- Email: [email protected]
Effects of neural stem cell media on hypoxic injury in rat hippocampal slice cultures
Brain Research 1677 (2017) 20–25
Contents lists available at ScienceDirect
Brain Research journal homepage: www.elsevier.com/locate/bres
Research report
Effects of neural stem cell media on hypoxic injury in rat hippocampal slice cultures Na Mi Lee a, Soo Ahn Chae a,⇑, Hong Jun Lee b a b
Department of Pediatrics, Chung-Ang University Hospital, College of Medicine, Chung-Ang University, 102 Heukseok-ro, Dongjak-gu, Seoul, Republic of Korea Biomedical Research Institute, Chung-Ang University Hospital, Seoul, Republic of Korea
a r t i c l e
i n f o
Article history: Received 20 June 2017 Received in revised form 10 September 2017 Accepted 14 September 2017 Available online 21 September 2017 Keywords: Hippocampus Hypoxia Brain Neural stem cells
a b s t r a c t Neonatal hypoxic-ischemic brain injuries cause serious neurological sequelae, yet there is currently no effective treatment for them. We hypothesized that neurotrophic factors released into the medium by stem cells could supply hypoxia-damaged organotypic hippocampal slice cultures with regenerative abilities. We prepared organotypic slice cultures of the hippocampus of 7-day-old Sprague-Dawley rats based on the modified Stoppini method; slices were cultured for 14 days in vitro using either Gahwiler’s medium (G-medium) or stem cell-conditioned medium (S-medium) as culture medium. At day 14 in vitro, hippocampal slice cultures were exposed to 95% N2 and 5% CO2 for 3 h to induce hypoxic damage, the extent of which was then measured using propidium iodide fluorescence and immunohistochemistry images. We performed dot blotting to estimate neurotrophic/growth factor levels in the G- and Smedia. Organotypic hippocampal slices cultured using S-medium after hypoxic injury were significantly less damaged than those cultured using G-medium. GLUT1, NGF, GDNF, VEGF, GCSF, and IGF2 levels were higher in S-medium than in G-medium, whereas FGF1, HIF, and MCP3 levels were not significantly different between media. In conclusion, we found that stem cell-conditioned medium had a neuroprotective effect against hypoxic injury, and that, of the various neurotrophic factors in S-medium, NGF, GDNF, and VEGF can contribute to neuroprotection. Ó 2017 Elsevier B.V. All rights reserved.
1. Introduction In neonates, hypoxic-ischemic brain injury is one of the most common causes of death (Berger and Garnier, 1999) or severe morbidity, with neurodevelopmental sequelae occurring in 30–40% of cases of moderate brain injury, and in more than 90% of cases of severe brain injury (Vannucci and Hagberg, 2004). Although several studies have focused on developing neuroprotective agents and therapies, treatment of hypoxic-ischemic encephalopathy is still mainly supportive. Recently, therapeutic hypothermia has demonstrated a neuroprotective effect in hypoxic--ischemic brain
Abbreviations: GLUT1, glucose transporter 1; FGF1, fibroblast growth factor 1; NT3, neurotrophin 3; NT4, neurotrophin 4; HIF, hypoxia inducible factor; NGF, nerve growth factor; GDNF, glial cell-derived neurotrophic factor; VEGF, vascular endothelial growth factor; MCP3, monocyte chemotactic protein 3; GCSF, granulocyte colony-stimulating factor; IGF1, insulin-like growth factor 1; IGF2, insulinlike growth factor 2. ⇑ Corresponding author at: Department of Pediatrics, Chung-Ang University Hospital, College of Medicine, Chung-Ang University, 102 Heukseok-ro, Dongjak-gu, Seoul 06973, Republic of Korea. E-mail address: [email protected] (S.A. Chae). https://doi.org/10.1016/j.brainres.2017.09.018 0006-8993/Ó 2017 Elsevier B.V. All rights reserved.
injury, and is now applied clinically, in limited situations (Giesinger et al., 2017). Research analyzing the ability of stem cells to regenerate tissue after injury has included neuronal tissue. Stem cell therapy is currently in the limelight as a new therapy in brain/nervous system injury, despite a lack of validated applications or transplantation methods (van Velthoven et al., 2010). Neural stem cells (NSCs) are self-renewing cells that can proliferate and differentiate into neurons, astrocytes, and oligodendrocytes; they may play a role in restoring neuronal function (Jin-qiao et al., 2009). NSCs have a certain degree of plasticity, giving rise to endothelial cells that can potentially form capillary networks (Pimentel-Coelho and Mendez-Otero 2010). Most studies in which NSCs were transplanted into a hypoxic-ischemic brain reported a good potential for migration and differentiation. In one study analyzing hypoxicischemic rat brains in vivo, NSCs migrated preferentially to the area of injury, and some expressed neuronal markers 14–21 days after transplantation. These results indicate that the environment of the hypoxic-ischemic brain can support NSC migration and neuronal differentiation (Zheng et al., 2006). However, there are a number of problems remaining to be solved for NSC transplanta-
N.M. Lee et al. / Brain Research 1677 (2017) 20–25
tion in clinical setting, such as, among others, further brain injury caused by the invasive transplantation procedure, a low survival rate of donor NSCs, limited cell migration, and the risk of tumorigenesis. To better determine the applicability of NSCs as a therapy for hypoxic-ischemic brain damage, we assessed hypoxic damage in cultured organotypic hippocampal rat brain slices. We also utilized two different growth media, one with and one without stem cell conditioning, to determine which (if any) neurotrophic or growth factors were present that could mediate the therapeutic abilities of NSCs. 2. Results We induced hypoxic injury in cultured hippocampal tissue slices while using Gahwiler’s medium and stem cell-conditioned medium for 14 days. We captured fluorescent images using propidium iodide (PI) and after exposure to NMDA, and compared the injured areas. We divided the tissue slices into four groups: tissues cultured using Gahwiler’s medium (G control), hypoxic
Fig. 1. Location of CA1 (Cornu Ammonis 1), CA3 (Cornu Ammonis 3), DG (Dentate Gyrus) in the cultured slices (scale bar: 200 lm).
21
damage tissues cultured using Gahwiler’s medium (G hypoxia), tissues cultured using stem cell-conditioned medium (S control), hypoxic damage tissues cultured using stem cell-conditioned medium (S hypoxia). At day 14 in vitro, the S control group was less damaged than the G control group, and the S hypoxia group was less damaged than the G hypoxia group (Fig. 2). As presented in Fig. 3, we also quantified the injured area according to the CA1, CA3 and DG subregions. In the CA1 region, the G control and S control groups were not significantly different from each other (p = 0.095), but in the hypoxia groups, with the S group ratio (ratio: see method section, 4.4 Image analysis) being significantly smaller than the G group ratio (p < 0.05). While the G hypoxia group ratio was higher (i.e., showing more hypoxic damage) than the G control group, but not significant (p = 0.166), the S hypoxia and S control groups were not significantly different from each other (p = 1.0). The S hypoxia group was significantly less damaged than the G hypoxia group (p < 0.05). In the CA3 subregion, the G hypoxia group ratio was not significantly higher than that of the G control group (p = 0.462), and the S hypoxia and S control groups were not significantly different from each other (p = 0.983). There were significant differences between the G hypoxia and the S hypoxia groups (p < 0.05) with the S group being significantly less damaged than its corresponding G group. In the DG, there were significant differences between the G control and the S control groups (p < 0.05); however, the G hypoxia group was not significantly different from the G control group (p = 1.0), nor was the S hypoxia group significantly different from the S control group (p = 0.788) (Fig. 3). Neurons were immunostained with mixed neurofilament (NFmix). The expression of NF-mix was increased in the S hypoxia group, compared to the G hypoxia group, suggesting a neuroprotective effect of secreted factors in the S-medium (Fig. 4). Gene expression of neurotrophic factors/growth factors in F3 (human) NSCs was studied using RT-PCR. The results demonstrated that F3 NSCs can express the NGF, BDNF, NT-3, GDNF, CNTF, bFGF, and VEGF gene products (Fig. 5). To examine neuroprotective
Fig. 2. Images of hippocampal slices at 14 days in vitro (scale bar: 400 lm): G control, Gahwiler’s medium before hypoxic injury; G hypoxia, Gahwiler’s medium after hypoxic injury; S control, stem cell-conditioned medium before hypoxic injury; S hypoxia, stem cell-conditioned medium after hypoxic injury.
22
N.M. Lee et al. / Brain Research 1677 (2017) 20–25
Fig. 3. Comparison of the extent of hypoxia: NMDA-injured area ratios in slices cultured with Gahwiler’s medium (G) and S-medium (S) (*p < 0.05). Abbreviations: CA1, Cornu Ammonis 1; CA3, Cornu Ammonis 3; DG, Dentate Gyrus.
effects of the S-medium from human neural stem cells, the secretion of neurotrophic factors/growth factors into conditioned medium were examined by dot blotting. GLUT1, FGF1, GDNF, VEGF, GCSF, MCP3, and IGF2 levels significantly increased (a two fold increase) in the S-medium compared to the G-medium. NT-4 and NGF levels increased slightly, while NT3 and IGF1 levels decreased in the S-medium (Fig. 6). 3. Discussion Neurotrophic factors are proteins that support the survival, development, and differentiation of neuronal cells in both the central and peripheral nervous systems. They also play roles in axonal guidance, dendritic growth, synaptic plasticity and secretion of
neurotransmitters. Recently, the focus has been on data indicating that neurotrophic factors affect neuronal activity related to adult neurogenesis, pain, and aggression as well as behavior expression and neurodegenerative diseases such as Alzheimer’s disease and Parkinson’s disease (Skaper, 2012). We studied the potential of stem cell-conditioned media, rather than the direct effects of stem cell injection, in protecting against hypoxic-ischemic injury in organotypic hippocampal slices. We found that in all tested regions, the hippocampus was less damaged after being grown in the conditioned medium than after being grown in Gahwiler’s medium. We found that stem cells could express (and thus potentially secrete) a variety of neurotrophic and growth factors, and that in conditioned medium, GLUT1, NGF, GDNF, VEGF, GCSF and IGF2 levels were significantly higher than in unconditioned (G) medium. The evidence thus suggests NGF, GDNF, and VEGF are neuroprotective against hypoxic injury. Most neurotrophic factors belong to the following three families: 1) neurotrophins, 2) glial- cell line derived neurotrophic factor family ligands, and 3) neuropoietic cytokines. The neurotrophin family contains NGF, GDNF, NT3, and NT4 (Barde, 1994). These neurotrophins are multifunctional, and are important regulators of neuronal development, proliferation, differentiation, and maturation in the central and peripheral nervous systems. Among the various neurotrophic factors, NGF, BDNF, GDNF, NT3, and NT4 seem to play crucial roles in hypoxic-ischemic brain injury. For example, Claudia et al. reported that NGF administration was effective in helping to prevent neuronal loss and brain damage, and could be a safe adjunct therapy, in neonates with severe hypoxicischemic brain injury (Fantacci et al., 2013). GDNF, a protein belonging to the transforming growth factor-b (TGF-b) superfamily, is a specific trophic factor and neuroprotective agent for dopaminergic neurons. Wang et al. reported that GDNF had neuroprotective effects that were mediated through the upregulation of GDNF receptor alpha-1/nitric oxide synthase activity during the very early stages of ischemia (Wang et al., 2002). Finally, a further study noted that combined NT3 and neural stem cell transplantation was more effective in supporting learning and memory, as well as limb function, than transplantation of neural stem cells alone, in hypoxic-ischemic rats. (Wang et al., 2007) Galvin et al. reported that continuous, low-dose, intracerebral treatment with BDNF and NT3 increased the total number of surviving medium spiny neurons in hypoxic-ischemic rats (Galvin and Oorschot, 2003). Essential to the coordination of both neurogenesis and angiogenesis is the regulation of cell survival, cell proliferation, polarity, differentiation, and migration. VEGF is especially important in forebrain neurodevelopment and neural stem cell differentiation in the early stages. There are five VEGFs (VEGF-A, -B, -C, -D, PIGF) and three receptors (VEGFR-1 (Flt-1), VEGFR-2 (Flk-1/KDR), VEGFR-3 (Flt-4)) (Sun et al., 2004), and VEGF-A is the most wellknown effector acting on both angio- and neurogenesis (Cain et al., 2014). VEGF-A has been shown to be increasingly expressed after focal cerebral ischemia in the rat (Gu et al., 2001). VEGF-B was expressed most abundantly in the heart, skeletal muscles, the pancreas, and the brain, and promoted angiogenesis after surgically induced hindlimb ischemia in mice (Silvestre et al., 2003; Sun et al., 2004). The roles of the other VEGF family members and receptors in cerebral ischemia may help identify new therapeutic targets in stroke. Basic fibroblast growth factor (BFGF) belongs to the family of polypeptide growth factors that are involved in embryonic development and adult tissue homeostasis (Jin-qiao et al., 2009). Jin-qiao et al. studied the role of BFGF on the proliferation and differentiation of neural stem cells in neonatal rats after ischemic brain injury. Treatment with BFGF not only increased proliferation of neural stem cells, but also stimulated these cells to differentiate
N.M. Lee et al. / Brain Research 1677 (2017) 20–25
23
Fig. 4. Immunohistochemistry using mixed neurofilament (NF-mix) in the Gahwiler’s media (G) hypoxia and stem cell-conditioned media (S) hypoxia groups (scale bar: 50 lm).
Fig. 5. Gene expression of neurotrophic factors/growth factors and cellular receptors inhuman neural stem cells studied using RT-PCR.
into neurons, astrocytes, and oligodendrocytes after ischemic injury. These data suggest that bFGF helps to repair neonatal ischemic brain injury in neonatal rats (Jin-qiao et al., 2009). We emphasized that the microenvironment surrounding the hippocampus in the hypoxic-damaged slices was important in this study. We believe that the mechanism underlying the environment’s neuroprotective effects involves the secretion of NGF, GDNF, and VEGF; a hypothesis that, is in close agreement with the findings of numerous other authors. We did not detect changed neurological activities to hypoxia injury in the hippocampus. We have to show the physiology, regeneration and plasticity of CNS in human young brain using transcriptome analysis (Buga et al., 2012, 2014).
4. Experimental procedure 4.1. Organotypic slice culture Organotypic slice cultures of the hippocampus were prepared from a total of 12 seven-day-old Sprague Dawley rats (DooYeol Biotech, Seoul, Republic of Korea) using the Stoppini method (Stoppini et al., 1991) with slight modifications. The rats were stabilized for 24 h prior to the experiment and decapitated using scissors. The heads were sterilized with 70% alcohol, and the hippocampi were quickly removed and placed in ice-cold Gey’s Balanced Salt Solution (GBSS, Sigma Aldrich, USA). The hippocampi were sliced (450 lm thick) with a manual tissue slicer (Stoelting
24
N.M. Lee et al. / Brain Research 1677 (2017) 20–25
Fig. 6. Dot blotting analysis for secreted neurotrophic factors in G- and S-media. (A) Dot blotting images of neurotrophic factors/growth factors from the media. (B) Quantitative graph for secreted neurotrophic factors. The relative secretion levels of neuroprotective factors in the S-medium were adjusted by comparison to the G-medium.
Co, USA). Millicell culture inserts (Millipore, Ireland, five slices per insert) were placed into 6-well plates (SPL, Republic of Korea) with 1 mL of culture medium(Gahwiler, 1981) per well. The slices were cultured with 5% CO2 atmosphere at 37 °C in a humidified incubator (MCO175, Sanyo, Japan). The media were half-changed with fresh medium twice per week for 14 days, and all procedures were performed aseptically in a horizontal flow hood.
damage groups were exposed to 95% N2 and 5% CO2 for 3 h in an incubator on day 14 in vitro. 4.4. Image analysis
We used Gahwiler’s medium (Gahwiler, 1981) for six plates (G1-6) and stem cell-conditioned medium (S1-6) for the other six plates. Gahwiler’s medium consists of 25% Hank’s Balanced Salt Solution (HBSS, GibcoBRL/Life Technologies, USA), 25% heatinactivated horse serum (Hyclone, Logan, UT, USA), 50% Basal Medium Eagle (BME, GibcoBRL/Life Technologies, USA), 6.5 mg/ mL glucose, and 200 mM glutamax-I (GibcoBRL/Life Technologies, USA). Stem cell-conditioned medium was collected after culturing HB1.F3 human neural stem cells (Lee et al., 2007) in Gahwiler’s medium for 48 h.
Fluorescent images of the slices were captured under an inverted microscope (IX 71, Olympus, Japan) after induction of hypoxia. The slices were exposed to 2 mM NMDA in serum-free medium for 30 min at 37 °C with 5% CO2 in a humidified incubator. The slices were then cultured with 1 mL of serum-free medium with 1 lg propidium iodide (PI, Sigma), and fluorescent images were collected. The images were analyzed with Image J (version 1.47c, National Institutes of Health, USA). We calculated the amount of fluorescent area above a previously-defined threshold, and a single researcher measured the individual areas of the CA1 (Cornu Ammonis 1), CA3 (Cornu Ammonis 3), and DG (dentate gyrus) regions (Fig. 1). After NMDA treatment, the PI fluorescence was assumed to include the total area of the hippocampal tissue. We estimated the extent of damage by calculating the ratio (%) of the hypoxia-damaged area to the NMDA damaged area (total) after the NMDA exposure (Fig. 3).
4.3. Induction of hypoxia
4.5. CLARITY method
Plates were divided into control (G1, G4, S1, S4) and hypoxic damage (G2, G3, G5, G6, S2, S3, S5, S6) groups. Plates in the hypoxic
Cultured brain sections were fixed with 4% paraformaldehyde. After washing with PBS, slices were embedded in hydrogel (Logos
4.2. Culture media (Gahwiler’s medium vs. stem cell conditioned medium)
Table 1 Sequence of PCR primers. Gene
Forward
Reverse
Size (bp)
NGF BDNF NT3 GDNF CNTF HGF IGF-1 bFGF VEGF GAPDH
TCATCATCCCATCCCATCTTCCAC ATGACCATCCTTTTCCTTACT ATGTCCATCTTGTTTTATGTGA ATGAAGTTATGGGATGTCGT ATGGCTTTCACAGAGCATT AGGAGAAGGCTACAGGGGCAC AAATCAGCAGTCTTCCAACCCA GGGTGGAGATGTAGAAGATG GAAGTGGTGAAGTTCATGGATGTC CATGACCACAGTCCATGCCATCACT
CACAGCCTTCCTGCTGAGCACAC CTATCTTCCCCTTTTAATGGT TCATGTTCTTCCGATTTTTC TTAGCGGAATGCTTTCTTAG AACTGCTACATTTTCTTGTTGTT TTTTTGCCATTCCCACGATAA CTTCTGGGTCTTGGGCATGT TTTATACTGCCCAGTTCGTT CGATCGTTCTGTATCAGTCTTTCC TGAGGTCCACCACCCTGTTGCTGTA
351 744 774 636 610 267 402 787 546 451
N.M. Lee et al. / Brain Research 1677 (2017) 20–25
Biosystems, Gyeonggi-do, Republic of Korea) for 24 h at 4 °C, and then polymerized for 3 h in a 37 °C incubator. They were then clarified in an electrophoretic tissue-clearing chamber (Logos Biosystems) for 3 h under a 1.5-A current, and finally washed with phosphate-buffered saline (PBS).
25
Funding This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors. References
4.6. Immunohistochemistry Cleared tissues were incubated with mixed neurofilament (NFmix) antibodies overnight (Millipore, MA, USA, 1:200 dilution, NFL, -M and -H) after incubation in blocking solution (10% normal goat serum, Gibco, CA, USA). They were labeled with Alexa Fluor 488-conjugated secondary antibodies (Molecular Probes, OR, USA) for 1 h at room temperature. Slices were incubated in XCLARITY mounting solution (Logos Biosystems) overnight at 4 °C and observed under a confocal microscope (Zeiss LSM 710, Zeiss, Oberkochen, Germany). 4.7. RT-PCR Total RNA was isolated from HB1.F3 cells using a miRNA Isolation Kit (QIAGEN, Hilden, Germany). First, 1 lg of total RNA was reverse-transcribed into cDNA using oligo-dT primers. Reverse transcription was performed with TOPscript RT DryMIX (Enzynomics, Daejeon, Republic of Korea) for 1 h at 42 °C, followed by an inactivation step for 5 min at 95 °C, and finally cooling down to 4 °C. The cDNA was amplified using 30 PCR cycles, products were then separated on 1.5% agarose gels and visualized under UV light. The primers used for the RT-PCR are listed in Table 1. 4.8. Dot blotting G medium and S medium samples were absorbed by applying negative pressure to a nitrocellulose membrane soaked with tris-buffered saline (150 mM NaCl, 20 mM Tris-HCl, pH 7.5, TBS). The nitrocellulose membrane was fixed with TBST including 5% non-fat milk and 0.02% TweenTM 20 for 30 min. We incubated with primary antibodies (1:200 dilution in TBST: GLUT1, Glucose transporter 1; FGF1, Fibroblast Growth Factor 1; NT3, Neurotrophin 3; NT4, Neurotrophin 4; NGF, Nerve Growth Factor; GDNF, Glial cell-derived neurotrophic factor; VEGF, Vascular Endothelial Growth Factor; MCP3, Monocyte Chemotactic Protein 3; GCSF, Granulocyte Colony-stimulating Factor; IGF1, Insulin-like Growth Factor 1; IGF2, Insulin-like Growth Factor 2; HIF, Hypoxia inducible factor, Santa Cruz, USA) at 4 °C for 24 h. We washed four times with TBST. We incubated with the appropriate secondary antibody (1:500 dilution for TBST, anti-rabbit, mouse, goat antibody conjugated with horseradish peroxidase (HRP) for 1 h, and washed four more times with TBST. Blot images were obtained with DavinchchemiTM (Davinch-K, Seoul, Republic of Korea) visualizer and the intensity of dots was measured using image J software. 4.9. Statistical analysis We evaluated brain injury using one-way ANOVA test and post hoc test. Differences were considered significant when p < 0.05. All analyses were performed using SPSS 18.0. Conflicts of interest The authors have no conflicts of interest of disclose.
Barde, Y.A., 1994. Neurotrophins: a family of proteins supporting the survival of neurons. Prog. Clin. Biol. Res. 390, 45–56. Berger, R., Garnier, Y., 1999. Pathophysiology of perinatal brain damage. Brain Res. Brain Res. Rev. 30 (2), 107–134. Buga, A.M., Scholz, C.J., Kumar, S., Herndon, J.G., Alexandru, D., Cojocaru, G.R., Dandekar, T., Popa-Wagner, A., 2012. Identification of new therapeutic targets by genome-wide analysis of gene expression in the ipsilateral cortex of aged rats after stroke. PLoS One 7 (12), e50985. Buga, A.M., Margaritescu, C., Scholz, C.J., Radu, E., Zelenak, C., Popa-Wagner, A., 2014. Transcriptomics of post-stroke angiogenesis in the aged brain. Front. Aging Neurosci. 6, 44. Cain, J.T., Berosik, M.A., Snyder, S.D., Crawford, N.F., Nour, S.I., Schaubhut, G.J., Darland, D.C., 2014. Shifts in the vascular endothelial growth factor isoforms result in transcriptome changes correlated with early neural stem cell proliferation and differentiation in mouse forebrain. Dev. Neurobiol. 74 (1), 63–81. Fantacci, C., Capozzi, D., Ferrara, P., Chiaretti, A., 2013. Neuroprotective role of nerve growth factor in hypoxic-ischemic brain injury. Brain Sci. 3 (3), 1013–1022. Gahwiler, B.H., 1981. Organotypic monolayer cultures of nervous tissue. J. Neurosci. Methods 4 (4), 329–342. Galvin, K.A., Oorschot, D.E., 2003. Continuous low-dose treatment with brainderived neurotrophic factor or neurotrophin-3 protects striatal medium spiny neurons from mild neonatal hypoxia/ischemia: a stereological study. Neuroscience 118 (4), 1023–1032. Giesinger, R.E., Bailey, L.J., Deshpande, P., McNamara, P.J., 2017. Hypoxic-ischemic encephalopathy and therapeutic hypothermia: the hemodynamic perspective. J. Pediatr. 180 (22–30), e22. Gu, W., Brannstrom, T., Jiang, W., Bergh, A., Wester, P., 2001. Vascular endothelial growth factor-A and -C protein up-regulation and early angiogenesis in a rat photothrombotic ring stroke model with spontaneous reperfusion. Acta Neuropathol. 102 (3), 216–226. Jin-qiao, S., Bin, S., Wen-hao, Z., Yi, Y., 2009. Basic fibroblast growth factor stimulates the proliferation and differentiation of neural stem cells in neonatal rats after ischemic brain injury. Brain Dev. 31 (5), 331–340. Lee, H.J., Kim, K.S., Kim, E.J., Choi, H.B., Lee, K.H., Park, I.H., Ko, Y., Jeong, S.W., Kim, S. U., 2007. Brain transplantation of immortalized human neural stem cells promotes functional recovery in mouse intracerebral hemorrhage stroke model. Stem Cells 25, 1204–1212. Pimentel-Coelho, P.M., Mendez-Otero, R., 2010. Cell therapy for neonatal hypoxicischemic encephalopathy. Stem Cells Dev. 19 (3), 299–310. Silvestre, J.S., Tamarat, R., Ebrahimian, T.G., Le-Roux, A., Clergue, M., Emmanuel, F., Duriez, M., Schwartz, B., Branellec, D., Levy, B.I., 2003. Vascular endothelial growth factor-B promotes in vivo angiogenesis. Circ. Res. 93 (2), 114–123. Skaper, S.D., 2012. The neurotrophin family of neurotrophic factors: an overview. Methods Mol. Biol. 846, 1–12. Stoppini, L., Buchs, P.A., Muller, D., 1991. A simple method for organotypic cultures of nervous tissue. J. Neurosci. Methods 37 (2), 173–182. Sun, Y., Jin, K., Childs, J.T., Xie, L., Mao, X.O., Greenberg, D.A., 2004. Increased severity of cerebral ischemic injury in vascular endothelial growth factor-B-deficient mice. J. Cereb. Blood Flow Metab. 24 (10), 1146–1152. van Velthoven, C.T., Kavelaars, A., van Bel, F., Heijnen, C.J., 2010. Mesenchymal stem cell treatment after neonatal hypoxic-ischemic brain injury improves behavioral outcome and induces neuronal and oligodendrocyte regeneration. Brain Behav. Immun. 24 (3), 387–393. Vannucci, S.J., Hagberg, H., 2004. Hypoxia-ischemia in the immature brain. J. Exp. Biol. 207 (Pt 18), 3149–3154. Wang, L.M., Wang, H.Y., Yang, Z.J., Zhu, X.F., Yuan, D.X., 2007. Combined transplantation of neurotrophin-3 and neural stem cells in treatment of hypoxic-ischemic brain injury in rats. Zhonghua Er Ke Za Zhi 45 (3), 212–216. Wang, Y., Chang, C.F., Morales, M., Chiang, Y.H., Hoffer, J., 2002. Protective effects of glial cell line-derived neurotrophic factor in ischemic brain injury. Ann. N. Y. Acad. Sci. 962, 423–437. Zheng, T., Rossignol, C., Leibovici, A., Anderson, K.J., Steindler, D.A., Weiss, M.D., 2006. Transplantation of multipotent astrocytic stem cells into a rat model of neonatal hypoxic-ischemic encephalopathy. Brain Res. 1112 (1), 99–105.
Contents lists available at ScienceDirect
Brain Research journal homepage: www.elsevier.com/locate/bres
Research report
Effects of neural stem cell media on hypoxic injury in rat hippocampal slice cultures Na Mi Lee a, Soo Ahn Chae a,⇑, Hong Jun Lee b a b
Department of Pediatrics, Chung-Ang University Hospital, College of Medicine, Chung-Ang University, 102 Heukseok-ro, Dongjak-gu, Seoul, Republic of Korea Biomedical Research Institute, Chung-Ang University Hospital, Seoul, Republic of Korea
a r t i c l e
i n f o
Article history: Received 20 June 2017 Received in revised form 10 September 2017 Accepted 14 September 2017 Available online 21 September 2017 Keywords: Hippocampus Hypoxia Brain Neural stem cells
a b s t r a c t Neonatal hypoxic-ischemic brain injuries cause serious neurological sequelae, yet there is currently no effective treatment for them. We hypothesized that neurotrophic factors released into the medium by stem cells could supply hypoxia-damaged organotypic hippocampal slice cultures with regenerative abilities. We prepared organotypic slice cultures of the hippocampus of 7-day-old Sprague-Dawley rats based on the modified Stoppini method; slices were cultured for 14 days in vitro using either Gahwiler’s medium (G-medium) or stem cell-conditioned medium (S-medium) as culture medium. At day 14 in vitro, hippocampal slice cultures were exposed to 95% N2 and 5% CO2 for 3 h to induce hypoxic damage, the extent of which was then measured using propidium iodide fluorescence and immunohistochemistry images. We performed dot blotting to estimate neurotrophic/growth factor levels in the G- and Smedia. Organotypic hippocampal slices cultured using S-medium after hypoxic injury were significantly less damaged than those cultured using G-medium. GLUT1, NGF, GDNF, VEGF, GCSF, and IGF2 levels were higher in S-medium than in G-medium, whereas FGF1, HIF, and MCP3 levels were not significantly different between media. In conclusion, we found that stem cell-conditioned medium had a neuroprotective effect against hypoxic injury, and that, of the various neurotrophic factors in S-medium, NGF, GDNF, and VEGF can contribute to neuroprotection. Ó 2017 Elsevier B.V. All rights reserved.
1. Introduction In neonates, hypoxic-ischemic brain injury is one of the most common causes of death (Berger and Garnier, 1999) or severe morbidity, with neurodevelopmental sequelae occurring in 30–40% of cases of moderate brain injury, and in more than 90% of cases of severe brain injury (Vannucci and Hagberg, 2004). Although several studies have focused on developing neuroprotective agents and therapies, treatment of hypoxic-ischemic encephalopathy is still mainly supportive. Recently, therapeutic hypothermia has demonstrated a neuroprotective effect in hypoxic--ischemic brain
Abbreviations: GLUT1, glucose transporter 1; FGF1, fibroblast growth factor 1; NT3, neurotrophin 3; NT4, neurotrophin 4; HIF, hypoxia inducible factor; NGF, nerve growth factor; GDNF, glial cell-derived neurotrophic factor; VEGF, vascular endothelial growth factor; MCP3, monocyte chemotactic protein 3; GCSF, granulocyte colony-stimulating factor; IGF1, insulin-like growth factor 1; IGF2, insulinlike growth factor 2. ⇑ Corresponding author at: Department of Pediatrics, Chung-Ang University Hospital, College of Medicine, Chung-Ang University, 102 Heukseok-ro, Dongjak-gu, Seoul 06973, Republic of Korea. E-mail address: [email protected] (S.A. Chae). https://doi.org/10.1016/j.brainres.2017.09.018 0006-8993/Ó 2017 Elsevier B.V. All rights reserved.
injury, and is now applied clinically, in limited situations (Giesinger et al., 2017). Research analyzing the ability of stem cells to regenerate tissue after injury has included neuronal tissue. Stem cell therapy is currently in the limelight as a new therapy in brain/nervous system injury, despite a lack of validated applications or transplantation methods (van Velthoven et al., 2010). Neural stem cells (NSCs) are self-renewing cells that can proliferate and differentiate into neurons, astrocytes, and oligodendrocytes; they may play a role in restoring neuronal function (Jin-qiao et al., 2009). NSCs have a certain degree of plasticity, giving rise to endothelial cells that can potentially form capillary networks (Pimentel-Coelho and Mendez-Otero 2010). Most studies in which NSCs were transplanted into a hypoxic-ischemic brain reported a good potential for migration and differentiation. In one study analyzing hypoxicischemic rat brains in vivo, NSCs migrated preferentially to the area of injury, and some expressed neuronal markers 14–21 days after transplantation. These results indicate that the environment of the hypoxic-ischemic brain can support NSC migration and neuronal differentiation (Zheng et al., 2006). However, there are a number of problems remaining to be solved for NSC transplanta-
N.M. Lee et al. / Brain Research 1677 (2017) 20–25
tion in clinical setting, such as, among others, further brain injury caused by the invasive transplantation procedure, a low survival rate of donor NSCs, limited cell migration, and the risk of tumorigenesis. To better determine the applicability of NSCs as a therapy for hypoxic-ischemic brain damage, we assessed hypoxic damage in cultured organotypic hippocampal rat brain slices. We also utilized two different growth media, one with and one without stem cell conditioning, to determine which (if any) neurotrophic or growth factors were present that could mediate the therapeutic abilities of NSCs. 2. Results We induced hypoxic injury in cultured hippocampal tissue slices while using Gahwiler’s medium and stem cell-conditioned medium for 14 days. We captured fluorescent images using propidium iodide (PI) and after exposure to NMDA, and compared the injured areas. We divided the tissue slices into four groups: tissues cultured using Gahwiler’s medium (G control), hypoxic
Fig. 1. Location of CA1 (Cornu Ammonis 1), CA3 (Cornu Ammonis 3), DG (Dentate Gyrus) in the cultured slices (scale bar: 200 lm).
21
damage tissues cultured using Gahwiler’s medium (G hypoxia), tissues cultured using stem cell-conditioned medium (S control), hypoxic damage tissues cultured using stem cell-conditioned medium (S hypoxia). At day 14 in vitro, the S control group was less damaged than the G control group, and the S hypoxia group was less damaged than the G hypoxia group (Fig. 2). As presented in Fig. 3, we also quantified the injured area according to the CA1, CA3 and DG subregions. In the CA1 region, the G control and S control groups were not significantly different from each other (p = 0.095), but in the hypoxia groups, with the S group ratio (ratio: see method section, 4.4 Image analysis) being significantly smaller than the G group ratio (p < 0.05). While the G hypoxia group ratio was higher (i.e., showing more hypoxic damage) than the G control group, but not significant (p = 0.166), the S hypoxia and S control groups were not significantly different from each other (p = 1.0). The S hypoxia group was significantly less damaged than the G hypoxia group (p < 0.05). In the CA3 subregion, the G hypoxia group ratio was not significantly higher than that of the G control group (p = 0.462), and the S hypoxia and S control groups were not significantly different from each other (p = 0.983). There were significant differences between the G hypoxia and the S hypoxia groups (p < 0.05) with the S group being significantly less damaged than its corresponding G group. In the DG, there were significant differences between the G control and the S control groups (p < 0.05); however, the G hypoxia group was not significantly different from the G control group (p = 1.0), nor was the S hypoxia group significantly different from the S control group (p = 0.788) (Fig. 3). Neurons were immunostained with mixed neurofilament (NFmix). The expression of NF-mix was increased in the S hypoxia group, compared to the G hypoxia group, suggesting a neuroprotective effect of secreted factors in the S-medium (Fig. 4). Gene expression of neurotrophic factors/growth factors in F3 (human) NSCs was studied using RT-PCR. The results demonstrated that F3 NSCs can express the NGF, BDNF, NT-3, GDNF, CNTF, bFGF, and VEGF gene products (Fig. 5). To examine neuroprotective
Fig. 2. Images of hippocampal slices at 14 days in vitro (scale bar: 400 lm): G control, Gahwiler’s medium before hypoxic injury; G hypoxia, Gahwiler’s medium after hypoxic injury; S control, stem cell-conditioned medium before hypoxic injury; S hypoxia, stem cell-conditioned medium after hypoxic injury.
22
N.M. Lee et al. / Brain Research 1677 (2017) 20–25
Fig. 3. Comparison of the extent of hypoxia: NMDA-injured area ratios in slices cultured with Gahwiler’s medium (G) and S-medium (S) (*p < 0.05). Abbreviations: CA1, Cornu Ammonis 1; CA3, Cornu Ammonis 3; DG, Dentate Gyrus.
effects of the S-medium from human neural stem cells, the secretion of neurotrophic factors/growth factors into conditioned medium were examined by dot blotting. GLUT1, FGF1, GDNF, VEGF, GCSF, MCP3, and IGF2 levels significantly increased (a two fold increase) in the S-medium compared to the G-medium. NT-4 and NGF levels increased slightly, while NT3 and IGF1 levels decreased in the S-medium (Fig. 6). 3. Discussion Neurotrophic factors are proteins that support the survival, development, and differentiation of neuronal cells in both the central and peripheral nervous systems. They also play roles in axonal guidance, dendritic growth, synaptic plasticity and secretion of
neurotransmitters. Recently, the focus has been on data indicating that neurotrophic factors affect neuronal activity related to adult neurogenesis, pain, and aggression as well as behavior expression and neurodegenerative diseases such as Alzheimer’s disease and Parkinson’s disease (Skaper, 2012). We studied the potential of stem cell-conditioned media, rather than the direct effects of stem cell injection, in protecting against hypoxic-ischemic injury in organotypic hippocampal slices. We found that in all tested regions, the hippocampus was less damaged after being grown in the conditioned medium than after being grown in Gahwiler’s medium. We found that stem cells could express (and thus potentially secrete) a variety of neurotrophic and growth factors, and that in conditioned medium, GLUT1, NGF, GDNF, VEGF, GCSF and IGF2 levels were significantly higher than in unconditioned (G) medium. The evidence thus suggests NGF, GDNF, and VEGF are neuroprotective against hypoxic injury. Most neurotrophic factors belong to the following three families: 1) neurotrophins, 2) glial- cell line derived neurotrophic factor family ligands, and 3) neuropoietic cytokines. The neurotrophin family contains NGF, GDNF, NT3, and NT4 (Barde, 1994). These neurotrophins are multifunctional, and are important regulators of neuronal development, proliferation, differentiation, and maturation in the central and peripheral nervous systems. Among the various neurotrophic factors, NGF, BDNF, GDNF, NT3, and NT4 seem to play crucial roles in hypoxic-ischemic brain injury. For example, Claudia et al. reported that NGF administration was effective in helping to prevent neuronal loss and brain damage, and could be a safe adjunct therapy, in neonates with severe hypoxicischemic brain injury (Fantacci et al., 2013). GDNF, a protein belonging to the transforming growth factor-b (TGF-b) superfamily, is a specific trophic factor and neuroprotective agent for dopaminergic neurons. Wang et al. reported that GDNF had neuroprotective effects that were mediated through the upregulation of GDNF receptor alpha-1/nitric oxide synthase activity during the very early stages of ischemia (Wang et al., 2002). Finally, a further study noted that combined NT3 and neural stem cell transplantation was more effective in supporting learning and memory, as well as limb function, than transplantation of neural stem cells alone, in hypoxic-ischemic rats. (Wang et al., 2007) Galvin et al. reported that continuous, low-dose, intracerebral treatment with BDNF and NT3 increased the total number of surviving medium spiny neurons in hypoxic-ischemic rats (Galvin and Oorschot, 2003). Essential to the coordination of both neurogenesis and angiogenesis is the regulation of cell survival, cell proliferation, polarity, differentiation, and migration. VEGF is especially important in forebrain neurodevelopment and neural stem cell differentiation in the early stages. There are five VEGFs (VEGF-A, -B, -C, -D, PIGF) and three receptors (VEGFR-1 (Flt-1), VEGFR-2 (Flk-1/KDR), VEGFR-3 (Flt-4)) (Sun et al., 2004), and VEGF-A is the most wellknown effector acting on both angio- and neurogenesis (Cain et al., 2014). VEGF-A has been shown to be increasingly expressed after focal cerebral ischemia in the rat (Gu et al., 2001). VEGF-B was expressed most abundantly in the heart, skeletal muscles, the pancreas, and the brain, and promoted angiogenesis after surgically induced hindlimb ischemia in mice (Silvestre et al., 2003; Sun et al., 2004). The roles of the other VEGF family members and receptors in cerebral ischemia may help identify new therapeutic targets in stroke. Basic fibroblast growth factor (BFGF) belongs to the family of polypeptide growth factors that are involved in embryonic development and adult tissue homeostasis (Jin-qiao et al., 2009). Jin-qiao et al. studied the role of BFGF on the proliferation and differentiation of neural stem cells in neonatal rats after ischemic brain injury. Treatment with BFGF not only increased proliferation of neural stem cells, but also stimulated these cells to differentiate
N.M. Lee et al. / Brain Research 1677 (2017) 20–25
23
Fig. 4. Immunohistochemistry using mixed neurofilament (NF-mix) in the Gahwiler’s media (G) hypoxia and stem cell-conditioned media (S) hypoxia groups (scale bar: 50 lm).
Fig. 5. Gene expression of neurotrophic factors/growth factors and cellular receptors inhuman neural stem cells studied using RT-PCR.
into neurons, astrocytes, and oligodendrocytes after ischemic injury. These data suggest that bFGF helps to repair neonatal ischemic brain injury in neonatal rats (Jin-qiao et al., 2009). We emphasized that the microenvironment surrounding the hippocampus in the hypoxic-damaged slices was important in this study. We believe that the mechanism underlying the environment’s neuroprotective effects involves the secretion of NGF, GDNF, and VEGF; a hypothesis that, is in close agreement with the findings of numerous other authors. We did not detect changed neurological activities to hypoxia injury in the hippocampus. We have to show the physiology, regeneration and plasticity of CNS in human young brain using transcriptome analysis (Buga et al., 2012, 2014).
4. Experimental procedure 4.1. Organotypic slice culture Organotypic slice cultures of the hippocampus were prepared from a total of 12 seven-day-old Sprague Dawley rats (DooYeol Biotech, Seoul, Republic of Korea) using the Stoppini method (Stoppini et al., 1991) with slight modifications. The rats were stabilized for 24 h prior to the experiment and decapitated using scissors. The heads were sterilized with 70% alcohol, and the hippocampi were quickly removed and placed in ice-cold Gey’s Balanced Salt Solution (GBSS, Sigma Aldrich, USA). The hippocampi were sliced (450 lm thick) with a manual tissue slicer (Stoelting
24
N.M. Lee et al. / Brain Research 1677 (2017) 20–25
Fig. 6. Dot blotting analysis for secreted neurotrophic factors in G- and S-media. (A) Dot blotting images of neurotrophic factors/growth factors from the media. (B) Quantitative graph for secreted neurotrophic factors. The relative secretion levels of neuroprotective factors in the S-medium were adjusted by comparison to the G-medium.
Co, USA). Millicell culture inserts (Millipore, Ireland, five slices per insert) were placed into 6-well plates (SPL, Republic of Korea) with 1 mL of culture medium(Gahwiler, 1981) per well. The slices were cultured with 5% CO2 atmosphere at 37 °C in a humidified incubator (MCO175, Sanyo, Japan). The media were half-changed with fresh medium twice per week for 14 days, and all procedures were performed aseptically in a horizontal flow hood.
damage groups were exposed to 95% N2 and 5% CO2 for 3 h in an incubator on day 14 in vitro. 4.4. Image analysis
We used Gahwiler’s medium (Gahwiler, 1981) for six plates (G1-6) and stem cell-conditioned medium (S1-6) for the other six plates. Gahwiler’s medium consists of 25% Hank’s Balanced Salt Solution (HBSS, GibcoBRL/Life Technologies, USA), 25% heatinactivated horse serum (Hyclone, Logan, UT, USA), 50% Basal Medium Eagle (BME, GibcoBRL/Life Technologies, USA), 6.5 mg/ mL glucose, and 200 mM glutamax-I (GibcoBRL/Life Technologies, USA). Stem cell-conditioned medium was collected after culturing HB1.F3 human neural stem cells (Lee et al., 2007) in Gahwiler’s medium for 48 h.
Fluorescent images of the slices were captured under an inverted microscope (IX 71, Olympus, Japan) after induction of hypoxia. The slices were exposed to 2 mM NMDA in serum-free medium for 30 min at 37 °C with 5% CO2 in a humidified incubator. The slices were then cultured with 1 mL of serum-free medium with 1 lg propidium iodide (PI, Sigma), and fluorescent images were collected. The images were analyzed with Image J (version 1.47c, National Institutes of Health, USA). We calculated the amount of fluorescent area above a previously-defined threshold, and a single researcher measured the individual areas of the CA1 (Cornu Ammonis 1), CA3 (Cornu Ammonis 3), and DG (dentate gyrus) regions (Fig. 1). After NMDA treatment, the PI fluorescence was assumed to include the total area of the hippocampal tissue. We estimated the extent of damage by calculating the ratio (%) of the hypoxia-damaged area to the NMDA damaged area (total) after the NMDA exposure (Fig. 3).
4.3. Induction of hypoxia
4.5. CLARITY method
Plates were divided into control (G1, G4, S1, S4) and hypoxic damage (G2, G3, G5, G6, S2, S3, S5, S6) groups. Plates in the hypoxic
Cultured brain sections were fixed with 4% paraformaldehyde. After washing with PBS, slices were embedded in hydrogel (Logos
4.2. Culture media (Gahwiler’s medium vs. stem cell conditioned medium)
Table 1 Sequence of PCR primers. Gene
Forward
Reverse
Size (bp)
NGF BDNF NT3 GDNF CNTF HGF IGF-1 bFGF VEGF GAPDH
TCATCATCCCATCCCATCTTCCAC ATGACCATCCTTTTCCTTACT ATGTCCATCTTGTTTTATGTGA ATGAAGTTATGGGATGTCGT ATGGCTTTCACAGAGCATT AGGAGAAGGCTACAGGGGCAC AAATCAGCAGTCTTCCAACCCA GGGTGGAGATGTAGAAGATG GAAGTGGTGAAGTTCATGGATGTC CATGACCACAGTCCATGCCATCACT
CACAGCCTTCCTGCTGAGCACAC CTATCTTCCCCTTTTAATGGT TCATGTTCTTCCGATTTTTC TTAGCGGAATGCTTTCTTAG AACTGCTACATTTTCTTGTTGTT TTTTTGCCATTCCCACGATAA CTTCTGGGTCTTGGGCATGT TTTATACTGCCCAGTTCGTT CGATCGTTCTGTATCAGTCTTTCC TGAGGTCCACCACCCTGTTGCTGTA
351 744 774 636 610 267 402 787 546 451
N.M. Lee et al. / Brain Research 1677 (2017) 20–25
Biosystems, Gyeonggi-do, Republic of Korea) for 24 h at 4 °C, and then polymerized for 3 h in a 37 °C incubator. They were then clarified in an electrophoretic tissue-clearing chamber (Logos Biosystems) for 3 h under a 1.5-A current, and finally washed with phosphate-buffered saline (PBS).
25
Funding This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors. References
4.6. Immunohistochemistry Cleared tissues were incubated with mixed neurofilament (NFmix) antibodies overnight (Millipore, MA, USA, 1:200 dilution, NFL, -M and -H) after incubation in blocking solution (10% normal goat serum, Gibco, CA, USA). They were labeled with Alexa Fluor 488-conjugated secondary antibodies (Molecular Probes, OR, USA) for 1 h at room temperature. Slices were incubated in XCLARITY mounting solution (Logos Biosystems) overnight at 4 °C and observed under a confocal microscope (Zeiss LSM 710, Zeiss, Oberkochen, Germany). 4.7. RT-PCR Total RNA was isolated from HB1.F3 cells using a miRNA Isolation Kit (QIAGEN, Hilden, Germany). First, 1 lg of total RNA was reverse-transcribed into cDNA using oligo-dT primers. Reverse transcription was performed with TOPscript RT DryMIX (Enzynomics, Daejeon, Republic of Korea) for 1 h at 42 °C, followed by an inactivation step for 5 min at 95 °C, and finally cooling down to 4 °C. The cDNA was amplified using 30 PCR cycles, products were then separated on 1.5% agarose gels and visualized under UV light. The primers used for the RT-PCR are listed in Table 1. 4.8. Dot blotting G medium and S medium samples were absorbed by applying negative pressure to a nitrocellulose membrane soaked with tris-buffered saline (150 mM NaCl, 20 mM Tris-HCl, pH 7.5, TBS). The nitrocellulose membrane was fixed with TBST including 5% non-fat milk and 0.02% TweenTM 20 for 30 min. We incubated with primary antibodies (1:200 dilution in TBST: GLUT1, Glucose transporter 1; FGF1, Fibroblast Growth Factor 1; NT3, Neurotrophin 3; NT4, Neurotrophin 4; NGF, Nerve Growth Factor; GDNF, Glial cell-derived neurotrophic factor; VEGF, Vascular Endothelial Growth Factor; MCP3, Monocyte Chemotactic Protein 3; GCSF, Granulocyte Colony-stimulating Factor; IGF1, Insulin-like Growth Factor 1; IGF2, Insulin-like Growth Factor 2; HIF, Hypoxia inducible factor, Santa Cruz, USA) at 4 °C for 24 h. We washed four times with TBST. We incubated with the appropriate secondary antibody (1:500 dilution for TBST, anti-rabbit, mouse, goat antibody conjugated with horseradish peroxidase (HRP) for 1 h, and washed four more times with TBST. Blot images were obtained with DavinchchemiTM (Davinch-K, Seoul, Republic of Korea) visualizer and the intensity of dots was measured using image J software. 4.9. Statistical analysis We evaluated brain injury using one-way ANOVA test and post hoc test. Differences were considered significant when p < 0.05. All analyses were performed using SPSS 18.0. Conflicts of interest The authors have no conflicts of interest of disclose.
Barde, Y.A., 1994. Neurotrophins: a family of proteins supporting the survival of neurons. Prog. Clin. Biol. Res. 390, 45–56. Berger, R., Garnier, Y., 1999. Pathophysiology of perinatal brain damage. Brain Res. Brain Res. Rev. 30 (2), 107–134. Buga, A.M., Scholz, C.J., Kumar, S., Herndon, J.G., Alexandru, D., Cojocaru, G.R., Dandekar, T., Popa-Wagner, A., 2012. Identification of new therapeutic targets by genome-wide analysis of gene expression in the ipsilateral cortex of aged rats after stroke. PLoS One 7 (12), e50985. Buga, A.M., Margaritescu, C., Scholz, C.J., Radu, E., Zelenak, C., Popa-Wagner, A., 2014. Transcriptomics of post-stroke angiogenesis in the aged brain. Front. Aging Neurosci. 6, 44. Cain, J.T., Berosik, M.A., Snyder, S.D., Crawford, N.F., Nour, S.I., Schaubhut, G.J., Darland, D.C., 2014. Shifts in the vascular endothelial growth factor isoforms result in transcriptome changes correlated with early neural stem cell proliferation and differentiation in mouse forebrain. Dev. Neurobiol. 74 (1), 63–81. Fantacci, C., Capozzi, D., Ferrara, P., Chiaretti, A., 2013. Neuroprotective role of nerve growth factor in hypoxic-ischemic brain injury. Brain Sci. 3 (3), 1013–1022. Gahwiler, B.H., 1981. Organotypic monolayer cultures of nervous tissue. J. Neurosci. Methods 4 (4), 329–342. Galvin, K.A., Oorschot, D.E., 2003. Continuous low-dose treatment with brainderived neurotrophic factor or neurotrophin-3 protects striatal medium spiny neurons from mild neonatal hypoxia/ischemia: a stereological study. Neuroscience 118 (4), 1023–1032. Giesinger, R.E., Bailey, L.J., Deshpande, P., McNamara, P.J., 2017. Hypoxic-ischemic encephalopathy and therapeutic hypothermia: the hemodynamic perspective. J. Pediatr. 180 (22–30), e22. Gu, W., Brannstrom, T., Jiang, W., Bergh, A., Wester, P., 2001. Vascular endothelial growth factor-A and -C protein up-regulation and early angiogenesis in a rat photothrombotic ring stroke model with spontaneous reperfusion. Acta Neuropathol. 102 (3), 216–226. Jin-qiao, S., Bin, S., Wen-hao, Z., Yi, Y., 2009. Basic fibroblast growth factor stimulates the proliferation and differentiation of neural stem cells in neonatal rats after ischemic brain injury. Brain Dev. 31 (5), 331–340. Lee, H.J., Kim, K.S., Kim, E.J., Choi, H.B., Lee, K.H., Park, I.H., Ko, Y., Jeong, S.W., Kim, S. U., 2007. Brain transplantation of immortalized human neural stem cells promotes functional recovery in mouse intracerebral hemorrhage stroke model. Stem Cells 25, 1204–1212. Pimentel-Coelho, P.M., Mendez-Otero, R., 2010. Cell therapy for neonatal hypoxicischemic encephalopathy. Stem Cells Dev. 19 (3), 299–310. Silvestre, J.S., Tamarat, R., Ebrahimian, T.G., Le-Roux, A., Clergue, M., Emmanuel, F., Duriez, M., Schwartz, B., Branellec, D., Levy, B.I., 2003. Vascular endothelial growth factor-B promotes in vivo angiogenesis. Circ. Res. 93 (2), 114–123. Skaper, S.D., 2012. The neurotrophin family of neurotrophic factors: an overview. Methods Mol. Biol. 846, 1–12. Stoppini, L., Buchs, P.A., Muller, D., 1991. A simple method for organotypic cultures of nervous tissue. J. Neurosci. Methods 37 (2), 173–182. Sun, Y., Jin, K., Childs, J.T., Xie, L., Mao, X.O., Greenberg, D.A., 2004. Increased severity of cerebral ischemic injury in vascular endothelial growth factor-B-deficient mice. J. Cereb. Blood Flow Metab. 24 (10), 1146–1152. van Velthoven, C.T., Kavelaars, A., van Bel, F., Heijnen, C.J., 2010. Mesenchymal stem cell treatment after neonatal hypoxic-ischemic brain injury improves behavioral outcome and induces neuronal and oligodendrocyte regeneration. Brain Behav. Immun. 24 (3), 387–393. Vannucci, S.J., Hagberg, H., 2004. Hypoxia-ischemia in the immature brain. J. Exp. Biol. 207 (Pt 18), 3149–3154. Wang, L.M., Wang, H.Y., Yang, Z.J., Zhu, X.F., Yuan, D.X., 2007. Combined transplantation of neurotrophin-3 and neural stem cells in treatment of hypoxic-ischemic brain injury in rats. Zhonghua Er Ke Za Zhi 45 (3), 212–216. Wang, Y., Chang, C.F., Morales, M., Chiang, Y.H., Hoffer, J., 2002. Protective effects of glial cell line-derived neurotrophic factor in ischemic brain injury. Ann. N. Y. Acad. Sci. 962, 423–437. Zheng, T., Rossignol, C., Leibovici, A., Anderson, K.J., Steindler, D.A., Weiss, M.D., 2006. Transplantation of multipotent astrocytic stem cells into a rat model of neonatal hypoxic-ischemic encephalopathy. Brain Res. 1112 (1), 99–105.