Effects of nitrite exposure on haematological parameters, oxidative stress and apoptosis in juvenile turbot (Scophthalmus maximus)

Accepted Manuscript Title: Effects of nitrite exposure on haematological parameters, oxidative stress and apoptosis in juvenile turbot (Scophthalmus maximus) Author: Rui Jia Cen Han Ji-Lin Lei Bao-Liang Liu Bin Huang Huan-Huan Huo Shu-Ting Yin PII: DOI: Reference:

S0166-445X(15)30056-4 http://dx.doi.org/doi:10.1016/j.aquatox.2015.09.016 AQTOX 4202

To appear in:

Aquatic Toxicology

Received date: Revised date: Accepted date:

2-9-2015 25-9-2015 28-9-2015

Please cite this article as: Jia, Rui, Han, Cen, Lei, Ji-Lin, Liu, Bao-Liang, Huang, Bin, Huo, Huan-Huan, Yin, Shu-Ting, Effects of nitrite exposure on haematological parameters, oxidative stress and apoptosis in juvenile turbot (Scophthalmus maximus).Aquatic Toxicology http://dx.doi.org/10.1016/j.aquatox.2015.09.016 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Effects of nitrite exposure on haematological parameters, oxidative stress and apoptosis in juvenile turbot (Scophthalmus maximus) Rui Jia a, b, Cen Han c, Ji-Lin Lei b, Bao-Liang Liu b, *, Bin Huang b, Huan-Huan Huo a, Shu-Ting Yin b

a b

Wuxi Fisheries College, Nanjing Agricultural University, Wuxi 214081, China Key Laboratory for Sustainable Development of Marine Fisheries, Ministry of

Agriculture, Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Qingdao 266071, China c

College of Fisheries and Life Science, Dalian Ocean University, Dalian 116023,

China *

Corresponding author.

Address: Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, 106 Nanjing Road, Qingdao 266071, China Tel: +86-532-85821347. Fax: +86-532-85821347. E-mail address: [email protected] (B-L. Liu).

1

HIGHLIGHTS 

The toxicity of nitrite and subsequent subsequent physiological and molecular effects were studied in turbot..



Nitrite exposure up-regulated the expression of apoptosis-related genes in gills.



The occurrence of apoptosis was related to oxidative stress and NO.



Caspase-dependent pathway played an important role in nitrite-induced apoptosis

2

Abstract Nitrite (NO2–) is commonly present as contaminant in aquatic environment and toxic to aquatic organisms. In the present study, we investigated the effects of nitrite exposure on haematological parameters, oxidative stress and apoptosis in juvenile turbot (Scophthalmus maximus). Fish were exposed to various concentrations of nitrite (0, 0.02, 0.08, 0.4 and 0.8 mM) for 96 h. Fish blood and gills were collected to assay haematological parameters, oxidative stress and expression of genes after 0, 24, 48 and 96 h of exposure. In blood, the data showed that the levels of methemoglobin (MetHb), triglyceride (TG), potassium (K+), cortisol, heat shock protein 70 (HSP70) and glucose significantly increased in treatments with higher concentrations of nitrite (0.4 and/or 0.8 mM) after 48 and 96 h, while the levels of haemoglobin (Hb) and sodium (Na+) significantly decreased in these treatments. In gills, nitrite (0.4 and/or 0.8 mM) apparently reduced the levels of superoxide dismutase (SOD), glutathione peroxidase (GPx), catalase (CAT) and glutathione (GSH), increased the formation of malondialdehyde (MDA), up-regulated the mRNA levels of c-jun amino-terminal kinase (JUK1), p53, caspase-3, caspase-7 and caspase-9 after 48 and 96 h of exposure. The results suggested caspase-dependent and JUK signaling pathways played important roles in nitrite-induced apoptosis in fish. Further, this study provides new insights into how nitrite affects the physiological responses and apoptosis in a marine fish.

Key word: Nitrite; Oxidative stress; Apoptosis; Gills; Scophthalmus maximus

3

1. Introduction Nitrite is commonly present as contaminant in aquatic environment (Hilmy et al., 1987). It is produced as a toxic intermediary in bacterial nitrification and denitrification processes in the nitrogen cycle (Lewis Jr and Morris, 1986). In natural water, nitrite concentration is typically lower than 1 µM (Madison and Wang, 2006), whereas it can build up in intensive fish culture systems especially in recirculation aquaculture systems (RAS) (Jensen, 2003; Svobodova et al., 2005). In RAS, imbalances of nitrification bacterial activity, Nitrosomonas sp. and Nitrobacter sp.(Mevel and Chamroux, 1981) may lead to a build-up of nitrite concentration to 1 mM or more (Hargreaves, 1998; Svobodova et al., 2005; Wuertz et al., 2013). High concentration of nitrite is a potential factor triggering stress in aquatic organisms (Palachek and Tomasso, 1984; Sampaio et al., 2002). The effects of nitrite toxicity have been widely studied in aquatic animals (Jensen, 2003), and for fish, the vast majority of investigations have used freshwater species as experimental models. In freshwater fish, nitrite enters fish through gill chloride cells via competition with chloride uptake (Williams and Eddy, 1986). In seawater fish, the mechanisms of nitrite uptake and toxicity are poorly described, but potential routes for nitrite accumulation have been shown to occur across the intestinal and gill epithelium (Deane and Woo, 2007; Grosell and Jensen, 2000; Jensen, 2003; Tomasso, 2012). Nitrite is generally less toxic in seawater than in freshwater. However, several investigations have found that high nitrite exposure reduced growth (Siikavuopio and Sæther, 2006), increased methemoglobin formation (Scarano et al., 1984), altered osmoregulatory function (Deane and Woo, 2007) and disturbed physiological responses (Grosell and Jensen, 2000; Park et al., 2013) in marine fish species. Generally, extracellular stimuli such as biological, chemical, or physical factors are transduced into intracellular responses by signal transduction pathways, leading to changes in gene expression (Chang and Karin, 2001). Mitogen-activated protein kinases (MAPKs) are major components of such signaling pathways with important 4

roles in regulation of stress responses and apoptosis (Plotnikov et al., 2011; Raman et al., 2007). The MAPKs are mainly composed of three subgroups: extracellular signal-regulated kinases (ERKs), c-jun amino-terminal kinases (JNKs), and p38 MAPKs (Johnson and Lapadat, 2002). Multiple isoforms of ERK (ERK1, ERK2, ERK7, and ERK8) are coupled to a variety of receptors and participate in numerous cellular responses (Lee et al., 2010; Xia et al., 1995). Activated ERK1 and ERK2 are often involved in proliferation, survival and apoptosis through Ras/Raf/ME KK/MEK pathway (Peyssonnaux and Eychène, 2001; Wang et al., 2000). JNKs, an important subfamilies in the MAPKs pathway, mainly associate with cell proliferation, differentiation, survival and apoptosis (Ammendrup et al., 2000; Behrens et al., 1999; Ma et al., 2007). Apoptosis is a highly organized cellular process which is accompanied by the activation of a large number of intracellular proteases and endonucleases (Takle and Andersen, 2007). Apoptotic pathways are mainly classified into two groups: extrinsic or the receptor apoptotic pathway and intrinsic or the mitochondrial apoptotic pathway (Luzio et al., 2013). The common event in the end point of both the intrinsic and extrinsic is the activation of a set of cysteine proteases (caspases) (Dos Santos et al., 2008). Caspase-3 and caspase -7 are the major executioner caspases in the mitochondria-initiated intrinsic pathway and the death receptor-triggered extrinsic pathway, while caspase-9 is the major initiator caspase implicated in the two pathways (Wang and Lenardo, 2000). The gills of teleost fish are multifunctional organ for excretion, osmoregulation and respiration (Maetz, 1971), and encompass the largest surface area in direct contact with dissolved toxicants. Consequently, gills are particularly vulnerable to toxicants (Alvarado et al., 2006; Luzio et al., 2013; Romano and Zeng, 2009). It has been reported that nitrite exposure induced hypertrophy, hyperplasia, epithelial cell necrosis and osmoregulatory dysfunction in gills (Deane and Woo, 2007; Park et al., 2007; Patrick Saoud et al., 2014; Romano and Zeng, 2009). In aquatic animal, nitrite exposure also promoted apoptosis. Sun et al. (2014b) reported that nitrite exposure induced the transcription of apoptosis-related genes (caspase-8 and caspase-9) and 5

contributed to apoptosis in gills of juvenile Megalobrama amblycephala. Similarly, nitrite-induced haemocyte apoptosis was observed in Litopenaeus vannamei, Penaeus monodon and Macrobrachium rosenbergii (Guo et al., 2013; Xian et al., 2011; Zhang et al., 2015). However, there was very limited information on the effects of nitrite on expression of apoptosis-related genes in marine fish gills. Turbot, a marine species, is widely cultured in Europe and China because of its considerable commercial value. The species is mainly produced in land-based farms including recirculation and flow-through systems. Intensification of turbot culture has led to excessive use of proteinaceous feed and higher stocking densities in these systems, thereby increasing the load of nitrogenous and other toxic metabolites, causing marked change in water quality (Lei et al., 2012; Liu et al., 2015). The change such as elevated nitrite may decrease growth and survival of turbot (Xie-fa et al., 2012). In turbot, the acute toxicity of nitrite has been reported and the 96-h median lethal concentration (LC50) was 1.88 mM (Keming et al., 2007), but the subsequent effects were not investigated. Given the present general gaps in our understanding of nitrite effects in marine fish, the haematological parameters, oxidative stress and expression of apoptosis-related genes of the gills, in turbot exposed to nitrite, were investigated. 2. Materials and methods 2.1 Animals Juvenile turbot (initial weight 90.3 ± 8.2 g) were obtained from Shandong Oriental Ocean Sci-Tech Co., Ltd (Shandong, China), and held in 500 L PVC tanks with flow-through of aerated seawater (salinity 27–30 ppt; temperature 16-18 ℃; dissolved oxygen > 6 mg/L; pH 7.4–8.1; total ammonia < 0.05 mg/l; nitrite < 0.001 mM) for 2 week. During the acclimation period, they were fed with a basal diet (52% crude protein, 12% crude lipids, 16.0% crude ash, 3.0% crude fiber, 12% water, 5% Ca, 0.5% P, ≥ 2.3% lysine, and ≤ 3.8% sodium chloride) at 2% of their body weight twice per day. 2.2 Nitrite exposure and sampling Nitrite test solution was prepared by dissolving NaNO2 in 1 L distilled water to 6

make a stock solution and then diluted by sea water based on the procedure described before (Chen and Cheng, 1995). There were five test solutions at nitrite concentrations of 0 (control), 0.02, 0.08, 0.4 and 0.8 mM. Each test solution contained 300 animals which were tested in triplicate. The actual nitrite concentration was checked using the Griess method (Federation and Association, 2005) and adjusted by adding NaNO2 solution every 12 h. After 0, 24, 48, 96 h of exposure, 24 fish were randomly netted from each treatment and immediately anesthetized in 0.05% tricaine methane sulfonate (MS-222, Sigma Diagnostics INS, St.Louis, MO). Blood sample was obtained from the caudal vein using heparinized syringes. The plasma was separated by centrifugation (5000 rpm, 4ºC, and 15 min) for analyses of plasma parameters. After blood collection, the gill of the sampled fish was removed and stored at -80 ºC for analyses of gene expression. A portion of collected gill tissue was homogenized with 10 times (w/v) ice-cold homogenization buffer (a 100 mM Tris– HCl buffer with 0.1 mM EDTA and 0.1 % Triton X-100, PH 7.8) and centrifuged at 3,000 rpm for 10 min. The supernatant was collected for assays of oxidative stress parameters and protein content. 2.3 Determination of blood parameters The levels of whole blood sodium (Na+), potassium (K+), chloride (Cl–) and haemoglobin (Hb) were analyzed using an i-STAT Portable Clinical Analyzer (Abbott Inc., USA) with EC8 + disposable cartridges (Abbott Laboratories, USA). The fraction of methaemoglobin (MetHb) in the blood was measured according to the method of Wuertz et al. (2013). Plasma cortisol and heat shock protein 70 (HSP70) were measured using commercially available ELISA kits (mlbio, Shanghai, China) as previously described methods (De Boeck et al., 2003; Rodríguez et al., 2000). Plasma glucose (Glu), triglyceride (TG) and cholesterol (CH) were measured in an automatic biochemical analyzer Roche Cobas C311 (Roche Cobas, Swiss) using kits purchased from Nanjing Jiancheng Biological Engineering Research Institute of China. 2.4 Determination of oxidative stress parameters The activities of superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPx) in the gills were measured using commercially available kits 7

(Jiancheng Institute of Biotechnology, Nanjing, China) and expressed as unit per milligram protein (Jia et al., 2014). SOD activity was measured according to the method of Peskin and Winterbourn (2000), using water-soluble tetrazolium salt as a superoxide detector. CAT activity was assayed by measuring the rate of decrease in H2O2 absorbance at 240 nm (Aebi, 1984). GPx activity was determined as previously described by Rotruck et al. (Rotruck et al., 1973). The glutathione (GSH) content was estimated by a colorimetric method as described by Lora et al. (2004) and expressed as microgramme per milligram protein. Lipid peroxidation in the gills was measured by estimating the formation of malondialdehyde (MDA), using the thiobarbituric acid-reactive substances (TBARS) assay (Ohkawa et al., 1979). The final concentration of MDA was expressed as nanomole per milligram protein. Protein concentration of gill homogenate was determined by the Bradford method, using bovine serum albumin as a standard (Bradford, 1976) 2.5 Gene expression analysis Total RNA was extracted from gills using a fast pure RNA kit (Dalian Takara, China) according to the manufacturer’s instruction. The RNA concentration was determined using GeneQuant 1300 (GE Healthcare Biosciences, Piscataway, NJ), and normalized to a common concentration with DEPC treated water (Invitrogen, China). The purity of each sample was determined by calculating the 260/280 ratio. Single-stranded cDNA was synthesized from 2µg total RNA using PrimeScript RT reagent Kit with gDNA Eraser (Takara, Dalian, China) according to the manufacturer’s instruction. The primers used for amplification and gene expression analysis were presented in Table 1. The specificity of the primer was evaluated by conventional PCR and sequence analysis. The efficiency (E) of the primer was determined based on the slopes of the standard curves generated by serial 10-fold dilutions of sample cDNA. The efficiency was calculated as follows: E (%) = (10–1/slope – 1) × 100 (Kubista et al., 2006). Real-time quantitative PCR (qRT-PCR) was performed to detect the expression genes using SYBR Premix Ex Taq (Dalian Takara, China) with an equipment of ABI PRISM 7500 Detection System (Applied Biosystems, USA). The amplification 8

reaction (20µL) consisted of the following: 4µL of cDNA template (ten-fold diluted), 10 μL of SYBR® Premix Ex TaqTM (Perfect Real Time) (Takara Bio., China), 0.4 μL of ROXII, 0.4 μL of each primer (10μmol/L) and 4.8 μL of ddH2O. The program was set to run for one cycle at 95 ℃ for 10 s, 40 cycles at 95 ℃ for 5 s and at 60 ℃ for 34 s. The specificity of PCR amplification was confirmed by agarose gel electrophoresis and melting curve analysis. β-actin was used as an internal control for qRT-PCR. Relative gene expression levels were evaluated using 2-CT method and the values were normalized to control values at time zero (Livak and Schmittgen, 2001). All samples were run in triplicate, and each assay was repeated three times. 2.6 Statistical analysis The data was expressed as mean ± standard deviation (SD). Isolated and interactive effects of nitrite concentration and exposure time were analyzed using two-way ANOVA. If significant differences were found in factors, Tukey’s multiple range tests were used to determine the differences between means. P < 0.05 was taken as statistically significant. Statistical analyses were carried out using SPSS version 18.0 software. 3. Results With the exception of sampled fish, no mortality occurred in any experimental groups throughout the experimental period. 3.1 Effects of nitrite exposure on Hb and MetHb Hb content significantly decreased in turbot exposed to 0.4 and 0.8 mM nitrite for 48 and 96 h (P<0.05; Fig.1A). Conversely, turbot exposed to 0.4 and 0.8 mM nitrite showed an increased MetHb level which were significantly higher than control values after 24 h (P < 0.05; Fig.1B). 3.2 Effects of nitrite exposure on plasma parameters The cortisol and HSP70 levels in treatments with 0.4 and 0.8 mM nitrite for 48 and 96 h were significantly higher than control (P<0.05; Fig.2 A and B). The increases of both parameters were also observed when fish were exposed to 0.8 mM nitrite for 24 h (P<0.05). The glucose level significantly elevated after 48 h of exposure to 0.4 and 0.8 mM nitrite compared to control (P<0.05), but values returned 9

to control levels after 96 h (Fig. 2C). Compared with the controls, exposure to 0.8 mM nitrite caused marked increases in TG and K+ levels, and decrease in Na+ level after 24 h (P<0.05; Fig. 2D, Fig. 3A and B). Similar changes of Na+ and K+ were detected in treatments with 0.4 mM nitrite for 96 h (P<0.05). However, the GH and Cl– levels were not any differences between nitrite treatments and control (Fig. 2E and Fig. 3C). 3.3 Effects of nitrite exposure on antioxidant activities and lipid peroxidation in gills The changes of antioxidant capacity and lipid peroxidation were shown in Fig. 4. Following exposure to 0.4 and 0.8 mM nitrite after 96 h, there were significant decreases in the SOD, CAT and GPx activities when compared with the controls (P<0.05). The activities of CAT and GPx also obviously decreased in treatment with 0.8 mM nitrite for 48 h. The content of GSH was considerably lowered in fish exposed to 0.4 and 0.8 mM nitrite for 24, 48 and 96 h compared to the control (P<0.05). After 96 h of exposure, treatments with 0.08, 0.4 and 0.8 mM nitrite caused a significant formation of MDA in gills (P<0.05). Meanwhile, the elevated MDA level was also seen in fish exposed to 0.8 mM nitrite for 48 h. 3.4 Effects of nitrite exposure on MAPKs gene transcription in gills QRT-PCR analysis showed that MAPKs-related gene including ERK1 and JUK1 were ubiquitously expressed in gills (Fig. 5). Quantification of expression showed that ERK1 mRNA level was not any difference after exposure to various concentrations of nitrite for 96 h, while the JUK1 mRNA level was evidently up-regulated in fish exposed to 0.4 and 0.8 mM nitrite for 48 and 96 h when compared with the control. 3.5 Effect of nitrite exposure on apoptosis-related gene transcription in gills The mRNA levels of p53, capase-3, capase-7 and caspase-9 from turbot gill were differently affected by nitrite exposure (Fig. 6). After 96 h, exposure to 0.4 and 0.8 mM nitrite induced significant increases in gene expressions of p53 and caspase-7 when compared with control groups (P<0.05). The same expressions were observed in fish exposed to 0.8 mM for 48 h. The expression of caspase-3 gene progressively increased up to 96 h in fish exposed to 0.4 and 0.8 mM, being significantly higher than the expression of control fish after 24 h (P < 0.05). The expression of caspase-9 10

gene did not apparently enhanced until the 48 h of exposure to 0.4 and 0.8 mM nitrite and progressively increased thereafter (p<0.05). 4. Discussion Nitrite is generally toxic to aquatic organisms and disrupt several physiological functions (Tomasso, 2012). A primary toxic action of nitrite is the conversion of Hb into MetHb, which is not able to carry oxygen (Madison and Wang, 2006). In the current study, an increase of MetHb level and a decrease of the oxygen-transporting Hb indicated that nitrite-induced methaemoglobinaemia occurred in turbot. The similar results were observed in other marine teleost fish (Grosell and Jensen, 2000; Park et al., 2013). MetHb formation is supposed to result in tissue hypoxia which causes significant stress and changes of stress markers including cortisol and glucose (Barton et al., 2002; Fei et al., 2007). The results from this study showed that acute nitrite exposure induced an increase in the cortisol level, similarly to what can be observed for other fish species (Ciji et al., 2012; Mazik et al., 1991). The increase suggested that nitrite activated the hypothalamic–pituitary–interrenal (HPI) axis, initiating a typical stress response in turbot (Pickering and Pottinger, 1989). In this study, we found an increase in blood glucose after 48 h of exposure, followed by a reduction after 96 h of exposure in treatments with 0.4 and 0.8 mM nitrite. This phenomenon suggested even though glycogenolysis has increased during the later exposure, probably the higher use of glucose during this period for increased cell metabolism would have masked the blood glucose increase (Das et al., 2004; Vijayan and Moon, 1994). Meanwhile, the present study demonstrated that exposure to nitrite induced a significant increase in the plasma TG, which was probably due to the mobilization of lipid reserves to cope with an increased energy demand in fish (Sies et al., 2005). Heat-shock proteins (HSPs) are a family of stress proteins that are induced by a variety of stressors (Wang et al., 2004b). Earlier reports showed that nitrite exposure enhanced HSP70 levels in gills, kidney and liver of silver sea bream (Sparus sarba) (Deane and Woo, 2007). Also, turbot exposed to nitrite in our study showed increased HSP70 level, which might reflect nitrite exposure caused tissue damage inducing the expression of HSP 11

70 (Deane and Woo, 2007; Jensen et al., 2015), and overexpression of HSP 70 entered blood (Madeira et al., 2012; SHENG et al., 2007). Previous researches have reported that nitrite exposure altered ionic homeostasis in fish and three key ions are K+, Cl– and Na+ (Madison and Wang, 2006). Nitrite was expected to have a critical influence on the K+ balance resulting in an extracellular elevation (Siikavuopio and Sæther, 2006), consistent changes occurred in this study. The large increase of K+ might result from a loss of K+ from both erythrocytes and skeletal muscle (Knudsen and Jensen, 1997; Stormer et al., 1996). In contrast to the change of K+ in this work, a significant decline in blood Na+ was observed in treatments with 0.4 and 0.8 mM nitrite for 48 and 96 h. According to Jensen (1996) and Martinez and Souza (2002), decreased Na+ might be due to an expansion in extracellular volume. Oxidative stress, primarily due to increased generation of reactive oxygen species (ROS) and reactive nitrogen species (RNS), is a feature of many environmental stresses (Federici et al., 2007). Several studies demonstrated that nitrite exposure in aquatic ecosystems could enhance the intracellular formation of ROS and RNS (Ciji et al., 2012; Guo et al., 2013; Jensen et al., 2015; Jensen and Hansen, 2011; Sun et al., 2014a). Both the ROS and RNS are able to attack antioxidant defense system, leading to the loss of antioxidant components (SOD, CAT, GPx and GSH) (Apel and Hirt, 2004; Bopp et al., 2008). In the present study, significant decreases of SOD, CAT, GPx and GSH in gills following 96-h exposure to 0.4 and 0.8 mM nitrite were observed, indicating that nitrite exposure could induce the oxidative damage in fish. Nitrite-induced oxidative stress also attacked polyunsaturated fatty acids, initiators of lipid peroxide formation, leading to impaired membrane function and structural integrity (Wang et al., 2004a). Our results showed a significant increase in MDA level in gills of turbot exposed to nitrite, which was consistent with previous research (Sun et al., 2014a). The high MDA level reflected the oxidative stress generated from nitrite, and depleted the antioxidants in different tissues (Üner et al., 2001). One important molecular consequence of oxidative stress is the activation of 12

MAPKs (Jayakumar et al., 2006). Numerous studies indicated that ERK1/2 and JUK could be activated by many environmental stressors or chemical agents via induction of oxidative stress, but this phenomenon was inhibited by treatment with antioxidants (Cao et al., 2014; Geng et al., 2014; Wang et al., 2014; Zhang et al., 2012). Also, oxidative stress could increase the protein or mRNA levels of MAPKs (Biswas et al., 2012; Liu et al., 2012; Liu et al., 2013). Our study showed that exposure to nitrite increased the mRNA levels of JUK1, implying that the JUK signaling pathways likely played a role in the damage of the turbot gill or branchial cells after nitrite exposure. Nitrite not only caused oxidative damage, but also might initiate apoptosis (Simon et al., 2000). The nitrite-induced apoptosis may be related to formations of ROS and nitric oxide (NO). It is reported that exposure to high-concentration nitrite leads to excess ROS and NO formations, initiating apoptosis (Ciji et al., 2012; Inadomi et al., 2012; Jensen and Hansen, 2011). P53 is a transcription factor involved in numerous vital functions, including cell cycle control and apoptosis (Doman et al., 1999). It can be activated by cellular stressors, such as DNA damage, ROS or NO (Blanco et al., 1995; Cheng et al., 2015). In the present study, the gene expression analysis showed that p53 gene was transcriptionally up-regulated when fish were exposed to 0.8 mM nitrite for 48 and 96 h, suggesting that P53 was involved in nitrite-induced apoptosis. The view was corroborated by studies with fish exposed to other environmental contaminants, which showed evidences of apoptosis induction by p53 activation (Cheng et al., 2015; Luzio et al., 2013) Caspases are cysteine proteases that play fundamental roles in the apoptotic responses of cells to different stimuli (Wang and Lenardo, 2000). Many investigations have demonstrated that nitrite could induce apoptosis via caspase-dependent pathway (Al-Gayyar et al., 2014; Kolb-Bachofen et al., 2009). Guo et al. (2013) estimated the caspase-3 mRNA level in nitrite-treated Litopenaeus vannamei and found nitrite led to activation of caspases and initiation of hemocytes apoptosis. In vivo study showed that nitrite exposure induced increases in mRNA levels of caspase -8 and caspase -9 in the gills of juvenile Megalobrama amblycephala (Sun et al., 2014b). In the present study, we also discovered the ascensions in mRNA levels of caspases -3, -7, and -9 in 13

gills of turbot exposed to nitrite. Based on the results, it was speculated that nitrite exposure induced apoptosis through activation of initiator caspases (caspase -9) and effector (caspase -3 and -7) in gills of turbot (Al-Gayyar et al., 2014).

5 Conclusion In blood, the nitrite exposure altered ionic homeostasis, helped in the production of metHb which resulted in stress response and increases of cortisol, glucose and HSP70 levels. In gills, the nitrite exposure induced oxidative stress, leading to lipid peroxidation and loss of antioxidant components. Further, the exposure to nitrite caused the transcriptional up-regulation of apoptosis-related genes, indicating the activation of the caspase-dependent pathway (Fig.7). This study also suggested that the

gill

apoptotic

response

to

nitrite

exposure

was

in

time-

and

concentration-dependent manners. Since mRNA levels need not necessarily reflect protein levels and activity, the apoptosis induced by nitrite requires further evaluation in protein levels in future research.

Acknowledgments This work was supported by the National Natural Science Foundation of China (No. 31402315 and 31240012), the Modern Agriculture Industry System Construction of Special Funds (CARS-50-G10) and Key R & D program of Jiangsu Province (BE2015328)

14

References Aebi, H., 1984. [13] Catalase in vitro. Methods Enzymol. 105, 121-126. Al-Gayyar, M.M., Al Youssef, A., Sherif, I.O., Shams, M.E., Abbas, A., 2014. Protective effects of arjunolic acid against cardiac toxicity induced by oral sodium nitrite: Effects on cytokine balance and apoptosis. Life Sci. 111, 18-26. Alvarado, N.E., Quesada, I., Hylland, K., Marigómez, I., Soto, M., 2006. Quantitative changes in metallothionein expression in target cell-types in the gills of turbot (Scophthalmus maximus) exposed to Cd, Cu, Zn and after a depuration treatment. Aquat. Toxicol. 77, 64-77. Ammendrup, A., Maillard, A., Nielsen, K., Andersen, N.A., Serup, P., Madsen, O.D., Mandrup-Poulsen, T., Bonny, C., 2000. The c-Jun amino-terminal kinase pathway is preferentially activated by interleukin-1 and controls apoptosis in differentiating pancreatic beta-cells. Diabetes 49, 1468-1476. Apel, K., Hirt, H., 2004. Reactive oxygen species: metabolism, oxidative stress, and signal transduction. Annu. Rev. Plant Biol. 55, 373-399. Barton, B., Morgan, J., Vijayan, M., Adams, S., 2002. Physiological and condition-related indicators of environmental stress in fish. Biological indicators of aquatic ecosystem stress, 111-148. Behrens, A., Sibilia, M., Wagner, E.F., 1999. Amino-terminal phosphorylation of c-Jun regulates stress-induced apoptosis and cellular proliferation. Nat. Genet. 21, 326-329. Biswas, N., Mahato, S.K., Chowdhury, A.A., Chaudhuri, J., Manna, A., Vinayagam, J., Chatterjee, S., Jaisankar, P., Chaudhuri, U., Bandyopadhyay, S., 2012. ICB3E induces iNOS expression by ROS-dependent JNK and ERK activation for apoptosis of leukemic cells. Apoptosis 17, 612-626. Blanco, F.J., Ochs, R.L., Schwarz, H., Lotz, M., 1995. Chondrocyte apoptosis induced by nitric oxide. The American journal of pathology 146, 75. Bopp, S.K., Abicht, H.K., Knauer, K., 2008. Copper-induced oxidative stress in rainbow trout gill cells. Aquat. Toxicol. 86, 197-204. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248-254. Cao, J., Chen, J., Wang, J., Klerks, P., Xie, L., 2014. Effects of sodium fluoride on MAPKs signaling pathway in the gills of a freshwater teleost, Cyprinus carpio. Aquat. Toxicol. 152, 164-172. Chang, L., Karin, M., 2001. Mammalian MAP kinase signalling cascades. Nature 410, 37-40. Chen, J., Cheng, S., 1995. Hemolymph oxygen content, oxyhemocyanin, protein levels and ammonia excretion in the shrimp Penaeus monodon exposed to ambient nitrite. Journal of Comparative Physiology B: Biochemical, Systemic, and Environmental Physiology 164, 530-535. Cheng, C.-H., Yang, F.-F., Ling, R.-Z., Liao, S.-A., Miao, Y.-T., Ye, C.-X., Wang, A.-L., 2015. Effects of ammonia exposure on apoptosis, oxidative stress and immune 15

response in pufferfish (Takifugu obscurus). Aquat. Toxicol. 164, 61-71. Ciji, A., Sahu, N., Pal, A., Dasgupta, S., Akhtar, M., 2012. Alterations in serum electrolytes, antioxidative enzymes and haematological parameters of Labeo rohita on short-term exposure to sublethal dose of nitrite. Fish Physiol. Biochem. 38, 1355-1365. Das, P., Ayyappan, S., Jena, J., Das, B., 2004. Nitrite toxicity in Cirrhinus mrigala (Ham.): acute toxicity and sub-lethal effect on selected haematological parameters. Aquaculture 235, 633-644. De Boeck, G., De Wachter, B., Vlaeminck, A., Blust, R., 2003. Effect of cortisol treatment and/or sublethal copper exposure on copper uptake and heat shock protein levels in common carp, Cyprinus carpio. Environ. Toxicol. Chem. 22, 1122-1126. Deane, E.E., Woo, N.Y., 2007. Impact of nitrite exposure on endocrine, osmoregulatory and cytoprotective functions in the marine teleost Sparus sarba. Aquat. Toxicol. 82, 85-93. Doman, R.K., Perez, M., Donato, N.J., 1999. JNK and p53 stress signaling cascades are altered in MCF-7 cells resistant to tumor necrosis factor-mediated apoptosis. J. Interferon Cytokine Res. 19, 261-269. Dos Santos, N., Vale, A.d., Reis, M., Silva, M., 2008. Fish and apoptosis: molecules and pathways. Curr. Pharm. Des. 14, 148-169. Federation, W.E., Association, A.P.H., 2005. Standard methods for the examination of water and wastewater. American Public Health Association (APHA): Washington, DC, USA. Federici, G., Shaw, B.J., Handy, R.D., 2007. Toxicity of titanium dioxide nanoparticles to rainbow trout (Oncorhynchus mykiss): Gill injury, oxidative stress, and other physiological effects. Aquat. Toxicol. 84, 415-430. Fei, G., Guo, C., Sun, H.S., Feng, Z.P., 2007. Chronic hypoxia stress‐induced differential modulation of heat‐shock protein 70 and presynaptic proteins. J. Neurochem. 100, 50-61. Geng, Y., Qiu, Y., Liu, X., Chen, X., Ding, Y., Liu, S., Zhao, Y., Gao, R., Wang, Y., He, J., 2014. Sodium fluoride activates ERK and JNK via induction of oxidative stress to promote apoptosis and impairs ovarian function in rats. J. Hazard. Mater. 272, 75-82. Grosell, M., Jensen, F.B., 2000. Uptake and effects of nitrite in the marine teleost fish Platichthys flesus. Aquat. Toxicol. 50, 97-107. Guo, H., Xian, J.-A., Li, B., Ye, C.-X., Wang, A.-L., Miao, Y.-T., Liao, S.-A., 2013. Gene expression of apoptosis-related genes, stress protein and antioxidant enzymes in hemocytes of white shrimp Litopenaeus vannamei under nitrite stress. Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology 157, 366-371. Hargreaves, J.A., 1998. Nitrogen biogeochemistry of aquaculture ponds. Aquaculture 166, 181-212. Hilmy, A., El-Domiaty, N., Wershana, K., 1987. Acute and chronic toxicity of nitrite to Clarias lazera. Comparative Biochemistry and Physiology Part C: Comparative Pharmacology 86, 247-253. Inadomi, C., Murata, H., Ihara, Y., Goto, S., Urata, Y., Yodoi, J., Kondo, T., Sumikawa, K., 2012. Overexpression of glutaredoxin protects cardiomyocytes against nitric 16

oxide-induced apoptosis with suppressing the S-nitrosylation of proteins and nuclear translocation of GAPDH. Biochem. Biophys. Res. Commun. 425, 656-661. Jayakumar, A., Panickar, K., Murthy, C.R., Norenberg, M., 2006. Oxidative stress and mitogen-activated protein kinase phosphorylation mediate ammonia-induced cell swelling and glutamate uptake inhibition in cultured astrocytes. The Journal of neuroscience 26, 4774-4784. Jensen, F., 1996. Physiological effects of nitrite in teleosts and crustaceans, SEMINAR SERIES-SOCIETY FOR EXPERIMENTAL BIOLOGY. Cambridge University Press, pp. 169-186. Jensen, F.B., 2003. Nitrite disrupts multiple physiological functions in aquatic animals. Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology 135, 9-24. Jensen, F.B., Gerber, L., Hansen, M.N., Madsen, S.S., 2015. Metabolic fates and effects of nitrite in brown trout under normoxic and hypoxic conditions: blood and tissue nitrite metabolism and interactions with branchial NOS, Na+/K+-ATPase and hsp70 expression. The Journal of experimental biology, jeb. 120394. Jensen, F.B., Hansen, M.N., 2011. Differential uptake and metabolism of nitrite in normoxic and hypoxic goldfish. Aquat. Toxicol. 101, 318-325. Jia, R., Cao, L.-P., Du, J.-L., Wang, J.-H., Liu, Y.-J., Jeney, G., Xu, P., Yin, G.-J., 2014. Effects of carbon tetrachloride on oxidative stress, inflammatory response and hepatocyte apoptosis in common carp (Cyprinus carpio). Aquat. Toxicol. 152, 11-19. Johnson, G.L., Lapadat, R., 2002. Mitogen-activated protein kinase pathways mediated by ERK, JNK, and p38 protein kinases. Science 298, 1911-1912. Keming, Q., Yong, X., Shaosai, M., 2007. Acute toxic effects of nitrite and non-ion ammonia on turbot (Scophthalmus maximus) at different DO levels. Mar Fish Res 28, 84-89. Knudsen, P., Jensen, F., 1997. Recovery from nitrite-induced methaemoglobinaemia and potassium balance disturbances in carp. Fish Physiol. Biochem. 16, 1-10. Kolb-Bachofen, V., Liebmann, J., Suschek, C., 2009. The presence of nitrite changes the UVA-mediated cell death from a caspase-dependent apoptosis into an AIF-dependent and caspase-independent mode, NITRIC OXIDE-BIOLOGY AND CHEMISTRY. ACADEMIC PRESS INC ELSEVIER SCIENCE 525 B ST, STE 1900, SAN DIEGO, CA 92101-4495 USA, pp. S38-S38. Kubista, M., Andrade, J.M., Bengtsson, M., Forootan, A., Jonák, J., Lind, K., Sindelka, R., Sjöback, R., Sjögreen, B., Strömbom, L., 2006. The real-time polymerase chain reaction. Molecular aspects of medicine 27, 95-125. Lee, Y.S., Park, Y., Choi, W., Park, E.-M., Lee, E.-Y., Lee, J.-S., Kim, G.-D., Chung, J., Choi, T.-J., 2010. Sequence and expression analysis of extracellular signal-regulated kinase 1 from flounder (Paralichthys olivaceous). Fish Shellfish Immunol. 28, 65-71. Lei, J., Liu, X., Guan, C., 2012. Turbot culture in China for two decades: achievement and prospect. Progress in Fishery Sciences 33, 123-130. Lewis Jr, W.M., Morris, D.P., 1986. Toxicity of nitrite to fish: a review. Trans. Am. Fish. Soc. 115, 183-195. 17

Liu, L., Wei, J., Huo, X., Fang, S., Yao, D., Gao, J., Jiang, H., Zhang, X., 2012. The Salvia miltiorrhiza monomer IH764-3 induces apoptosis of hepatic stellate cells in vivo in a bile duct ligation-induced model of liver fibrosis. Molecular medicine reports 6, 1231-1238. Liu, X., Mai, K., Liufu, Z., Ai, Q., 2015. Dietary protein requirement of juvenile turbot (Scophthalmus maximus Linnaeus). J. Ocean Univ. China 14, 325-328. Liu, Y., Tao, L., Fu, X., Zhao, Y., Xu, X., 2013. BDNF protects retinal neurons from hyperglycemia through the TrkB/ERK/MAPK pathway. Molecular medicine reports 7, 1773-1778. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. methods 25, 402-408. Lora, J., Alonso, F.J., Segura, J.A., Lobo, C., Marquez, J., Mates, J.M., 2004. Antisense glutaminase inhibition decreases glutathione antioxidant capacity and increases apoptosis in Ehrlich ascitic tumour cells. Eur. J. Biochem. 271, 4298-4306. Luzio, A., Monteiro, S.M., Fontaínhas-Fernandes, A.A., Pinto-Carnide, O., Matos, M., Coimbra, A.M., 2013. Copper induced upregulation of apoptosis related genes in zebrafish (Danio rerio) gill. Aquat. Toxicol. 128, 183-189. Ma, F.Y., Flanc, R.S., Tesch, G.H., Han, Y., Atkins, R.C., Bennett, B.L., Friedman, G.C., Fan, J.-H., Nikolic-Paterson, D.J., 2007. A pathogenic role for c-Jun amino-terminal kinase signaling in renal fibrosis and tubular cell apoptosis. Journal of the American Society of Nephrology 18, 472-484. Madeira, D., Narciso, L., Cabral, H., Diniz, M., Vinagre, C., 2012. Thermal tolerance of the crab Pachygrapsus marmoratus: intraspecific differences at a physiological (CTMax) and molecular level (Hsp70). Cell Stress and Chaperones 17, 707-716. Madison, B.N., Wang, Y.S., 2006. Haematological responses of acute nitrite exposure in walleye (Sander vitreus). Aquat. Toxicol. 79, 16-23. Maetz, J., 1971. Fish gills: mechanisms of salt transfer in fresh water and sea water. Philosophical Transactions of the Royal Society B: Biological Sciences 262, 209-249. Martinez, C.B., Souza, M.M., 2002. Acute effects of nitrite on ion regulation in two neotropical fish species. Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology 133, 151-160. Mazik, P.M., Hinman, M.L., Winkelmann, D.A., Klaine, S.J., Simco, B.A., Parker, N.C., 1991. Influence of nitrite and chloride concentrations on survival and hematological profiles of striped bass. Trans. Am. Fish. Soc. 120, 247-254. Mevel, G., Chamroux, S., 1981. A study on nitrification in the presence of prawns (Penaeus japonicus) in marine closed systems. Aquaculture 23, 29-43. Ohkawa, H., Ohishi, N., Yagi, K., 1979. Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Anal. Biochem. 95, 351-358. Palachek, R., Tomasso, J., 1984. Toxicity of nitrite to channel catfish (Ictalurus punctatus), tilapia (Tilapia aurea), and largemouth bass (Micropterus salmoides): evidence for a nitrite exclusion mechanism. Can. J. Fish. Aquat. Sci. 41, 1739-1744. Park, I.S., Lee, J., Hur, J.W., Song, Y.C., Na, H.C., Noh, C.H., 2007. Acute Toxicity and Sublethal Effects of Nitrite on Selected Hematological Parameters and Tissues in Dark‐banded Rockfish, Sebastes inermis. J. World Aquacult. Soc. 38, 188-199. 18

Park, J., Daniels, H.V., Cho, S.H., 2013. Nitrite Toxicity and Methemoglobin Changes in Southern Flounder, Paralichthys lethostigma, in Brackish Water. J. World Aquacult. Soc. 44, 726-734. Patrick Saoud, I., Naamani, S., Ghanawi, J., Nasser, N., 2014. Effects of Acute and Chronic Nitrite Exposure on Rabbitfish Siganus rivulatus Growth, Hematological Parameters, and Gill Histology. J Aquac Res Development 5, 2. Peskin, A.V., Winterbourn, C.C., 2000. A microtiter plate assay for superoxide dismutase using a water-soluble tetrazolium salt (WST-1). Clinica Chimica Acta 293, 157-166. Peyssonnaux, C., Eychène, A., 2001. The Raf/MEK/ERK pathway: new concepts of activation. Biol. Cell 93, 53-62. Pickering, A., Pottinger, T., 1989. Stress responses and disease resistance in salmonid fish: effects of chronic elevation of plasma cortisol. Fish Physiol. Biochem. 7, 253-258. Plotnikov, A., Zehorai, E., Procaccia, S., Seger, R., 2011. The MAPK cascades: signaling components, nuclear roles and mechanisms of nuclear translocation. Biochimica et Biophysica Acta (BBA)-Molecular Cell Research 1813, 1619-1633. Raman, M., Chen, W., Cobb, M., 2007. Differential regulation and properties of MAPKs. Oncogene 26, 3100-3112. Rodríguez, L., Begtashi, I., Zanuy, S., Carrillo, M., 2000. Development and validation of an enzyme immunoassay for testosterone: effects of photoperiod on plasma testosterone levels and gonadal development in male sea bass (Dicentrarchus labrax, L.) at puberty. Fish Physiol. Biochem. 23, 141-150. Romano, N., Zeng, C., 2009. Subchronic exposure to nitrite, potassium and their combination on survival, growth, total haemocyte count and gill structure of juvenile blue swimmer crabs, Portunus pelagicus. Ecotoxicol. Environ. Saf. 72, 1287-1295. Rotruck, J., Pope, A., Ganther, H., Swanson, A., Hafeman, D.G., Hoekstra, W., 1973. Selenium: biochemical role as a component of glutathione peroxidase. Science 179, 588-590. Sampaio, L., Wasielesky, W., Miranda-Filho, K.C., 2002. Effect of salinity on acute toxicity of ammonia and nitrite to juvenile Mugil platanus. Bull. Environ. Contam. Toxicol. 68, 668-674. Scarano, G., Saroglia, M., Gray, R., Tibaldi, E., 1984. Hematological responses of sea bass Dicentrarchus labrax to sublethal nitrite exposures. Trans. Am. Fish. Soc. 113, 360-364. SHENG, L.-x., YU, W.-g., XU, J.-b., ZHENG, Y.-c., WANG, Y.-b., 2007. Effects of temperature and copper on HSP70 expression in carp serum [J]. Journal of Northeast Normal University (Natural Science Edition) 1, 022. Sies, H., Stahl, W., Sevanian, A., 2005. Nutritional, dietary and postprandial oxidative stress. The Journal of nutrition 135, 969-972. Siikavuopio, S.I., Sæther, B.-S., 2006. Effects of chronic nitrite exposure on growth in juvenile Atlantic cod, Gadus morhua. Aquaculture 255, 351-356. Simon, H.-U., Haj-Yehia, A., Levi-Schaffer, F., 2000. Role of reactive oxygen species (ROS) in apoptosis induction. Apoptosis 5, 415-418. 19

Stormer, J., Jensen, F.B., Rankin, J.C., 1996. Uptake of nitrite, nitrate, and bromide in rainbow trout,(Oncorhynchus mykiss): effects on ionic balance. Can. J. Fish. Aquat. Sci. 53, 1943-1950. Sun, S., Ge, X., Zhu, J., Xuan, F., Jiang, X., 2014a. Identification and mRNA expression of antioxidant enzyme genes associated with the oxidative stress response in the Wuchang bream (Megalobrama amblycephala Yih) in response to acute nitrite exposure. Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology 159, 69-77. Sun, S., Zhu, J., Ge, X., Zhang, C., Miao, L., Jiang, X., 2014b. Cloning and expression analysis of a heat shock protein 90 β isoform gene from the gills of Wuchang bream (Megalobrama amblycephala Yih) subjected to nitrite stress. Genetics and molecular research: GMR 14, 3036-3051. Svobodova, Z., Machova, J., Poleszczuk, G., Hůda, J., Hamáčková, J., Kroupova, H., 2005. Nitrite poisoning of fish in aquaculture facilities with water-recirculating systems. Acta Vet Brno 74, 129-137. Takle, H., Andersen, Ø., 2007. Caspases and apoptosis in fish. J. Fish Biol. 71, 326-349. Tomasso, J., 2012. Environmental nitrite and aquaculture: a perspective. Aquacult. Int. 20, 1107-1116. Üner, N., Oruç, E.Ö., Canli, M., Sevgler, Y., 2001. Effects of cypermethrin on antioxidant enzyme activities and lipid peroxidation in liver and kidney of the freshwater fish, Oreochromis niloticus and Cyprinus carpio (L.). Bull. Environ. Contam. Toxicol. 67, 657-664. Vijayan, M., Moon, T., 1994. The stress response and the plasma disappearance of corticosteroid and glucose in a marine teleost, the sea raven. Can J Zool 72, 379-386. Wang, J., Lenardo, M.J., 2000. Roles of caspases in apoptosis, development, and cytokine maturation revealed by homozygous gene deficiencies. J. Cell Sci. 113, 753-757. Wang, W.-N., Wang, A.-L., Zhang, Y.-J., Li, Z.-H., Wang, J.-X., Sun, R.-Y., 2004a. Effects of nitrite on lethal and immune response of Macrobrachium nipponense. Aquaculture 232, 679-686. Wang, W., Vinocur, B., Shoseyov, O., Altman, A., 2004b. Role of plant heat-shock proteins and molecular chaperones in the abiotic stress response. Trends Plant Sci. 9, 244-252. Wang, X., Martindale, J.L., Holbrook, N.J., 2000. Requirement for ERK activation in cisplatin-induced apoptosis. J. Biol. Chem. 275, 39435-39443. Wang, Y., Wang, S., Luo, X., Yang, Y., Jian, F., Wang, X., Xie, L., 2014. The roles of DNA damage-dependent signals and MAPK cascades in tributyltin-induced germline apoptosis in Caenorhabditis elegans. Chemosphere 108, 231-238. Williams, E., Eddy, F., 1986. Chloride uptake in freshwater teleosts and its relationship to nitrite uptake and toxicity. Journal of Comparative Physiology B 156, 867-872. Wuertz, S., Schulze, S., Eberhardt, U., Schulz, C., Schroeder, J., 2013. Acute and chronic nitrite toxicity in juvenile pike-perch (Sander lucioperca) and its 20

compensation by chloride. Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology 157, 352-360. Xia, Z., Dickens, M., Raingeaud, J., Davis, R.J., Greenberg, M.E., 1995. Opposing effects of ERK and JNK-p38 MAP kinases on apoptosis. Science 270, 1326-1331. Xian, J.-A., Wang, A.-L., Chen, X.-D., Gou, N.-N., Miao, Y.-T., Liao, S.-A., Ye, C.-X., 2011. Cytotoxicity of nitrite on haemocytes of the tiger shrimp, Penaeus monodon, using flow cytometric analysis. Aquaculture 317, 240-244. Xie-fa, S., Yi-ming, C., Lei, P., Qiang, L., Deng-pan, D., 2012. Effects of DO, ammonia and nitrite on growth and metabolism of juvenile turbot. Fishery Modernization 6, 1-9. Zhang, F., Ni, C., Kong, D., Zhang, X., Zhu, X., Chen, L., Lu, Y., Zheng, S., 2012. Ligustrazine attenuates oxidative stress-induced activation of hepatic stellate cells by interrupting platelet-derived growth factor-β receptor-mediated ERK and p38 pathways. Toxicol. Appl. Pharmacol. 265, 51-60. Zhang, Y., Ye, C., Wang, A., Zhu, X., Chen, C., Xian, J., Sun, Z., 2015. Isolated and combined exposure to ammonia and nitrite in giant freshwater pawn (Macrobrachium rosenbergii): effects on the oxidative stress, antioxidant enzymatic activities and apoptosis in haemocytes. Ecotoxicology, 1-10.

21

Hb (g/L)

A 70 60 50 40 30 20 10 0

a a aa a

0

0 mM

B

MetHb (%)

60

Two-Way ANOVA: Nitrite concentration * Exposure time * Interaction * a a a a a a a a a a a bb b b

24 48 Time of exposure (h) 0.02 mM 0.08 mM 0.4 mM

0.8 mM

Two-Way ANOVA: Nitrite concentration * Exposure time * Interaction *

50

c

c

40 30

20

96

d

cd

cd

b a a a a a

a a a

a a a

a a a

10

0 0

0 mM

24 48 Time of exposure (h) 0.02 mM 0.08 mM 0.4 mM

96

0.8 mM

Fig. 1. The changes of Hb (A) and MetHb (B) in turbot exposed to different concentrations of nitrite for 96 h. Data with different letters are significantly different (P < 0.05) among treatments. *P < 0.05. The treatment with 0 mM nitrite is control. Values are mean ± SD (n = 24 turbots in each case).

22

a a a a a

0 mM

3.0 Glucose (mM)

2.5 2.0

a

a aa

250

c c

c a

a

24 48 Time of exposure (h) 0.02 mM 0.08 mM 0.4 mM

Two-Way ANOVA: Nitrite concentration Exposure time Interaction a a a a a a a a

150

a a a a a

a b a a a

a

c c

bc bc

a

a a a

a

100 50

* * * ab a

0

0.8 mM

0 mM

D b

b

a a a

3.0 a a

2.5 a a a

1.0 0.5

2.0

24 48 Time of exposre (h) 0.02 mM 0.08 mM 0.4 mM

Two-Way ANOVA: Nitrite concentration * Exposure time NS Interaction NS b a a a a a a a a a

96 0.8 mM

b a a

a

a

b a a a a

1.5 1.0 0.5

0.0 0 0 mM

3.0

200

96

1.5

E

Two-Way ANOVA: Nitrite concentration * Exposure time * Interaction *

0

0

C

a a a a b

bc

HSP 70 (pg/mL)

2.0 1.8 1.6 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0

B

Two-Way ANOVA: Nitrite concentration * Exposure time * Interaction *

TG (mM)

Cortisol (ng/mL)

A

24 48 Time of exposure (h) 0.02 mM 0.08 mM 0.4 mM

0.0

96

0

0.8 mM

0 mM

24 48 Time of exposure (h） 0.02 mM 0.08 mM 0.4 mM

96 0.8 mM

Two-Way ANOVA: Nitrite concentration NS Exposure time NS Interaction NS

CH (mM)

2.5 2.0

1.5 1.0 0.5 0.0

0 0 mM

24 48 Time of exposure (h） 0.02 mM 0.08 mM 0.4 mM

96 0.8 mM

Fig. 2. The changes of plasma parameters in turbot exposed to different concentrations of nitrite for 96 h. Data with different letters are significantly different (P < 0.05) among treatments. NS, non-significant at P > 0.05; *P < 0.05. The treatment with 0 mM nitrite is control. Values are mean ± SD (n = 24 turbots in each case).

23

Na + (mM)

A 200 180 160 140 120 100 80 60 40 20 0

Two-Way ANOVA: Nitrite concentration * Exposure time NS Interaction NS a a a a a a a a a a a a a a ab b ab b b b

0

0 mM

K + (mM)

B 10 9 8 7 6 5 4 3 2 1 0

Cl – (mM)

0.8 mM

b b a a a

24 48 Time of exposure (h） 0.02 mM 0.08 mM 0.4 mM

0 mM

160 140 120 100 80 60 40 20 0

96

Two-Way ANOVA: Nitrite concentration * Exposure time * Interaction * b b a a b a a a a a a a a a a

0

C

24 48 Time of exposure (h） 0.02 mM 0.08 mM 0.4 mM

96

0.8 mM

Two-Way ANOVA: Nitrite concentration NS Exposure time NS Interaction NS

0 0 mM

24 48 Time of exposure (h） 0.02 mM 0.08 mM 0.4 mM

96 0.8 mM

Fig. 3. The changes of ion concentration in blood of turbot exposed to different concentrations of nitrite for 96 h. Data with different letters are significantly different (P < 0.05) among treatments. NS, non-significant at P > 0.05; *P < 0.05. The treatment with 0 mM nitrite is control. Values are mean ± SD (n = 24 turbots in each case).

24

Two-Way ANOVA: Nitrite concentration NS Exposure time * Interaction NS a a a a a a a a a a a a ab a a a a a b b

0 0 mM

GPx (U/mgprot)

C 90 80 70 60 50 40 30 20 10 0

MDA (nmol/mgprot)

20

15

Two-Way ANOVA: Nitrite concentration * Exposure time * Interaction * a a a a a a a a a a a a a a a a a b b b

10 5

0

96

0

0.8 mM

0 mM

D 12 10

8

24 48 Time of exposure (h) 0.02 mM 0.08 mM 0.4 mM

96

0.8 mM

Two-Way ANOVA: Nitrite concentration * Exposure time * Interaction * a a a a a a a a a a a a a a b b b b b b

6 4 2

0

0 mM

8 7 6 5 4 3 2 1 0

25

Two-Way ANOVA: Nitrite concentration NS Exposure time * Interaction NS a a a a a a a a a a a a a a ab a ab b c c

0

E

24 48 Time of exposure (h) 0.02 mM 0.08 mM 0.4 mM

B CAT (U/mgprot)

160 140 120 100 80 60 40 20 0

GSH (µg/mgprot)

SOD (U/mgprot)

A

24 48 Time of exposure (h) 0.02 mM 0.08 mM 0.4 mM

Two-Way ANOVA: Nitrite concentration * Exposure time * Interaction * bc a ab ab ab a a a a a a a a a a

0

0 mM

24 48 Time of exposure (h)

0.02 mM

0.08 mM

0.4 mM

96

0

0.8 mM

0 mM

24 48 Time of exposure (h) 0.02 mM 0.08 mM 0.4 mM

96 0.8 mM

c c c a a

96

0.8 mM

Fig. 4. The changes of antioxidant capacity and lipid peroxidation in gills of turbot exposed to different concentrations of nitrite for 96 h. Data with different letters are significantly different (P < 0.05) among treatments. NS, non-significant at P > 0.05; *P < 0.05. The treatment with 0 mM nitrite is control. Values are mean ± SD (n = 24 turbots in each case).

25

ERK1 mRNA levels (arbitary units)

A 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0

Two-Way ANOVA: Nitrite concentration NS Exposure time NS Interaction NS

0 0 mM

JUK1 mRNA levels (arbitary units)

B 5.0 4.5 4.0 3.5 3.0 2.5 2.0 1.5 1.0 0.5 0.0

0.02 mM

24 48 Time of exposure 0.08 mM 0.4 mM

96 0.8 mM

Two-Way ANOVA: Nitrite concentration * Exposure time * Interaction *

c b

b b a a a a a

0 0 mM

a a a a a

a ab a

ab a a

24 48 Time of exposure (h) 0.02 mM 0.08 mM 0.4 mM

96 0.8 mM

Fig. 5. Gene expression levels of ERK1 (A) and JUK1 (B) in gills of turbot exposed to different concentrations of nitrite for 96 h. Data with different letters are significantly different (P < 0.05) among treatments. NS, non-significant at P > 0.05; *P < 0.05. The treatment with 0 mM nitrite is control. The values were normalized to control values at time zero and expressed as mean ± SD (n = 24 turbots in each case).

26

2.5

Two-Way ANOVA: Nitrite concentration * Exposure time * Interaction *

B c

2.0

bc

bc 1.5 a a a a a 1.0

a a a

a

a

a a

a a

Caspase -3 mRNA levels (arbitary units)

P53 mRNA levels (arbitary units)

A

a

a

ab

0.5 0.0

0 mM

Caspase -7 mRNA levels (arbitary units)

C 4.0 3.5 3.0 2.5 2.0 1.5 1.0 0.5 0.0

24 48 Time of exposure 0.02 mM 0.08 mM 0.4 mM

a a a a a

0 0 mM

a a ab

24 48 Time of exposure (h) 0.02 mM 0.08 mM 0.4 mM

1.0 0.5 0.0

0 mM

D c

b

a

1.5

0.8 mM

b

ab

2.0

0

Two-Way ANOVA: Nitrite concentration * Exposure time * Interaction *

a a a a

2.5

Two-Way ANOVA: Nitrite concentration * Exposure time * Interaction * d cd bc b bc b a a ab ab a a a a a a a a a a

96

a

a

a

Caspase -9 mRNA levels (arbitary units)

0

3.0

3.0

96 0.8 mM

Two-Way ANOVA: Nitrite concentration * Exposure time * Interaction *

c c

2.5 ab ab

2.0 1.5

a a a a a

1.0

a a a a a

b b

a

a a a

0.5

0.0 0

96 0.8 mM

24 48 Time of exposure (h) 0.02 mM 0.08 mM 0.4 mM

0 mM

24 48 Time of exposure (h) 0.02 mM 0.08 mM 0.4 mM

96 0.8 mM

Fig. 6. Gene expression levels of P53 (A), caspase-3 (B), caspase-7 (C) and caspase-9 (D) in gills of turbot exposed to different concentrations of nitrite for 96 h. Data with different letters are significantly different (P < 0.05) among treatments. The values were normalized to control values at time zero and expressed as mean ± SD (n = 24 turbots in each case).

27

Nitrite

Gills

NO

Blood

Ionic homeostasis variation

MetHb Oxidative stress

JUK activation Hypoxia stress P53 activation Cortisol

Loss of antioxidants

Glucose

HSP70

Caspase -9 Lipid peroxidation Caspase -3 and -7

Apoptosis

Fig. 7. Schematic model of nitrite-induced toxicity in turbot. In blood, nitrite exposure altered ionic homeostasis, helped in the production of MetHb which resulted in stress response and increases of cortisol, glucose and HSP70 levels. In gills nitrite exposure induced oxidative stress which caused lipid peroxidation and loss of antioxidants. Further, nitrite-induced oxidative stress or NO might activate MAPK/JUK signaling pathways, increased P53 levels and triggered the caspase cascade to promote apoptosis.

28

Table 1: Primers utilized for gene expression analyses by for qRT-PCR. Genes Primer sequence (5’-3’) Amplicon size (pb) ß-actin F: TGAACCCCAAAGCCAACAGG 107 R; AGAGGCATACAGGGACAGCAC ERK1 F: CATTCTCAGGGCAAGGCACAT 226 R: GAGGTCGTAGGTGGTGTTGATGA JUK1 F: GTATTCACGCCGCAAAAGACA 92 R: CAATGTTACTGGGCTTCAGGTCC P53 F: GCGGGCTCAGTATTTTGAAGAC 94 R: GCTCAGCAGGATGGTCGTCA Caspase-3 F: TCGTTCGTCTGTGTCCTGTTGAG 91 R: GCTGTGGAGAAGGCGTAGAGG Caspase-7 F: GACACTCTGGAGACGGATGCTAA 90 R: GTAATAGCCTGGCACAGTGGAGTA Caspase-9 F: TGTTGAGACTCTGGACCGTGTTC 164 R: TTTGAAAGTAGAGAAGTTTGCGGAG

29

Gen Bank

Species

EU686692.1

Scophthalmus maximus Paralichthys olivaceus Cynoglossus semilaevis Scophthalmus maximus Paralichthys olivaceus Cynoglossus semilaevis Cynoglossus semilaevis

AF433655.2 XM_008314798.1 EU711045.1 JQ394697.1 XM_008313782.1 XM_008318763.1

Efficiency (%) 99.7 95.4 98.2 101.3 93.2 103.4 94.8