synthase isozymes in plants. J. Plant Physiol. 164, 923–933. Meisel, L., Fonseca, B., González, S., Baeza-Yates, R., Cambiazo, V., Campos, R., González, M., Orellana, A., Retamales, J., Silva, H., 2005. A rapid and efficient method for purifying high quality total RNA from peaches (Prunus persica) for functional genomics analyses. Biol. Res. 38, 83–88. Meng, X., Han, J., Wang, Q., Tian, S., 2009. Changes in physiology and quality of peach fruits treated by methyl jasmonate under low temperature stress. Food Chem. 114, 1028–1035. Murray, R., Lucangeli, C., Polenta, G., Budde, C., 2007. Combined pre-storage heat treatment and controlled atmosphere storage reduced internal breakdown of ‘Flavorcrest’ peach. Postharvest Biol. Technol. 44, 116–121. Nishizawa, A., Yabuta, Y., Shigeoka, S., 2008. Galactinol and raffinose constitute a novel function to protect plants from oxidative damage. Plant Physiol. 147, 1251–1263.
16
L. Yu et al. / Postharvest Biology and Technology 113 (2016) 8–16
Oliver, A.E., Hincha, D.K., Crowe, J.H., 2002. Looking beyond sugars: the role of amphiphilic solutes in preventing adventitious reactions in anhydrobiotes at low water contents. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 131, 515– 525. Ou, Y., Song, B., Liu, X., Lin, Y., Zhang, H., Li, M., Fang, H., Liu, J., 2013. Profiling of stvacINV1 expression in relation to acid invertase activity and sugar accumulation in potato cold-stored tubers. Potato Res. 56, 157–165. Pathirana, R., Harris, J.C., McKenzie, M.J., 2008. A comparison of microtubers and field-grown tubers of potato (Solanum tuberosum L.) for hexoses, sucrose and their ratios following postharvest cold storage. Postharvest Biol. Technol. 49, 180–184. Perez-Tello, G.O., Silva-Espinoza, B.A., Vargas-Arispuro, I., Briceno-Torres, B.O., Martinez-Tellez, M.A., 2001. Effect of temperature on enzymatic and physiological factors related to chilling injury in carambola fruit (Averrhoa carambola L.). Biochem. Biophys. Res. Commun. 287, 846–851. Puig, C.P., Dagar, A., Ibanez, C.M., Singh, V., Crisosto, C.H., Friedman, H., Lurie, S., Granell, A., 2015. Pre-symptomatic transcriptome changes during cold storage of chilling sensitive and resistant peach cultivars to elucidate chilling injury mechanisms. BMC Genom. 16, 245. Qi, H., Hua, L., Zhao, L., Zhou, L., 2011. Carbohydrate metabolism in tomato (Lycopersicon esculentum Mill.) seedlings and yield and fruit quality as affected by low night temperature and subsequent recovery. Afr. J. Biotechnol. 10, 5743– 5749. Sagisaka, S., 1972. Decrease of glucose 6-phosphate and 6-phosphogluconate dehydrogenase activities in the xylem of Populus gelrica on budding. Plant Physiol. 50, 750–755. Shao, X., Zhu, Y., Cao, S., Wang, H., Song, Y., 2013. Soluble sugar content and metabolism as related to the heat-induced chilling tolerance of loquat fruit during cold storage. Food Bioprocess Technol. 6, 3490–3498.
Solomakhin, A.A., Blanke, M.M., 2010. Mechanical flower thinning improves the fruit quality of apples. J. Sci. Food. Agric. 90, 735–741. Steponkus, P.L., 1984. Role of the plasma membrane in freezing injury and cold acclimation. Annu. Rev. Plant Physiol. 35, 543–584. Sturm, A., Tang, G., 1999. The sucrose-cleaving enzymes of plants are crucial for development, growth and carbon partitioning. Trends Plant Sci. 4, 401–407. Sun, Z., Li, Y., Zhou, J., Zhu, S., 2011. Effects of exogenous nitric oxide on contents of soluble sugars and related enzyme activities in ‘Feicheng’ peach fruit. J. Sci. Food Agric. 91, 1795–1800. Tang, G., Lüscher, M., Sturm, A., 1999. Antisense repression of vacuolar and cell wall invertase in transgenic carrot alters early plant development and sucrose partitioning. Plant Cell 11, 177–189. Tymowska-Lalanne, Z., Kreis, M., 1998. The plant invertases: physiology, biochemistry and molecular biology. Adv. Bot. Res. 28, 71–117. Wang, K., Shao, X., Gong, Y., Zhu, Y., Wang, H., Zhang, X., Yu, D., Yu, F., Qiu, Z., Lu, H., 2013. The metabolism of soluble carbohydrates related to chilling injury in peach fruit exposed to cold stress. Postharvest Biol. Technol. 86, 53–61. Wang, K., Shao, X., Gong, Y., Xu, F., Wang, H., 2014. Effects of postharvest hot air treatment on gene expression associated with ascorbic acid metabolism in peach fruit. Plant Mol. Biol. Rep. 32, 881–887. Wongsheree, T., Ketsa, S., van Doorn, W.G., 2009. The relationship between chilling injury and membrane damage in lemon basil (Ocimum citriodourum) leaves. Postharvest Biol. Technol. 51, 91–96. Yamada, K., Kojima, T., Bantog, N., Shimoda, T., Mori, H., Shiratake, K., Yamaki, S., 2007. Cloning of two isoforms of soluble acid invertase of Japanese pear and their expression during fruit development. J. Plant Physiol. 164, 746–755. Zhu, L., Zhou, J., Zhu, S., 2010. Effect of a combination of nitric oxide treatment and intermittent warming on prevention of chilling injury of ‘Feicheng’ peach fruit during storage. Food Chem. 121, 165–170.
Contents lists available at ScienceDirect
Postharvest Biology and Technology journal homepage: www.elsevier.com/locate/postharvbio
Effects of hot air and methyl jasmonate treatment on the metabolism of soluble sugars in peach fruit during cold storage Lina Yua , Hongxing Liub , Xingfeng Shaoa,* , Fang Yua , Yanzhen Weia , Zhiming Nib , Feng Xua , Hongfei Wanga a b
Department of Food Science and Engineering, Ningbo University, Ningbo 315211, PR China Key Laboratory of Healthy & Intelligent Kitchen System Integration, Ningbo Fotile Kitchenware Co., Ltd., Ningbo 315326, PR China
A R T I C L E I N F O
A B S T R A C T
Article history: Received 20 July 2015 Received in revised form 23 October 2015 Accepted 25 October 2015 Available online xxx
Soluble sugar metabolism affects the quality and chilling resistance of postharvest peach fruit. Although hot air (HA) and methyl jasmonate (MeJA) treatments are often effective in reducing chilling injury (CI), little is known about the relationship between sugar metabolism and HA or MeJA treatments in peach fruit. In this study, peach fruit was treated with hot air at 37 C for 3 days or MeJA vapor at 10 mmol/L for 24 h before storage at 5 C. Soluble sugar content, gene expression and enzyme activities associated with sugar metabolism were measured. Both treatments resulted in an initial increase, then a decrease in sucrose content over the course of storage time. Sucrose levels at every time point, but one, throughout the experiment were significantly higher than in control fruit, paralleled by higher gene expression and activity of SPS (sucrose phosphate synthase) and lower expression and activity of AI (acid invertase). HAtreated fruit had the highest sucrose content at the end of storage and the mildest CI symptoms. All treated fruit had higher sorbitol content and lower levels of SDH (sorbitol dehydrogenase) gene expression than control fruit. After 21 days in cold storage, sucrose content had decreased sharply in the control group, hexose content was not markedly affected, perhaps due to the increased expression of PFK (phosphofructokinase), resulting in more glucose entering the Embden–Meyerhof–Parnas pathway (EMP). These results suggest that the increase in sucrose observed during cold storage, associated with higher SPS and lower AI levels, enhances the chilling tolerance observed in HA- and MeJA-treated fruit. ã 2015 Elsevier B.V. All rights reserved.
Keywords: Prunus persica Hot air Methyl jasmonate Sugar metabolism
1. Introduction Because peaches (Prunus persica L. Batsh) ripen and deteriorate quickly at ambient temperature, cold storage is used to slow the ripening process and the development of decay. Peaches are however sensitive to low temperature, and symptoms of chilling injury (CI) develop within 1 or 2 weeks when fruit is stored at 2– 5 C; these symptoms include wooliness, flesh browning, reddening and leatheriness (Lurie and Crisosto, 2005). Hot air treatment (HA), an environmentally friendly technology, has proven to be an effective method for reducing CI in peach fruit by enhancing antioxidant system activity, stimulating the accumulation of heat shock proteins, and maintaining membrane integrity (Cao et al., 2010; Murray et al., 2007; Wang et al., 2014). Methyl jasmonate (MeJA), a natural plant regulatory compound, can trigger defense
* Corresponding author. Fax: +86 574 87608347. E-mail address: [email protected] (X. Shao). http://dx.doi.org/10.1016/j.postharvbio.2015.10.013 0925-5214/ ã 2015 Elsevier B.V. All rights reserved.
mechanisms against chilling stress and plays an important role in alleviating CI in peaches (Meng et al., 2009) by enhancing cell membrane integrity and antioxidant system activity (Cao et al., 2009), increasing the polygalacturonase/pectin methylesterase ratio (Jin et al., 2009) and increasing the content of proline and g-aminobutyric acid (Cao et al., 2012). Sugars, including soluble sugars and sugar alcohols, are significant sources of energy, contribute to the quality and taste of fruits (Cai et al., 2015), and affect fruit stress resistance (Der Agopian et al., 2011). Puig et al. (2015) put forward that sugar partitioning and demand during cold storage may play a role in the tolerance mechanism of peach fruit. The soluble sugars in peach fruit include sucrose, sorbitol, glucose and fructose. Sucrose is well known as the major carbohydrate in peach fruit, and it is hypothesized that high sucrose and glucose content can alleviate CI symptoms in peaches (Abidi et al., 2015). Wang et al. (2013) demonstrated that sucrose plays a more important role than glucose or fructose in protecting peach fruit and alleviating CI during cold stress. Jiang et al. (2013) have suggested that sucrose is
L. Yu et al. / Postharvest Biology and Technology 113 (2016) 8–16
more important than hexose in protecting grape branches from cold injury under low temperature conditions. In potato (Solanumtuberosum L.) microtubers and field-grown tubers, higher sucrose levels were observed at 4 C than at 10 C (Pathirana et al., 2008). Sucrose regulates osmotic pressure (Anchordoguy et al., 1987), stabilizes cell membrane structure (Oliver et al., 2002), activates the anti-oxidization system to eliminate free radicals (Nishizawa et al., 2008), and regulates metabolic pathways (Lalonde et al., 1999). Researchers have demonstrated that HA treatment can modify sugar metabolism in postharvest fruit at chilling and non-chilling temperatures. Lara et al. (2009) showed that during storage at ambient temperature, peach fruit treated at 39 C for 3 days prior to storage has significantly decreased sucrose content and increased levels of reducing sugars, compared to non HA treated peach fruit. Shao et al. (2013) found that heat treatment increased levels of reducing sugars in loquat fruit under chilling stress. Holland et al. (2002) demonstrated that heat treatment prevents the decline of sucrose content in citrus fruit stored at chilling temperature. In toto, research indicates that sucrose is a necessary factor in heat-induced chilling tolerance. In addition, treatment with MeJA at low concentrations significantly increases the sucrose content in two guava fruit cultivars during storage for various times at 5 C, followed by two days at 25 C (GonzálezAguilar et al., 2004). To our knowledge, no studies have focused on the effect of HA and MeJA treatments on sugar metabolism in peaches exposed to low temperatures. Therefore, the objective of our study was to examine the effect of HA and MeJA treatments on sugar content in peach fruit and associated changes in gene expression and enzyme activity during cold storage. 2. Materials and methods 2.1. Plant material and experimental design Peach fruits (Prunus persica L. Batsch) were harvested from a commercial orchard in Fenghua, Zhejiang Province, China. Fruits were immediately transported to our laboratory, selected for uniformity of color and the absence of physical damage, and randomly divided into three groups (HA treated, MeJA treated and non-treated control) of 105 peaches each. The first group was heattreated at 37 C for 3 days, after which fruits were stored at 5 C for 5 weeks. The second group was treated with 10 mmol/L MeJA (Sigma-Aldrich, Madrid, Spain) vapor in a sealed container for 24 h at 5 C. After treatment, the container was opened and ventilated for 1 h, and then fruits were stored at 5 C for 5 weeks. The last group (control) was stored at 5 C for 5 weeks immediately after selection. After cold storage for 0, 7, 14, 21, 28, or 35 days, CI indexes were assessed immediately after removal from cold storage, and then samples of five fruits from each replicate were mixed and frozen immediately in liquid nitrogen, and then stored at –80 C. Each treatment was replicated three times and the experiments were conducted twice. 2.2. Evaluation of CI index Internal browning (IB) is the visual characteristic symptom of CI. CI was assessed the visually IB on five fruits from each replicate after cutting the fruits along their axial diameters. The severity of CI was scored on a scale ranging from 0 to 4: 0 = none of IB, 1 = slight, 2 = moderate, 3 = moderately severe, 4 = severe. The results were expressed as the CI index, calculated using the following formula: CI index = [(CI score)(number of fruits with that CI score)]/(4 total number of fruits in each treatment).
9
2.3. Measurement of soluble sugars The method of Shao et al. (2013) was used to determine the soluble sugar content of the frozen fruit. Briefly, 5 g frozen peach tissue was ground with 0.5 ml of solution I [5.48% (w/v) zinc acetate: glacial acetic acid (97:3)] and 0.5 ml solution II [potassium ferrocyanide 2.65% (w/v)]. The homogenate was diluted to 25 ml with deionized water and passed through a 0.2 mm filter. Soluble sugars were measured using a high performance liquid chromatography (HPLC) system (Model 2695, Waters, USA), an X BrigeTM Amide Column (3.5 mm, 4.6 250 mm, USA), and a refractive index (RI) detector (Model 2414, Waters, USA). A sample of 20 ml was injected into the HPLC system for analysis. Acetonitrile/water (80:20, v/v) was used as the solvent at a flow rate of 1 ml min1 at 35 C. 2.4. RNA isolation and real-time PCR analysis Total RNA from frozen peach samples was isolated from 2 g of tissue according to the method described by Meisel et al. (2005). First, samples were subjected to several extractions with chloroform:isoamyl alcohol (24:1) to remove protein. Samples were then treated with RNase-free DNase (TaKaRa, Japan) to eliminate genomic DNA, following the manufacturer’s instructions. RNA integrity was assessed by agarose electrophoresis. The concentration of DNA-free RNA was determined using a spectrophotometer (NanoDrop 1000, Thermal, USA). RNA samples were stored at –80 C. First-strand cDNA was synthesized from 2 mg of treated total RNA using the SYBR PrimeScript RT-PCR kit II reverse transcriptase (TaKaRa, Japan) following the manufacturer’s instructions. The cDNA was diluted 10-fold with DEPC treated water and stored at –20 C prior to RT-qPCR analysis. Relative gene expression levels were determined by RT-qPCR using the SYBR Green kit II (Takara, Japan) as a fluorescent reporter. RT-qPCR primers sequences are shown in Table 1, which was according to the design of Wang et al. (2013) and the P. persica expressed sequence tag (EST) database (TIGR Plant Transcript Assemblies; http://plantta.Tigr.org) (Childs et al., 2007). These gene included: AI (GenBank ID KC905744), NI1 (GenBank ID AM409095), NI2 (GenBank ID XM_007221355), SS (GenBank ID JQ412752), SPS (GenBank ID JQ412751), SDH (GenBank ID AB025969), PFK (GenBank ID KC700019) and G6PDH (GenBank ID XM_007215059). PCR reactions were performed in a total volume of 20 ml, which included 1.6 ml of cDNA, 0.8 ml of each primer (10 mM), 10 ml of SYBR Green kit II, and 6.8 ml of RNase-free water. The real-time PCR program was initiated with a preliminary step of 2 min at 95 C, followed by 40 cycles of 94 C for 15 s, 55 C for 20 s and 72 C for 20 s. Relative gene expression was calculated using the ‘Comparative 2DDCT’ method (Livak and Schmittgen, 2001). Translation elongation factor 2 (TEF2, JQ732180.1) was used as an internal control, and cycle threshold (Ct) numbers were extracted for both the reference and target genes. Each RNA sample Table 1 Real-time PCR primer sequences for genes related to sugar metabolism. Gene
Forward primer sequence (50 –30 )
Reverse primer sequence (50 –30 )
AI NI/1 NI/2 SS SPS SDH PFK G6PDH TEF2
TCATACGCCCATACCACCAG TGCTCTGGAGTATGAAGAATGG CTATGACACCAAAAGGGGTAGG ATGAGGAGAAGGCTGAGATGAAG TTGAGGCTACAGGAAAGGAAAG GCAGACTTTGTTGTTCAAGAGC TCTTGCATCGACGAACCAGC GGTCCAGCAGAAGCCGATG TGAAGGAGAGGGAAGGTGAAAG
CGAAATCGGAATCGAATAGC ATCCACTGCCTTTTGTGCTAAC GCTTTCTTCTTGGGTTAGCACT CAAGTAGCGAATGTTGGAAGTC GGACGCTCCTCTGAATGAATAG TCATGTCAGGGCAGAGATTG AAGCCGTAAGTCATGTCACCTTG CGTTATGGTATATGGCACACACTG TGAAGGAGAGGGAAGGTGAAAG
10
L. Yu et al. / Postharvest Biology and Technology 113 (2016) 8–16
was run in triplicate and repeated in three independent sets of treatments for at total nine replicates per gene per sample. 2.5. AI and SPS activities AI activity was determined according to the method of Sun et al. (2011). 1 g of frozen mesocarp tissue was homogenized with 5 ml of 100 mM sodium phosphate buffer (pH 7.5), containing 5 mM MgCl2, 1 mM ethylenediaminetetraacetic acid (EDTA), 2.5 mM dithiothreitol (DTT), and 0.1% (v/v) Triton X-100. The homogenates were centrifuged at 10,000 g for 20 min at 4 C, and the supernatants were diluted 1:5 with distilled water. AI activity was assayed in mixture of 100 mM sodium citrate buffer (pH 4.5), 1% (m/v) sucrose and crude enzyme extract. The mixture was incubated at 34 C for 30 min, then boiled for 5 min to stop the reaction. SPS activity was measured according to the method of Solomakhin and Blanke (2010). Briefly, a reaction mixture
containing 100 mM HEPES-NaOH (pH 8.0), 10 mM uridinediphosphate (UDP)-glucose, 5 mM fructose-6-phosphate, 15 mM glucose6-phosphate, 15 mM MgCl2 and crude extract was incubated for 30 min at 34 C. The reaction was terminated by adding 5 M NaOH and then placed in boiling water for 10 min. 2.6. Statistical analysis Experiments were performed using a completely randomized design. Statistical analyses were calculated over two factors, treatment and storage time, and performed with SAS software (version 8.2, SAS Institute, Cary, NC, USA). Real-time PCR expression analysis was performed with Microsoft Excel (Microsoft, WA, USA). Figures were drawn using OriginPro 8.1G (Microcal Software Inc., Northampton, MA, USA). Differences between means were assessed by Duncan’s multiple range tests with a significance threshold of 0.05.
Fig. 1. Effect of HA and MeJA treatments on CI in peach fruit stored at 5 C for 35 days. (A) CI indexes are shown as the means SE of triplicate assays. Different lowercase letters indicate significant difference using Duncan’s multiple range test at each time point. (B) Five representative peaches sampled from each treatment group at week 5.
L. Yu et al. / Postharvest Biology and Technology 113 (2016) 8–16
3. Results 3.1. The CI index Peaches exhibited CI symptoms after storage for 28 days, although treatment with HA or MeJA significantly (p < 0.05) reduced CI over non-treated controls (Fig. 1A). After 35 days of storage, the CI index of control peaches was 0.74, while those treated with HA or MeJA had indexes of 0.18 and 0.43, respectively (Fig. 1B). The CI index of HA treated fruit was significantly (p < 0.05) lower than that of MeJA treated fruit.
11
highest values. Compared with the control, MeJA significantly reduced glucose content only over the first 14 days, although had no significant effect on fructose during the storage period. HA treatment significantly (p < 0.05) reduced glucose and fructose content relative to the control group at days 14 and 21. The sorbitol content in all fruits was increased at day 7, and then generally decreased thereafter (Fig. 2D). The treated groups exhibited higher sorbitol levels than the control group, and HA treatment yielded significantly (p < 0.05) higher values at day 21 and after. Although the sorbitol content of HA treatment increased after 21 days of cold storage, there was no significant difference (p > 0.05) at 21, 28 and 35 days.
3.2. Changes in sucrose, glucose, fructose and sorbitol content 3.3. Transcription of genes involved in soluble sugar metabolism Sucrose is the predominant soluble carbohydrate in peach fruit at harvest. As shown in Fig. 2A, the sucrose content in peaches treated with HA or MeJA significantly increased during the first two weeks of storage and then decreased thereafter. In contrast, sucrose content in the control group steadily decreased during the storage period, and was consistently significantly (p < 0.05) lower than that observed in treated peaches except for the MeJA group at day 21. At later times, the sucrose content of the HA group was significantly (p < 0.05) higher than that of the MeJA group, which is consistent with the lower CI index in HA group (Fig. 1A). Hexose (glucose and fructose) content generally increased for all groups (Fig. 2B and C), with the control group showing the
For all groups, the AI transcript levels increased rapidly early in storage, peaked at 21 days, and then decreased (Fig. 3A). In the control and MeJA groups the peak AI levels were over one thousand times higher than the levels observed at the beginning of the experiment (day 0). Except at day 21, AI transcript levels in peaches treated with MeJA were lower (p < 0.05) than those observed in the control group. Peaches treated with HA exhibited the lowest transcript levels at all time points, with a peak value one half that of the other groups. NI/1 transcript levels for both treatment groups was reduced relative to the control, except for the MeJA treated group at day 21
Fig. 2. Effect of HA and MeJA treatments on (A) sucrose, (B) glucose, (C) fructose, and (D) sorbitol content in peach fruit stored at 5 C over a 5-week period. Values are the means SE of triplicate assays. Different lowercase letters indicate significant difference using Duncan’s multiple range test at each time point.
12
L. Yu et al. / Postharvest Biology and Technology 113 (2016) 8–16
Fig. 3. Effect of HA and MeJA treatments on transcript levels for genes involved in sucrose metabolism in peach fruit stored at 5 C. (A) AI; (B) NI/1; (C) NI/2; (D) SS; (E) SPS; (F) SDH. Values are the means SE of triplicate assays. Different lowercase letters indicate significant difference using Duncan’s multiple range test at each time point.
(Fig. 3B). The lowest levels were exhibited in the HA group during the first 21 days storage. NI/2 transcript levels in the control and MeJA treated fruit shared a similar profile, increasing early during storage then decreasing. MeJA treatment appeared to shift the peak of NI/2 transcript to later in storage (day 21 versus day 14 for control). In contrast, the NI/2 transcript levels in HA treated fruit decreased early in storage then increased until day 28 before decreasing again (Fig. 3C).
Untreated fruit, along with MeJA-treated fruit, displayed a similar pattern of SS transcription increasing until day 21 and then decreasing (Fig. 3D). SS levels in the MeJA group were significantly (p < 0.05) lower than in the control except at day 21, and levels in the HA group were markedly (p < 0.05) lower than in the control after 7 days storage. For all groups the transcript levels of SPS peaked at day 7 then decreased (Fig. 3E). Transcript levels in the HA- and MeJA-treated
L. Yu et al. / Postharvest Biology and Technology 113 (2016) 8–16
groups were higher than in the control, except at day 35 (HA group) and day 28 (MeJA group). The SDH transcription pattern was similar for all groups as well, peaking at day 7 then sharply decreasing. SDH transcript levels were equivalent in all groups except on day 7, when the levels in the HA and MeJA groups were significantly lower than in the control. 3.4. Activities of AI and SPS In all peaches, AI or SPS activities initially increased and then decreased during cold storage (Fig. 4). For AI, peak values for the treated groups were 1.2 times higher than in fruit immediately after harvest, while the peak values for the control group were 1.67 times higher than immediately after harvest (Fig. 4A). HA and MeJA treatment significantly (p < 0.05) reduced AI activity relative to the control during the experiment. In contrast, both treatments significantly (p < 0.05) enhanced SPS activity (Fig. 4B). The peak values for the HA and MeJA groups were 7.4 and 6.6 times higher than in fruit immediately after harvest, respectively. 3.5. Expression of PFK and G6PDH during storage In non-treated fruit PFK transcript increased steadily for 28 days reaching a peak value 14.5 times higher than in fruit immediately after harvest, before declining (Fig. 5A). Treatment with either HA or MeJA shifted the peak value to day 21 and significantly decreased the PFK transcription. The lowest levels were observed in the HA-treated group. For control and MeJA treated fruit, G6PDH transcript levels increased early in storage, reaching peak levels at day 7, then decreasing. In contrast, G6PDH levels in HA treated fruit was significantly reduced early in storage but increased steadily after day 14. MeJA treated fruit also showed an increase in G6PDH transcript levels after day 21 (Fig. 5B). 4. Discussion Peach fruit is sensitive to low temperature and highly susceptible to CI during cold storage. A number of studies confirm that HA and MeJA treatments alleviate CI, many varieties such as ‘Jiubao’ (Meng et al., 2009), ‘Yulu’ (Wang et al., 2013), ‘Baifeng’ (Jin et al., 2009) and ‘Feicheng’ (Zhu et al., 2010) exhibit CI symptoms (IB and mealiness) after 3 weeks. In our study we observed CI
13
symptoms in treated peaches after 4 weeks of cold storage. HA and MeJA treatments clearly delay and reduce the CI index in this variety as well (Fig. 1A). Browning potential of peaches depends on the level of phenolic compounds and polyphenol oxidase (PPO) activity present in the fruit. When the membrane permeability changes, phenolic compounds and PPO interact, leading to tissue deterioration or senescence (Lurie and Crisosto, 2005). The cell membrane is the primary structure affected by low temperature; the membrane changes from the gel to liquid crystalline phase at chilling temperature, which increases the risk that the semi-permeability of the cell membrane will be lost (Jin et al., 2014). At chilling temperature, membrane fatty acid peroxidation, electrolyte leakage and lipid peroxidation are responsible for the loss of membrane integrity (Aghdam and Bodbodak, 2013; Wongsheree et al., 2009). Sugar metabolism, including sucrose metabolism and hexose metabolism, is necessary to contribute the antioxidant compounds that are crucial for the protection of fruit cells against oxidative chilling stress (Couée et al., 2006). In loquat fruit, increased levels of reducing sugars induce the ascorbate– glutathione cycle and are associated with higher resistance to CI (Cao et al., 2013; Shao et al., 2013). However, sucrose is more important than hexose in protecting grape branches from CI at low temperature (Jiang et al., 2013), a finding that has also been confirmed in tomato seedlings (Qi et al., 2011). Steponkus (1984) suggests that sucrose functions as an antioxidant, provides protection to membranes against leakage and protein inactivation, and has a higher antioxidant capacity than glucose (Couée et al., 2006). The effect of cold stress on sugar can reflect the stress imposed to the peach fruit (Puig et al., 2015). Sucrose is the primary sugar in peach fruit (Brooks et al., 1993). The degradation of sucrose is accompanied by increases in glucose and fructose during the ripening process (Borsani et al., 2009). Abidi et al. (2015) have suggested that peach cultivars with high levels of sucrose and glucose exhibit reduced CI during cold storage, and Wang et al. (2013) have demonstrated that higher levels of sucrose contribute to membrane stability and enhance chilling tolerance in peach fruit. In carambola fruit, a significant increase in sucrose content was observed at 2 C and 10 C (but not at 20 C), and was associated with a physiological response of tissues to CI (PerezTello et al., 2001). Holland et al. (2002) demonstrated that heat treatment prevents a decline in sucrose content in citrus fruit stored at chilling temperature, suggesting that sucrose is a
Fig. 4. Effect of HA and MeJA treatments on (A) AI activity and (B) SPS activity in peach fruit stored at 5 C. Values are the means SE of triplicate assays. Different lowercase letters indicate significant difference using Duncan’s multiple range test at each time point.
14
L. Yu et al. / Postharvest Biology and Technology 113 (2016) 8–16
Fig. 5. Effect of HA and MeJA treatments on (A) PFK and (B) G6PDH transcript levels in peach fruit stored at 5 C. Values are the means SE of triplicate assays.
necessary factor for the heat-induced chilling tolerance. Our results show that sucrose content significantly increases over the first 7–14 days in peaches treated with HA or MeJA before decreasing (Fig. 2A) and is accompanied by a reduced CI index (Fig. 1). HA-treated peaches exhibit the highest sucrose content by the end of storage and the least CI symptoms. These results indicate that sucrose is closely related to CI in peach fruit. Among sucrose metabolizing enzymes, invertase, including AI and NI, as well as SS-cleavage, are responsible for the accumulation of reducing sugars (Sturm and Tang, 1999). Additionally, SSsynthesis and SPS are involved in catalyzing sucrose biosynthesis (Guo et al., 2002). Wang et al. (2013) reported that enhanced AI, NI/1-2, and SS transcription, and decreased SPS/1 transcription, lead to a sharp reduction in sucrose in peaches stored at 5 C. Sun et al. (2011) found that peach fruit treated with 10 mmol/l NO maintain a high level of sucrose and lower levels of reducing sugars. These changes, which are associated with an increase in SPS activity and a decrease in AI, NI and SS-cleavage activities, effectively prolong the storage period of fruit. Itai and Tanahashi (2008) demonstrated that treating Japanese pears with 1-MCP inhibits AI gene expression, accelerates the accumulation of SPS1 transcript levels during cold storage, and is associated with a reduction in sucrose loss and the accumulation of glucose and fructose. In grape branches, the increase of hexose is due to enhanced AI activity and the accumulation of sucrose is mostly due to the elevation of SPS activity (Jiang et al., 2013). Cai et al. (2015) showed that SPS played an important role in controlling sucrose flux through metabolic pathways. The complete genomic sequence of the model higher plant Arabidopsis reveals four SPS genes (Lutfiyya et al., 2007). Itai and Tanahashi (2008) considered SPS/1 has SPS activity, the accumulation of the SPS/1 transcript contributed to the inhibition of sucrose loss in Japaness pear. The SPS gene measured in this study is SPS/1. HA and MeJA treatments enhanced the transcript and activities of SPS (Figs. 3 E and Fig. 44B), which contribute to the increase in sucrose content in peaches observed during cold storage. There were four putative genes of NI in peach, and a significant increase in the levels of NI/2 and NI/3, while decrease the level of NI/1 and NI/4 were detected during the post-harvest ripening process (Borsani et al., 2009). However, Wang et al. (2013) reported that among NI/1-4 enhanced NI/1-2 transcription lead to a sharp reduction in sucrose in peaches stored at 5 C. In present study, HA and MeJA treatments reduced NI/1-2 transcript levels, which contributed to the higher sucrose content in peach fruit during cold storage.
AI is classified into three main types, cell wall-bound invertase, vacuolar invertase and apoplastic invertase. The latter two types are referred to as soluble acid invertase (SAI). SAI plays an important role in functions related to sucrose metabolism and presumably hydrolyzes sucrose to supply reducing sugars necessary for cell growth and development (Tang et al., 1999; Tymowska-Lalanne and Kreis, 1998). Sucrose deposited in the vacuole is cleaved by vacuolar invertase. Yamada et al. (2007) isolated cDNA clones for SAI from Japanese pear fruit and found that two isoforms of vacuolar invertase, especially AI/2, have important functions during development. Transcription levels of the vacuolar invertase gene StvacINV1 increase sharply, even thousands times, in potato tubers stored under low-temperature sweetening conditions. Suppression of StvacINV1 inhibits sucrose decomposition, which is related to lower reducing sugar content (Liu et al., 2011). The AI gene measured in this study is also a vacuolar invertase. The transcript level of AI exhibited the highest rate of increase and highest level attained among the sucrose catabolism genes we tested (Fig. 3A). Compared with fruit immediately after harvest, AI transcript levels in control and MeJA-treated fruit increased about 1400 fold, and increased more than 700 fold in HA-treated fruit. AI transcription increases rapidly in response to low temperature and affects sucrose catabolism. The reduction in sucrose loss observed in HA- and MeJA-treated fruit is associated with a reduction in AI transcript levels. Therefore, changes in AI transcript levels probably play the predominant role in modulating soluble sugar metabolism during cold storage. It may be important that AI activity does not increase as rapidly as the level of AI transcription (Fig. 4A). This phenomenon has been noted in potato tubers in cold storage (Ou et al., 2013). The weak correlation between AI activity and gene expression may be related to an invertase inhibitor (Liu et al., 2013). Liu et al. (2013) suggested that the protease inhibitor gene, St-Inh, reduced AI activity in cold-stored potatoes. Investigation of the inhibitor protein may help explain the difference between AI activity and AI gene expression in peach fruit under cold stress. Sorbitol is the main sugar alcohol in peach fruit. Sorbitol is converted into fructose by sorbitol dehydrogenase (SDH) (Itai and Tanahashi, 2008). Sorbitol content of harvested peach fruits increased at the first 7 days and decreased later. The increase of sorbitol may be related with peach fruits still have the ability of synthesis, which compound sorbitol by hexose phosphate pool in the cytosol (Wang et al., 2013). HA and MeJA treatments reduce transcript levels of SDH (Fig. 3F), which delays sorbitol content loss
L. Yu et al. / Postharvest Biology and Technology 113 (2016) 8–16
Fig. 6. Model for regulation by HA and MeJA on soluble sugar metabolism in peach fruit stored at cold temperature (5 C).
(Fig. 2D). The oxidation of hexose occurs via the Embden– Meyerhof–Parnas (EMP) and pentose phosphate pathways (PPP). Phosphofructokinase (PFK) and glucose-6-phosphate dehydrogenase (G6PDH) are the main enzymes that regulate EMP and catalyze the first irreversible reaction of PPP, respectively (Kruger and Hammond, 1988; Sagisaka, 1972). In most tissues, glucose is predominantly metabolized by EMP rather than by PPP (Couée et al., 2006). Energy is produced via EMP, which is associated with cell membrane integrity (Jin et al., 2014). Fig. 6 showed the possible regulation mechanism by HA and MeJA on soluble sugar metabolism in peach fruit stored at cold temperature. For treated fruits, the lower expression and activity of AI and the higher expression and activity of SPS, which resulted in less sucrose converted into hexose. Meanwhile, the lower PFK and G6PDH transcript levels observed in treated peach fruit, especially PFK, suggest that less glucose was routed into EMP. Although more sucrose converted into hexose in control group, higher PFK transcript levels led more hexose feed to EMP. Thus, the hexose content of treated and untreated fruit during cold storage was indistinguishable (Fig. 2B and C). In conclusion, cold storage causes a decrease in sucrose and an increase in hexose in peach fruit. HA and MeJA treatments were effective in alleviating CI during cold storage by reducing the magnitude of these changes (Fig. 6). The enhancement of chilling tolerance by these treatments may be due to the increase in sucrose content, which is a consequence of higher SPS and lower AI levels. Changes in AI transcript levels probably play the predominant role in modulating soluble sugar metabolism during cold storage. Acknowledgments This study was supported by the Nature Science Foundation of Zhejiang Province (No. LR15C200002), the National Science Foundation of China (No. 31000825), the Key Laboratory of Healthy & Intelligent Kitchen System Integration of Zhejiang Province (No. 2014E10014) and the K. C. Wong Magna Fund at Ningbo University. References Abidi, W., Cantin, C.M., Jimenez, S., Gimenez, R., Moreno, M.A., Gogorcena, Y., 2015. Influence of antioxidant compounds, total sugars and genetic background on the chilling injury susceptibility of a non-melting peach (Prunus persica (L.) Batsch) progeny. J. Sci. Food Agric. 95, 351–358. Aghdam, M.S., Bodbodak, S., 2013. Physiological and biochemical mechanisms regulating chilling tolerance in fruits and vegetables under postharvest salicylates and jasmonates treatments. Sci. Hortic. 156, 73–85. Anchordoguy, T.J., Rudolph, A.S., Carpenter, J.F., Crowe, J.H., 1987. Modes of interaction of cryoprotectants with membrane phospholipids during freezing. Cryobiology 24, 324–331. Borsani, J., Budde, C.O., Porrini, L., Lauxmann, M.A., Lombardo, V.A., Murray, R., Andreo, C.S., Drincovich, M.F., Lara, M.V., 2009. Carbon metabolism of peach fruit after harvest: changes in enzymes involved in organic acid and sugar level modifications. J. Exp. Bot. 60, 1823–1837.
15
Brooks, S.J., Moore, J.N., Murphy, J.B., 1993. Quantitative and qualitative changes in sugar content of peach genotypes [Prunus persica (L.) Batsch.]. J. Am. Soc. Hortic. Sci. 118, 97–100. Cai, X., Wang, H., Pang, G., 2015. Flux control analysis of a lactate and sucrose metabolic network at different storage temperatures for Hami melon (Cucumis melo var. saccharinus). Sci. Hortic. 181, 4–12. Cao, S., Zheng, Y., Wang, K., Jin, P., Rui, H., 2009. Methyl jasmonate reduces chilling injury and enhances antioxidant enzyme activity in postharvest loquat fruit. Food Chem. 115, 1458–1463. Cao, S., Hu, Z., Zheng, Y., Lu, B., 2010. Synergistic effect of heat treatment and salicylic acid on alleviating internal browning in cold-stored peach fruit. Postharvest Biol. Technol. 58, 93–97. Cao, S., Cai, Y., Yang, Z., Zheng, Y., 2012. MeJA induces chilling tolerance in loquat fruit by regulating proline and g-aminobutyric acid contents. Food Chem. 133, 1466–1470. Cao, S., Yang, Z., Zheng, Y., 2013. Sugar metabolism in relation to chilling tolerance of loquat fruit. Food Chem. 136, 139–143. Childs, K.L., Hamilton, J.P., Zhu, W., Ly, E., Cheung, F., Wu, H., Rabinowicz, P.D., Town, C.D., Buell, C.R., Chan, A.P., 2007. The TIGR plant transcript assembies database. Nucleic Acids Res. 35, D846–D851. Couée, I., Sulmon, C., Gouesbet, G., El Amrani, A., 2006. Involvement of soluble sugars in reactive oxygen species balance and responses to oxidative stress in plants. J. Exp. Bot. 57, 449–459. Der Agopian, R.G., Peroni-Okita, F.H.G., Soares, C.A., Mainardi, J.A., do Nascimento, J. R.O., Cordenunsi, B.R., Lajolo, F.M., Purgatto, E., 2011. Low temperature induced changes in activity and protein levels of the enzymes associated to conversion of starch to sucrose in banana fruit. Postharvest Biol. Technol. 62, 133–140. González-Aguilar, G.A., Tiznado-Hernández, M.E., Zavaleta-Gatica, R., Martı’nezTéllez, M.A., 2004. Methyl jasmonate treatments reduce chilling injury and activate the defense response of guava fruits. Biochem. Biophys. Res. Commun. 313, 694–701. Guo, J., Jermyn, W.A., Turnbull, M.H., 2002. Carbon assimilation, partitioning and export in mature cladophylls of two asparagus (Asparagus officinalis) cultivars with contrasting yield. Physiol. Plant. 115, 362–369. Holland, N., Menezes, H.C., Lafuente, M.T., 2002. Carbohydrates as related to the heat-induced chilling tolerance and respiratory rate of ‘Fortune’ mandarin fruit harvested at different maturity stages. Postharvest Biol. Technol. 25, 181–191. Itai, A., Tanahashi, T., 2008. Inhibition of sucrose loss during cold storage in Japanese pear (Pyrus pyrifolia Nakai) by 1-MCP. Postharvest Biol. Technol. 48, 355–363. Jiang, H., Li, W., He, B., Gao, Y., Lu, J., 2013. Sucrose metabolism in grape (Vitis vinifera L.) branches under low temperature during overwintering covered with soil. Plant Growth Regul. 72, 229–238. Jin, P., Wang, K., Shang, H., Tong, J., Zheng, Y., 2009. Low-temperature conditioning combined with methyl jasmonate treatment reduces chilling injury of peach fruit. J. Sci. Food Agric. 89, 1690–1696. Jin, P., Zhu, H., Wang, L., Shan, T., Zheng, Y., 2014. Oxalic acid alleviates chilling injury in peach fruit by regulating energy metabolism and fatty acid contents. Food Chem. 161, 87–93. Kruger, N.J., Hammond, J.B., 1988. Molecular comparison of pyrophosphate- and ATP-dependent fructose 6-phosphate 1-phosphotransferases from potato tuber. Plant Physiol. 86, 645–648. Lalonde, S., Boles, E., Hellmann, H., Barker, L., Patrick, J.W., Frommer, W.B., Ward, J. M., 1999. The dual function of sugar carriers: transport and sugar sensing. Plant Cell 11, 707–726. Lara, M.V., Borsani, J., Budde, C.O., Lauxmann, M.A., Lombardo, V.A., Murray, R., Andreo, C.S., Drincovich, M.F., 2009. Biochemical and proteomic analysis of ‘Dixiland’ peach fruit (Prunus persica) upon heat treatment. J. Exp. Bot. 60, 4315– 4333. Liu, X., Zhang, C., Ou, Y., Lin, Y., Song, B., Xie, C., Liu, J., Li, X., 2011. Systematic analysis of potato acid invertase genes reveals that a cold-responsive member, StvacINV1, regulates cold-induced sweetening of tubers. Mol. Genet. Genom. 286, 109–118. Liu, X., Cheng, S., Liu, J., Ou, Y., Song, B., Zhang, C., Lin, Y., Li, X., Xie, C., 2013. The potato protease inhibitor gene, St-Inh, plays roles in the cold-induced sweetening of potato tubers by modulating invertase activity. Postharvest Biol. Technol. 86, 265–271. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2DDCT. Methods 25, 402–408. Lurie, S., Crisosto, C.H., 2005. Chilling injury in peach and nectarine. Postharvest Biol. Technol. 37, 195–208. Lutfiyya, L.L., Xu, N., D’Ordine, R.L., Morrell, J.A., Miller, P.W., Duff, S.M.G., 2007. Phylogenetic and expression analysis of sucrose phosphate synthase isozymes in plants. J. Plant Physiol. 164, 923–933. Meisel, L., Fonseca, B., González, S., Baeza-Yates, R., Cambiazo, V., Campos, R., González, M., Orellana, A., Retamales, J., Silva, H., 2005. A rapid and efficient method for purifying high quality total RNA from peaches (Prunus persica) for functional genomics analyses. Biol. Res. 38, 83–88. Meng, X., Han, J., Wang, Q., Tian, S., 2009. Changes in physiology and quality of peach fruits treated by methyl jasmonate under low temperature stress. Food Chem. 114, 1028–1035. Murray, R., Lucangeli, C., Polenta, G., Budde, C., 2007. Combined pre-storage heat treatment and controlled atmosphere storage reduced internal breakdown of ‘Flavorcrest’ peach. Postharvest Biol. Technol. 44, 116–121. Nishizawa, A., Yabuta, Y., Shigeoka, S., 2008. Galactinol and raffinose constitute a novel function to protect plants from oxidative damage. Plant Physiol. 147, 1251–1263.
16
L. Yu et al. / Postharvest Biology and Technology 113 (2016) 8–16
Oliver, A.E., Hincha, D.K., Crowe, J.H., 2002. Looking beyond sugars: the role of amphiphilic solutes in preventing adventitious reactions in anhydrobiotes at low water contents. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 131, 515– 525. Ou, Y., Song, B., Liu, X., Lin, Y., Zhang, H., Li, M., Fang, H., Liu, J., 2013. Profiling of stvacINV1 expression in relation to acid invertase activity and sugar accumulation in potato cold-stored tubers. Potato Res. 56, 157–165. Pathirana, R., Harris, J.C., McKenzie, M.J., 2008. A comparison of microtubers and field-grown tubers of potato (Solanum tuberosum L.) for hexoses, sucrose and their ratios following postharvest cold storage. Postharvest Biol. Technol. 49, 180–184. Perez-Tello, G.O., Silva-Espinoza, B.A., Vargas-Arispuro, I., Briceno-Torres, B.O., Martinez-Tellez, M.A., 2001. Effect of temperature on enzymatic and physiological factors related to chilling injury in carambola fruit (Averrhoa carambola L.). Biochem. Biophys. Res. Commun. 287, 846–851. Puig, C.P., Dagar, A., Ibanez, C.M., Singh, V., Crisosto, C.H., Friedman, H., Lurie, S., Granell, A., 2015. Pre-symptomatic transcriptome changes during cold storage of chilling sensitive and resistant peach cultivars to elucidate chilling injury mechanisms. BMC Genom. 16, 245. Qi, H., Hua, L., Zhao, L., Zhou, L., 2011. Carbohydrate metabolism in tomato (Lycopersicon esculentum Mill.) seedlings and yield and fruit quality as affected by low night temperature and subsequent recovery. Afr. J. Biotechnol. 10, 5743– 5749. Sagisaka, S., 1972. Decrease of glucose 6-phosphate and 6-phosphogluconate dehydrogenase activities in the xylem of Populus gelrica on budding. Plant Physiol. 50, 750–755. Shao, X., Zhu, Y., Cao, S., Wang, H., Song, Y., 2013. Soluble sugar content and metabolism as related to the heat-induced chilling tolerance of loquat fruit during cold storage. Food Bioprocess Technol. 6, 3490–3498.
Solomakhin, A.A., Blanke, M.M., 2010. Mechanical flower thinning improves the fruit quality of apples. J. Sci. Food. Agric. 90, 735–741. Steponkus, P.L., 1984. Role of the plasma membrane in freezing injury and cold acclimation. Annu. Rev. Plant Physiol. 35, 543–584. Sturm, A., Tang, G., 1999. The sucrose-cleaving enzymes of plants are crucial for development, growth and carbon partitioning. Trends Plant Sci. 4, 401–407. Sun, Z., Li, Y., Zhou, J., Zhu, S., 2011. Effects of exogenous nitric oxide on contents of soluble sugars and related enzyme activities in ‘Feicheng’ peach fruit. J. Sci. Food Agric. 91, 1795–1800. Tang, G., Lüscher, M., Sturm, A., 1999. Antisense repression of vacuolar and cell wall invertase in transgenic carrot alters early plant development and sucrose partitioning. Plant Cell 11, 177–189. Tymowska-Lalanne, Z., Kreis, M., 1998. The plant invertases: physiology, biochemistry and molecular biology. Adv. Bot. Res. 28, 71–117. Wang, K., Shao, X., Gong, Y., Zhu, Y., Wang, H., Zhang, X., Yu, D., Yu, F., Qiu, Z., Lu, H., 2013. The metabolism of soluble carbohydrates related to chilling injury in peach fruit exposed to cold stress. Postharvest Biol. Technol. 86, 53–61. Wang, K., Shao, X., Gong, Y., Xu, F., Wang, H., 2014. Effects of postharvest hot air treatment on gene expression associated with ascorbic acid metabolism in peach fruit. Plant Mol. Biol. Rep. 32, 881–887. Wongsheree, T., Ketsa, S., van Doorn, W.G., 2009. The relationship between chilling injury and membrane damage in lemon basil (Ocimum citriodourum) leaves. Postharvest Biol. Technol. 51, 91–96. Yamada, K., Kojima, T., Bantog, N., Shimoda, T., Mori, H., Shiratake, K., Yamaki, S., 2007. Cloning of two isoforms of soluble acid invertase of Japanese pear and their expression during fruit development. J. Plant Physiol. 164, 746–755. Zhu, L., Zhou, J., Zhu, S., 2010. Effect of a combination of nitric oxide treatment and intermittent warming on prevention of chilling injury of ‘Feicheng’ peach fruit during storage. Food Chem. 121, 165–170.