- Email: [email protected]
Effects of Lycium barbarum polysaccharides on immunological parameters, apoptosis, and growth performance of Nile tilapia (Oreochromis niloticus)
Fish and Shellfish Immunology 97 (2020) 509–514
Contents lists available at ScienceDirect
Fish and Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
Effects of Lycium barbarum polysaccharides on immunological parameters, apoptosis, and growth performance of Nile tilapia (Oreochromis niloticus)
T
Xu Zhanga,b, Kai Huangb, Huan Zhonga, Yanqun Mab, Zhongbao Guoa, Zhanyang Tanga,b,∗, Junneng Lianga, Yongju Luoa,b,∗∗, Zhijian Sub, Liqun Wangb a b
Guangxi Academy of Fishery Science, Nanning, 530021, China College of Animal Science and Technology of Guangxi University, Nanning, 530005, China
A R T I C LE I N FO
A B S T R A C T
Keywords: LBP Nile tilapia Immunology Apoptosis Growth performance
In this study, the effect of Lycium barbarum polysaccharides (LBP) on immunological parameters, apoptosis, and growth performance of Nile tilapia (Oreochromis niloticus) was investigated. Dietary supplementation with LBP significantly increased complement 3 (C3) activity and promoted interleukin IL-1β gene expression in spleen tissue, significantly reduced apoptosis in spleen tissue, increased the specific growth rate (SGR), relative length gain (LG), and relative weight gain (WG) of Nile tilapia. However, dietary supplementation with LBP did not have a significant effect on serum alkaline phosphatase (AKP), malondialdehyde (MDA), and superoxide dismutase (SOD), blood constituents, apoptosis, or gene expression of IL-1β in liver tissue. Overall, the results showed that dietary supplementation with LBP increased the nonspecific immunity of Nile tilapia and reduced the apoptosis rate to promote growth and development. Thus, LBP has potential for use as a new immunostimulant in aquaculture.
1. Introduction
Studies focused of the use of Chinese herbal medicines to improve immunity and promote growth of aquatic animals are becoming more common. For example, Bhavan [10] and Zahran [1] reported that dietary supplementation with Alteranthera sessilis, Eclipta alba, Cissus quadrangularis, and Astragalus polysaccharides (APS) significantly increased the activity of digestive enzymes of the prawn Macrobrachium rosenbergii and Nile tilapia (Oreochromis niloticus). László et al. [8] and Mo et al. [11] found that Astragalus membranaceus and Lycium barbarum enhanced the nonspecific immunity of Nile tilapia and grass carp (Ctenopharyngodon idella). The boxthorn Lycium barbarum, which is the source of the goji berry, has properties that are promising for warding off disease. Lycium barbarum po1ysaccharides (LBP) are the main active immune component in this plant, and they play a critical role in activating T cells, promoting B cell maturation, removing free radicals to protect cells, and improving immunity [12–15]. LBP also has a significant effect on reducing blood sugar and blood lipids in mice [16]. Thus, the application of LBP as an immunostimulant for aquatic animals has great potential. The goal of this study was to analyze the effects of LBP on the growth and development, immunity, hematology, and apoptosis of Nile tilapia to explore the potential of this immunostimulant to promote healthy
Tilapia is an economically important group of fish that is farmed worldwide. Its cultivation is always accompanied by bacterial and viral infections, and large amounts of antibiotics and illegal drugs are used to try to combat the problem [1]. Mesalhy and Albutti [2] reported that the abuse of antibiotics resulted in drug resistance of microbes affecting tilapia and that it has indirect effects on human health. Thus, food safety has become a major issue that limits the development of aquatic products. Many studies of Chinese herbal medicines in animals have shown that these products can treat a variety of conditions, including peanut allergy [3], asthma [4], and irritable bowel syndrome [5]. The active ingredients of herbal medicines are mainly polysaccharides and flavonoids, which are closely related to animal immune function [6,7]. Therefore, their use might be a promising approach to dealing with disease in fish aquaculture. László et al. [8] noted that enhancing the fish immune system was the most promising method to prevent diseases. Moreover, Citarasu [9] found that Chinese herbal medicines such as Quillaja saponins and Withania somnifera have positive effects on fish growth, immunity, appetite, and stress responses. It is imperative to find natural products with no toxic side effects for use in aquaculture.
∗
Corresponding author. Guangxi Academy of Fishery Science, Nanning, 530021, China. Corresponding author. Guangxi Academy of Fishery Science, Nanning, 530021, China. E-mail addresses: [email protected] (Z. Tang), [email protected] (Y. Luo).
∗∗
https://doi.org/10.1016/j.fsi.2019.12.068 Received 1 November 2019; Received in revised form 18 December 2019; Accepted 21 December 2019 Available online 23 December 2019 1050-4648/ © 2019 Elsevier Ltd. All rights reserved.
Fish and Shellfish Immunology 97 (2020) 509–514
X. Zhang, et al.
and sustainable development of the tilapia industry.
2.5. Hematology test
2. Materials and methods
At the end of the experiment, three fingerlings were randomly selected from each test group and anesthetized with the MS-222. Blood from the tail vein was immediately collected on ice, and the collected blood samples were placed in 2 mL anticoagulation tubes and stored temporarily at 4 °C. Using the hematology test method developed by Zhang et al. [17], the number of white blood cells (WBC), red blood cell count (RBC), hemoglobin content (HGB), hematocrit (HCT), mean red blood cell volume (MCV), and mean red blood cell hemoglobin content (MCH) in the blood were measured using an automatic hematology analyzer (Mindray BC-2800vet, Shenzhen, China).
2.1. Fish Nile tilapia were obtained from the Guangxi Academy of Fishery Sciences (Guangxi, China). Healthy and vigorous fingerlings with uniform specifications were selected for use in the experiment and cultivated at 28 ± 0.5 °C, pH 8 for 1 week before the experiment. 2.2. LBP LBP with a purity of 50% UV was provided by Shanghai Yuanye Biotechnology Co., Ltd. (Shanghai, China). The samples were dark brown in color, had a powdery consistency, and easily absorbed moisture.
2.6. Serum biochemical analysis At the end of the experiment, six fingerlings were randomly selected from each group for blood collection using the method described above. The blood samples were placed in 2 mL centrifuge tubes at 4 °C for 24 h, then centrifuged at 4000 rpm for 10 min at 4 °C. The upper serum was collected for analysis. Testing kits were used to detect the activities and contents of lysozyme (LYS), alkaline phosphatase (AKP), malondialdehyde (MDA), superoxide dismutase (SOD), and complement 3 (C3) in serum. All kits used in this study were purchased from Jiangsu Zeyu Biotechnology Co., Ltd. (JiangSu, China), and the experiment was conducted according to the manufacturer's instructions. Instruments used in this experiment included: a microplate reader (Labsystems Multiskan MS 352, Finland), a plate washer (Thermo Labsystems AC8, Finland), a micro high-speed centrifuge (Xiangyi Group, TG16W, Hunan, China), and a water-jacket incubator (Jinghong, GNP-9080, Shanghai, China).
2.3. Feed and experimental design The experimental feed base was provided by Baiyang Industrial Investment Group Co., Ltd. (Guangxi, China). The raw materials were composed of corn, wheat bran, fish meal, soybean meal, rapeseed meal, calcium dihydrogen phosphate, sodium chloride, ferrous sulfate, copper sulfate, manganese sulfate, zinc sulfate, sodium selenite, vitamins (A, E, K3, B1, B2, B6, and C), niacin, folic acid, and inositol (Table 1). For the treatment groups, the feed base was supplemented with LBP at 500 mg/ kg (Group 2), 1000 mg/kg (Group 3), 1500 mg/kg (Group 4), and 2000 mg/kg (Group 5); 0 mg/kg (Group 1) served as the control. The feed was uniformly mixed and dried and stored at low temperature in a dry place. We used a control group and four test groups in the experiment. Each group was designed with three water tanks, there are 50 fingerlings in each water tank (150L). At beginning of the experiment, the 750 Nile tilapia (6.12 ± 2.75 g, 6.92 ± 0.49 cm) were randomly distributed into the 15 tanks (50 fish/tank). During the 40 d breeding experiment, the water temperature in each tank was maintained at 28 ± 0.5 °C, pH 8. The test water consisted of tap water that was exposed to the sun to remove the chlorine, and the water was changed every 3 d. Fingerlings were fed at 9:00 and 17:00 every day. During the cultivation period, all test fingerlings were in good condition with no death or illness.
2.7. Tissue apoptosis assay At the end of the experiment, three fingerlings were randomly selected from each test group and anesthetized with MS-222. The liver and spleen were collected and immersed in 4% paraformaldehyde universal tissue fixative (Saiguo Biotechnology Co., Ltd., Guangzhou, China) for embedding. Dewaxing, repairing, and rupturing were performed after 4 μm continuous routine sections were produced with a pathological slicer (Leica Instrument Co., Ltd., Shanghai, China). They then were treated with fluorescent dye according to the instructions for the TUNEL kit (Basel, Germany, Switzerland) and sealed with antifluorescence quenching mounting medium (Servicebio, Wuhan, China). The sections were ultimately observed under a fluorescence microscope (Nikon Eclipse C1, Tokyo, Japan), and the images were collected for the tissue apoptosis analysis. For the tissue apoptosis analysis, photographs were randomly taken of each section under a ×200 field. The background light of each photograph was consistent to ensure that the tissue filled the entire field. Image-Pro Plus 6.0 software (Media Cybernetics Inc., Rockville, MD, USA) was used to select the green fluorescent cell nuclei with the same label as the unified standard for judging photo positive cells. Cell nuclei of all cells were stained with the blue DAPI label. In each photograph, the number of positive cells and the total number of cells were counted. The percentage of positive cells [(Number of positive cells/ Number of total cells) ×100] was calculated as the apoptosis rate (%).
2.4. Growth parameters At the beginning and end of the experiment, the weight and full length of the fingerlings were measured, and the relative weight gain (WG), relative length gain (LG), feed conversion ratio (FCR), and specific growth rate (SGR) were calculated as follows: SGR = (ln W2 – ln W1)/t × 100%; WG = (W2 – W1)/W1 × 100%; FCR = W3/(W2 – W1); LG = (L2 – L1)/L1 × 100%; where W1 is the original weight (g), W2 is the final weight (g), W3 is the feed consumption, L1 is the original length (cm), L2 is the final length (cm), and t is the breeding time (d). Table 1 Nutrients of the basic feed. Nutrition indicators
Protein
Lipid
Ash
Fiber
Moisture
Lysine
Calcium
Total phosphorus
Sodium chloride
Content (%)
≥30.0
≥3.0
≤13.0
≤10.0
≤12.0
≥1.4
0.5-2.5
0.6-2.0
0.3-1.5
510
Fish and Shellfish Immunology 97 (2020) 509–514
X. Zhang, et al.
3.2. Hematology test
Table 2 Primers used in real time PCR. Primer
Sequence (5′-3′)
Annealing temperature (°C)
gapdh-S gapdh-A IL-1β-S IL-1β-A
AACTCCCTCAAGGTTGTCAGCA GTCTTCTGGGTGGCAGTGATG CTCAGTTCACCAGCAGGGATG GACTGTTTTTATCCGTCACCTCC
60 60 60 60
Table 4 shows the results of the hematology test. As LBP content increased in the diet, the WBC, MCV, and MCH in the blood of Nile tilapia increased first and then decreased. Group 2 had the highest WBC and MCV values at 188.77 109/L and 143.17 fl, and Group 3 had the highest MCH content at 107.3 pg, but it did not differ significantly from that of the control group (P > 0.05). RBC, HGB, and HCT decreased with increasing dietary content of LBP, but the values were not significantly different from those of the control group (P > 0.05).
2.8. Immune-related gene expression analysis At the end of the experiment, the liver and spleen from three fingerlings in each group were collected using same method as described above and temporarily stored at −80 °C. Total RNA from liver and spleen tissues was extracted using TRIzol reagent (Servicebio, Wuhan, China). An ultra-micro UV spectrophotometer (Thermo NanoDrop 2000, Waltham, MA, USA) was used to determine RNA purity and concentration. First strand cDNA was then synthesized using a cDNA synthesis kit (Thermo, USA) and stored at −20 °C. The NCBI database was used to search for the gene sequence for use in primer design. The primers were all provided by Saiwei Biotechnology Co., Ltd. (Wuhan, China) (Table 2). The PCR reaction was conducted on a real-time PCR instrument (ABI Stepone plus, USA) using SYBR Green as the fluorescent dye and the housekeeping gene GAPDH, which is expressed at a high level in each tissue, as the internal reference gene. The reaction system (25 μL) included cDNA (2.5 μL), gene primer (2.0 μL) (primer concentration of 7.5 μM/L), ddH2O (8.0 μl), and SYBR Mix (12.5 μL). The reaction procedure was as follows: pre-denaturation at 95 °C for 10 min, 95 °C for 15 s, 60 °C for 60 s, and 40 cycles. The final gene expression amount was analyzed by 2–ΔΔCT [18].
3.3. Serum biochemical analysis Fig. 1 shows the serum biochemical indicators of the fingerlings. Group 3 had the highest C3 activity, and it was significantly different from that of the control group (P < 0.05). LYS activity was significantly lower in Groups 3 and 4 compared to the control (P < 0.05), but no significant difference was observed in the other groups (P > 0.05). SOD activity was highest in Group 4, but it did not differ significantly from that of the control group (P > 0.05). The content of MDA increased with the increase of LBP content in the diet, which was the highest in Group 5, but there was no significant difference between the control group (P > 0.05). AKP activity peaked in Group 4 but did not differ significantly from that of the control group (P > 0.05). 3.4. Tissue apoptosis assay Fig. 2 shows the results of the tissue apoptosis assay. As LBP content increased in the diet, the apoptosis rate in spleen tissue decreased and reached the lowest value in Group 3; the value was significantly lower than that of the control group (P < 0.05). The apoptosis rate of liver tissue decreased first to the lowest value in Group 3 and then increased to the highest value in Group 5. However, the values did not differ significantly from that of the control group (P > 0.05).
2.9. Data analysis SPSS 17.0 software was used to conduct one-way analysis of variance and multiple comparison (Duncan's test) to analyze the data. P < 0.05 was considered to be statistically significant.
3.5. Immune-related gene expression analysis Fig. 3 shows the gene expression of interleukin IL-1β in liver and spleen tissues of Nile tilapia. Expression of IL-1β in spleen tissues increased in all test groups after LBP was added. Group 2 had the highest value, which was significantly different from that of the control group (P < 0.05). Expression of IL-1β in the liver of decreased first and then increased as the LBP content in the diet increased. It was highest in Group 5 but was not significantly different from that of the control (P > 0.05).
3. Results 3.1. Growth parameters As LBP content increased in the diet from 0 (Group 1) to 2000 mg/ kg (Group 5), final length, final weight, WG, LG, and SGR increased first and then decreased. These parameters reached the maximum values in Group 4, respectively at 12.80 cm, 44.76 g, 623.20%, 83.03%, and 4.97%/d; they were significantly different from values in the control group (P < 0.05). FCR first decreased and then increased, reaching a minimum of 2.08 in Group 4, which was significantly different from the control group (P < 0.05). Table 3 lists the growth parameters of Nile tilapia in this study.
4. Discussion Chinese herbal medicines can promote the growth and development of organisms by improving the phagocytic ability of white blood cells [19] and enhancing nonspecific immunity [20,21]. They also can affect digestive enzyme activity and the number of microorganisms in the
Table 3 Growth parameters of Nile tilapia fed with different LBP levels for 40 days (n = 15). Values (mean ± S.E.) in the same line with different superscript letters significantly differ from each other (P < 0.05). Parameters Initial length (cm) Final lenght (cm) Initial weight (g) Final weight (g) WG (%) LG (%) SGR (%/d) FCR (g/g)
0 mg/kg
500 mg/kg a
6.92 ± 0.49 11.89 ± 0.29a 6.12 ± 2.75a 34.78 ± 2.34a 468.22 ± 38.27a 71.80 ± 4.15a 4.34 ± 0.17a 2.80 ± 0.23a
1000 mg/kg a
1500 mg/kg a
6.92 ± 0.49 12.02 ± 0.36a 6.12 ± 2.75a 35.70 ± 4.50a 447.72.07 ± 81.41a 70.66 ± 5.04a 4.40 ± 0.33a 2.75 ± 0.45 ab
6.92 ± 0.49 12.22 ± 0.48 ab 6.12 ± 2.75a 37.90 ± 6.05 ab 547.79 ± 64.21 80.02 ± 1.49b 4.54 ± 0.40 ab 2.58 ± 0.49 abc
511
2000 mg/kg a
ab
6.92 ± 0.49 12.80 ± 0.25b 6.12 ± 2.75a 44.76 ± 2.31b 623.20 ± 42.79b 83.03 ± 3.79b 4.97 ± 0.13b 2.08 ± 0.12c
6.92 ± 0.49a 12.54 ± 0.35 ab 6.12 ± 2.75a 44.13 ± 4.58b 607.31 ± 60.07b 80.04 ± 3.74b 4.89 ± 0.27b 2.13 ± 0.27 bc
Fish and Shellfish Immunology 97 (2020) 509–514
X. Zhang, et al.
Table 4 Blood parameters of Nile tilapia raised at different LBP levels for 40 days (n = 3) Values (mean ± S.E.) in the same line with different superscript letters significantly differ from each other (P < 0.05). Project
0 mg/kg
500 mg/kg
1000 mg/kg
1500 mg/kg
2000 mg/kg
WBC (109/L) RBC (1012/L) HGB (g/l) HCT (%) MCV (fl) MCH (pg)
168.47 ± 12.12a 1.10 ± 0.38a 104.33 ± 7.09a 15.23 ± 1.25a 139.87 ± 13.34a 95.17 ± 7.41a
188.77 ± 1.59a 1.06 ± 0.10a 103.67 ± 8.96a 15.23 ± 3.31a 143.17 ± 16.74a 98.6 ± 15.11a
170.47 ± 24.41a 0.96 ± 0.15a 101.67 ± 14.67a 13.43 ± 1.82a 141.47 ± 22.37a 107.3 ± 21.53a
169.1 ± 34.33a 1.00 ± 0.22a 97.33 ± 16.56a 16.27 ± 4.90a 142.53 ± 20.89a 87.97 ± 19.07a
149.8 ± 19.90a 1.02 ± 0.31a 85.33 ± 22.03a 13.53 ± 5.06a 133.23 ± 28.59a 86.77 ± 28.91a
Fig. 1. Serum biochemical parameters of Nile tilapia raised at different LBP levels for 40 days (n = 6). A: C3, B: LYS, C: AKP, D: MDA, E: SOD. Group values (mean ± S.E.) with different superscript letters significantly differ from each other (P < 0.05).
capacity of blood and the number of RBCs [31,32]. WBCs are an important component of non-specific immunity, and their presence in the blood determines the resistance of fish to pathogen infection and stress [33]. In this study, the WBC was highest amount in Group 2, but the value was not significantly different from that of the control. This result is inconsistent with that of Hassaan et al. [34], who reported significant difference in the blood parameters between the test groups and the control. However, We guess that the effect of LBP was slow, and the short time period of the experiment may not have been long enough for a significant difference to be detected. Antioxidant enzymes effectively protect cells from the damage caused by reactive oxygen species [35]. SOD is an important antioxidant enzyme in the animal body because it scavenges free radicals, and its activity is positively correlated with the body's antioxidant capacity [1,36]. MDA is an oxidative metabolite of cells, and its content is
body [22] to promote digestion to stimulate growth and development of the organism. Citarasu reported that Chinese herbal medicines can be used as an appetite stimulant to affect animal growth [23]. In the current study, adding LBP to the feed promoted growth and development of Nile tilapia. Interestingly, similar findings have been found in other herbal studies of tilapia [24], carp [25], sunfish (Lepomis macrochirus) [26], and shrimps [27,28]. The results showed that LBP can also promote the growth and development of tilapia as an appetite stimulant. as has been shown for APS, Lonicera japonica, and other Chinese herbal medicines. Blood is an important component of the immune system, and its components are susceptible to different factors. Thus, changes in blood parameters can be used to determine the physiological health of fish [29,30]. RBCs transport oxygen, whereas HGB binds to oxygen in the RBCs. HCT affects the blood viscosity to influence the oxygen transport
Fig. 2. Apoptosis in spleen (A) and liver (B) of Nile tilapia at different LBP levels for 40 days (n = 3). Group values (mean ± S.E.) with different superscript letters significantly differ from each other (P < 0.05). 512
Fish and Shellfish Immunology 97 (2020) 509–514
X. Zhang, et al.
Fig. 3. The expression levels of Il-1β in spleen (A) and liver (B) of Nile tilapia at different LBP levels for 40 days (n = 3). Group values (mean ± S.E.) with different superscript letters significantly differ from each other (P < 0.05).
herbal medicines can induce expression of the IL-1β gene in animal immune tissues. For example, Selvaraj et al. [55] injected yeast dextran into the carp (Cyprinus carpio) for 7 days and found that IL-1 mRNA expression increased in the fish kidney. In the current study, gene expression of IL-1β in the spleen tissues of all test groups increased after adding LBP. Group 2 had the highest value, which was significantly higher than that of the control. These results are consistent with the findings of Tang et al. [56], who reported that a Chinese herbal mixture composed of angelica, astragalus, hawthorn, licorice root, and honeysuckle can improve the mRNA expression of IL-1β in the tilapia head, kidney, and spleen. However, no significant difference in gene expression of IL1β was detected in liver tissue. We concluded that LBP promoted the expression of the IL-1β gene in the spleen by activating tilapia macrophages, thus improving the non-specific immunity of tilapia. In conclusion, LBP played an important role in promoting the growth and immunity of Nile tilapia. Furthermore, LBP could be used as a feed additive for tilapia. Based on our findings, the application of LBP has great significance for reducing food safety risk and promoting the sustainable development of Nile tilapia aquaculture.
negatively correlated with the number of cells attacked by free radicals in the body. AKP is an important nonspecific phosphohydrolase and part of the detoxification system, and it is associated with the digestion and absorption of nutrients [37,38]. In the current study, dietary supplementation with LBP had no significant effect on SOD and AKP activities and MDA content of Nile tilapia. However, LBP has been shown to have significant antioxidant function in other species. For example, Tan et al. [39] found that LBP improved the antioxidant capacity of the pompano Trachinotus ovatus, and Bai et al. [40] reported that LBP significantly improved the antioxidant capacity of the minnow Tanichthys albonubes. Our differing results may be due to differences in the absorption and metabolism of LBP in the different species, which would have different biological effects. LYS is a nonspecific immune defense factor in the fish immune system that is extremely important in the fight against pathogenic microorganisms [41,42]. In this study, the activity of LYS was lowest in Group 4 and significantly lower than that of the control. The complement system also is an important component of the non-specific immunity of organisms. C3 has biological functions such as bacteriolysis and immune regulation [43]. In the current study, C3 activity was highest in Group 3, and it differed significantly from that of the control. Similar results were reported for the fish species Pelteobagrus fulvidraco [44], Scophthalmus maxima [45], and Squaliobarbus curriculus [46]. Zhang [47] and Chen et al. [48] proposed that LBP can enhance the function of T cells, B cells, and macrophages, and Su et al. [49] found that LBP can enhance humoral immunity by activating follicular helper T cells. Thus, LBP may activate the immune system of Nile tilapia to promote the production of C3. In summary, the proper amount of dietary LBP can promote the non-specific immunity of tilapia to resist invasion by viruses and bacteria. As the largest peripheral lymph organ in the body, the spleen is the main site for the immune response and plays a critical role in maintaining the normal immune function of the animal body. In this study, the apoptosis rate of spleen tissue was significantly reduced in Group 3, whereas C3 activity was highest in this group; this may be because C3's bacteriostatic, immunomodulatory, and immune complex functions protected the spleen of the fish [43,49]. In addition, it has been reported that LBP can also inhibit apoptosis of zebrafish and mice cells through the p53 signaling pathway and promote development of the spleen. [50,51]. The liver is the major organ for metabolism and secretion in the body, and its health affects the normal life activities of fish. In this study, LBP did not have a significant effect on liver tissue apoptosis. Therefore, the results indicated that LBP enhanced the nonspecific immunity of tilapia by protecting the spleen tissue of tilapia. IL-1β is a classic proinflammatory cytokine secreted by macrophages after T cell and macrophage activation. It stimulates Th17 cell differentiation and the production of the related factors and enhances the cell-mediated immune response and immunity [52–54]. Many studies have shown that immunostimulants such as vaccines and Chinese
Author contributions Xu Zhang participated in the literature search, study design, data collection, data analysis, data interpretation, and wrote the manuscript. Zhanyang Tang and Yongju Luo participated in the study design and provided the critical revision. Kai Huang, Huan Zhong, Yanqun Ma, Zhongbao Guo, Junneng Liang, Zhijian Su, and Liqun Wang carried out the data collection and analysis. All authors read and approved the final manuscript. Declaration of competing interest We declare that we have no conflict of interest. Acknowledgement This work was supported by the Guangxi Science and Technology Research Program (AA17204094-2), China Agriculture Research System (CARS-46), National Natural Science Foundation of China (31560716), National Key Research and Development Program of China (2018YFD0900601), National Natural Science Foundation of China (31960733), Natural Science Foundation of Guangxi (2018GXNSFAA138128), and Natural Science Foundation of Guangxi (2016GXNSFFA380002). References [1] Z. Eman, R. Engy, A. Fatma, M. Hebata Allah, I. Tarek, Effects of dietary Astragalus polysaccharides (APS) on growth performance, immunological parameters, digestive enzymes, and intestinal morphology of Nile tilapia (Oreochromis niloticus),
513
Fish and Shellfish Immunology 97 (2020) 509–514
X. Zhang, et al.
[30] P.D. Marco, A. Priori, M. Finoia, A. Massari, A. Mandich, G. Marino, Physiological responses of European sea bass Dicentrarchus labrax to different stocking densities and acute stress challenge, Aquaculture 275 (2008) 319–328. [31] J.W. Bao, J. Qiang, Y.F. Tao, H.X. Li, J. He, P. Xu, D.J. Chen, Responses of blood biochemistry, fatty acid composition and expression of microRNAs to heat stress in genetically improved farmed tilapia (Oreochromis niloticus), J. Therm. Biol. 73 (2018) 91–97. [32] R. Wells, G. Grigg, L. Beard, G. Summers, Hypoxic responses in a fish from a stable environment: blood oxygen transport in the Antarctic fish Pagothenia borchgrevinki, J. Exp. Biol. 141 (1989) 97–111. [33] A. Ellis, The leucocytes of fish: a review, J. Fish Biol. 11 (1977) 453–491. [34] M. Hassaan, M. Soltan, M. Ghonemy, Effect of synbiotics between Bacillus licheniformis and yeast extract on growth, hematological and biochemical indices of the Nile tilapia (Oreochromis niloticus), Egypt. J. Aquat. Res. 40 (2014) 199–208. [35] I. Messaoudi, S. Barhoumi, K. Saïd, A. Kerken, Study on the sensitivity to cadmium of marine fish Salaria basilisca (Pisces: Blennidae), J. Environ. Sci. 21 (2009) 1620–1624. [36] G.W. Winston, Oxidants and antioxidants in aquatic animals, Comp. Biochem. Physiol. C Comp. Pharmacol. 100 (1991) 173–176. [37] R.Q. Zhang, Q.X. Chen, W.Z. Zheng, J.Y. Lin, Z.L. Zhuang, H.M. Zhou, Inhibition kinetics of green crab (Scylla serrata) alkaline phosphatase activity by dithiothreitol or 2-mercaptoethanol, Int. J. Biochem. Cell Biol. 32 (2000) 865–872. [38] R. Molina, I. Moreno, S. Pichardo, A. Jos, R. Moyano, J.G. Monterde, Acid and alkaline phosphatase activities and pathological changes induced in Tilapia fish (Oreochromis sp.) exposed subchronically to microcystins from toxic cyanobacterial blooms under laboratory conditions, Toxicon 46 (2005) 725–735. [39] L.J. Tan, H.Z. Lin, Z. Huang, C.P. Zhou, P.W. Xun, Q.Q. Huang, W.F. Yu, X.L. Huang, W. YuJ, Effects of lycium barbarum polysaccharide on growth performance, antioxidant capacity, serum immune and biochemical indexes of Juvenile golden pompano (Trachinotus ovatus), Chin. J. Anim. Nutr. 31 (2019) 429–438 [Chinese]. [40] D.Q. Bai, X. Wu, Y.H. LiJ, The effects of Lycium bararum polysaccharides and Ganoderima luaidum polysaccharides on the antioxidant abilities and nonspecific immunity on white cloud mountain fish, China Feed 1 (2011) 30–32 [Chinese]. [41] M. Dunier, A.K. Siwicki, A. Demaël, Effects of organophosphorus insecticides: effects of trichlorfon and dichlorvos on the immune response of carp (Cyprinus carpio): III. In Vitro effects on lymphocyte proliferation and phagocytosis and in Vivo effects on humoral response, Ecotoxicol. Environ. Saf. 22 (1991) 79–87. [42] J.A. Simser, K.R. Macaluso, A. Mulenga, A.F. Azad, Immune-responsive lysozymes from hemocytes of the American dog tick, Dermacentor variabilis and an embryonic cell line of the Rocky Mountain wood tick, D. andersoni, Insect Biochem. Mol. Biol. 34 (2004) 1235–1246. [43] D. Ndong, Y.Y. Chen, Y.H. Lin, B. Vaseeharan, J.C. Chen, The immune response of tilapia Oreochromis mossambicus and its susceptibility to Streptococcus iniae under stress in low and high temperatures, Fish Shellfish Immunol. 22 (2007) 686–694. [44] M. Qu, C. Huang, B.L. Zhang, Z.Y. Cheng, D.Q. Bai, L.Y. Jia, S.L. Zhai, Effects of compound Chinese traditional drug on the growth performance, muscle quality and complement C3, complement C4 content in serum of Pelteobagrus fulvidraco, China Feed 615 (2018) 77–82 [Chinese]. [45] H. Li, T.E. Zhang, Q. Li, Influence of compound Chinese herbal medicine on nonspecific immunity of turbot Scophthalmus maximus, J. Dalian Ocean Univ. 28 (2013) 115–120 [Chinese]. [46] G.F. Li, Y.C. Kang, J.J. Sun, J.G. He, The effects of yeast glucan on the Squaliobarbus curriculus non-specific immune response, Acta Sci. Nat. Univ. Sunyatseni 42 (2003) 55–58 [Chinese]. [47] X. Zhang, Y. Li, J. Cheng, G. Liu, C. Qi, W. Zhou, Y. Zhang, Immune activities comparison of polysaccharide and polysaccharide-protein complex from Lycium barbarum L, Int. J. Biol. Macromol. 65 (2014) 441–445. [48] Z. Chen, B.K.H. Tan, S.H.J.I.I. Chan, Activation of T lymphocytes by polysaccharide–protein complex from Lycium barbarum L, Int. Immunopharmacol. 8 (2008) 1663–1671. [49] C.X. Su, X.G. Duan, L.J. Liang, J. Zheng, X.Y. Fu, Y.M. Yan, N.P. Wang, Immunopathology, Lycium barbarum polysaccharides as an adjuvant for recombinant vaccine through enhancement of humoral immunity by activating Tfh cells, Vet. Immunol. Immunopathol. 158 (2014) 98–104. [50] G. Xia, N. Xin, W. Liu, H. Yao, Y. Hou, J. Qi, Inhibitory effect of Lycium barbarum polysaccharides on cell apoptosis and senescence is potentially mediated by the p53 signaling pathway, Mol. Med. Rep. 9 (2014) 1237–1241. [51] W.L. Hao, Z.B. Chen, R. Zhao, L. Bo, Effect of Lycium barbarum polysaccharide on immune function and anti-fatigue of sub-healthy mice, Chin. J. Biol. 28 (2015) 693–697. [52] B.J. Kullberg, J.W.V.D. Meer, Cytokines in the Treatment of Infectious Diseases: Options for the Modulation of Host Defense, Springer Science & Business Media, 1995. [53] A.R. Mridha, A. Wree, A.A. Robertson, M.M. Yeh, C.D. Johnson, D.M. Van Rooyen, F. Haczeyni, N.C. Teoh, C. Savard, G.N. Ioannou, S.L. Masters, K. Schroder, M.A. Cooper, A.E. Feldstein, G.C. Farrell, NLRP3 inflammasome blockade reduces liver inflammation and fibrosis in experimental NASH in mice, J. Hepatol. 66 (2017) 1037–1046. [54] J.L. Ather, K. Ckless, R. Martin, K.L. Foley, B.T. Suratt, J.E. Boyson, K.A. Fitzgerald, R.A. Flavell, S.C. Eisenbarth, M.E. Poynter, Serum amyloid A activates the NLRP3 inflammasome and promotes Th17 allergic asthma in mice, J. Immunol. 187 (2011) 64–73. [55] V. Selvaraj, K. Sampath, V. Sekar, Administration of yeast glucan enhances survival and some non-specific and specific immune parameters in carp (Cyprinus carpio) infected with Aeromonas hydrophila[J], Fish Shellfish Immunol. 19 (4) (2005) 0306. [56] J. Tang, J. Cai, R. Liu, J. Wang, Y. Lu, Z. Wu, J. Jian, Immunostimulatory effects of artificial feed supplemented with a Chinese herbal mixture on Oreochromis niloticus against Aeromonas hydrophila, Fish Shellfish Immunol. 39 (2014) 401–406.
Fish Shellfish Immunol. 38 (2014) 149–157. [2] S. Mesalhy, A. Albutti, Antimicrobials use in aquaculture and their public health impact, J. Aquac. Res. Dev. 5 (2014). [3] K.D. Srivastava, J.D. Kattan, Z.M. Zou, J.H. Li, L. Zhang, S. Wallenstein, J. Goldfarb, H.A. Sampson, X.M. li, The Chinese herbal medicine formula FAHF-2 completely blocks anaphylactic reactions in a murine model of peanut allergy, J. Allergy Clin. Immunol. 115 (2005) 171–178. [4] X.M. Li, C.K. Huang, T.F. Zhang, A.A. Teper, K. Srivastava, B.H. Schofield, H.A. Sampson, The Chinese herbal medicine formula MSSM-002 suppresses allergic airway hyperreactivity and modulates TH1/TH2 responses in a murine model of allergic asthma, J. Allergy Clin. Immunol. 106 (2000) 660–668. [5] A. Bensoussan, N.J. Talley, M. Hing, R. Menzies, A. Guo, M. Ngu, Treatment of irritable bowel syndrome with Chinese herbal medicine: a randomized controlled trial, Jama 280 (1998) 1585. [6] B.K. Tan, J. Vanitha, Immunomodulatory and antimicrobial effects of some traditional Chinese medicinal herbs: a review, Curr. Med. Chem. 11 (2004) 1423–1430. [7] T. Gengyuan, F. Yucheng, Study and application of polysaccharide immunoregulators, Prog. Chem. 2 (1994). [8] L. Ardó, G. Yin, P. Xu, L. Váradi, G. Szigeti, Z. Jeney, G. Jeney, Chinese herbs (Astragalus membranaceus and Lonicera japonica) and boron enhance the nonspecific immune response of Nile tilapia (Oreochromis niloticus) and resistance against Aeromonas hydrophila, Aquaculture 275 (2008) 26–33. [9] T. Citarasu, Herbal biomedicines: a new opportunity for aquaculture industry, Aquacult. Int. 18 (2010) 403–414. [10] S. Radhakrishnan, P.S. Bhavan, C. Seenivasan, R. Shanthi, R. Poongodi, Influence of medicinal herbs (Alteranthera sessilis , Eclipta alba and Cissus quadrangularis) on growth and biochemical parameters of the freshwater prawn Macrobrachium rosenbergii, Aquacult. Int. 22 (2014) 551–572. [11] W.Y. Mo, C.H.I. Lun, W.M. Choi, Y.B. Man, M. Wong, Enhancing growth and nonspecific immunity of grass carp and Nile tilapia by incorporating Chinese herbs (Astragalus membranaceus and Lycium barbarum) into food waste based pellets, Environ. Pollut. 219 (2016) 475–482. [12] C.X. Su, X.G. Duan, L.J. Liang, J. Zheng, X.Y. Fu, Y.M. Yan, Ling Huang, N.P. Wang, Immunopathology, Lycium barbarum polysaccharides as an adjuvant for recombinant vaccine through enhancement of humoral immunity by activating Tfh cells, Vet. Immunol. Immunopathol. 158 (2014) 98–104. [13] Z. Chen, B.K.H. Tan, S.H. Chan, Activation of T lymphocytes by polysaccharide–protein complex from Lycium barbarum L, Int. Immunopharmacol. 8 (2008) 1663–1671. [14] X. Manyan, Z. Hongfeng, W. Yufei, The protective effects of lychan barbarian polysaccharide on alloxan-induced isolated islet cells damage in rats, J. Chin. Med. Mater. 25 (2002) 649–651. [15] L. Zhang, J. Gu, Y. Chen, A study on four antioxidation effects of lycium barbarum polysaccharides in vitro, Afr. J. Tradit., Complementary Altern. Med. 10 (2013) 494–498. [16] L. Jing, L. Yin, Antihyperglycemic activity of polysaccharide from Lycium barbarum, J. Med. Plants Res. 4 (2010) 23–26. [17] Q.Q. Zhang, T.Q. Liu, T.T. Li, J. Xu, M. Long, X.H. Wang, X.N. Gong, A.H. Li, The effects of jade screen power on the non-specific immune response and the expression of the related genes in fish, Acta Hydrobiol. Sin. 39 (2015) 1076–1084 [Chinese]. [18] M.A.A. Norag, A.M. El-Shenawy, S.E. Fadl, W.S. Abdo, D.M. Gad, M.A. Rashed, A.M. Prince, Effect of phytase enzyme on growth performance, serum biochemical alteration, immune response and gene expression in nile tilapia, Fish Shellfish Immunol. 80 (2018) 97–108. [19] X. Lin, W.N. Zhang, S.K. Wang, W.Y. Huang, J.M. Chen, J. Zhao, Influence of Astragalus polysaccharides on leukocyte phagocytosis activity and immune organs indexes of Tilapia, Fujian J. Agric. Sci. 27 (2012) 27–31 [Chinese]. [20] H. LI, W.H. Song, X. Yu, L.J. Fu, F.X. Yao, Z.Y. Hu, T. Zhang, Effects of different immunopotentiators on serum SOD, CAT and AKP activities in grass carp (Ctenopharyngodon idellus), Chin. J. Fish. 23 (2010) 6–9. [21] G. Yin, L. Ardó, K. Thompson, A. Adams, Z. Jeney, G. Jeney, Chinese herbs (Astragalus radix and Ganoderma lucidum) enhance immune response of carp, Cyprinus carpio, and protection against Aeromonas hydrophila, Fish Shellfish Immunol. 26 (2009) 140–145. [22] H. Liu, Y. Zhang, Y. Yang, T. Lu, J. Ye, Effects of five Chinese herb medicines as additive in feed on the growth and intestinal microflora in common carp (Cyprinus carpio), J. Dalian Fish. Coll. 19 (2004) 16–20. [23] T. Citarasu, Herbal biomedicines: a new opportunity for aquaculture industry, Aquacult. Int. 18 (2010) 403–414. [24] L.L. Xie, J.H. Cao, S.X. Yang, C.Y. Zhao, L. Ren, The impact of dietary Chinese herbal medicines on growth performance and muscular composition in Juvenile Tilapia, Fish. Sci. 28 (2009) 11–14. [25] S.B. Bahrami, F.P. Heyrati, M. Akhlaghi, S. Dorafshan, The dietary wood betony, Stachys lavandulifolia Vahl extract as a growth promoter and immune enhancer in common carp (Cyprinus carpio), Iran. J. Vet. Res. 15 (2014) 359. [26] H. Elabd, H.P. Wang, A. Shaheen, H. Yao, A. Abbass, Astragalus membranaceus (AM) enhances growth performance and antioxidant stress profiles in bluegill sunfish (Lepomis macrochirus), Fish Physiol. Biochem. 42 (2016) 955–966. [27] K. Venkatramalingam, J.G. Christopher, T. Citarasu, Zingiber officinalis an herbal appetizer in the tiger shrimp Penaeus monodon (Fabricius) larviculture, Aquacult. Nutr. 13 (2007) 439–443. [28] T. Citarasu, K. Venkatramalingam, M.M. Babu, R.R.J. Sekar, M. Petermarian, Influence of the antibacterial herbs, Solanum trilobatum, Andrographis paniculata and Psoralea corylifolia on the survival, growth and bacterial load of Penaeus monodon post larvae, Aquacult. Int. 11 (2003) 581–595. [29] J.D. Simonato, C.L. Guedes, C.B. Martinez, Biochemical, physiological, and histological changes in the neotropical fish Prochilodus lineatus exposed to diesel oil, Ecotoxicol. Environ. Saf. 69 (2008) 112–120.
514
Contents lists available at ScienceDirect
Fish and Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
Effects of Lycium barbarum polysaccharides on immunological parameters, apoptosis, and growth performance of Nile tilapia (Oreochromis niloticus)
T
Xu Zhanga,b, Kai Huangb, Huan Zhonga, Yanqun Mab, Zhongbao Guoa, Zhanyang Tanga,b,∗, Junneng Lianga, Yongju Luoa,b,∗∗, Zhijian Sub, Liqun Wangb a b
Guangxi Academy of Fishery Science, Nanning, 530021, China College of Animal Science and Technology of Guangxi University, Nanning, 530005, China
A R T I C LE I N FO
A B S T R A C T
Keywords: LBP Nile tilapia Immunology Apoptosis Growth performance
In this study, the effect of Lycium barbarum polysaccharides (LBP) on immunological parameters, apoptosis, and growth performance of Nile tilapia (Oreochromis niloticus) was investigated. Dietary supplementation with LBP significantly increased complement 3 (C3) activity and promoted interleukin IL-1β gene expression in spleen tissue, significantly reduced apoptosis in spleen tissue, increased the specific growth rate (SGR), relative length gain (LG), and relative weight gain (WG) of Nile tilapia. However, dietary supplementation with LBP did not have a significant effect on serum alkaline phosphatase (AKP), malondialdehyde (MDA), and superoxide dismutase (SOD), blood constituents, apoptosis, or gene expression of IL-1β in liver tissue. Overall, the results showed that dietary supplementation with LBP increased the nonspecific immunity of Nile tilapia and reduced the apoptosis rate to promote growth and development. Thus, LBP has potential for use as a new immunostimulant in aquaculture.
1. Introduction
Studies focused of the use of Chinese herbal medicines to improve immunity and promote growth of aquatic animals are becoming more common. For example, Bhavan [10] and Zahran [1] reported that dietary supplementation with Alteranthera sessilis, Eclipta alba, Cissus quadrangularis, and Astragalus polysaccharides (APS) significantly increased the activity of digestive enzymes of the prawn Macrobrachium rosenbergii and Nile tilapia (Oreochromis niloticus). László et al. [8] and Mo et al. [11] found that Astragalus membranaceus and Lycium barbarum enhanced the nonspecific immunity of Nile tilapia and grass carp (Ctenopharyngodon idella). The boxthorn Lycium barbarum, which is the source of the goji berry, has properties that are promising for warding off disease. Lycium barbarum po1ysaccharides (LBP) are the main active immune component in this plant, and they play a critical role in activating T cells, promoting B cell maturation, removing free radicals to protect cells, and improving immunity [12–15]. LBP also has a significant effect on reducing blood sugar and blood lipids in mice [16]. Thus, the application of LBP as an immunostimulant for aquatic animals has great potential. The goal of this study was to analyze the effects of LBP on the growth and development, immunity, hematology, and apoptosis of Nile tilapia to explore the potential of this immunostimulant to promote healthy
Tilapia is an economically important group of fish that is farmed worldwide. Its cultivation is always accompanied by bacterial and viral infections, and large amounts of antibiotics and illegal drugs are used to try to combat the problem [1]. Mesalhy and Albutti [2] reported that the abuse of antibiotics resulted in drug resistance of microbes affecting tilapia and that it has indirect effects on human health. Thus, food safety has become a major issue that limits the development of aquatic products. Many studies of Chinese herbal medicines in animals have shown that these products can treat a variety of conditions, including peanut allergy [3], asthma [4], and irritable bowel syndrome [5]. The active ingredients of herbal medicines are mainly polysaccharides and flavonoids, which are closely related to animal immune function [6,7]. Therefore, their use might be a promising approach to dealing with disease in fish aquaculture. László et al. [8] noted that enhancing the fish immune system was the most promising method to prevent diseases. Moreover, Citarasu [9] found that Chinese herbal medicines such as Quillaja saponins and Withania somnifera have positive effects on fish growth, immunity, appetite, and stress responses. It is imperative to find natural products with no toxic side effects for use in aquaculture.
∗
Corresponding author. Guangxi Academy of Fishery Science, Nanning, 530021, China. Corresponding author. Guangxi Academy of Fishery Science, Nanning, 530021, China. E-mail addresses: [email protected] (Z. Tang), [email protected] (Y. Luo).
∗∗
https://doi.org/10.1016/j.fsi.2019.12.068 Received 1 November 2019; Received in revised form 18 December 2019; Accepted 21 December 2019 Available online 23 December 2019 1050-4648/ © 2019 Elsevier Ltd. All rights reserved.
Fish and Shellfish Immunology 97 (2020) 509–514
X. Zhang, et al.
and sustainable development of the tilapia industry.
2.5. Hematology test
2. Materials and methods
At the end of the experiment, three fingerlings were randomly selected from each test group and anesthetized with the MS-222. Blood from the tail vein was immediately collected on ice, and the collected blood samples were placed in 2 mL anticoagulation tubes and stored temporarily at 4 °C. Using the hematology test method developed by Zhang et al. [17], the number of white blood cells (WBC), red blood cell count (RBC), hemoglobin content (HGB), hematocrit (HCT), mean red blood cell volume (MCV), and mean red blood cell hemoglobin content (MCH) in the blood were measured using an automatic hematology analyzer (Mindray BC-2800vet, Shenzhen, China).
2.1. Fish Nile tilapia were obtained from the Guangxi Academy of Fishery Sciences (Guangxi, China). Healthy and vigorous fingerlings with uniform specifications were selected for use in the experiment and cultivated at 28 ± 0.5 °C, pH 8 for 1 week before the experiment. 2.2. LBP LBP with a purity of 50% UV was provided by Shanghai Yuanye Biotechnology Co., Ltd. (Shanghai, China). The samples were dark brown in color, had a powdery consistency, and easily absorbed moisture.
2.6. Serum biochemical analysis At the end of the experiment, six fingerlings were randomly selected from each group for blood collection using the method described above. The blood samples were placed in 2 mL centrifuge tubes at 4 °C for 24 h, then centrifuged at 4000 rpm for 10 min at 4 °C. The upper serum was collected for analysis. Testing kits were used to detect the activities and contents of lysozyme (LYS), alkaline phosphatase (AKP), malondialdehyde (MDA), superoxide dismutase (SOD), and complement 3 (C3) in serum. All kits used in this study were purchased from Jiangsu Zeyu Biotechnology Co., Ltd. (JiangSu, China), and the experiment was conducted according to the manufacturer's instructions. Instruments used in this experiment included: a microplate reader (Labsystems Multiskan MS 352, Finland), a plate washer (Thermo Labsystems AC8, Finland), a micro high-speed centrifuge (Xiangyi Group, TG16W, Hunan, China), and a water-jacket incubator (Jinghong, GNP-9080, Shanghai, China).
2.3. Feed and experimental design The experimental feed base was provided by Baiyang Industrial Investment Group Co., Ltd. (Guangxi, China). The raw materials were composed of corn, wheat bran, fish meal, soybean meal, rapeseed meal, calcium dihydrogen phosphate, sodium chloride, ferrous sulfate, copper sulfate, manganese sulfate, zinc sulfate, sodium selenite, vitamins (A, E, K3, B1, B2, B6, and C), niacin, folic acid, and inositol (Table 1). For the treatment groups, the feed base was supplemented with LBP at 500 mg/ kg (Group 2), 1000 mg/kg (Group 3), 1500 mg/kg (Group 4), and 2000 mg/kg (Group 5); 0 mg/kg (Group 1) served as the control. The feed was uniformly mixed and dried and stored at low temperature in a dry place. We used a control group and four test groups in the experiment. Each group was designed with three water tanks, there are 50 fingerlings in each water tank (150L). At beginning of the experiment, the 750 Nile tilapia (6.12 ± 2.75 g, 6.92 ± 0.49 cm) were randomly distributed into the 15 tanks (50 fish/tank). During the 40 d breeding experiment, the water temperature in each tank was maintained at 28 ± 0.5 °C, pH 8. The test water consisted of tap water that was exposed to the sun to remove the chlorine, and the water was changed every 3 d. Fingerlings were fed at 9:00 and 17:00 every day. During the cultivation period, all test fingerlings were in good condition with no death or illness.
2.7. Tissue apoptosis assay At the end of the experiment, three fingerlings were randomly selected from each test group and anesthetized with MS-222. The liver and spleen were collected and immersed in 4% paraformaldehyde universal tissue fixative (Saiguo Biotechnology Co., Ltd., Guangzhou, China) for embedding. Dewaxing, repairing, and rupturing were performed after 4 μm continuous routine sections were produced with a pathological slicer (Leica Instrument Co., Ltd., Shanghai, China). They then were treated with fluorescent dye according to the instructions for the TUNEL kit (Basel, Germany, Switzerland) and sealed with antifluorescence quenching mounting medium (Servicebio, Wuhan, China). The sections were ultimately observed under a fluorescence microscope (Nikon Eclipse C1, Tokyo, Japan), and the images were collected for the tissue apoptosis analysis. For the tissue apoptosis analysis, photographs were randomly taken of each section under a ×200 field. The background light of each photograph was consistent to ensure that the tissue filled the entire field. Image-Pro Plus 6.0 software (Media Cybernetics Inc., Rockville, MD, USA) was used to select the green fluorescent cell nuclei with the same label as the unified standard for judging photo positive cells. Cell nuclei of all cells were stained with the blue DAPI label. In each photograph, the number of positive cells and the total number of cells were counted. The percentage of positive cells [(Number of positive cells/ Number of total cells) ×100] was calculated as the apoptosis rate (%).
2.4. Growth parameters At the beginning and end of the experiment, the weight and full length of the fingerlings were measured, and the relative weight gain (WG), relative length gain (LG), feed conversion ratio (FCR), and specific growth rate (SGR) were calculated as follows: SGR = (ln W2 – ln W1)/t × 100%; WG = (W2 – W1)/W1 × 100%; FCR = W3/(W2 – W1); LG = (L2 – L1)/L1 × 100%; where W1 is the original weight (g), W2 is the final weight (g), W3 is the feed consumption, L1 is the original length (cm), L2 is the final length (cm), and t is the breeding time (d). Table 1 Nutrients of the basic feed. Nutrition indicators
Protein
Lipid
Ash
Fiber
Moisture
Lysine
Calcium
Total phosphorus
Sodium chloride
Content (%)
≥30.0
≥3.0
≤13.0
≤10.0
≤12.0
≥1.4
0.5-2.5
0.6-2.0
0.3-1.5
510
Fish and Shellfish Immunology 97 (2020) 509–514
X. Zhang, et al.
3.2. Hematology test
Table 2 Primers used in real time PCR. Primer
Sequence (5′-3′)
Annealing temperature (°C)
gapdh-S gapdh-A IL-1β-S IL-1β-A
AACTCCCTCAAGGTTGTCAGCA GTCTTCTGGGTGGCAGTGATG CTCAGTTCACCAGCAGGGATG GACTGTTTTTATCCGTCACCTCC
60 60 60 60
Table 4 shows the results of the hematology test. As LBP content increased in the diet, the WBC, MCV, and MCH in the blood of Nile tilapia increased first and then decreased. Group 2 had the highest WBC and MCV values at 188.77 109/L and 143.17 fl, and Group 3 had the highest MCH content at 107.3 pg, but it did not differ significantly from that of the control group (P > 0.05). RBC, HGB, and HCT decreased with increasing dietary content of LBP, but the values were not significantly different from those of the control group (P > 0.05).
2.8. Immune-related gene expression analysis At the end of the experiment, the liver and spleen from three fingerlings in each group were collected using same method as described above and temporarily stored at −80 °C. Total RNA from liver and spleen tissues was extracted using TRIzol reagent (Servicebio, Wuhan, China). An ultra-micro UV spectrophotometer (Thermo NanoDrop 2000, Waltham, MA, USA) was used to determine RNA purity and concentration. First strand cDNA was then synthesized using a cDNA synthesis kit (Thermo, USA) and stored at −20 °C. The NCBI database was used to search for the gene sequence for use in primer design. The primers were all provided by Saiwei Biotechnology Co., Ltd. (Wuhan, China) (Table 2). The PCR reaction was conducted on a real-time PCR instrument (ABI Stepone plus, USA) using SYBR Green as the fluorescent dye and the housekeeping gene GAPDH, which is expressed at a high level in each tissue, as the internal reference gene. The reaction system (25 μL) included cDNA (2.5 μL), gene primer (2.0 μL) (primer concentration of 7.5 μM/L), ddH2O (8.0 μl), and SYBR Mix (12.5 μL). The reaction procedure was as follows: pre-denaturation at 95 °C for 10 min, 95 °C for 15 s, 60 °C for 60 s, and 40 cycles. The final gene expression amount was analyzed by 2–ΔΔCT [18].
3.3. Serum biochemical analysis Fig. 1 shows the serum biochemical indicators of the fingerlings. Group 3 had the highest C3 activity, and it was significantly different from that of the control group (P < 0.05). LYS activity was significantly lower in Groups 3 and 4 compared to the control (P < 0.05), but no significant difference was observed in the other groups (P > 0.05). SOD activity was highest in Group 4, but it did not differ significantly from that of the control group (P > 0.05). The content of MDA increased with the increase of LBP content in the diet, which was the highest in Group 5, but there was no significant difference between the control group (P > 0.05). AKP activity peaked in Group 4 but did not differ significantly from that of the control group (P > 0.05). 3.4. Tissue apoptosis assay Fig. 2 shows the results of the tissue apoptosis assay. As LBP content increased in the diet, the apoptosis rate in spleen tissue decreased and reached the lowest value in Group 3; the value was significantly lower than that of the control group (P < 0.05). The apoptosis rate of liver tissue decreased first to the lowest value in Group 3 and then increased to the highest value in Group 5. However, the values did not differ significantly from that of the control group (P > 0.05).
2.9. Data analysis SPSS 17.0 software was used to conduct one-way analysis of variance and multiple comparison (Duncan's test) to analyze the data. P < 0.05 was considered to be statistically significant.
3.5. Immune-related gene expression analysis Fig. 3 shows the gene expression of interleukin IL-1β in liver and spleen tissues of Nile tilapia. Expression of IL-1β in spleen tissues increased in all test groups after LBP was added. Group 2 had the highest value, which was significantly different from that of the control group (P < 0.05). Expression of IL-1β in the liver of decreased first and then increased as the LBP content in the diet increased. It was highest in Group 5 but was not significantly different from that of the control (P > 0.05).
3. Results 3.1. Growth parameters As LBP content increased in the diet from 0 (Group 1) to 2000 mg/ kg (Group 5), final length, final weight, WG, LG, and SGR increased first and then decreased. These parameters reached the maximum values in Group 4, respectively at 12.80 cm, 44.76 g, 623.20%, 83.03%, and 4.97%/d; they were significantly different from values in the control group (P < 0.05). FCR first decreased and then increased, reaching a minimum of 2.08 in Group 4, which was significantly different from the control group (P < 0.05). Table 3 lists the growth parameters of Nile tilapia in this study.
4. Discussion Chinese herbal medicines can promote the growth and development of organisms by improving the phagocytic ability of white blood cells [19] and enhancing nonspecific immunity [20,21]. They also can affect digestive enzyme activity and the number of microorganisms in the
Table 3 Growth parameters of Nile tilapia fed with different LBP levels for 40 days (n = 15). Values (mean ± S.E.) in the same line with different superscript letters significantly differ from each other (P < 0.05). Parameters Initial length (cm) Final lenght (cm) Initial weight (g) Final weight (g) WG (%) LG (%) SGR (%/d) FCR (g/g)
0 mg/kg
500 mg/kg a
6.92 ± 0.49 11.89 ± 0.29a 6.12 ± 2.75a 34.78 ± 2.34a 468.22 ± 38.27a 71.80 ± 4.15a 4.34 ± 0.17a 2.80 ± 0.23a
1000 mg/kg a
1500 mg/kg a
6.92 ± 0.49 12.02 ± 0.36a 6.12 ± 2.75a 35.70 ± 4.50a 447.72.07 ± 81.41a 70.66 ± 5.04a 4.40 ± 0.33a 2.75 ± 0.45 ab
6.92 ± 0.49 12.22 ± 0.48 ab 6.12 ± 2.75a 37.90 ± 6.05 ab 547.79 ± 64.21 80.02 ± 1.49b 4.54 ± 0.40 ab 2.58 ± 0.49 abc
511
2000 mg/kg a
ab
6.92 ± 0.49 12.80 ± 0.25b 6.12 ± 2.75a 44.76 ± 2.31b 623.20 ± 42.79b 83.03 ± 3.79b 4.97 ± 0.13b 2.08 ± 0.12c
6.92 ± 0.49a 12.54 ± 0.35 ab 6.12 ± 2.75a 44.13 ± 4.58b 607.31 ± 60.07b 80.04 ± 3.74b 4.89 ± 0.27b 2.13 ± 0.27 bc
Fish and Shellfish Immunology 97 (2020) 509–514
X. Zhang, et al.
Table 4 Blood parameters of Nile tilapia raised at different LBP levels for 40 days (n = 3) Values (mean ± S.E.) in the same line with different superscript letters significantly differ from each other (P < 0.05). Project
0 mg/kg
500 mg/kg
1000 mg/kg
1500 mg/kg
2000 mg/kg
WBC (109/L) RBC (1012/L) HGB (g/l) HCT (%) MCV (fl) MCH (pg)
168.47 ± 12.12a 1.10 ± 0.38a 104.33 ± 7.09a 15.23 ± 1.25a 139.87 ± 13.34a 95.17 ± 7.41a
188.77 ± 1.59a 1.06 ± 0.10a 103.67 ± 8.96a 15.23 ± 3.31a 143.17 ± 16.74a 98.6 ± 15.11a
170.47 ± 24.41a 0.96 ± 0.15a 101.67 ± 14.67a 13.43 ± 1.82a 141.47 ± 22.37a 107.3 ± 21.53a
169.1 ± 34.33a 1.00 ± 0.22a 97.33 ± 16.56a 16.27 ± 4.90a 142.53 ± 20.89a 87.97 ± 19.07a
149.8 ± 19.90a 1.02 ± 0.31a 85.33 ± 22.03a 13.53 ± 5.06a 133.23 ± 28.59a 86.77 ± 28.91a
Fig. 1. Serum biochemical parameters of Nile tilapia raised at different LBP levels for 40 days (n = 6). A: C3, B: LYS, C: AKP, D: MDA, E: SOD. Group values (mean ± S.E.) with different superscript letters significantly differ from each other (P < 0.05).
capacity of blood and the number of RBCs [31,32]. WBCs are an important component of non-specific immunity, and their presence in the blood determines the resistance of fish to pathogen infection and stress [33]. In this study, the WBC was highest amount in Group 2, but the value was not significantly different from that of the control. This result is inconsistent with that of Hassaan et al. [34], who reported significant difference in the blood parameters between the test groups and the control. However, We guess that the effect of LBP was slow, and the short time period of the experiment may not have been long enough for a significant difference to be detected. Antioxidant enzymes effectively protect cells from the damage caused by reactive oxygen species [35]. SOD is an important antioxidant enzyme in the animal body because it scavenges free radicals, and its activity is positively correlated with the body's antioxidant capacity [1,36]. MDA is an oxidative metabolite of cells, and its content is
body [22] to promote digestion to stimulate growth and development of the organism. Citarasu reported that Chinese herbal medicines can be used as an appetite stimulant to affect animal growth [23]. In the current study, adding LBP to the feed promoted growth and development of Nile tilapia. Interestingly, similar findings have been found in other herbal studies of tilapia [24], carp [25], sunfish (Lepomis macrochirus) [26], and shrimps [27,28]. The results showed that LBP can also promote the growth and development of tilapia as an appetite stimulant. as has been shown for APS, Lonicera japonica, and other Chinese herbal medicines. Blood is an important component of the immune system, and its components are susceptible to different factors. Thus, changes in blood parameters can be used to determine the physiological health of fish [29,30]. RBCs transport oxygen, whereas HGB binds to oxygen in the RBCs. HCT affects the blood viscosity to influence the oxygen transport
Fig. 2. Apoptosis in spleen (A) and liver (B) of Nile tilapia at different LBP levels for 40 days (n = 3). Group values (mean ± S.E.) with different superscript letters significantly differ from each other (P < 0.05). 512
Fish and Shellfish Immunology 97 (2020) 509–514
X. Zhang, et al.
Fig. 3. The expression levels of Il-1β in spleen (A) and liver (B) of Nile tilapia at different LBP levels for 40 days (n = 3). Group values (mean ± S.E.) with different superscript letters significantly differ from each other (P < 0.05).
herbal medicines can induce expression of the IL-1β gene in animal immune tissues. For example, Selvaraj et al. [55] injected yeast dextran into the carp (Cyprinus carpio) for 7 days and found that IL-1 mRNA expression increased in the fish kidney. In the current study, gene expression of IL-1β in the spleen tissues of all test groups increased after adding LBP. Group 2 had the highest value, which was significantly higher than that of the control. These results are consistent with the findings of Tang et al. [56], who reported that a Chinese herbal mixture composed of angelica, astragalus, hawthorn, licorice root, and honeysuckle can improve the mRNA expression of IL-1β in the tilapia head, kidney, and spleen. However, no significant difference in gene expression of IL1β was detected in liver tissue. We concluded that LBP promoted the expression of the IL-1β gene in the spleen by activating tilapia macrophages, thus improving the non-specific immunity of tilapia. In conclusion, LBP played an important role in promoting the growth and immunity of Nile tilapia. Furthermore, LBP could be used as a feed additive for tilapia. Based on our findings, the application of LBP has great significance for reducing food safety risk and promoting the sustainable development of Nile tilapia aquaculture.
negatively correlated with the number of cells attacked by free radicals in the body. AKP is an important nonspecific phosphohydrolase and part of the detoxification system, and it is associated with the digestion and absorption of nutrients [37,38]. In the current study, dietary supplementation with LBP had no significant effect on SOD and AKP activities and MDA content of Nile tilapia. However, LBP has been shown to have significant antioxidant function in other species. For example, Tan et al. [39] found that LBP improved the antioxidant capacity of the pompano Trachinotus ovatus, and Bai et al. [40] reported that LBP significantly improved the antioxidant capacity of the minnow Tanichthys albonubes. Our differing results may be due to differences in the absorption and metabolism of LBP in the different species, which would have different biological effects. LYS is a nonspecific immune defense factor in the fish immune system that is extremely important in the fight against pathogenic microorganisms [41,42]. In this study, the activity of LYS was lowest in Group 4 and significantly lower than that of the control. The complement system also is an important component of the non-specific immunity of organisms. C3 has biological functions such as bacteriolysis and immune regulation [43]. In the current study, C3 activity was highest in Group 3, and it differed significantly from that of the control. Similar results were reported for the fish species Pelteobagrus fulvidraco [44], Scophthalmus maxima [45], and Squaliobarbus curriculus [46]. Zhang [47] and Chen et al. [48] proposed that LBP can enhance the function of T cells, B cells, and macrophages, and Su et al. [49] found that LBP can enhance humoral immunity by activating follicular helper T cells. Thus, LBP may activate the immune system of Nile tilapia to promote the production of C3. In summary, the proper amount of dietary LBP can promote the non-specific immunity of tilapia to resist invasion by viruses and bacteria. As the largest peripheral lymph organ in the body, the spleen is the main site for the immune response and plays a critical role in maintaining the normal immune function of the animal body. In this study, the apoptosis rate of spleen tissue was significantly reduced in Group 3, whereas C3 activity was highest in this group; this may be because C3's bacteriostatic, immunomodulatory, and immune complex functions protected the spleen of the fish [43,49]. In addition, it has been reported that LBP can also inhibit apoptosis of zebrafish and mice cells through the p53 signaling pathway and promote development of the spleen. [50,51]. The liver is the major organ for metabolism and secretion in the body, and its health affects the normal life activities of fish. In this study, LBP did not have a significant effect on liver tissue apoptosis. Therefore, the results indicated that LBP enhanced the nonspecific immunity of tilapia by protecting the spleen tissue of tilapia. IL-1β is a classic proinflammatory cytokine secreted by macrophages after T cell and macrophage activation. It stimulates Th17 cell differentiation and the production of the related factors and enhances the cell-mediated immune response and immunity [52–54]. Many studies have shown that immunostimulants such as vaccines and Chinese
Author contributions Xu Zhang participated in the literature search, study design, data collection, data analysis, data interpretation, and wrote the manuscript. Zhanyang Tang and Yongju Luo participated in the study design and provided the critical revision. Kai Huang, Huan Zhong, Yanqun Ma, Zhongbao Guo, Junneng Liang, Zhijian Su, and Liqun Wang carried out the data collection and analysis. All authors read and approved the final manuscript. Declaration of competing interest We declare that we have no conflict of interest. Acknowledgement This work was supported by the Guangxi Science and Technology Research Program (AA17204094-2), China Agriculture Research System (CARS-46), National Natural Science Foundation of China (31560716), National Key Research and Development Program of China (2018YFD0900601), National Natural Science Foundation of China (31960733), Natural Science Foundation of Guangxi (2018GXNSFAA138128), and Natural Science Foundation of Guangxi (2016GXNSFFA380002). References [1] Z. Eman, R. Engy, A. Fatma, M. Hebata Allah, I. Tarek, Effects of dietary Astragalus polysaccharides (APS) on growth performance, immunological parameters, digestive enzymes, and intestinal morphology of Nile tilapia (Oreochromis niloticus),
513
Fish and Shellfish Immunology 97 (2020) 509–514
X. Zhang, et al.
[30] P.D. Marco, A. Priori, M. Finoia, A. Massari, A. Mandich, G. Marino, Physiological responses of European sea bass Dicentrarchus labrax to different stocking densities and acute stress challenge, Aquaculture 275 (2008) 319–328. [31] J.W. Bao, J. Qiang, Y.F. Tao, H.X. Li, J. He, P. Xu, D.J. Chen, Responses of blood biochemistry, fatty acid composition and expression of microRNAs to heat stress in genetically improved farmed tilapia (Oreochromis niloticus), J. Therm. Biol. 73 (2018) 91–97. [32] R. Wells, G. Grigg, L. Beard, G. Summers, Hypoxic responses in a fish from a stable environment: blood oxygen transport in the Antarctic fish Pagothenia borchgrevinki, J. Exp. Biol. 141 (1989) 97–111. [33] A. Ellis, The leucocytes of fish: a review, J. Fish Biol. 11 (1977) 453–491. [34] M. Hassaan, M. Soltan, M. Ghonemy, Effect of synbiotics between Bacillus licheniformis and yeast extract on growth, hematological and biochemical indices of the Nile tilapia (Oreochromis niloticus), Egypt. J. Aquat. Res. 40 (2014) 199–208. [35] I. Messaoudi, S. Barhoumi, K. Saïd, A. Kerken, Study on the sensitivity to cadmium of marine fish Salaria basilisca (Pisces: Blennidae), J. Environ. Sci. 21 (2009) 1620–1624. [36] G.W. Winston, Oxidants and antioxidants in aquatic animals, Comp. Biochem. Physiol. C Comp. Pharmacol. 100 (1991) 173–176. [37] R.Q. Zhang, Q.X. Chen, W.Z. Zheng, J.Y. Lin, Z.L. Zhuang, H.M. Zhou, Inhibition kinetics of green crab (Scylla serrata) alkaline phosphatase activity by dithiothreitol or 2-mercaptoethanol, Int. J. Biochem. Cell Biol. 32 (2000) 865–872. [38] R. Molina, I. Moreno, S. Pichardo, A. Jos, R. Moyano, J.G. Monterde, Acid and alkaline phosphatase activities and pathological changes induced in Tilapia fish (Oreochromis sp.) exposed subchronically to microcystins from toxic cyanobacterial blooms under laboratory conditions, Toxicon 46 (2005) 725–735. [39] L.J. Tan, H.Z. Lin, Z. Huang, C.P. Zhou, P.W. Xun, Q.Q. Huang, W.F. Yu, X.L. Huang, W. YuJ, Effects of lycium barbarum polysaccharide on growth performance, antioxidant capacity, serum immune and biochemical indexes of Juvenile golden pompano (Trachinotus ovatus), Chin. J. Anim. Nutr. 31 (2019) 429–438 [Chinese]. [40] D.Q. Bai, X. Wu, Y.H. LiJ, The effects of Lycium bararum polysaccharides and Ganoderima luaidum polysaccharides on the antioxidant abilities and nonspecific immunity on white cloud mountain fish, China Feed 1 (2011) 30–32 [Chinese]. [41] M. Dunier, A.K. Siwicki, A. Demaël, Effects of organophosphorus insecticides: effects of trichlorfon and dichlorvos on the immune response of carp (Cyprinus carpio): III. In Vitro effects on lymphocyte proliferation and phagocytosis and in Vivo effects on humoral response, Ecotoxicol. Environ. Saf. 22 (1991) 79–87. [42] J.A. Simser, K.R. Macaluso, A. Mulenga, A.F. Azad, Immune-responsive lysozymes from hemocytes of the American dog tick, Dermacentor variabilis and an embryonic cell line of the Rocky Mountain wood tick, D. andersoni, Insect Biochem. Mol. Biol. 34 (2004) 1235–1246. [43] D. Ndong, Y.Y. Chen, Y.H. Lin, B. Vaseeharan, J.C. Chen, The immune response of tilapia Oreochromis mossambicus and its susceptibility to Streptococcus iniae under stress in low and high temperatures, Fish Shellfish Immunol. 22 (2007) 686–694. [44] M. Qu, C. Huang, B.L. Zhang, Z.Y. Cheng, D.Q. Bai, L.Y. Jia, S.L. Zhai, Effects of compound Chinese traditional drug on the growth performance, muscle quality and complement C3, complement C4 content in serum of Pelteobagrus fulvidraco, China Feed 615 (2018) 77–82 [Chinese]. [45] H. Li, T.E. Zhang, Q. Li, Influence of compound Chinese herbal medicine on nonspecific immunity of turbot Scophthalmus maximus, J. Dalian Ocean Univ. 28 (2013) 115–120 [Chinese]. [46] G.F. Li, Y.C. Kang, J.J. Sun, J.G. He, The effects of yeast glucan on the Squaliobarbus curriculus non-specific immune response, Acta Sci. Nat. Univ. Sunyatseni 42 (2003) 55–58 [Chinese]. [47] X. Zhang, Y. Li, J. Cheng, G. Liu, C. Qi, W. Zhou, Y. Zhang, Immune activities comparison of polysaccharide and polysaccharide-protein complex from Lycium barbarum L, Int. J. Biol. Macromol. 65 (2014) 441–445. [48] Z. Chen, B.K.H. Tan, S.H.J.I.I. Chan, Activation of T lymphocytes by polysaccharide–protein complex from Lycium barbarum L, Int. Immunopharmacol. 8 (2008) 1663–1671. [49] C.X. Su, X.G. Duan, L.J. Liang, J. Zheng, X.Y. Fu, Y.M. Yan, N.P. Wang, Immunopathology, Lycium barbarum polysaccharides as an adjuvant for recombinant vaccine through enhancement of humoral immunity by activating Tfh cells, Vet. Immunol. Immunopathol. 158 (2014) 98–104. [50] G. Xia, N. Xin, W. Liu, H. Yao, Y. Hou, J. Qi, Inhibitory effect of Lycium barbarum polysaccharides on cell apoptosis and senescence is potentially mediated by the p53 signaling pathway, Mol. Med. Rep. 9 (2014) 1237–1241. [51] W.L. Hao, Z.B. Chen, R. Zhao, L. Bo, Effect of Lycium barbarum polysaccharide on immune function and anti-fatigue of sub-healthy mice, Chin. J. Biol. 28 (2015) 693–697. [52] B.J. Kullberg, J.W.V.D. Meer, Cytokines in the Treatment of Infectious Diseases: Options for the Modulation of Host Defense, Springer Science & Business Media, 1995. [53] A.R. Mridha, A. Wree, A.A. Robertson, M.M. Yeh, C.D. Johnson, D.M. Van Rooyen, F. Haczeyni, N.C. Teoh, C. Savard, G.N. Ioannou, S.L. Masters, K. Schroder, M.A. Cooper, A.E. Feldstein, G.C. Farrell, NLRP3 inflammasome blockade reduces liver inflammation and fibrosis in experimental NASH in mice, J. Hepatol. 66 (2017) 1037–1046. [54] J.L. Ather, K. Ckless, R. Martin, K.L. Foley, B.T. Suratt, J.E. Boyson, K.A. Fitzgerald, R.A. Flavell, S.C. Eisenbarth, M.E. Poynter, Serum amyloid A activates the NLRP3 inflammasome and promotes Th17 allergic asthma in mice, J. Immunol. 187 (2011) 64–73. [55] V. Selvaraj, K. Sampath, V. Sekar, Administration of yeast glucan enhances survival and some non-specific and specific immune parameters in carp (Cyprinus carpio) infected with Aeromonas hydrophila[J], Fish Shellfish Immunol. 19 (4) (2005) 0306. [56] J. Tang, J. Cai, R. Liu, J. Wang, Y. Lu, Z. Wu, J. Jian, Immunostimulatory effects of artificial feed supplemented with a Chinese herbal mixture on Oreochromis niloticus against Aeromonas hydrophila, Fish Shellfish Immunol. 39 (2014) 401–406.
Fish Shellfish Immunol. 38 (2014) 149–157. [2] S. Mesalhy, A. Albutti, Antimicrobials use in aquaculture and their public health impact, J. Aquac. Res. Dev. 5 (2014). [3] K.D. Srivastava, J.D. Kattan, Z.M. Zou, J.H. Li, L. Zhang, S. Wallenstein, J. Goldfarb, H.A. Sampson, X.M. li, The Chinese herbal medicine formula FAHF-2 completely blocks anaphylactic reactions in a murine model of peanut allergy, J. Allergy Clin. Immunol. 115 (2005) 171–178. [4] X.M. Li, C.K. Huang, T.F. Zhang, A.A. Teper, K. Srivastava, B.H. Schofield, H.A. Sampson, The Chinese herbal medicine formula MSSM-002 suppresses allergic airway hyperreactivity and modulates TH1/TH2 responses in a murine model of allergic asthma, J. Allergy Clin. Immunol. 106 (2000) 660–668. [5] A. Bensoussan, N.J. Talley, M. Hing, R. Menzies, A. Guo, M. Ngu, Treatment of irritable bowel syndrome with Chinese herbal medicine: a randomized controlled trial, Jama 280 (1998) 1585. [6] B.K. Tan, J. Vanitha, Immunomodulatory and antimicrobial effects of some traditional Chinese medicinal herbs: a review, Curr. Med. Chem. 11 (2004) 1423–1430. [7] T. Gengyuan, F. Yucheng, Study and application of polysaccharide immunoregulators, Prog. Chem. 2 (1994). [8] L. Ardó, G. Yin, P. Xu, L. Váradi, G. Szigeti, Z. Jeney, G. Jeney, Chinese herbs (Astragalus membranaceus and Lonicera japonica) and boron enhance the nonspecific immune response of Nile tilapia (Oreochromis niloticus) and resistance against Aeromonas hydrophila, Aquaculture 275 (2008) 26–33. [9] T. Citarasu, Herbal biomedicines: a new opportunity for aquaculture industry, Aquacult. Int. 18 (2010) 403–414. [10] S. Radhakrishnan, P.S. Bhavan, C. Seenivasan, R. Shanthi, R. Poongodi, Influence of medicinal herbs (Alteranthera sessilis , Eclipta alba and Cissus quadrangularis) on growth and biochemical parameters of the freshwater prawn Macrobrachium rosenbergii, Aquacult. Int. 22 (2014) 551–572. [11] W.Y. Mo, C.H.I. Lun, W.M. Choi, Y.B. Man, M. Wong, Enhancing growth and nonspecific immunity of grass carp and Nile tilapia by incorporating Chinese herbs (Astragalus membranaceus and Lycium barbarum) into food waste based pellets, Environ. Pollut. 219 (2016) 475–482. [12] C.X. Su, X.G. Duan, L.J. Liang, J. Zheng, X.Y. Fu, Y.M. Yan, Ling Huang, N.P. Wang, Immunopathology, Lycium barbarum polysaccharides as an adjuvant for recombinant vaccine through enhancement of humoral immunity by activating Tfh cells, Vet. Immunol. Immunopathol. 158 (2014) 98–104. [13] Z. Chen, B.K.H. Tan, S.H. Chan, Activation of T lymphocytes by polysaccharide–protein complex from Lycium barbarum L, Int. Immunopharmacol. 8 (2008) 1663–1671. [14] X. Manyan, Z. Hongfeng, W. Yufei, The protective effects of lychan barbarian polysaccharide on alloxan-induced isolated islet cells damage in rats, J. Chin. Med. Mater. 25 (2002) 649–651. [15] L. Zhang, J. Gu, Y. Chen, A study on four antioxidation effects of lycium barbarum polysaccharides in vitro, Afr. J. Tradit., Complementary Altern. Med. 10 (2013) 494–498. [16] L. Jing, L. Yin, Antihyperglycemic activity of polysaccharide from Lycium barbarum, J. Med. Plants Res. 4 (2010) 23–26. [17] Q.Q. Zhang, T.Q. Liu, T.T. Li, J. Xu, M. Long, X.H. Wang, X.N. Gong, A.H. Li, The effects of jade screen power on the non-specific immune response and the expression of the related genes in fish, Acta Hydrobiol. Sin. 39 (2015) 1076–1084 [Chinese]. [18] M.A.A. Norag, A.M. El-Shenawy, S.E. Fadl, W.S. Abdo, D.M. Gad, M.A. Rashed, A.M. Prince, Effect of phytase enzyme on growth performance, serum biochemical alteration, immune response and gene expression in nile tilapia, Fish Shellfish Immunol. 80 (2018) 97–108. [19] X. Lin, W.N. Zhang, S.K. Wang, W.Y. Huang, J.M. Chen, J. Zhao, Influence of Astragalus polysaccharides on leukocyte phagocytosis activity and immune organs indexes of Tilapia, Fujian J. Agric. Sci. 27 (2012) 27–31 [Chinese]. [20] H. LI, W.H. Song, X. Yu, L.J. Fu, F.X. Yao, Z.Y. Hu, T. Zhang, Effects of different immunopotentiators on serum SOD, CAT and AKP activities in grass carp (Ctenopharyngodon idellus), Chin. J. Fish. 23 (2010) 6–9. [21] G. Yin, L. Ardó, K. Thompson, A. Adams, Z. Jeney, G. Jeney, Chinese herbs (Astragalus radix and Ganoderma lucidum) enhance immune response of carp, Cyprinus carpio, and protection against Aeromonas hydrophila, Fish Shellfish Immunol. 26 (2009) 140–145. [22] H. Liu, Y. Zhang, Y. Yang, T. Lu, J. Ye, Effects of five Chinese herb medicines as additive in feed on the growth and intestinal microflora in common carp (Cyprinus carpio), J. Dalian Fish. Coll. 19 (2004) 16–20. [23] T. Citarasu, Herbal biomedicines: a new opportunity for aquaculture industry, Aquacult. Int. 18 (2010) 403–414. [24] L.L. Xie, J.H. Cao, S.X. Yang, C.Y. Zhao, L. Ren, The impact of dietary Chinese herbal medicines on growth performance and muscular composition in Juvenile Tilapia, Fish. Sci. 28 (2009) 11–14. [25] S.B. Bahrami, F.P. Heyrati, M. Akhlaghi, S. Dorafshan, The dietary wood betony, Stachys lavandulifolia Vahl extract as a growth promoter and immune enhancer in common carp (Cyprinus carpio), Iran. J. Vet. Res. 15 (2014) 359. [26] H. Elabd, H.P. Wang, A. Shaheen, H. Yao, A. Abbass, Astragalus membranaceus (AM) enhances growth performance and antioxidant stress profiles in bluegill sunfish (Lepomis macrochirus), Fish Physiol. Biochem. 42 (2016) 955–966. [27] K. Venkatramalingam, J.G. Christopher, T. Citarasu, Zingiber officinalis an herbal appetizer in the tiger shrimp Penaeus monodon (Fabricius) larviculture, Aquacult. Nutr. 13 (2007) 439–443. [28] T. Citarasu, K. Venkatramalingam, M.M. Babu, R.R.J. Sekar, M. Petermarian, Influence of the antibacterial herbs, Solanum trilobatum, Andrographis paniculata and Psoralea corylifolia on the survival, growth and bacterial load of Penaeus monodon post larvae, Aquacult. Int. 11 (2003) 581–595. [29] J.D. Simonato, C.L. Guedes, C.B. Martinez, Biochemical, physiological, and histological changes in the neotropical fish Prochilodus lineatus exposed to diesel oil, Ecotoxicol. Environ. Saf. 69 (2008) 112–120.
514