- Email: [email protected]
Effects of NLRP6 on the proliferation and activation of human hepatic stellate cells
Experimental Cell Research xxx (xxxx) xxx–xxx
Contents lists available at ScienceDirect
Experimental Cell Research journal homepage: www.elsevier.com/locate/yexcr
Effects of NLRP6 on the proliferation and activation of human hepatic stellate cells Yiming Zhua,1, Tao Nib,1, Wensheng Denga, Jiayun Lina, Lei Zhenga, Chihao Zhanga, Meng Luoa, a b
⁎
Department of General Surgery, Shanghai Ninth People’ Hospital, School of Medicine, Shanghai Jiao Tong University, Huangpu, Shanghai, China Department of Plastic and Reconstructive Surgery, Shanghai Ninth People’ Hospital, School of Medicine, Shanghai Jiao Tong University, Huangpu, Shanghai, China
A R T I C LE I N FO
A B S T R A C T
Keywords: NLRP6 Liver fibrosis HSCs TGF-β1/Smad
Nod-like receptor pyrin domain-containing proteins (NLRPs) are known to take part in the pathogenesis of chronic liver diseases, including liver fibrosis. However, no known direct role of NLRP6, a member of NLRPs, has been reported in liver fibrosis. Here, we found that NLRP6 expression was decreased in fibrotic and cirrhotic livers. In a human hepatic stellate cell line, LX-2, overexpression of NLRP6 suppressed cell proliferation, hydroxyproline accumulation, as well as the expression of type I and type III collagens (Col-I and Col-III), α-smooth muscle actin (α-SMA) and matrix metalloproteinases (MMP2 and MMP9), whereas NLRP6 knockdown displayed reverse effects. Furthermore, NLRP6 significantly suppressed the phosphorylation of Smad2/3 (p-Smad2/3) and enhanced the expression of protein phosphatase magnesium dependent 1 A (PPM1A), the only phosphatase for Smad2/3. NLRP6 overexpression abrogated TGF-β1-stimulated hydroxyproline accumulation and p-Smad2/3. Co-immunoprecipitation assay demonstrated that NLRP6 was able to form a complex with PPM1A. NLRP6 overexpression did not change the level of p-Smad2/3 in LX-2 cells with PPM1A knockdown. These data indicated that PPM1A was required for the inhibitory effects of NLRP6 on TGF-β1/Smad2/3 signaling. In conclusion, our results suggest that NLRP6 exerts anti-fibrotic effects in LX-2 cells via regulating PPM1A/Smad2/3 and that NLRP6 may be an effective target in the treatment of liver fibrosis.
1. Introduction Liver fibrosis, a reversible wound-healing process, is the main complication in most chronic liver diseases [1]. The main causes of liver fibrosis have been described, including chronic viral hepatitis B or C infection, autoimmune disease, cholestasis, alcohol abuse and nonalcoholic steatohepatitis (NASH) [2]. Liver fibrosis can progress to cirrhosis if liver injury is persistent [3]. Liver fibrosis is associated with progressive deposition of extracellular matrix (ECM) proteins, such as fibronectin and collagen, within the liver [1]. Hepatic stellate cells (HSCs) are key mediators of liver fibrosis [4–6]. In response to liver injury, HSCs are activated, transdifferentiate into highly proliferative myofibroblasts, and secret several ECM proteins including type I and type III collagens (Col-I and Col-III) [7]. Besides ECM synthesis, matrix degradation also participate in the pathological process of liver fibrosis [8]. Transforming growth factor β (TGF-β) appears to be a key growth factor for HSCs activation and ECM production [9]. Protein phosphatase magnesium dependent 1A (PPM1A, also named PP2Cα), a Ser/Thr protein phosphatase, involved in the regulation of several signaling ⁎
1
pathways, such as p38, c-Jun N-terminal kinase (JNK) [10], Wnt [11,12] and p53 [13]. Importantly, it is identified as the only phosphatase for Smad2 and Smad3, downstream effectors of TGF-β [14]. A recent study has reported that PPM1A exerts anti-fibrogenic effects in carbon tetrachloride- and bile duct ligation-induced liver fibrosis and PPM1A activation might be a promising strategy for the treatment of liver fibrosis [14]. Nod-like receptor pyrin domain-containing protein 6 (NLRP6) belongs to Nod-Like Receptor (NLR) family [15]. NLRP6 plays important roles in infection, autoinflammation and tumorigenesis via negatively regulating mitogen-activated protein kinase (MAPK), the canonical NFκB [16] and Wnt signaling pathways [17]. NLR family protein is a component of inflammasome, which can sense danger signals and active interleukin-1β (IL-1β) and IL-18. The functions of NLR family proteins have been studied in many types of chronic liver diseases, including liver fibrosis [18–23]. NLRP6 inflammasome can modulate the gut microbiota and then negatively regulate the progression of nonalcoholic fatty liver disease (NAFLD)/NASH [18]. However, no known direct role of NLRP6 has been revealed in liver fibrosis. Here we found that NLRP6 expression was decreased in liver fibrosis
Corresponding author. E-mail address: [email protected] (M. Luo). Contribute equally.
https://doi.org/10.1016/j.yexcr.2018.06.040 Received 23 February 2018; Received in revised form 27 June 2018; Accepted 29 June 2018 0014-4827/ © 2018 Published by Elsevier Inc.
Please cite this article as: Zhu, Y., Experimental Cell Research (2018), https://doi.org/10.1016/j.yexcr.2018.06.040
Experimental Cell Research xxx (xxxx) xxx–xxx
Y. Zhu et al.
Fig. 1. NLRP6 expression was decreased in liver fibrosis and cirrhosis. (A) NLRP6 mRNA expression was determined by real-time PCR in hepatic specimens. * **P < 0.001 versus normal tissues; ###P < 0.001 versus liver fibrosis. (B) NLRP6 protein expression was determined by western blot analysis. (C) Immunohistochemical staining was performed to detect NLRP6 in hepatic specimens (n = 6 per group). Representative images are shown. Scale bar: 100 µm.
5′-CGTCTCGTACAGGCAGTACAG −3′ (reverse primer); GAPDH, 5′CACCCACTCCTCCACCTTTG −3′ (forward primer) and 5′- CCACCAC CCTGTTGCTGTAG −3′ (reverse primer); MMP2, 5′- TTGGTGGGAACT CAGAAG −3′ (forward primer) and 5′- TTGCGGTCATCATCGTAG −3′ (reverse primer); MMP9, 5′- AAGGGCGTCGTGGTTCCAACTC-3′ (forward primer) and 5′- AGCATTGCCGTCCTGGGTGTAG-3′ (reverse primer). The expression of NLRP6, MMP2 and MMP9 were all normalized to GAPDH expression as previously described [25].
and cirrhosis. NLRP6 significantly suppressed cell proliferation and reduced collagen expression in an immortalized human HSC line, LX-2. Further investigation revealed that the anti-fibrotic effects of NLRP6 were mainly through inhibiting TGF-β/Smad2/3 signaling pathway and PPM1A was required for this process. Our data here provide new evidence for NLRP6 as the potential target in the treatment of liver fibrosis. 2. Materials and methods 2.1. Liver specimens
2.3. Western blot analysis
Ethical approval was provided by the independent ethics committee of Shanghai Ninth People’ Hospital (Shanghai, China). Ten patients without evidence of liver disease (normal), 15 patients with fibrosis and 30 patients with cirrhosis participated in this study after informed and written consent was obtained according to the guidelines of the ethics committee. Liver biopsy tissue from patients was scored for fibrosis by the METAVIR system [24], and separated into groups with normal (F0, n = 10), fibrosis (F1-F3, n = 15) or cirrhosis (F4-F5, n = 30). Liver specimens were resected from the participants, snap-frozen immediately in liquid nitrogen and stored at − 80 °C until use.
Total protein was isolated with radioimmunoprecipitation assay (RIPA) buffer supplemented with protease cocktail (Sigma, St. Louis, MO, USA). Equal amount of proteins (30 μg) from different samples was subject to 10% SDS-polyacrylamide gel electrophoresis and transferred to nitrocellulose membrane (EMD Millipore, Bedford, MA, USA). After blocking the membranes with 5% nonfat milk, the membranes were probed with primary antibodies as per the manufacturers’ instructions. After washing, the membranes were incubated with horseradish peroxidase-conjugated secondary antibody (Beyotime Institute of Biotechnology, Shanghai, China) followed by detection with Enhanced Chemiluminescence (ECL) Analysis Kit (EMD Millipore). The sources of primary antibodies are listed as followed: anti-NLRP6 (ABF29) from Millipore; α-smooth muscle actin (α-SMA, #14968 [26]), anti-PPM1A (#3549 [27]), anti-p-Smad2/3 (#8828 [28]), anti-Smad2/3(#8685 [28]) and anti-GAPDH (#5174 [29]) from Cell Signaling (Danvers, MA, USA); anti-MMP2 (matrix metalloproteinase 2, ab97779 [30]) and antiMMP9 (ab73734 [31]) from Abcam (Cambridge, MA, USA). Western blot was repeated 3 times and representative blots are shown.
2.2. Real-time PCR Total RNA was extracted with Tizol Reagent (Thermo Fisher Scientific) following the manufacturer's protocol. Two micrograms of total RNA was reversed transcribed using Reverse Transcription Reagents (Promega, Madison, WI, USA). Real-time PCR was performed in ABI Prism 7300 (Applied Biosystems, Foster City, CA, USA) with SYBR Green Mix (Thermo Fisher Scientific). The primers are as follows: NLRP6, 5′- TTCGGCTGCATGGTTTCAGAG −3′ (forward primer) and 2
Experimental Cell Research xxx (xxxx) xxx–xxx
Y. Zhu et al.
Science (Shanghai, China) were cultured in Dulbecco's modified Eagle's medium (Hyclone, Logan, UT, USA) in the present of 10% fetal bovine serum (Thermo Fisher Scientific, Waltham, MA, USA). The cells were grown at 37 °C in a humidified atmosphere of 5% CO2/95% air. 2.6. Small interfering RNA and ectopic expression NLRP6 specific siRNAs (siNLRP6-1, 5′- GUGUCCGAGUACAAGAAG AUU-3′; siNLRP6-2, 5′- CUACAAGUAUUUCCGGGAUUU-3′; and siNLRP6-3, 5′- GAACUCAUCUCGACCUUCUUU-3′), PPM1A specific siRNA [32] (siPPM1A, 5′-GCGUGAUUUCAAACCAUAAUU-3′), and nonsense siRNA (siNC, 5′- CCUACAUCCCGAUCGAUGAUGUU-3′) were prepared by GenePharma (Shanghai, China). siRNAs were introduced into LX-2 cells at a final concentration of 200 nM using Lipofectamine 2000 (Invitrogen). Human NLRP6 CDNA was inserted into the AgeI/EcoRI sites of a lentiviral expression vector GV348 (Genechem, Shanghai, China) and confirmed by DNA sequencing. Lentivirus expressing NLRP6 (NLRP6 OE) or control vector was generated by using 293 T cells. 2.7. Cell proliferation assay LX-2 cells (3000 cells/well) were seeded in triplicate. After culture overnight, the cells were transduced with Vector/NLRP6 OE lentivirus or transfected with siNLRP6-2/siNC. After incubation for 0, 24, 48 and 72 h, the cells were incubated with CCK-8 solution (SAB biotech. College Park, MD, USA) for 1 h and optical density (OD) values were measured at 450 nm using the manufacturer's protocol. 2.8. Measurement of hydroxyproline content LX-2 cells were lysed after treatment. Then, hydroxyproline content in the lysates was measured with commercially available kit (Jiancheng Institute of Biotechnology, Nanjing, China) in accordance with the manufacturer's protocols. 2.9. Enzyme-linked immunosorbent assay (ELISA) The cultured supernatant was collected from LX-2 cells and used to measure the concentrations of Col-I and Col-III with ELISA assay kits (Ebioscience, San Diego, CA, USA) following the manufacturer's instructions.
Fig. 2. NLRP6 significantly suppressed LX-2 cell proliferation. (A, B) LX-2 cells were transduced with Vector/NLRP6 OE lentivirus or transfected with siNLRP61/siNLRP6-2/siNLRP6-3/siNC. At 48 h after treatment, the mRNA and protein expression of NLRP6 was determined by real-time PCR (A) and western blot analysis (B), respectively. Western blot was repeated 3 times and representative blots are shown. (C) LX-2 cells were transduced with Vector/NLRP6 OE lentivirus or transfected with siNLRP6-2/siNC. CCK-8 assay was performed to assess cell proliferation at 0, 24, 48 and 72 h after treatment. * *P < 0.01, * **P < 0.001 versus Vector group; #P < 0.05, ##P < 0.01, ###P < 0.001 versus siNC group.
2.10. Co-immunoprecipitation (Co-IP) assay Total lysate extracted from LX-2 cells (500 μg) were incubated with anti-NLRP6 (Santa Cruz) or anti-PPM1A (Cell Signaling) or IgG at 4 °C for 2 h, and then with protein G-Sepharose beads at 4 °C overnight. The beads were washed 3–4 times with lysis buffer, boiled in SDS loading buffer for 5 min, and then subjected to western blot analysis with total lysate as positive control.
2.4. Immunohistochemical staining (IHC)
2.11. Statistical analysis
Liver specimens were fixed in 4% formaldehyde, paraffin embedded, and cut into 5-μm-thick sections in accordance with routine procedure. Following section deparaffinization and rehydration, antigen retrieval was performed in a pressure cooker using 0.01 M citrate buffer (pH 6.0). Endogenous peroxidase was blocked with 3% hydrogen peroxide for 10 min. IHC staining was then conduced with anti-NLRP6 (Abcam, ab198798, 1:50) according to the manufacturer's protocol.
All values were expressed as mean ± standard deviation (SD). Statistical significance was analyzed using one-way ANOVA with the GraphPad prism v6 (GraphPad Software Inc., La Jolla, CA, USA). P < 0.05 was considered as statistically significant. 3. Results 3.1. NLRP6 expression was decreased in liver fibrosis and cirrhosis We detected the mRNA expression of NLRP6 in normal liver tissues (n = 10) and liver samples from patients with liver fibrosis (n = 15) or cirrhosis (n = 30). As shown in Fig. 1A, comparing with normal liver
2.5. Cell culture LX-2 cells obtained from the cell bank of Chinese Academy of 3
Experimental Cell Research xxx (xxxx) xxx–xxx
Y. Zhu et al.
Fig. 3. NLRP6 significantly reduces collagen production and α-SMA expression in LX-2 cells. LX-2 cells were transduced with Vector/NLRP6 OE lentivirus or transfected with siNLRP6-2/siNC. At 48 h after treatment, hydroxyproline content (A), the release of Col-I and Col-III (B), and α-SMA protein expression was measured. ***P < 0.001 versus Vector group; ###P < 0.001 versus siNC group.
Fig. 4. NLRP6 reduced MMP2/9 expression in LX-2 cells. LX-2 cells were transduced with Vector/NLRP6 OE lentivirus or transfected with siNLRP6-2/siNC. At 48 h after treatment, the mRNA and protein expression of MMP2 and MMP9 was determined by real-time PCR (A) and western blot analysis (B), respectively. Western blot was repeated 3 times and representative blots are shown. ***P < 0.001 versus Vector group; ###P < 0.001 versus siNC group.
tissues, the NLRP6 mRNA in liver fibrosis and cirrhosis decreased by 42.8% and 81.8%, respectively. Western blot (Fig. 1B) and IHC staining (Fig. 1C) indicated that the protein expression of NLRP6 in normal liver specimens and liver samples from patients with chronic disease had the similar trend. These findings suggested that NLRP6 may be involved in the pathogenesis of liver fibrosis and cirrhosis.
transfected with nonsense siRNA (siNC), NLRP6 expression was decreased by 47.1%, 84.7% and 47.2% in LX-2 cells transfection with NLRP6-specific siRNAs (siNLRP6-1, −2 and −3), respectively. siNLRP6-2 had the best knockdown efficiency and was used in the subsequent experiments. The changes of NLRP6 protein expression were consistent with its mRNA expression (Fig. 2B). Subsequently, the effect of NLRP6 on the proliferation of LX-2 was assessed by CCK-8 assay. NLRP6 overexpression significantly inhibited HSC proliferation at 24 h, 48 h and 72 h after virus transduction (Fig. 2C), while complementary results were observed in HSCs with NLRP6 knockdown. These data suggested the inhibitory functions of NLRP6 on HSC proliferation.
3.2. NLRP6 significantly suppressed LX-2 cell proliferation HSCs are key mediators of liver fibrosis [4–6]. To determine whether NLRP6 affected liver fibrosis, an immortalized human stellate cell line, LX-2 cell, was used. First, we manipulated NLRP6 expression in LX-2 cells by lentiviral transduction and siRNA transfection. As illustrated in Fig. 2A, NLRP6 mRNA in LX-2 cells transduced with NLRP6 overexpressing virus (NLRP6 OE) increased to 3.17 fold as compared to those transduced with control Vector virus. Comparing with LX-2 cells 4
Experimental Cell Research xxx (xxxx) xxx–xxx
Y. Zhu et al.
Fig. 5. TGF-β signaling was involved in the anti-fibrogenic function of NLRP6. (A) LX-2 cells were transduced with Vector/NLRP6 OE lentivirus or transfected with siNLRP6-2/siNC. At 48 h after treatment, the protein levels of PPM1A, p-Smad2/3 and Smad2/3 were determined by western blot analysis. Western blot was repeated 3 times and representative blots are shown. (B, C) LX-2 cells were transduced with Vector/NLRP6 OE lentivirus for 16 h, and starved overnight, then treated with TGF-β1 (5 ng/ml; Sigma) for 24 h. The protein levels of p-Smad2/3 and Smad2/3 (B), and hydroxyproline content were evaluated (C). **P < 0.01, ***P < 0.001. (D) Binding of NLRP6 to PPM1A was examined in LX-2 cells by immunoprecipitation (IP) and western blot. IgG was used as a negative control. (E) LX-2 cells were treated with Vector/NLRP6 OE lentivirus and siPPM1A/siNC. At 48 h after treatment, the protein levels of PPM1A, p-Smad2/3 and Smad2/3 were determined by western blot analysis.
3.3. NLRP6 significantly reduces collagen production and α-SMA expression in LX-2 cells
protein expression of MMP2 and MMP9 was also detected. As shown in Fig. 4, NLRP6 overexpression cause a significant decrease in the mRNA and protein expression of MMP2 and MMP9, while complementary results were obtained in NLRP6 knockdown cells.
To determine the effect of NLRP6 on collagen production, hydroxyproline content, as well as the release of Col-I and Col-III was examined in LX-2 cells with NLRP6 overexpression or knockdown. Hydroxyproline content was decreased in LX-2 cells with NLRP6 overexpression (4.1 ± 0.4 μg/mg protein) compared with the control Vector group (11.8 ± 1.3 μg/mg protein), and it was increased in the LX-2 cells with NLRP6 knockdown (26.3 ± 2.3 μg/mg protein) compared with the control siNC group (11.7 ± 1.3 μg/mg protein). Consistently, concentration of Col-I and Col-III in NLRP6 overexpressed cells were significantly reduced in NLRP6 overexpressed cells compared with the control Vector group (Col-I: 28.2 ± 0.2 μg/l vs. 56.2 ± 0.3 μg/l; Col-III, 50.8 ± 0.4 μg/l vs. 89.6 ± 0.5 μg/l), while reverse results were observed in NLRP6 knockdown cells compared with the control siNC group (Col-I: 70.9 ± 0.2 μg/l vs. 56.3 ± 0.2 μg/ l; Col-III, 130.3 ± 0.7 μg/l vs. 90.0 ± 0.5 μg/l) (Fig. 3B). The protein levels of α-SMA, a marker of fibrosis, were determined by western blot. The results showed that α-SMA expression was decreased by NLRP6 overexpression and increased by NLRP6 knockdown (Fig. 3C).
3.5. TGF-β signaling was involved in the anti-fibrogenic function of NLRP6 The protein levels of PPM1A (the only phosphatase for Smad2 and Smad3 [14]), Smad2/3 and phosphorylated Smad2/3 (p-Smad2/3) were also detected. As showed in Fig. 5A, PPM1A protein expression was enhanced by NLRP6 overexpression, whereas suppressed by NLRP6 knockdown. The level of p-Smad2/3 showed the opposite change. We then tried to explore the molecular mechanism how NLRP6 exerted anti-fibrogenic functions. LX-2 cells with or without NLRP6 overexpression were treated with TGF-β1 (5 ng/ml) for 24 h. The level of p-Smad2/3 (Fig. 5B) and hydroxyproline content (Fig. 5C) were increased in LX-2 cells with TGF-β1 treatment, which could be abrogated by NLRP6 overexpression. These data suggested that NLRP6 may work as an anti-fibrogenic factor via inhibiting TGF-β/Smad2/3 signaling. We next examined the potential interaction between NLRP6 and PPM1A. Co-IP assays demonstrated that NLRP6 formed a complex with PPM1A in LX-2 cells (Fig. 5D). To further validate the requirement of PPM1A on the effects of NLRP6, we knocked down the endogenous PPM1A using siRNA transfection. As shown in Fig. 5E, in LX-2 cells with PPM1A knockdown, NLRP6 overexpression did not change the level of p-Smad2/3, suggesting that the inhibitory effects of NLRP6 on TGF-β/ Smad2/3 signaling was dependent on PPM1A.
3.4. NLRP6 reduced MMP2/9 expression in LX-2 cells MMP2 and MMP9 are the most related matrix metalloproteinases (MMPs) that participate in the process of liver fibrosis [8]. To further determine the effect of NLRP6 on fibrogenic activation, the mRNA and 5
Experimental Cell Research xxx (xxxx) xxx–xxx
Y. Zhu et al.
4. Discussion
References
Emerging evidence has suggested that NLR family proteins play a critical role in many types of chronic liver diseases, such as NAFLD, NASH and liver fibrosis [18–23]. Two recent studies using NLRP3 knockout mice [23] and knock-in mice [19] have suggested that NLRP3 may promote HSC activation and collagen deposition, thus leading to liver fibrosis. In the current study, NLRP6 was found down-regulated in fibrosis and cirrhosis specimens compared to the normal liver specimens (Fig. 1). To determine whether NLRP6 is involved in hepatic fibrogenesis, NLRP6 was overexpression or knocked down in LX-2 cells, a human HSC line, and then cell proliferation, hydroxyproline content, as well as the release of Col-I and Col-III were measured. The results showed that NLRP6 overexpression significantly attenuated not only cell proliferation (Fig. 2) but also collagen production (Fig. 3), while NLRP6 knockdown had reverse effects. Thus, our study firstly demonstrated the anti-fibrogenic role of NLRP6 in vitro. Liver matrix degradation also participate in the pathogenesis of liver fibrosis [8]. Matrix metalloproteinases (MMPs), including MMP2 and MMP9, are the main enzymes responsible for the degradation of normal liver matrix. Increased activity of MMP2 and MMP9 is observed during liver fibrosis in both human specimens and animal models [33]. In the current study, the expression of MMP2 and MMP9 was decreased obviously after NLRP6 overexpression and increased after NLRP6 knockdown at both transcriptional and translational levels (Fig. 4). These data indicated that NLRP6 may inhibit fibrogenesis of HSCs by inhibiting matrix degradation. TGF-β signaling is essential for HSCs activation and ECM production during liver fibrosis [9]. The suppression of TGF-β expression or its downstream signal transduction pathway could reduce fibrogenesis and be used as a therapy strategy for liver fibrosis [34]. The current study showed that the phosphorylation of Smad2/3 was significantly inhibited by NLRP6 overexpression, and enhanced by NLRP6 knockdown. These results were consistent with the anti-fibrogenic role of NLRP6. Unsurprisingly, the level of p-Smad2/3 and hydroxyproline content were increased in LX-2 cells with TGF-β1 treatment. More importantly, NLRP6 overexpression abrogated the fibrogenic functions of TGF-β1. Our data suggested that TGF-β/Smad2/3 signaling was involved in the anti-fibrogenic role of NLRP6. Moreover, PPM1A, as the only phosphatase for Smad2 and Smad3, has anti-fibrogenic effects in vivo [14]. Here, we demonstrated that NLRP6 formed a complex with PPM1A in LX-2 cells by Co-IP assays. The protein level of PPM1A was associated with that of NLRP6. Moreover, NLRP6 overexpression had no effects on the level of p-Smad2/3 in LX-2 cells with PPM1A knockdown. Our data indicated that PPM1A was required for the inhibitory effects of NLRP6 on TGF-β/Smad2/3 signaling and HSC activation, although the detailed mechanism how NLRP6 affected the protein levels of PPM1A needed further investigation. Conclusively, the present work has indicated that NLRP6 expression was decreased in liver fibrosis and cirrhosis. NLRP6 may work as an anti-fibrogenic factor in LX-2 cells via inhibiting TGF-β/Smad2/3 signaling and PPM1A, a Smad phosphatase, was required for the functions of NLRP6. NLRP6 could be a promising target for the treatment of liver fibrosis.
[1] S.L. Friedman, Hepatic fibrosis – overview, Toxicology 254 (2008) 120–129. [2] R. Bataller, D.A. Brenner, Liver fibrosis, J. Clin. Investig. 115 (2005) 209–218. [3] E.A. Tsochatzis, J. Bosch, A.K. Burroughs, Future treatments of cirrhosis, Expert Rev. Gastroenterol. Hepatol. 8 (2014) 571–581. [4] H.L. Reeves, S.L. Friedman, Activation of hepatic stellate cells–a key issue in liver fibrosis, Front. Biosci.: a J. Virtual Libr. 7 (2002) d808–d826. [5] E. Gabele, D.A. Brenner, R.A. Rippe, Liver fibrosis: signals leading to the amplification of the fibrogenic hepatic stellate cell, Front. Biosci.: a J. Virtual Libr. 8 (2003) d69–d77. [6] J.E. Puche, Y. Saiman, S.L. Friedman, Hepatic stellate cells and liver fibrosis, Compr. Physiol. 3 (2013) 1473–1492. [7] S.L. Friedman, Liver fibrosis: from mechanisms to treatment, Gastroenterol. Clin. Et. Biol. 31 (2007) 812–814. [8] M.J. Arthur, Fibrogenesis II. Metalloproteinases and their inhibitors in liver fibrosis, Am. J. Physiol. Gastrointest. liver Physiol. 279 (2000) G245–G249. [9] C. Meyer, P. Godoy, A. Bachmann, Y. Liu, D. Barzan, I. Ilkavets, P. Maier, C. Herskind, J.G. Hengstler, S. Dooley, Distinct role of endocytosis for Smad and non-Smad TGF-beta signaling regulation in hepatocytes, J. Hepatol. 55 (2011) 369–378. [10] M. Takekawa, T. Maeda, H. Saito, Protein phosphatase 2Calpha inhibits the human stressresponsive p38 and JNK MAPK pathways, EMBO J. 17 (1998) 4744–4752. [11] S. Zolnierowicz, Type 2A protein phosphatase, the complex regulator of numerous signaling pathways, Biochem. Pharmacol. 60 (2000) 1225–1235. [12] E.T. Strovel, D. Wu, D.J. Sussman, Protein phosphatase 2Calpha dephosphorylates axin and activates LEF-1-dependent transcription, J. Biol. Chem. 275 (2000) 2399–2403. [13] P. Ofek, D. Ben-Meir, Z. Kariv-Inbal, M. Oren, S. Lavi, Cell cycle regulation and p53 activation by protein phosphatase 2C alpha, J. Biol. Chem. 278 (2003) 14299–14305. [14] L. Wang, X. Wang, J. Chen, Z. Yang, L. Yu, L. Hu, X. Shen, Activation of protein serine/ threonine phosphatase PP2Calpha efficiently prevents liver fibrosis, PloS One 5 (2010) e14230. [15] J.M. Grenier, L. Wang, G.A. Manji, W.J. Huang, A. Al-Garawi, R. Kelly, A. Carlson, S. Merriam, J.M. Lora, M. Briskin, P.S. DiStefano, J. Bertin, Functional screening of five PYPAF family members identifies PYPAF5 as a novel regulator of NF-kappaB and caspase1, FEBS Lett. 530 (2002) 73–78. [16] P.K. Anand, R.K. Malireddi, J.R. Lukens, P. Vogel, J. Bertin, M. Lamkanfi, T.D. Kanneganti, NLRP6 negatively regulates innate immunity and host defence against bacterial pathogens, Nature 488 (2012) 389–393. [17] P.K. Anand, T.D. Kanneganti, NLRP6 in infection and inflammation, Microbes Infect. 15 (2013) 661–668. [18] G. Szabo, J. Petrasek, Inflammasome activation and function in liver disease, Nat. Rev. Gastroenterol. Hepatol. 12 (2015) 387–400. [19] A. Wree, A. Eguchi, M.D. McGeough, C.A. Pena, C.D. Johnson, A. Canbay, H.M. Hoffman, A.E. Feldstein, NLRP3 inflammasome activation results in hepatocyte pyroptosis, liver inflammation, and fibrosis in mice, Hepatol. (Baltim., Md.) 59 (2014) 898–910. [20] J. Henao-Mejia, E. Elinav, C. Jin, L. Hao, W.Z. Mehal, T. Strowig, C.A. Thaiss, A.L. Kau, S.C. Eisenbarth, M.J. Jurczak, J.P. Camporez, G.I. Shulman, J.I. Gordon, H.M. Hoffman, R.A. Flavell, Inflammasome-mediated dysbiosis regulates progression of NAFLD and obesity, Nature 482 (2012) 179–185. [21] G. Szabo, T. Csak, Inflammasomes in liver diseases, J. Hepatol. 57 (2012) 642–654. [22] T. Csak, A. Pillai, M. Ganz, D. Lippai, J. Petrasek, J.K. Park, K. Kodys, A. Dolganiuc, E.A. Kurt-Jones, G. Szabo, Both bone marrow-derived and non-bone marrow-derived cells contribute to AIM2 and NLRP3 inflammasome activation in a MyD88-dependent manner in dietary steatohepatitis, Liver Int.: Off. J. Int. Assoc. Study Liver 34 (2014) 1402–1413. [23] A. Watanabe, M.A. Sohail, D.A. Gomes, A. Hashmi, J. Nagata, F.S. Sutterwala, S. Mahmood, M.N. Jhandier, Y. Shi, R.A. Flavell, W.Z. Mehal, Inflammasome-mediated regulation of hepatic stellate cells, Am. J. Physiol. Gastrointest. liver Physiol. 296 (2009) G1248–G1257. [24] S. Sharma, K. Khalili, G.C. Nguyen, Non-invasive diagnosis of advanced fibrosis and cirrhosis, World J. Gastroenterol. 20 (2014) 16820–16830. [25] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method, methods 25 (2001) 402–408. [26] R. Dong, Y. Yang, Z. Shen, C. Zheng, Z. Jin, Y. Huang, Z. Zhang, S. Zheng, G. Chen, Forkhead box A3 attenuated the progression of fibrosis in a rat model of biliary atresia, Cell Death Dis. 8 (2017) e2719. [27] T. Chida, M. Ando, T. Matsuki, Y. Masu, Y. Nagaura, T. Takano-Yamamoto, S. Tamura, T. Kobayashi, N-Myristoylation is essential for protein phosphatases PPM1A and PPM1B to dephosphorylate their physiological substrates in cells, Biochem. J. 449 (2013) 741–749. [28] K. Zhang, X. Han, Z. Zhang, L. Zheng, Z. Hu, Q. Yao, H. Cui, G. Shu, M. Si, C. Li, The liverenriched lnc-LFAR1 promotes liver fibrosis by activating TGFβ and Notch pathways, Nat. Commun. 8 (2017) 144. [29] K.-F. Wang, H. Yang, W.-Q. Jiang, S. Li, Y.-C. Cai, Puquitinib mesylate (XC-302) induces autophagy via inhibiting the PI3K/AKT/mTOR signaling pathway in nasopharyngeal cancer cells, Int. J. Mol. Med. 36 (2015) 1556–1562. [30] C. Li, T.-F. Wen, X.-Y. Zhang, X. Chen, J.-Y. Shen, IQGAP1 expression in hepatocellular carcinoma predicts poor prognosis by inducing epithelial-mesenchymal transition, Transl. Cancer Res. 6 (2017) 530–540. [31] Z. Li, H. Jin, G. Mao, L. Wu, Q. Guo, msi2 plays a carcinogenic role in esophageal squamous cell carcinoma via regulation of the Wnt/β-catenin and Hedgehog signaling pathways, Exp. Cell Res. 361 (2017) 170–177. [32] P.T. Heikkinen, M. Nummela, S.-K. Leivonen, J. Westermarck, C.S. Hill, V.-M. Kähäri, P.M. Jaakkola, Hypoxia-activated Smad3-specific dephosphorylation by PP2A, J. Biol. Chem. 285 (2010) 3740–3749. [33] M.J. Arthur, Fibrogenesis II. Metalloproteinases and their inhibitors in liver fibrosis, Am. J. Physiol.-Gastrointest. Liver Physiol. 279 (2000) G245–G249. [34] C.C. Prosser, R.D. Yen, J. Wu, Molecular therapy for hepatic injury and fibrosis: where are we? World J. Gastroenterol. 12 (2006) 509–515.
Acknowledgments This work was supported by the Natural Science Foundation of China (No. 81770599). Conflicts of Interest The authors declare no conflict of interest.
6
Contents lists available at ScienceDirect
Experimental Cell Research journal homepage: www.elsevier.com/locate/yexcr
Effects of NLRP6 on the proliferation and activation of human hepatic stellate cells Yiming Zhua,1, Tao Nib,1, Wensheng Denga, Jiayun Lina, Lei Zhenga, Chihao Zhanga, Meng Luoa, a b
⁎
Department of General Surgery, Shanghai Ninth People’ Hospital, School of Medicine, Shanghai Jiao Tong University, Huangpu, Shanghai, China Department of Plastic and Reconstructive Surgery, Shanghai Ninth People’ Hospital, School of Medicine, Shanghai Jiao Tong University, Huangpu, Shanghai, China
A R T I C LE I N FO
A B S T R A C T
Keywords: NLRP6 Liver fibrosis HSCs TGF-β1/Smad
Nod-like receptor pyrin domain-containing proteins (NLRPs) are known to take part in the pathogenesis of chronic liver diseases, including liver fibrosis. However, no known direct role of NLRP6, a member of NLRPs, has been reported in liver fibrosis. Here, we found that NLRP6 expression was decreased in fibrotic and cirrhotic livers. In a human hepatic stellate cell line, LX-2, overexpression of NLRP6 suppressed cell proliferation, hydroxyproline accumulation, as well as the expression of type I and type III collagens (Col-I and Col-III), α-smooth muscle actin (α-SMA) and matrix metalloproteinases (MMP2 and MMP9), whereas NLRP6 knockdown displayed reverse effects. Furthermore, NLRP6 significantly suppressed the phosphorylation of Smad2/3 (p-Smad2/3) and enhanced the expression of protein phosphatase magnesium dependent 1 A (PPM1A), the only phosphatase for Smad2/3. NLRP6 overexpression abrogated TGF-β1-stimulated hydroxyproline accumulation and p-Smad2/3. Co-immunoprecipitation assay demonstrated that NLRP6 was able to form a complex with PPM1A. NLRP6 overexpression did not change the level of p-Smad2/3 in LX-2 cells with PPM1A knockdown. These data indicated that PPM1A was required for the inhibitory effects of NLRP6 on TGF-β1/Smad2/3 signaling. In conclusion, our results suggest that NLRP6 exerts anti-fibrotic effects in LX-2 cells via regulating PPM1A/Smad2/3 and that NLRP6 may be an effective target in the treatment of liver fibrosis.
1. Introduction Liver fibrosis, a reversible wound-healing process, is the main complication in most chronic liver diseases [1]. The main causes of liver fibrosis have been described, including chronic viral hepatitis B or C infection, autoimmune disease, cholestasis, alcohol abuse and nonalcoholic steatohepatitis (NASH) [2]. Liver fibrosis can progress to cirrhosis if liver injury is persistent [3]. Liver fibrosis is associated with progressive deposition of extracellular matrix (ECM) proteins, such as fibronectin and collagen, within the liver [1]. Hepatic stellate cells (HSCs) are key mediators of liver fibrosis [4–6]. In response to liver injury, HSCs are activated, transdifferentiate into highly proliferative myofibroblasts, and secret several ECM proteins including type I and type III collagens (Col-I and Col-III) [7]. Besides ECM synthesis, matrix degradation also participate in the pathological process of liver fibrosis [8]. Transforming growth factor β (TGF-β) appears to be a key growth factor for HSCs activation and ECM production [9]. Protein phosphatase magnesium dependent 1A (PPM1A, also named PP2Cα), a Ser/Thr protein phosphatase, involved in the regulation of several signaling ⁎
1
pathways, such as p38, c-Jun N-terminal kinase (JNK) [10], Wnt [11,12] and p53 [13]. Importantly, it is identified as the only phosphatase for Smad2 and Smad3, downstream effectors of TGF-β [14]. A recent study has reported that PPM1A exerts anti-fibrogenic effects in carbon tetrachloride- and bile duct ligation-induced liver fibrosis and PPM1A activation might be a promising strategy for the treatment of liver fibrosis [14]. Nod-like receptor pyrin domain-containing protein 6 (NLRP6) belongs to Nod-Like Receptor (NLR) family [15]. NLRP6 plays important roles in infection, autoinflammation and tumorigenesis via negatively regulating mitogen-activated protein kinase (MAPK), the canonical NFκB [16] and Wnt signaling pathways [17]. NLR family protein is a component of inflammasome, which can sense danger signals and active interleukin-1β (IL-1β) and IL-18. The functions of NLR family proteins have been studied in many types of chronic liver diseases, including liver fibrosis [18–23]. NLRP6 inflammasome can modulate the gut microbiota and then negatively regulate the progression of nonalcoholic fatty liver disease (NAFLD)/NASH [18]. However, no known direct role of NLRP6 has been revealed in liver fibrosis. Here we found that NLRP6 expression was decreased in liver fibrosis
Corresponding author. E-mail address: [email protected] (M. Luo). Contribute equally.
https://doi.org/10.1016/j.yexcr.2018.06.040 Received 23 February 2018; Received in revised form 27 June 2018; Accepted 29 June 2018 0014-4827/ © 2018 Published by Elsevier Inc.
Please cite this article as: Zhu, Y., Experimental Cell Research (2018), https://doi.org/10.1016/j.yexcr.2018.06.040
Experimental Cell Research xxx (xxxx) xxx–xxx
Y. Zhu et al.
Fig. 1. NLRP6 expression was decreased in liver fibrosis and cirrhosis. (A) NLRP6 mRNA expression was determined by real-time PCR in hepatic specimens. * **P < 0.001 versus normal tissues; ###P < 0.001 versus liver fibrosis. (B) NLRP6 protein expression was determined by western blot analysis. (C) Immunohistochemical staining was performed to detect NLRP6 in hepatic specimens (n = 6 per group). Representative images are shown. Scale bar: 100 µm.
5′-CGTCTCGTACAGGCAGTACAG −3′ (reverse primer); GAPDH, 5′CACCCACTCCTCCACCTTTG −3′ (forward primer) and 5′- CCACCAC CCTGTTGCTGTAG −3′ (reverse primer); MMP2, 5′- TTGGTGGGAACT CAGAAG −3′ (forward primer) and 5′- TTGCGGTCATCATCGTAG −3′ (reverse primer); MMP9, 5′- AAGGGCGTCGTGGTTCCAACTC-3′ (forward primer) and 5′- AGCATTGCCGTCCTGGGTGTAG-3′ (reverse primer). The expression of NLRP6, MMP2 and MMP9 were all normalized to GAPDH expression as previously described [25].
and cirrhosis. NLRP6 significantly suppressed cell proliferation and reduced collagen expression in an immortalized human HSC line, LX-2. Further investigation revealed that the anti-fibrotic effects of NLRP6 were mainly through inhibiting TGF-β/Smad2/3 signaling pathway and PPM1A was required for this process. Our data here provide new evidence for NLRP6 as the potential target in the treatment of liver fibrosis. 2. Materials and methods 2.1. Liver specimens
2.3. Western blot analysis
Ethical approval was provided by the independent ethics committee of Shanghai Ninth People’ Hospital (Shanghai, China). Ten patients without evidence of liver disease (normal), 15 patients with fibrosis and 30 patients with cirrhosis participated in this study after informed and written consent was obtained according to the guidelines of the ethics committee. Liver biopsy tissue from patients was scored for fibrosis by the METAVIR system [24], and separated into groups with normal (F0, n = 10), fibrosis (F1-F3, n = 15) or cirrhosis (F4-F5, n = 30). Liver specimens were resected from the participants, snap-frozen immediately in liquid nitrogen and stored at − 80 °C until use.
Total protein was isolated with radioimmunoprecipitation assay (RIPA) buffer supplemented with protease cocktail (Sigma, St. Louis, MO, USA). Equal amount of proteins (30 μg) from different samples was subject to 10% SDS-polyacrylamide gel electrophoresis and transferred to nitrocellulose membrane (EMD Millipore, Bedford, MA, USA). After blocking the membranes with 5% nonfat milk, the membranes were probed with primary antibodies as per the manufacturers’ instructions. After washing, the membranes were incubated with horseradish peroxidase-conjugated secondary antibody (Beyotime Institute of Biotechnology, Shanghai, China) followed by detection with Enhanced Chemiluminescence (ECL) Analysis Kit (EMD Millipore). The sources of primary antibodies are listed as followed: anti-NLRP6 (ABF29) from Millipore; α-smooth muscle actin (α-SMA, #14968 [26]), anti-PPM1A (#3549 [27]), anti-p-Smad2/3 (#8828 [28]), anti-Smad2/3(#8685 [28]) and anti-GAPDH (#5174 [29]) from Cell Signaling (Danvers, MA, USA); anti-MMP2 (matrix metalloproteinase 2, ab97779 [30]) and antiMMP9 (ab73734 [31]) from Abcam (Cambridge, MA, USA). Western blot was repeated 3 times and representative blots are shown.
2.2. Real-time PCR Total RNA was extracted with Tizol Reagent (Thermo Fisher Scientific) following the manufacturer's protocol. Two micrograms of total RNA was reversed transcribed using Reverse Transcription Reagents (Promega, Madison, WI, USA). Real-time PCR was performed in ABI Prism 7300 (Applied Biosystems, Foster City, CA, USA) with SYBR Green Mix (Thermo Fisher Scientific). The primers are as follows: NLRP6, 5′- TTCGGCTGCATGGTTTCAGAG −3′ (forward primer) and 2
Experimental Cell Research xxx (xxxx) xxx–xxx
Y. Zhu et al.
Science (Shanghai, China) were cultured in Dulbecco's modified Eagle's medium (Hyclone, Logan, UT, USA) in the present of 10% fetal bovine serum (Thermo Fisher Scientific, Waltham, MA, USA). The cells were grown at 37 °C in a humidified atmosphere of 5% CO2/95% air. 2.6. Small interfering RNA and ectopic expression NLRP6 specific siRNAs (siNLRP6-1, 5′- GUGUCCGAGUACAAGAAG AUU-3′; siNLRP6-2, 5′- CUACAAGUAUUUCCGGGAUUU-3′; and siNLRP6-3, 5′- GAACUCAUCUCGACCUUCUUU-3′), PPM1A specific siRNA [32] (siPPM1A, 5′-GCGUGAUUUCAAACCAUAAUU-3′), and nonsense siRNA (siNC, 5′- CCUACAUCCCGAUCGAUGAUGUU-3′) were prepared by GenePharma (Shanghai, China). siRNAs were introduced into LX-2 cells at a final concentration of 200 nM using Lipofectamine 2000 (Invitrogen). Human NLRP6 CDNA was inserted into the AgeI/EcoRI sites of a lentiviral expression vector GV348 (Genechem, Shanghai, China) and confirmed by DNA sequencing. Lentivirus expressing NLRP6 (NLRP6 OE) or control vector was generated by using 293 T cells. 2.7. Cell proliferation assay LX-2 cells (3000 cells/well) were seeded in triplicate. After culture overnight, the cells were transduced with Vector/NLRP6 OE lentivirus or transfected with siNLRP6-2/siNC. After incubation for 0, 24, 48 and 72 h, the cells were incubated with CCK-8 solution (SAB biotech. College Park, MD, USA) for 1 h and optical density (OD) values were measured at 450 nm using the manufacturer's protocol. 2.8. Measurement of hydroxyproline content LX-2 cells were lysed after treatment. Then, hydroxyproline content in the lysates was measured with commercially available kit (Jiancheng Institute of Biotechnology, Nanjing, China) in accordance with the manufacturer's protocols. 2.9. Enzyme-linked immunosorbent assay (ELISA) The cultured supernatant was collected from LX-2 cells and used to measure the concentrations of Col-I and Col-III with ELISA assay kits (Ebioscience, San Diego, CA, USA) following the manufacturer's instructions.
Fig. 2. NLRP6 significantly suppressed LX-2 cell proliferation. (A, B) LX-2 cells were transduced with Vector/NLRP6 OE lentivirus or transfected with siNLRP61/siNLRP6-2/siNLRP6-3/siNC. At 48 h after treatment, the mRNA and protein expression of NLRP6 was determined by real-time PCR (A) and western blot analysis (B), respectively. Western blot was repeated 3 times and representative blots are shown. (C) LX-2 cells were transduced with Vector/NLRP6 OE lentivirus or transfected with siNLRP6-2/siNC. CCK-8 assay was performed to assess cell proliferation at 0, 24, 48 and 72 h after treatment. * *P < 0.01, * **P < 0.001 versus Vector group; #P < 0.05, ##P < 0.01, ###P < 0.001 versus siNC group.
2.10. Co-immunoprecipitation (Co-IP) assay Total lysate extracted from LX-2 cells (500 μg) were incubated with anti-NLRP6 (Santa Cruz) or anti-PPM1A (Cell Signaling) or IgG at 4 °C for 2 h, and then with protein G-Sepharose beads at 4 °C overnight. The beads were washed 3–4 times with lysis buffer, boiled in SDS loading buffer for 5 min, and then subjected to western blot analysis with total lysate as positive control.
2.4. Immunohistochemical staining (IHC)
2.11. Statistical analysis
Liver specimens were fixed in 4% formaldehyde, paraffin embedded, and cut into 5-μm-thick sections in accordance with routine procedure. Following section deparaffinization and rehydration, antigen retrieval was performed in a pressure cooker using 0.01 M citrate buffer (pH 6.0). Endogenous peroxidase was blocked with 3% hydrogen peroxide for 10 min. IHC staining was then conduced with anti-NLRP6 (Abcam, ab198798, 1:50) according to the manufacturer's protocol.
All values were expressed as mean ± standard deviation (SD). Statistical significance was analyzed using one-way ANOVA with the GraphPad prism v6 (GraphPad Software Inc., La Jolla, CA, USA). P < 0.05 was considered as statistically significant. 3. Results 3.1. NLRP6 expression was decreased in liver fibrosis and cirrhosis We detected the mRNA expression of NLRP6 in normal liver tissues (n = 10) and liver samples from patients with liver fibrosis (n = 15) or cirrhosis (n = 30). As shown in Fig. 1A, comparing with normal liver
2.5. Cell culture LX-2 cells obtained from the cell bank of Chinese Academy of 3
Experimental Cell Research xxx (xxxx) xxx–xxx
Y. Zhu et al.
Fig. 3. NLRP6 significantly reduces collagen production and α-SMA expression in LX-2 cells. LX-2 cells were transduced with Vector/NLRP6 OE lentivirus or transfected with siNLRP6-2/siNC. At 48 h after treatment, hydroxyproline content (A), the release of Col-I and Col-III (B), and α-SMA protein expression was measured. ***P < 0.001 versus Vector group; ###P < 0.001 versus siNC group.
Fig. 4. NLRP6 reduced MMP2/9 expression in LX-2 cells. LX-2 cells were transduced with Vector/NLRP6 OE lentivirus or transfected with siNLRP6-2/siNC. At 48 h after treatment, the mRNA and protein expression of MMP2 and MMP9 was determined by real-time PCR (A) and western blot analysis (B), respectively. Western blot was repeated 3 times and representative blots are shown. ***P < 0.001 versus Vector group; ###P < 0.001 versus siNC group.
tissues, the NLRP6 mRNA in liver fibrosis and cirrhosis decreased by 42.8% and 81.8%, respectively. Western blot (Fig. 1B) and IHC staining (Fig. 1C) indicated that the protein expression of NLRP6 in normal liver specimens and liver samples from patients with chronic disease had the similar trend. These findings suggested that NLRP6 may be involved in the pathogenesis of liver fibrosis and cirrhosis.
transfected with nonsense siRNA (siNC), NLRP6 expression was decreased by 47.1%, 84.7% and 47.2% in LX-2 cells transfection with NLRP6-specific siRNAs (siNLRP6-1, −2 and −3), respectively. siNLRP6-2 had the best knockdown efficiency and was used in the subsequent experiments. The changes of NLRP6 protein expression were consistent with its mRNA expression (Fig. 2B). Subsequently, the effect of NLRP6 on the proliferation of LX-2 was assessed by CCK-8 assay. NLRP6 overexpression significantly inhibited HSC proliferation at 24 h, 48 h and 72 h after virus transduction (Fig. 2C), while complementary results were observed in HSCs with NLRP6 knockdown. These data suggested the inhibitory functions of NLRP6 on HSC proliferation.
3.2. NLRP6 significantly suppressed LX-2 cell proliferation HSCs are key mediators of liver fibrosis [4–6]. To determine whether NLRP6 affected liver fibrosis, an immortalized human stellate cell line, LX-2 cell, was used. First, we manipulated NLRP6 expression in LX-2 cells by lentiviral transduction and siRNA transfection. As illustrated in Fig. 2A, NLRP6 mRNA in LX-2 cells transduced with NLRP6 overexpressing virus (NLRP6 OE) increased to 3.17 fold as compared to those transduced with control Vector virus. Comparing with LX-2 cells 4
Experimental Cell Research xxx (xxxx) xxx–xxx
Y. Zhu et al.
Fig. 5. TGF-β signaling was involved in the anti-fibrogenic function of NLRP6. (A) LX-2 cells were transduced with Vector/NLRP6 OE lentivirus or transfected with siNLRP6-2/siNC. At 48 h after treatment, the protein levels of PPM1A, p-Smad2/3 and Smad2/3 were determined by western blot analysis. Western blot was repeated 3 times and representative blots are shown. (B, C) LX-2 cells were transduced with Vector/NLRP6 OE lentivirus for 16 h, and starved overnight, then treated with TGF-β1 (5 ng/ml; Sigma) for 24 h. The protein levels of p-Smad2/3 and Smad2/3 (B), and hydroxyproline content were evaluated (C). **P < 0.01, ***P < 0.001. (D) Binding of NLRP6 to PPM1A was examined in LX-2 cells by immunoprecipitation (IP) and western blot. IgG was used as a negative control. (E) LX-2 cells were treated with Vector/NLRP6 OE lentivirus and siPPM1A/siNC. At 48 h after treatment, the protein levels of PPM1A, p-Smad2/3 and Smad2/3 were determined by western blot analysis.
3.3. NLRP6 significantly reduces collagen production and α-SMA expression in LX-2 cells
protein expression of MMP2 and MMP9 was also detected. As shown in Fig. 4, NLRP6 overexpression cause a significant decrease in the mRNA and protein expression of MMP2 and MMP9, while complementary results were obtained in NLRP6 knockdown cells.
To determine the effect of NLRP6 on collagen production, hydroxyproline content, as well as the release of Col-I and Col-III was examined in LX-2 cells with NLRP6 overexpression or knockdown. Hydroxyproline content was decreased in LX-2 cells with NLRP6 overexpression (4.1 ± 0.4 μg/mg protein) compared with the control Vector group (11.8 ± 1.3 μg/mg protein), and it was increased in the LX-2 cells with NLRP6 knockdown (26.3 ± 2.3 μg/mg protein) compared with the control siNC group (11.7 ± 1.3 μg/mg protein). Consistently, concentration of Col-I and Col-III in NLRP6 overexpressed cells were significantly reduced in NLRP6 overexpressed cells compared with the control Vector group (Col-I: 28.2 ± 0.2 μg/l vs. 56.2 ± 0.3 μg/l; Col-III, 50.8 ± 0.4 μg/l vs. 89.6 ± 0.5 μg/l), while reverse results were observed in NLRP6 knockdown cells compared with the control siNC group (Col-I: 70.9 ± 0.2 μg/l vs. 56.3 ± 0.2 μg/ l; Col-III, 130.3 ± 0.7 μg/l vs. 90.0 ± 0.5 μg/l) (Fig. 3B). The protein levels of α-SMA, a marker of fibrosis, were determined by western blot. The results showed that α-SMA expression was decreased by NLRP6 overexpression and increased by NLRP6 knockdown (Fig. 3C).
3.5. TGF-β signaling was involved in the anti-fibrogenic function of NLRP6 The protein levels of PPM1A (the only phosphatase for Smad2 and Smad3 [14]), Smad2/3 and phosphorylated Smad2/3 (p-Smad2/3) were also detected. As showed in Fig. 5A, PPM1A protein expression was enhanced by NLRP6 overexpression, whereas suppressed by NLRP6 knockdown. The level of p-Smad2/3 showed the opposite change. We then tried to explore the molecular mechanism how NLRP6 exerted anti-fibrogenic functions. LX-2 cells with or without NLRP6 overexpression were treated with TGF-β1 (5 ng/ml) for 24 h. The level of p-Smad2/3 (Fig. 5B) and hydroxyproline content (Fig. 5C) were increased in LX-2 cells with TGF-β1 treatment, which could be abrogated by NLRP6 overexpression. These data suggested that NLRP6 may work as an anti-fibrogenic factor via inhibiting TGF-β/Smad2/3 signaling. We next examined the potential interaction between NLRP6 and PPM1A. Co-IP assays demonstrated that NLRP6 formed a complex with PPM1A in LX-2 cells (Fig. 5D). To further validate the requirement of PPM1A on the effects of NLRP6, we knocked down the endogenous PPM1A using siRNA transfection. As shown in Fig. 5E, in LX-2 cells with PPM1A knockdown, NLRP6 overexpression did not change the level of p-Smad2/3, suggesting that the inhibitory effects of NLRP6 on TGF-β/ Smad2/3 signaling was dependent on PPM1A.
3.4. NLRP6 reduced MMP2/9 expression in LX-2 cells MMP2 and MMP9 are the most related matrix metalloproteinases (MMPs) that participate in the process of liver fibrosis [8]. To further determine the effect of NLRP6 on fibrogenic activation, the mRNA and 5
Experimental Cell Research xxx (xxxx) xxx–xxx
Y. Zhu et al.
4. Discussion
References
Emerging evidence has suggested that NLR family proteins play a critical role in many types of chronic liver diseases, such as NAFLD, NASH and liver fibrosis [18–23]. Two recent studies using NLRP3 knockout mice [23] and knock-in mice [19] have suggested that NLRP3 may promote HSC activation and collagen deposition, thus leading to liver fibrosis. In the current study, NLRP6 was found down-regulated in fibrosis and cirrhosis specimens compared to the normal liver specimens (Fig. 1). To determine whether NLRP6 is involved in hepatic fibrogenesis, NLRP6 was overexpression or knocked down in LX-2 cells, a human HSC line, and then cell proliferation, hydroxyproline content, as well as the release of Col-I and Col-III were measured. The results showed that NLRP6 overexpression significantly attenuated not only cell proliferation (Fig. 2) but also collagen production (Fig. 3), while NLRP6 knockdown had reverse effects. Thus, our study firstly demonstrated the anti-fibrogenic role of NLRP6 in vitro. Liver matrix degradation also participate in the pathogenesis of liver fibrosis [8]. Matrix metalloproteinases (MMPs), including MMP2 and MMP9, are the main enzymes responsible for the degradation of normal liver matrix. Increased activity of MMP2 and MMP9 is observed during liver fibrosis in both human specimens and animal models [33]. In the current study, the expression of MMP2 and MMP9 was decreased obviously after NLRP6 overexpression and increased after NLRP6 knockdown at both transcriptional and translational levels (Fig. 4). These data indicated that NLRP6 may inhibit fibrogenesis of HSCs by inhibiting matrix degradation. TGF-β signaling is essential for HSCs activation and ECM production during liver fibrosis [9]. The suppression of TGF-β expression or its downstream signal transduction pathway could reduce fibrogenesis and be used as a therapy strategy for liver fibrosis [34]. The current study showed that the phosphorylation of Smad2/3 was significantly inhibited by NLRP6 overexpression, and enhanced by NLRP6 knockdown. These results were consistent with the anti-fibrogenic role of NLRP6. Unsurprisingly, the level of p-Smad2/3 and hydroxyproline content were increased in LX-2 cells with TGF-β1 treatment. More importantly, NLRP6 overexpression abrogated the fibrogenic functions of TGF-β1. Our data suggested that TGF-β/Smad2/3 signaling was involved in the anti-fibrogenic role of NLRP6. Moreover, PPM1A, as the only phosphatase for Smad2 and Smad3, has anti-fibrogenic effects in vivo [14]. Here, we demonstrated that NLRP6 formed a complex with PPM1A in LX-2 cells by Co-IP assays. The protein level of PPM1A was associated with that of NLRP6. Moreover, NLRP6 overexpression had no effects on the level of p-Smad2/3 in LX-2 cells with PPM1A knockdown. Our data indicated that PPM1A was required for the inhibitory effects of NLRP6 on TGF-β/Smad2/3 signaling and HSC activation, although the detailed mechanism how NLRP6 affected the protein levels of PPM1A needed further investigation. Conclusively, the present work has indicated that NLRP6 expression was decreased in liver fibrosis and cirrhosis. NLRP6 may work as an anti-fibrogenic factor in LX-2 cells via inhibiting TGF-β/Smad2/3 signaling and PPM1A, a Smad phosphatase, was required for the functions of NLRP6. NLRP6 could be a promising target for the treatment of liver fibrosis.
[1] S.L. Friedman, Hepatic fibrosis – overview, Toxicology 254 (2008) 120–129. [2] R. Bataller, D.A. Brenner, Liver fibrosis, J. Clin. Investig. 115 (2005) 209–218. [3] E.A. Tsochatzis, J. Bosch, A.K. Burroughs, Future treatments of cirrhosis, Expert Rev. Gastroenterol. Hepatol. 8 (2014) 571–581. [4] H.L. Reeves, S.L. Friedman, Activation of hepatic stellate cells–a key issue in liver fibrosis, Front. Biosci.: a J. Virtual Libr. 7 (2002) d808–d826. [5] E. Gabele, D.A. Brenner, R.A. Rippe, Liver fibrosis: signals leading to the amplification of the fibrogenic hepatic stellate cell, Front. Biosci.: a J. Virtual Libr. 8 (2003) d69–d77. [6] J.E. Puche, Y. Saiman, S.L. Friedman, Hepatic stellate cells and liver fibrosis, Compr. Physiol. 3 (2013) 1473–1492. [7] S.L. Friedman, Liver fibrosis: from mechanisms to treatment, Gastroenterol. Clin. Et. Biol. 31 (2007) 812–814. [8] M.J. Arthur, Fibrogenesis II. Metalloproteinases and their inhibitors in liver fibrosis, Am. J. Physiol. Gastrointest. liver Physiol. 279 (2000) G245–G249. [9] C. Meyer, P. Godoy, A. Bachmann, Y. Liu, D. Barzan, I. Ilkavets, P. Maier, C. Herskind, J.G. Hengstler, S. Dooley, Distinct role of endocytosis for Smad and non-Smad TGF-beta signaling regulation in hepatocytes, J. Hepatol. 55 (2011) 369–378. [10] M. Takekawa, T. Maeda, H. Saito, Protein phosphatase 2Calpha inhibits the human stressresponsive p38 and JNK MAPK pathways, EMBO J. 17 (1998) 4744–4752. [11] S. Zolnierowicz, Type 2A protein phosphatase, the complex regulator of numerous signaling pathways, Biochem. Pharmacol. 60 (2000) 1225–1235. [12] E.T. Strovel, D. Wu, D.J. Sussman, Protein phosphatase 2Calpha dephosphorylates axin and activates LEF-1-dependent transcription, J. Biol. Chem. 275 (2000) 2399–2403. [13] P. Ofek, D. Ben-Meir, Z. Kariv-Inbal, M. Oren, S. Lavi, Cell cycle regulation and p53 activation by protein phosphatase 2C alpha, J. Biol. Chem. 278 (2003) 14299–14305. [14] L. Wang, X. Wang, J. Chen, Z. Yang, L. Yu, L. Hu, X. Shen, Activation of protein serine/ threonine phosphatase PP2Calpha efficiently prevents liver fibrosis, PloS One 5 (2010) e14230. [15] J.M. Grenier, L. Wang, G.A. Manji, W.J. Huang, A. Al-Garawi, R. Kelly, A. Carlson, S. Merriam, J.M. Lora, M. Briskin, P.S. DiStefano, J. Bertin, Functional screening of five PYPAF family members identifies PYPAF5 as a novel regulator of NF-kappaB and caspase1, FEBS Lett. 530 (2002) 73–78. [16] P.K. Anand, R.K. Malireddi, J.R. Lukens, P. Vogel, J. Bertin, M. Lamkanfi, T.D. Kanneganti, NLRP6 negatively regulates innate immunity and host defence against bacterial pathogens, Nature 488 (2012) 389–393. [17] P.K. Anand, T.D. Kanneganti, NLRP6 in infection and inflammation, Microbes Infect. 15 (2013) 661–668. [18] G. Szabo, J. Petrasek, Inflammasome activation and function in liver disease, Nat. Rev. Gastroenterol. Hepatol. 12 (2015) 387–400. [19] A. Wree, A. Eguchi, M.D. McGeough, C.A. Pena, C.D. Johnson, A. Canbay, H.M. Hoffman, A.E. Feldstein, NLRP3 inflammasome activation results in hepatocyte pyroptosis, liver inflammation, and fibrosis in mice, Hepatol. (Baltim., Md.) 59 (2014) 898–910. [20] J. Henao-Mejia, E. Elinav, C. Jin, L. Hao, W.Z. Mehal, T. Strowig, C.A. Thaiss, A.L. Kau, S.C. Eisenbarth, M.J. Jurczak, J.P. Camporez, G.I. Shulman, J.I. Gordon, H.M. Hoffman, R.A. Flavell, Inflammasome-mediated dysbiosis regulates progression of NAFLD and obesity, Nature 482 (2012) 179–185. [21] G. Szabo, T. Csak, Inflammasomes in liver diseases, J. Hepatol. 57 (2012) 642–654. [22] T. Csak, A. Pillai, M. Ganz, D. Lippai, J. Petrasek, J.K. Park, K. Kodys, A. Dolganiuc, E.A. Kurt-Jones, G. Szabo, Both bone marrow-derived and non-bone marrow-derived cells contribute to AIM2 and NLRP3 inflammasome activation in a MyD88-dependent manner in dietary steatohepatitis, Liver Int.: Off. J. Int. Assoc. Study Liver 34 (2014) 1402–1413. [23] A. Watanabe, M.A. Sohail, D.A. Gomes, A. Hashmi, J. Nagata, F.S. Sutterwala, S. Mahmood, M.N. Jhandier, Y. Shi, R.A. Flavell, W.Z. Mehal, Inflammasome-mediated regulation of hepatic stellate cells, Am. J. Physiol. Gastrointest. liver Physiol. 296 (2009) G1248–G1257. [24] S. Sharma, K. Khalili, G.C. Nguyen, Non-invasive diagnosis of advanced fibrosis and cirrhosis, World J. Gastroenterol. 20 (2014) 16820–16830. [25] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method, methods 25 (2001) 402–408. [26] R. Dong, Y. Yang, Z. Shen, C. Zheng, Z. Jin, Y. Huang, Z. Zhang, S. Zheng, G. Chen, Forkhead box A3 attenuated the progression of fibrosis in a rat model of biliary atresia, Cell Death Dis. 8 (2017) e2719. [27] T. Chida, M. Ando, T. Matsuki, Y. Masu, Y. Nagaura, T. Takano-Yamamoto, S. Tamura, T. Kobayashi, N-Myristoylation is essential for protein phosphatases PPM1A and PPM1B to dephosphorylate their physiological substrates in cells, Biochem. J. 449 (2013) 741–749. [28] K. Zhang, X. Han, Z. Zhang, L. Zheng, Z. Hu, Q. Yao, H. Cui, G. Shu, M. Si, C. Li, The liverenriched lnc-LFAR1 promotes liver fibrosis by activating TGFβ and Notch pathways, Nat. Commun. 8 (2017) 144. [29] K.-F. Wang, H. Yang, W.-Q. Jiang, S. Li, Y.-C. Cai, Puquitinib mesylate (XC-302) induces autophagy via inhibiting the PI3K/AKT/mTOR signaling pathway in nasopharyngeal cancer cells, Int. J. Mol. Med. 36 (2015) 1556–1562. [30] C. Li, T.-F. Wen, X.-Y. Zhang, X. Chen, J.-Y. Shen, IQGAP1 expression in hepatocellular carcinoma predicts poor prognosis by inducing epithelial-mesenchymal transition, Transl. Cancer Res. 6 (2017) 530–540. [31] Z. Li, H. Jin, G. Mao, L. Wu, Q. Guo, msi2 plays a carcinogenic role in esophageal squamous cell carcinoma via regulation of the Wnt/β-catenin and Hedgehog signaling pathways, Exp. Cell Res. 361 (2017) 170–177. [32] P.T. Heikkinen, M. Nummela, S.-K. Leivonen, J. Westermarck, C.S. Hill, V.-M. Kähäri, P.M. Jaakkola, Hypoxia-activated Smad3-specific dephosphorylation by PP2A, J. Biol. Chem. 285 (2010) 3740–3749. [33] M.J. Arthur, Fibrogenesis II. Metalloproteinases and their inhibitors in liver fibrosis, Am. J. Physiol.-Gastrointest. Liver Physiol. 279 (2000) G245–G249. [34] C.C. Prosser, R.D. Yen, J. Wu, Molecular therapy for hepatic injury and fibrosis: where are we? World J. Gastroenterol. 12 (2006) 509–515.
Acknowledgments This work was supported by the Natural Science Foundation of China (No. 81770599). Conflicts of Interest The authors declare no conflict of interest.
6