Effects of lead exposure on brain glucose metabolism and insulin signaling pathway in the hippocampus of rats

Toxicology Letters 310 (2019) 23–30

Contents lists available at ScienceDirect

Toxicology Letters journal homepage: www.elsevier.com/locate/toxlet

Effects of lead exposure on brain glucose metabolism and insulin signaling pathway in the hippocampus of rats

T

Shaojun Yuna,b, Yanli Wua, Ruiyan Niub, Cuiping Fenga, , Jundong Wangb, ⁎

a b

⁎

College of Food Science and Engineering, Shanxi Agricultural University, Taigu, 030801, China Shanxi Key Laboratory of Ecological Animal Science and Environmental Medicine, Shanxi Agricultural University, Taigu, 030801, China

ARTICLE INFO

ABSTRACT

Keywords: Lead Brain glucose metabolism Glucose metabolism-related enzymes Insulin signaling pathway GLUT-1 GLUT-3

The aim of this study was to determine whether Pb affects glucose metabolism in the hippocampus of rats. Male Sprague-Dawley rats aged 21 days were orally administered a 0.1%, 0.2%, or 0.3% lead acetate solution in deionized water for 65 days. Then, the weight of the rats; brain Pb content; brain glucose levels; activities of hexokinase, fructose-6-phosphate kinase, pyruvate kinase, glucose-6-phosphate dehydrogenase; expression of genes related to the insulin signaling pathway; as well as the gene and protein expression of glucose transporter (GLUT)-1 and GLUT-3 in the hippocampus were evaluated. The results showed that Pb content in the brain tissue of rats in the dose groups significantly increased, whereas the body weight gain, activities of glucose metabolismrelated enzymes, and expression of the insulin signaling pathway-related genes significantly decreased compared to the corresponding values in the control group. In comparison with the control group, the brain glucose levels increased significantly in the low-dose group, but there were no significant differences with the middle- and high-dose groups. Furthermore, the mRNA of GLUT-1 in the three dose groups and the GLUT-3 in the middleand high-dose groups rose markedly, while the GLUT-1 and GLUT-3 protein expression significantly increased in the middle- and high-dose groups and in the high-dose group, respectively. Taken together, the results showed that Pb exposure resulted in a lower body weight gain, higher brain Pb content and also affected brain glucose metabolism and the insulin signaling pathway.

1. Introduction Pb is a heavy metal, environmental pollutant, and toxicant that causes a wide variety of long-lasting adverse effects in adults and children, particularly in the developing nervous system (Karri et al., 2016; Peters et al., 2011). Human exposure to Pb occurs via food, water, air, and soil. Pb is excreted extremely slowly from the body, with its biological half-life estimated at 10 years, thus facilitating accumulation in the body. It affects the higher functions of the central nervous system (CNS) and impairs brain growth, preventing appropriate development of cognitive and behavioral functions (Mason et al., 2014; White et al., 2007). Recent studies have revealed that a high maternal Pb level is associated with a low birth weight (Afeiche et al., 2011; González-Cossı́o et al., 1997). In an animal study, the Pb-exposed male offspring

exhibited increased blood insulin levels and insulin resistance, signifying an abnormal response to insulin in order to properly transport glucose. The insulin resistance response was likely a consequence of inefficient cellular glucose uptake owing to increased body weight and fat accumulation, which were observed throughout the male offspring’s lifecourse (Faulk et al., 2014). CNS has been traditionally considered an insulin-insensitive tissue, although components of the insulin signaling pathway are widely distributed throughout the CNS, and insulin has been shown to reach these components by crossing the blood-brain barrier (Cardoso et al., 2009; Gerozissis, 2008). The release of insulin (Clarke et al., 1986), presence of insulin mRNA (Singh et al., 1997), and insulin-like immunoreactivity (Raizada, 1983) have also been detected in cultured neurons, suggesting the neuronal synthesis of insulin. Recent advances in the knowledge of insulin receptor (IR) function in CNS have yielded new

Abbreviations: AKT, protein kinase B; CNS, central nervous system; G6PD, glucose-6-phosphate dehydrogenase; GLUT, glucose transporter; HIF, hypoxia-inducible factor; HK, hexokinase; ICP-MS, inductively coupled plasma mass spectrometry; IR, insulin receptor; IRS, insulin receptor substrate; mTOR, mammalian target of rapamycin; PFK, fructose-6-phosphate kinase; PHD, prolyl hydroxylase; PI3K, phosphatidylinositol 3-kinase; PK, pyruvate kinase; PTEN, phosphatase and tensin homolog; qRT-PCR, quantitative real-time polymerase chain reaction ⁎ Corresponding authors. E-mail addresses: [email protected] (C. Feng), [email protected] (J. Wang). https://doi.org/10.1016/j.toxlet.2019.04.011 Received 13 January 2018; Received in revised form 7 March 2019; Accepted 8 April 2019 Available online 10 April 2019 0378-4274/ © 2019 Elsevier B.V. All rights reserved.

S. Yun, et al.

Toxicology Letters 310 (2019) 23–30

insights into the role of IR signal transduction in the regulation of energy homeostasis, reproduction, and neuronal survival. The molecular mechanisms underlying these processes have not been completely elucidated but seem to involve the activation of phosphatidylinositol 3kinase (PI3K) and KATP channels. The actions of insulin are mediated via IR, which belongs to the family of tyrosine kinase receptors. Binding of insulin leads to a rapid autophosphorylation of the receptor, followed by tyrosine phosphorylation of insulin receptor substrate (IRS) proteins, which induce the activation of downstream pathways such as the PI3K and mitogen-activated protein kinase cascades (White, 2003). When PI3K is activated by phosphorylation of the p85 regulatory subunit at Tyr458, it activates downstream pathways, including the protein kinase B (also known as AKT), mammalian target of rapamycin (mTOR), and glucose transporter (GLUT) pathways. Brain glucose metabolism consists of two processes, glucose transport and intracellular decomposition. Glucose transport is mainly dependent on GLUTs (Duelli and Kuschinsky, 2001; Molofsky et al., 2012). GLUTs adjust the glucose transport and maintain the steady state of brain energy. GLUT-1 and GLUT-3 play important roles in the brain. Because GLUT-1 and GLUT-3 are insulin-insensitive, brain glucose metabolism was previously viewed as independent of insulin. However, these GLUTs do appear to be regulated by insulin (Ferreira et al., 2005; Pankratz et al., 2009). Intracellular oxidation of glucose is a complex process involving the pentose phosphate pathway, glycolysis, tricarboxylic acid cycle, oxidative phosphorylation, and various other pathways (Kuzuya, 1990). Through oxidative catabolism in the brain cell, glucose is transformed into ATP and other metabolites, which provides energy for neural activity and substrates necessary for biosynthesis (Chen and Zhong, 2013). In the past few years, it has become clear that insulin also has profound effects on CNS where it regulates key processes such as energy homeostasis, reproductive endocrinology, and neuronal survival. The hippocampus, a key brain section for learning and memory, has been considered to play a critical role in mediating many behavioral changes observed early following Pb exposure, which indicates that the hippocampus may serve as an excellent model system for further studies of the neurobehavioral effects of Pb. The recent advances in the role of IR signal transduction in the CNS have raised a question of whether neurotoxicity of Pb is associated with the insulin signaling pathway. Therefore, the aim of this study was to evaluate, for the first time, whether Pb exposure can induce abnormal brain glucose metabolism. To test this hypothesis, we used long-term administration of Pb to analyze its effects on the insulin signaling pathway and glucose metabolism in the rat hippocampus.

water). All the groups received the same basal diet, and had free access to water containing different doses of lead for 65 days. During the experimental period, the body weights of all the rats were measured every 5 days. At the end of the experiment, the rats were sacrificed under ether anesthesia, and the brain tissues were collected. After freezing in liquid nitrogen, the tissues were stored at −80 °C for further testing. In this study, all the analytical reagents were obtained from Sinopharm Chemical Reagent Beijing Co., Ltd (http://www.crc-bj.com/default. aspx) unless otherwise specified. 2.2. Determination of the brain Pb content by inductively coupled plasma mass spectrometry (ICP-MS) Pb content in brain tissue was determined by using ICP-MS (7700x, Agilent, American) to verify whether the lead-exposure rat model was established successfully (n = 10). Concentrated HNO3 (8 mL) and HClO4 (2 mL) were added to 0.1 g of brain tissue sample (including some cortical, hippocampal tissues and small amounts of adjacent brain tissue) in the tube, and the mixture was shaken, sealed, and allowed to stand overnight. On the next day, the mixture was heated until the liquid became transparent and then cooled. Subsequently, the mixture was filtered and Pb content was determined by using ICP-MS after adjusting the volume to 25 mL with 1% nitric acid solution. The indicator was performed in at least duplicate for each rat. 2.3. Determination of free glucose content in the brain A glucose content detection kit (Beijing Solaibao Biotechnology Co., Ltd.; Catalogue number: BC2500) was used to detect the free glucose levels in brain tissue (n = 10). Glucose oxidase catalyzes the oxidation of glucose to produce gluconic acid and hydrogen peroxide; peroxidase catalyzes the oxidation of 4-aminoantipyrine coupling phenol by hydrogen peroxide to form colored compounds with characteristic absorption peaks at 505 nm. So according to the manufacturer’s instructions, 1 mL of distilled water was added to 0.1 g brain tissue (including some cortical, hippocampal tissues and small amounts of adjacent brain tissue), and then the sample was homogenized in an ice bath. Next, the homogenate was placed in a water bath at 95 °C for 10 min. This was followed by centrifugation at 8000× g under 25 °C for 10 min. The blank tube contained 100 μL of distilled water; the standard tube contained 100 μL of glucose standard solution (Reagent I in the kit, 0.5 μmol/mL); and the test tube contained 100 μL of the brain tissue supernatant; 900 μL of a mixed reagent (mixture of reagent II and reagent III contained in the kit at 1:1 before use) was added to all three tubes. After incubation in a water bath at 37 °C for 15 min, absorbance of the colored compounds was measured at 505 nm. Glucose content in the brain was calculated according to the instructions provided in the kit. The indicator was performed in at least duplicate for each rat.

2. Materials and methods 2.1. Animals and treatments Male Sprague-Dawley rats (n = 40) aged 21 days old were obtained from Beijing Wei Tong Li hua Co., Ltd. Experimental animal protocols and animal procedures complied with the Guide for the Care and Use of Laboratory Animals (U.S. National Academy of Sciences, National Institutes of Health Publication 6–23, revised 1985) and with the principles and procedures of the European Communities Council Directives (86/609/EEC). The protocols also received an approval from the local ethics committee. During the entire study period, the rats received a diet and deionized water purified using a MilliQ Plus system (Millipore Corp., Sao Paulo, SP, Brazil), ad libitum. All the rats were maintained in stainless steel cages, under a 12-h light/dark cycle, at a temperature of 23°C ± 2°C. The rats were adaptively fed for 7 days and then divided into the following four groups (n = 10 in each group): group 1, normal control group (deionized water); group 2, low-dose Pb group (0.1% lead acetate solution in deionized water); group 3, middledose Pb group (0.2% lead acetate solution in deionized water); and group 4, high-dose Pb group (0.3% lead acetate solution in deionized

2.4. Measurement of glucose metabolism related enzymes activity in brain tissue of rats The activities of hexokinase (HK), fructose-6-phosphate kinase (PFK), pyruvate kinase (PK) and glucose-6-phosphate dehydrogenase (G6PD) in brain tissue were determined by using appropriate kits (Beijing Solaibao Biotechnology Co., Ltd.; Catalogue numbers: HK detecting kit, BC0745; PFK detecting kit, BC0530; PK detecting kit, BC0540; G6PD detecting kit, BC0260) (n = 10). According to the manufacturers’ instructions, 0.2 g brain tissue (including some cortical, hippocampal tissues and small amounts of adjacent brain tissue) was added to 2 mL extracting solution (contained in the related kit), and homogenized in an ice bath. The mixture was then centrifugated at 8000× g for 10 min at 4 °C. The supernatant was placed on ice and used for analyzing the activities of HK, PFK, PK and G6PD. For HK activity detection, the assay kit utilizes the HK present in each supernatant sample to catalyze the synthesis of known amounts of 24

S. Yun, et al.

Toxicology Letters 310 (2019) 23–30

glucose to 6-phosphate glucose; then 6-phosphate glucose dehydrogenase is used to catalyze the dehydrogenation of the 6-phosphate glucose to NADPH, which is quantified at its characteristic absorption peak of 340 nm. According to the instructions of the kit, 18 mL of Reagent I was mixed with Reagent II, and allowed to stand at 37 °C for 5 min. Simultaneously, 1 mL of Reagent I was also mixed with Reagent III until dissolution. Next, 10 μL of the sample, 10 μL of Reagent III, and 180 μL of Reagent II were added to 96-well plates. The absorbance values of A1 at 20 s and A2 at 5 min 20 s at 340 nm were recorded. Each assay was performed in at least duplicate. For PFK activity detection, the assay utilizes the PFK present in each supernatant sample to catalyze known amounts of fructose-6-phosphate and ATP to produce fructose-1, 6-diphosphate and ADP; then pyruvate kinase and lactate dehydrogenase further catalyze NADH oxidation to NAD +, and then the decline in NADH absorbance at 340 nm is detected to reflect PFK activity. The working solution (a mixture of 19 mL Reagent I and 1.26 mL Reagent II, 800 μL), the sample (30 μL), Reagent III (5 μL) and Reagent IV (5 μL) were added into a 1 mL quartz colorimeter in sequence, and the time was started at the same time as the sample was added. The initial absorbance (A1, 340 nm) at 20 s was recorded, and then the colorimetric dish together with the reaction solution was incubated at 37 °C for 10 min. The absorbance A2 was recorded at 10 min 20 s at 340 nm. Each assay was performed in at least duplicate. For PK activity detection, the assay utilizes the PK present in each supernatant sample to catalyze phosphoenolpyruvate and ADP to produce ATP and pyruvate; then lactate dehydrogenase further catalyzes NADH and pyruvate to produce lactic acid and NAD +, and the decline in NADH absorbance at 340 nm is determined to reflect the PK activity. The working solution (a mixture of Reagent I and Reagent II, 900 μL), Reagent III (30 μL), Reagent IV (15 μL) and the sample (30 μL) were added into the 1 mL quartz colorimeter in sequence, and the time was started at the same time as the sample was added. The initial absorbance (A1, 340 nm) at 20 s was recorded, and then the colorimetric dish together with the reaction solution was incubated at 37 °C for 2 min. The absorbance A2 was recorded at 2 min 20 s at 340 nm. Each assay was performed in at least duplicate. The assay for G6PD activity detection in supernatant samples is based on the ability of G6PDH to reduce NADP to NADPH, and its activity is linearly related to the change in concentration of the product. The G6PDH activity is reflected by measuring the increase in amount of absorbance of NADPH at 340 nm. Reagent I (750 μL), Reagent II (10 μL), Reagent III (10 μL), and the sample (30 μL) were added into the 1 mL quartz colorimeter in sequence, and the time was started at the

same time as the sample was added. The initial absorbance (A1, 340 nm) at 20 s was recorded, and then the colorimetric dish together with the reaction solution was incubated at 37 °C for 5 min. The absorbance A2 was recorded at 5 min 20 s under 340 nm. Each assay was performed in at least duplicate. The activities of the enzymes were calculated according to the instructions provided in the kits, and distilled water was used as the control. The related regents (Regent I, II, III and IV used in the above tests) were all contained in the corresponding kit. 2.5. RNA extraction and quantitative real-time polymerase chain reaction Total RNA was extracted from the hippocampus (30–50 mg) using the RNAiso Plus*(Takara, Dalian, China; Catalogue number: 9108) according to the manufacturer’s instructions (n = 10). RNA extracts (2 μL) were subjected to agarose gel electrophoresis to confirm the RNA integrity, and 1 μL was tested for RNA quality and quantity using a Nanodrop ND-2000 spectrophotometer. Primers for β-actin, IR, IRS1, PI3K, AKT2, mTOR, GLUT-1, and GLUT-3 sequences for quantitative real-time polymerase chain reaction (qRT-PCR) were designed using the Primer 5.0 software. The primer sets used for the qRT-PCR analysis are shown in Table 1. Each pair of primers was tested for their specificity by using conventional reverse-transcription PCR before running qRT-PCR. qRT-PCR was performed on the Mx3000P™ qPCR system (Stratagene, La Jolla, CA,USA) using a Two-Step PrimeScript™ RT-PCR Kit (Takara, Dalian, China; Code number: RR014 A). After initial denaturation at 95 °C for 5 min, qRT-PCR was performed under the following thermocycling conditions: 45 cycles at 95 °C for 10 s and 60 °C for 30 s. Then, dissociation curves were obtained at 95 °C for 15 s, 60 °C for 1 min, and 95 °C for 15 s to confirm the specificity of the amplified products. The abundance of β-actin, IR, IRS1, PI3K, AKT2, mTOR, GLUT-1, and GLUT3 mRNA was calculated by using the comparative ΔΔCt method provided with the Mx3000P™ qPCR system. The indicator was performed in at least duplicate for each rat. 2.6. Semi-quantitative western blotting Total protein was extracted from the hippocampus of rats. The tissue was lysed in RIPA lysis buffer (Beyotime Inc., Shanghai, China; Catalogue number: P0013) and centrifuged at 12,000×g for 5 min at 4 °C. Subsequently, the protein concentration was determined using a BCA Protein Assay Kit (Beyotime Inc., Shanghai, China; Catalogue number: P0012) according to the manufacturer’s instructions (n = 10). Each protein sample (30 μg) was separated by SDS-PAGE and then

Table 1 Primer sequences and corresponding PCR product size. No.

Gene

Primer sequences (5' > 3')

Product Sizes (bp)

Accession no.

1

β-actin

115

NM031144.3

2

Insr

171

NM017071.2

3

IRS1

106

NM012969.1

4

PI3K

143

NM013005.1

5

AKT2

160

NM017093.1

6

mTOR

114

NM019906.1

7

GLUT-1

185

NM138827.1

8

GLUT-3

F: TACCCAGGCATTGCTGACAG R: AGCCACCAATCCACACAGAG F:ACCCACCTATTTTTATGTGACTGAT R: GAAGAAGCGTACAGTGGTCC F: AGGCACCATCTCAACAATCC R: GTTTCCCACCCACCATACTG F: CTAAACCACCCAAGCCCACT R: CTAAACCACCCAAGCCCACT F: CCTCATGGAGGAGATCCGGT R: CTGCCAGTTGATGCTGAGGA F: AGAACCTGGCTCAAGTACGC R: AGGATGGTCAAGTTGCCGAG F: GCTGTGGCTGGCTTCTCTAA R: CCGGAAGCGATCTCATCGAA F: GTTGGGATCCTTGTGGCTCA R: GGCTGCGCTCTGTAGGATAG

114

NM017102.2

25

Toxicology Letters 310 (2019) 23–30

S. Yun, et al.

transferred onto a nitrocellulose membrane at 60 V for 2 h. Then, the membrane was blocked with 5% bovine serum albumin for 1 h at 37 °C and incubated with rabbit anti-mouse GLUT-1 and GLUT-3 antibodies (1:500; Bioss Inc., Beijing, China; Catalogue numbers: bs-0472R and bs1207R, respectively) or a rabbit anti-mouse β-actin antibody (1:2000; BiossInc., Beijing, China; Catalogue number: bs-0061R) overnight at 4 °C. After washing the membrane three times, it was incubated with horseradish peroxidase-conjugated goat anti-rabbit IgG (1:10,000; Beyotime Inc., Shanghai, China; Catalogue number: A0208) for 1.5 h at 25 °C. Finally, immunoreactive bands were detected using an enhanced chemiluminescence kit (Beyotime Inc., Shanghai, China; Catalogue number: P0018S), and image acquisition and relative optical density analysis were performed using the AlphaView software (version 3.2.2.0) on the FluorChem Q system (Alpha Innotech, Santa Clara, CA, USA). The indicator was performed in at least duplicate for each rat.

Fig. 2. Pb content in the brain tissue of lead-exposed rats.

3.3. Free glucose levels in the brain tissue of rats

2.7. Statistical analysis

It was found that compared with the control group (0.506 ± 0.050 μmol/g), the content of free glucose increased significantly in the low-dose group (0.740 ± 0.370 μmol/g) (P < 0.05). There were no significant differences among the middle-dose group (0.555 ± 0.010 μmol/g), the high-dose group (0.444 ± 0.050 μmol/ g) and the control group.

SPSS software (SPSS, Inc., Chicago, IL, USA) was used for statistical analysis. Differences among the dietary groups were determined by using one-way analysis of variance with a post-hoc Tukey’s test. P < 0.05 indicated statistical significance, and P < 0.01 indicated high statistical significance.

3.4. HK, PFK, and PK enzyme activities and G6PDlevels in brain tissues of rats

3. Results 3.1. Effect of Pb on the body weight of rats

As shown in Fig. 3, the activities of HK, PFK, and PK and the levels of G6PD in the three dose groups were significantly lower than those in the control group (P < 0.01). In particular, the activity of HK in the low-, middle-, and high-dose groups was 34.90%, 53.30%, and 59.75% lower, respectively, than that in the control group, and the activity of PFK was 42.66%, 59.54%, and 71.24% lower, respectively. The activity of PK was 50.15%, 54.09%, and 56.95% lower, and the G6PD level was 45.90%, 47.14%, and 52.01% lower, respectively, than the corresponding values in the control group. In all cases, there was an inverse dose-response relationship between the levels of Pb exposure and enzyme activity when the Pb treatment dose in feed water was higher than 0.1%.

As shown in Fig. 1, compared with that in the control group, the body weight of rats in the dose groups increased slowly, and the weight gain decreased as the Pb dose increased. On day 10 and 25, the weight of all rats in the high- and middle-dose groups became lower than that of control group rats (P < 0.05). After 35 days, the weight of rats in the low-dose group was also lower than that of rats in the control group. After 55 days, the weight of rats in the middle- and high-dose groups was extremely lower than that of rats in the control group, and the differences were highly significant (P < 0.01). 3.2. Pb content in brain tissue of rats

3.5. Gene expression of IR, IRS1, PI3K, AKT2, mTOR, GLUT-1, and GLUT3 in the hippocampus

As shown in Fig. 2, the contents of Pb in brain tissues of the rats from the three dose groups were each significantly higher than that in the control group (P < 0.05 or P < 0.01). This showed that the Pb exposure rat model was successfully established. Results also suggested that the amount of lead in the rat brain increased with increasing Pb treatment dose when the lead content in dietary water was higher than 0.1%.

As shown in Fig. 4, the mRNA expression of IR, IRS1, PI3K, AKT2, and mTOR in the hippocampi of the rats from the three dose groups was significantly lower than that in the control group (P < 0.05 or P < 0.01). In particular, the IR expression in the low-, middle-, and high-dose groups was 33.87%, 62.68%, and 65.62% lower, respectively, than that in the control group, and the differences were significant (P < 0.01). The IRS1 expression in the dose groups was 55.43%, 72.51%, and 64.94% lower, respectively (P < 0.01). The PI3K expression in the low-, middle-, and high-dose groups was 18.97%, 58.22%, and 77.67% lower, and the AKT2 expression was 21.51%, 63.70%, and 28.04% lower, respectively (P < 0.01). The mTOR expression in the dose groups was 31.05%, 34.99%, and 44.93% lower, respectively (P < 0.05), than that in the control group. On the other hand, the expression of GLUT-1 and GLUT-3 mRNA in the hippocampi of the rats from the three dose groups was higher than that in the control group. GLUT-1 expression was 25.72%, 54.48%, and 66.30% higher, respectively, and the differences were highly significant (P < 0.01). GLUT-3 expression was 21.34% higher in the middle-dose group and 127.37% higher in the high-dose group, and the differences were also significant (P < 0.05 or P < 0.01).

Fig. 1. Effects of Pb on weight gains of rats in every group. 26

Toxicology Letters 310 (2019) 23–30

S. Yun, et al.

Fig. 3. Effects of different concentrations of Pb on HK, PFK, PK, G6PD enzyme activities in the brain tissue of rats.

3.6. Expression of GLUT-1 and GLUT-3 in the hippocampus of rats

Studies have shown that even at low levels, Pb may penetrate the brain by altering the functional competence of the blood-brain barrier (Sharifi et al., 2010). Pb exposure can also lead to a decrease in the expression of tight junction proteins in the blood-brain barrier and alter the membrane structure of CNS vascular endothelial cells. All these research findings may be the reasons for the results presented in this experiment, and the specific mechanism still needs to be further explored. It has not been investigated yet how an increase in Pb content affects the brain glucose metabolism. Our study showed the content of free glucose increased significantly in the low-dose group compared to that in the control group, and there were no significant differences in the middle-, high-dose group. This suggests that Pb does affect the brain glucose levels. During the period of this study, the food intake only partially affects glucose content, and there must be other additional compensatory mechanisms influencing the free glucose content. So, we detected the activities of glucose metabolism-related enzymes further. It has been known that glucose is decomposed in the cell via several pathways, such as the pentose phosphate pathway, glycolysis, tricarboxylic acid cycle, and oxidative phosphorylation. Through intracellular oxidative catabolism, glucose is metabolized into ATP and other metabolites, which can provide energy for neuronal activities and substrates necessary for biosynthesis. HK, PFK, and PK are rate-limiting enzymes of the glycolysis pathway, whereas G6PD is the key enzyme of the pentose phosphate pathway. Therefore, their activities can indirectly reflect the activity of glucose decomposition (Rui, 2014). Our results showed that the activities of HK, PFK, and PK and G6PD were reduced in the brain tissue of experimental rats, indicating that Pb could affect the glycolytic and pentose phosphate pathways. It is known

As shown in Figs. 5 and 6, the protein expressions of GLUT-1 and GLUT-3 in the three dose groups were higher than that in the control group. The GLUT-1 protein expression in the middle- and high-dose groups was 31.09% and 43.85% higher, respectively, than the expression level in the control group, and the differences were significant (P < 0.05). The GLUT-3 expression in the high-dose group was 191.74% higher than that in the control group, and the difference was highly significant (P < 0.01). 4. Discussion In this study, we developed a Pb exposure rat model using different concentrations of lead acetate, which were selected based on a previous study (Gruber et al., 1997). The results showed that exposure to all the Pb concentrations used, 0.1%, 0.2%, and 0.3%, resulted in a lower weight gain in rats. The effect was dose-dependent and was accompanied by an elevated Pb content in the brain. Our data were consistent with those of a previous study in which a Pb-containing diet (200 mg/ kg) resulted in a reduction in the feed intake and growth rate in broiler chickens (Roohollah et al., 2015). Based on previous studies (Minnema and Hammond, 1994; Roohollah et al., 2015; Sun et al., 2017), when the body is exposed to a Pb-containing environment for a long time, the feed intake, feed efficiency, as well as lipid and glucose metabolism are suppressed in rats, representing a possible mechanism of the weight gain inhibition in rats by Pb. The brain is an organ most sensitive to Pb exposure. A high-dose of Pb disrupts the integrity of the blood-brain barrier (Goldstein, 1984).

27

Toxicology Letters 310 (2019) 23–30

S. Yun, et al.

Fig. 4. Gene expression levels of IR, IRS1, PI3K, Akt2, mTOR, GLUT-1, and GLUT-3 in the hippocampus.

that Pb exposure influences metabolism of Ca2+ and other metal ions (Bouton et al., 2001). Many enzymatic reactions require metal ions for their catalytic activity. In the glycolysis pathway, HK catalyzes the phosphorylation of glucose to produce glucose 6-phosphate, for which

Mg2+ is required as a cofactor. When glucose 6-phosphate is converted to fructose-6-phosphate in the second step of glycolysis, PFK catalyzes the phosphorylation of fructose-6-phosphate to form fructose-l, 6-bisphosphate, which requires ATP and Mg2+. During ATP generation in

28

Toxicology Letters 310 (2019) 23–30

S. Yun, et al.

expression and affect phosphatase and tensin homolog (PTEN) expression (Franco et al., 2009). PTEN is an important regulator of the PI3K/ AKT signaling pathway. The activation of PI3K and the conversion of inositol diphosphatetoinositol triphosphate are regulated by PTEN (Georgescu, 2010). Pb inhibits PTEN expression, which may negatively regulate the PI3K/AKT signaling pathway. Another study has shown that Pb exposure could cause oxidative damage and induce the production of large amounts of reactive oxygen species, which are known to inhibit mTOR expression (Liou and Storz, 2010). Thus, Pb exposure not only directly affects the insulin signaling pathway but may also indirectly affect it through other mechanisms. In the mammalian brain, GLUT-1 and GLUT-3 are predominantly responsible for glucose transport (McEwen and Reagan, 2004), and in herein, we studied both transporters at the mRNA and protein levels. We found that both mRNA and protein expression levels of GLUT-1 and GLUT-3 increased in the brain of rats exposed to Pb. As Pb induced a decrease in the expression of genes of the PI3K/AKT/mTOR signaling pathway, it could be expected that GLUT expression would be reduced. However, our results showed that GLUT expression increased at both mRNA and protein levels. This may be explained by the fact that activation of genes located upstream of the insulin signaling pathway is not the only regulatory mechanism of GLUT expression, which can also be controlled by other factors. It has been known that hypoxia-inducible factor-1 (HIF-1), which consists of α and β subunits, is also an upstream gene of GLUTs, and α subunits are oxygen regulators determining HIF-1 activity. Pb can replace the prolyl hydroxylase (PHD)-bound Fe2+, thus inhibiting the hydroxylation of HIF-1α by PHD and blocking the degradation of HIF-1α, which further promotes it to form an HIF-1complex with HIF-1β. A putative HIF-1binding site has been identified in the GLUT-1 promoter, which may increase GLUT-1 gene expression (Semenza, 2010). GLUT-1 and GLUT-3 up-regulation by Pb may also induce a compensatory growth and survival response in neural cells. The up-regulation of glucose transporters and the decrease of glucose metabolism-related enzymes activity may be the main reasons for the increased brain glucose levels in the low-dose group. At the meanwhile, the antagonistic effect of food intake and glucose transporters expression, glucose metabolism-related enzymes activity may result in no significantly rise in the glucose levels of the middle- and high-dose group. The present data does not exclude other mechanisms, and thus an understanding of the detailed mechanisms of the effects of Pb on the expression of GLUTs requires a more in-depth study. In conclusion, in this study, we demonstrated that Pb exposure could result in a lower weight gain in rats and a higher Pb content in brain tissue. It could also reduce glycolytic activity, pentose phosphate pathway activity, and disrupt the insulin signaling pathway.

Fig. 5. Western-blot of GLUT-1 and GLUT-3 proteins in the hippocampi of rats (NC: the control group; L: the low-dose group; M: the middle-dose group; H: the high-dose group; MW: relative molecular weight).

the final step of glycolysis, phosphoenolpyruvate is catalyzed by PK into pyruvate, which also requires Mg2+ as an activator. Thus, Mg2+ is involved in the entire process of glycolysis. Pb exposure can cause the body to reduce the absorption of Mg2+, which would affect the catalytic reactions of enzymes. The antagonism between Pb2+ and Mg2+ results in Pb2+ occupying the binding site of Mg2+, which also reduces the activities of enzymes involved in the glycolytic pathway. The pentose phosphate pathway is another very important pathway in oxidative catabolism of glucose in cells, which provides some raw materials needed for biosynthesis, such as NADPH and ribose 5-phosphate, for cells to sustain life activities. In this pathway, G6PD catalyzes glucose 6phosphate to produce ribose 5-phosphate and NADPH. Studies have shown that Pb could bind to the thiol moiety in G6PD, which affected the enzyme activity, and also influenced, as a noncompetitive inhibitor, the binding of G6PD and glucose-6-phosphate. This might suggest that Pb could cause a decrease in the activity of G6PD in the brain in vivo. In addition, a reduction of food intake induced by Pb may also play some role in the decrease of glucose metabolism-related enzymes activities. To further explore the impact of Pb on brain glucose metabolism, we studied the relative expression levels of genes of the insulin signaling pathway, which regulate glucose metabolism in the brain and plays important roles in neuronal activities. The results showed that when rats were exposed to Pb for prolonged periods, expression of the genes encoding IR, IRS1, PI3K, AKT2, and mTOR significantly decreased in the hippocampus, indicating that the insulin signaling pathway was impaired in a Pb-affected brain. A recent study indicated that Pb could induce insulin resistance in peripheral organs (Faulk et al., 2014). Based on this, we concluded that Pb could also induce insulin resistance in the brain by reducing IR expression, which further affected the downstream gene expression. Studies have also shown that Pb can induce oxidative stress in tissues and is associated with characteristic microRNA expression profiles, while microRNAs can inhibit IRS1

Fig. 6. Relative expression levels of GLUT-1 and GLUT-3 proteins in the hippocampi of rats.

29

Toxicology Letters 310 (2019) 23–30

S. Yun, et al.

Conflict of interest

Gerozissis, K., 2008. Brain insulin, energy and glucose homeostasis; genes, environment and metabolic pathologies. Eur. J. Pharmacol. 585, 38–49. Goldstein, G.W., 1984. Brain capillaries: a target for inorganic lead poisoning. Neurotoxicology 5, 167–176. González-Cossı́o, T., Peterson, K.E., Sanı́n, L.H., Fishbein, E., Palazuelos, E., Aro, A., Hernández-Avila, M., Hu, H., 1997. Decrease in birth weight in relation to maternal bone-lead burden. Pediatrics 100, 856–862. Gruber, H.E., Gonick, H.C., Khalil-Manesh, F., Sanchez, T.V., Motsinger, S., Meyer, M., Sharp, C.F., 1997. Osteopenia induced by long-term, low- and high-level exposure of the adult rat to lead. Miner. Electrol. Metab. 23, 65–73. Karri, V., Schuhmacher, M., Kumar, V., 2016. Heavy metals (Pb, Cd, As and MeHg) as risk factors for cognitive dysfunction: A general review of metal mixture mechanism in brain. Environ. Toxicol. Pharm. 48, 203–213. Kuzuya, T., 1990. Outline of glucose metabolism and its regulations. Nihon. Rinsho. 48 (Suppl), 51–59. Liou, G.Y., Storz, P., 2010. Reactive oxygen species in cancer. Free Radic. Res. 44, 479–496. Mason, L.H., Harp, J.P., Han, D.Y., 2014. Pb neurotoxicity: neuropsychological effects of lead toxicity. Biomed Res. Int. 1–8. McEwen, B.S., Reagan, L.P., 2004. Glucose transporter expression in the central nervous system: relationship to synaptic function. Eur. J. Pharmacol. 490, 13–24. Minnema, D.J., Hammond, P.B., 1994. Effect of lead exposure on patterns of food intake in weanling rats. Neurotoxicol. Teratol. 16, 623–629. Molofsky, A.V., Krencik, R., Ullian, E., Tsai, H., Deneen, B., Richardson, W.D., Barres, B.A., Rowitc, A.H., 2012. Astrocytes and disease: a neurodevelopmental perspective. Genes Dev. 26, 891–907. Pankratz, S.L., Tan, E.Y., Fine, Y., Mercurio, A.M., Shaw, L.M., 2009. Insulin receptor substrate-2 regulates aerobic glycolysis in mouse mammary tumor cells via glucose transporter 1. J. Biol. Chem. 284, 2031–2037. Peters, J.L., Kubzansky, L.D., Ikeda, A., Spiro, A., Wright, R.O., Weisskopf, M.G., Kim, D., Sparrow, D., Nie, L.H., Hu, H., Schwartz, J., 2011. Childhood and adult socioeconomic position, cumulative lead levels, and pessimism in later life: the VA normative aging study. Am. J. Epidemiol. 174, 1345–1353. Raizada, M.K., 1983. Localization of insulin-like immunoreactivity in the neurons from primary cultures of rat brain. Exp. Cell Res. 143, 351–357. Roohollah, E., Mohammad, F.J., Juan, B.L., Abdoreza, S.F., Parisa, S., Zulkifli, I., 2015. Effect of dietary lead on intestinal nutrient transporters mRNA expression in broiler chickens. Biomed Res. Int. 1–8. Rui, L.Y., 2014. Energy metabolism in the liver. Compr. Physiol. 4, 177–197. Semenza, G.L., 2010. HIF-1: upstream and downstream of cancer metabolism. Curr. Opin. Genet. Dev. 20, 51–56. Sharifi, A.M., Mousavi, S.H., Jorjani, M., 2010. Effect of chronic lead exposure on proapoptotic bax and anti-apoptotic bcl-2 protein expression in rat hippocampus in vivo. Cell. Mol. Neurobiol. 30, 769–774. Singh, B.S., Rajakumar, P.A., Eves, E.M., Rosner, M.R., Wainer, B.H., Devaskar, S.U., 1997. Insulin gene expression in immortalized rat hippocampal and pheochromocytoma-12 cell lines. Regul. Pept. 69, 7–14. Sun, H.L., Wang, N.J., Nie, X.M., Zhao, L., Li, Q., Cang, Z., Chen, Z., Lu, M., Cheng, J., Zhai, H.L., Xia, F.Z., Ye, L., Lu, Y.L., 2017. Lead exposure induces weight gain in adult rats, accompanied by DNA hypermethylation. PLoS One 12, 1–13. White, M.F., 2003. Insulin signaling in health and disease. Science 302, 1710–1711. White, L.D., Cory-Slechta, D.A., Gilbert, M.E., Tiffany-Castiglioni, E., Zawia, N.H., Virgolini, M., Rossi-George, A., Lasley, S.M., Qian, Y.C., Basha, M.R., 2007. New and evolving concepts in the neurotoxicology of lead. Toxicol. Appl. Pharmacol. 225, 1–27.

The authors declare that there are no conflicts of interest. Transparency document The Transparency document associated with this article can be found in the online version. Acknowledgements This project was supported by the National Natural Science Foundation (31801551), the Key Laboratory Open Fund of Ecological Animal Husbandry and Environmental Veterinary Medicine in Shanxi Province (KF2013-01), Research Startup Funds from Shanxi Agricultural University (2013YJ30), the National Key Research and Development Program of China (2017YFD0400200) and the Science and Technology Innovation Project of Higher Education in Shanxi Province (2016150). References Afeiche, M., Peterson, K.E., Sánchez, B.N., Cantonwine, D., Lamadrid-Figueroa, H., Schnaas, L., Ettinger, A.S., Hernández-Avila, M., Hu, H., Téllez-Rojo, M.M., 2011. Prenatal lead exposure and weight of 0- to 5-year-old children in Mexico City. Environ. Health Persp. 119, 1436–1441. Bouton, C.M., Frelin, L.P., Forde, C.E., Godwin, H.A., Pevsner, J., 2001. Synaptotagmin I is a molecular target for lead. J. Neurochem. 76, 1724–1735. Cardoso, S., Correia, S., Santos, R.X., Carvalho, C., Santos, M.S., Oliveira, C.R., George, P., Smith, M.A., Zhu, X.W., Moreira, P.I., 2009. Insulin is a two-edged knife on the brain. J. Alzheimers Dis. 18, 483–507. Chen, Z.C., Zhong, C.J., 2013. Decoding Alzheimer’s disease from perturbed cerebral glucose metabolism: implications for diagnostic and therapeutic strategies. Prog. Neurobiol. 108, 21–43. Clarke, D.W., Mudd, L., Boyd, F.T., Fields, M., Raizada, M.K., 1986. Insulin is released from rat brain neuronal cells in culture. J. Neurochem. 47, 831–836. Duelli, R., Kuschinsky, W., 2001. Brain glucose transporters: relationship to local energy demand. News Physiol. Sci. 16, 71–76. Faulk, C., Barks, A., Sánchez, B.N., Zhang, Z.Z., Anderson, O.S., Peterson, K.E., Dolinoy, D.C., 2014. Perinatal lead (Pb) exposure results in sex-specific effects on food intake, fat, weight, and insulin response across the murinelife-course. PLoS One 9, 1–9. Ferreira, I.A., Mocking, A.I., Urbanus, R.T., Varlack, S., Wnuk, M., Akkerman, J.W., 2005. Glucose uptake via glucose transporter 3 by human platelets is regulated by protein kinase B. J. Biol. Chem. 280, 32625–32633. Franco, R., Sánchez-Olea, R., Reyes-Reyes, E.M., Panayiotidis, M.I., 2009. Environmental toxicity, oxidative stress andapoptosis: Ménage àTrois. Mutat. Res. Gen. Tox. Environ. 674, 3–22. Georgescu, M.M., 2010. PTEN tumor suppressor network in PI3K-AKT pathway control. Genes Cancer 1, 1170–1177.

30