- Email: [email protected]
Effects of nonylphenol exposure on expression of cell receptors and secretory function in mouse Sertoli TM4 cells
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 608–616
Available online at www.sciencedirect.com
ScienceDirect journal homepage: www.elsevier.com/locate/etap
Effects of nonylphenol exposure on expression of cell receptors and secretory function in mouse Sertoli TM4 cells Xiaozhen Liu, Shaoping Nie, Danfei Huang, Mingyong Xie ∗ State Key Laboratory of Food Science and Technology, Nanchang University, Nanchang 330047, China
a r t i c l e
i n f o
a b s t r a c t
Article history:
The aim of this study was to investigate the effects of nonylphenol (NP) exposure on the
Received 19 November 2013
expression of cell receptors and secretory function in mouse Sertoli TM4 cells. There were
Received in revised form
no significant changes in mRNA expression of estrogen receptor (ER)-␣ and toll like receptor
17 January 2014
(TLR)-4 in the cells exposed to NP for 24 h. However, the mRNA expression levels of ER-,
Accepted 24 January 2014
progesterone receptor (PR) and androgen receptor (AR) were down-regulated in NP groups.
Available online 3 February 2014
Furthermore, NP treatment evoked significant changes in protein expression levels of ER and follicle-stimulating hormone receptor (FSHR). There were significant changes in the
Keywords:
mRNA expression levels of vinculin, N-cadherin and occludin, but not vimentin. Levels of
Nonylphenol
inhibin B, androgen binding protein (ABP) and transferrin (Trf) were found to change signifi-
Cell receptors
cantly in NP challenged cells. Additionally, the decrease of nitric oxide (NO) production and
Secretory function
inducible nitric oxide synthase (iNOS) mRNA expression and increase of cytokine levels were
TM4 cells
simultaneously found in NP stimulated TM4 cells. In conclusion, these findings have shown that NP exposure affected expression of cell receptors and may damage specific secretory function of Sertoli TM4 cells, which may be associated with the male-specific reproductive toxicity of NP. © 2014 Elsevier B.V. All rights reserved.
1.
Introduction
Endocrine disrupting compounds (EDCs) are an emerging problem with serious consequences for the environment. They are widely dispersed in the environment and are persistent organic pollutants. Previous studies showed that EDCs exhibited potential hazardous effect on animal reproduction and development (Cox, 1996), and on reproductive function
in men (Carlsen et al., 1992). Male reproductive parameters that have been reported as altered include a decrease in sperm count, increased incidence of congenital malformations of the male reproductive tract and testicular cancer among young men (Pflieger-Bruss et al., 2004; Sharpe, 2001). While it is not clear what factors or changes in lifestyle may be responsible for these changes, it has been suggested that among the different classes of reproductive toxicants present in the environment, those that act as EDCs have been singled out as
Abbreviations: EDCs, endocrine-disrupting compounds; NP, nonylphenol; ER, estrogen receptor; TLR, toll like receptor; PR, progesterone receptor; AR, androgen receptor; FSHR, follicle-stimulating hormone receptor; ABP, androgen binding protein; Trf, transferrin; MIS, mullerian inhibiting substance; BTB, blood-testis barrier; DMEM/F-12, Dulbecco’s modified Eagle’s medium nutrient mixture F-12 HAM; HRP, horseradish peroxidase; RT-PCR, reverse transcription polymerase chain reaction; IL-1, interleukin-1; TGF, transforming growth factor; TNF, tumor necrosis factor; iNOS, inducible nitric oxide synthase; nNOS, neuronal NOS; eNOS, endothelial NOS. ∗ Corresponding author at: State Key Laboratory of Food Science and Technology, Nanchang University, 235 Nanjing East Road, Nanchang 330047, China. Tel.: +86 791 83969009; fax: +86 791 83969009. E-mail address: [email protected] (M. Xie). 1382-6689/$ – see front matter © 2014 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.etap.2014.01.017
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 608–616
contributing to male reproductive dysfunction. In recent years, there has been increased interest in assessing the relationship between impaired male fertility and environmental factors. Nonylphenol (NP), the major degradation product of alkylphenol ethoxylates, is a potential endocrine disruptor (Hu et al., 2012). NP has been used as emulsifier and modifier in paints, pesticides, textiles, and some personal care products, and has been also used as plasticizer and antioxidant in plastics and resins. It was found that NPs, which may leach from plastics used in food processing and packing and from commercially available polystyrene tubes, were ubiquitous in food (Guenther et al., 2002). A previous study showed that NP could result in potential reproduction problem (Han et al., 2004). Additionally, recent studies have shown that the impacts of NP in the environment include feminization of aquatic organisms and decrease in male fertility (Soares et al., 2008). Based on these observations, it is important to study the effects of NP and clearly understand its action mechanism. Testis is the target organ for most male reproductive toxicants. Sertoli cells, located in the seminiferous tubules of the testis, provide nutritional as well as morphogenetic support for germ cells during spermatogenesis (Lipshultz et al., 1997). Furthermore, they are involved in the synthesis and release of proteins including inhibin, androgen binding protein (ABP) and transferrin (Trf), which regulate or respond to pituitary hormone release and further influence spermatogenesis (Xiong et al., 2006). In addition, one major function of Sertoli cells is to establish blood-testis barrier (BTB) which provides a specialized and stable environment for germ cell development (Mruk and Cheng, 2004). Due to the importance of Sertoli cells in the testis, any agent that impairs the viability and/or function of these cells may have profound effects on spermatogenesis. NP is a toxic compound classified as being capable of interfering with the hormonal system of numerous organisms. Therefore, the goal of this study was to determine whether NP exposure has adverse effects on the levels of BTB-associated elements including vimentin, vinculin, N-cadherin and occludin, cell receptors including estrogen receptor (ER)-␣, ER-, androgen receptor (AR), progesterone receptor (PR), toll like receptor (TLR)4 and follicle-stimulating hormone receptor (FSHR), and specific secretion associated molecules including mullerian inhibiting substance (MIS), Trf, ABP, inhibin B and some cytokines. The present study has provided some prerequisite information for understanding the molecular mechanisms by which NP exposure causes reproductive toxicity.
2.
Materials and methods
2.1.
Reagents and chemicals
NP (99.9% purity), penicillin and streptomycin sulfate were obtained from Sigma–Aldrich Inc (St. Louis, MO, USA). Dulbecco’s modified Eagle’s medium nutrient mixture F-12 HAM (DMEM/F-12 medium), fetal bovine serum and horse serum were purchased from Hyclone (Waltham, MA, USA).
609
Antibodies against ER-␣, ER-, FSHR, -actin and horseradish peroxidase (HRP)-conjugated goat anti-rabbit/mouse IgG antibody were purchased from Abcam (Beverly, MA, USA). ABP and inhibin B ELISA kits were obtained from Westang (Shanghai, China), cytokine ELISA kits were from Boster (Wuhan, China). All other chemicals were of analytical grade.
2.2.
Cell culture
The Sertoli cell line, TM4 was obtained from American Type Culture Collection (ATTC, Rockville, MD). Cells were maintained in DMEM/F-12 medium, supplemented with 1% penicillin–streptomycin, 5% (v/v) horse serum and 2.5% (v/v) fetal bovine serum in an atmosphere with 95% humidity and 5% CO2 at 37 ◦ C. Cells were treated with NP at different concentrations (0, 0.1, 1, 10, or 20 M) for 24 h for subsequent experiments.
2.3.
Protein extraction and western blot analysis
Cells were collected and whole cell homogenates were extracted on ice in lysis buffer (Cell lysis buffer for Western and IP, Beyotime, Shanghai, China) containing 1 mM PMSF. Nuclear extracts were prepared using the commercial kit according to the manufacturer’s instruction (Nuclear and cytoplasmic extraction kit, Beyotime). Protein concentrations were determined by BCA protein assay (Beyotime). In the study, nuclear extracts were used to determine the ER-␣ and ER- expression levels, whole cell homogenates were used for the determination of the FSHR expression levels. Proteins were denatured by boiling in loading buffer (20 mM Tris–HCl, pH 6.8, 10% glycerol, 4% SDS, 100 mM DTT and 0.04% bromophenol blue). Samples (approximately 40 g protein) were loaded onto 10% SDS polyacrylamide gel followed by electroblotting onto nitrocellulose membrane. After blocking of non-specific binding with 5% bovine serum albumin (prepared in TBS containing 0.1% Tween 20) for 1 h at room temperature, the membranes were applied with antibodies against ER-␣, ER-, FSHR and -actin, followed by incubation with anti-rabbit/mouse IgG-HRP antibody. Then the protein was detected using enhanced chemiluminescence. Densitometry was performed using the software Quantity One.
2.4. Reverse transcription polymerase chain reaction (RT-PCR) analysis Total RNA was extracted using Trizol Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. The cDNA was synthesized from 2 g of total RNA in 20 L reaction mixture using ReverAidTM First Strand cDNA Synthesis Kit according to the manufacturer’s instruction (Thermo Scientific, Maryland, USA). PCR primer sets were shown in Table 1. PCR products were analyzed by GoldView-agarose gel electrophoresis on 2% (w/v) agarose gel, and visualized under UV light. The signals of target genes were measured by scanning densitometry and normalized to -actin using Quantity One software.
610
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 608–616
Table 1 – List of primers used in polymerase chain reactions. Genes
Actin
ER␣
ER
AR
PR
TLR-4
Vinculin
N-cadherin
Vimentin
Ocln
Trf
MIS
iNOS
2.5. levels
Sequence (5’- > 3’)
Forward primer: TGGCACCACACCTTCTACAATG Reverse primer: CCTGCTTGCTGATCCACAATCTG Forward primer: AATGCAAGAACGTTGTGCCC Reverse primer: TCTGCTTCCGGGGGTATGTA Forward primer: CTGTCCAGCCACGAATCAGT Reverse primer: CCTCATCCCTGTCCAGAACG Forward primer: GGACCATGTTTTACCCATCG Reverse primer: TCGTTTCTGCTGGCACATAG Forward primer: ACCAGAACTCGCTGGGATTG Reverse primer: GGTCTTGGTCAGCTCCTGTC Forward primer: GCTTTCACCTCTGCCTTCAC Reverse primer: GAAACTGCCATGTTTGAGCA Forward primer: ACCAAGCGGGCACTTATTCA Reverse primer: AAAGCCAGCATCTGTTCGGA Forward primer: GGAATCCCGCCTATGAGTGG Reverse primer: CGTCTAGCCGTCTGATTCCC Forward primer: CAGCAGTATGAAAGCGTGG Reverse primer: GGAAGAAAAGGTTGGCAGAG Forward primer: TGTCCGTGAGGCCTTTTGAA Reverse primer: GGGCGACGTCCATTTGTAGA Forward primer: GGCATCGGACACTAGCATCA Reverse primer: TGGGCCAATACACAGGTCAC Forward primer: ATTTGGCTCTGATTCCCGCT Reverse primer: ATAGGGGTTCCTCCCAGTCG Forward primer: CTCGGAACTGTAGCACAGCA Reverse primer: TGGAGCACAGCCACATTGAT
Product length (bp) 800
181
548
171
385
174
336
691
441
182
205
338
Fig. 1 – Effect of NP on mRNA expression of cell receptors in TM4 Cells. (A) mRNA levels of cell receptors were determined by RT-PCR. (B) Histogram represents quantification of mRNA expression of cell receptors in NP-stimulated TM4 cells using Quantity One software (levels of control cells/-actin defined as 1). Results are presented as mean ± S.D. with triplicate measurement. * P < 0.05, # P < 0.01 vs. control group.
2.6.
Cells were treated with NP for 24 h, and then supernatants were collected and immediately assayed for the levels of NO using commercial kit (JianCheng Bioengineering Institute, Nanjing, China) with an automated microplate reader, following the manufacturer’s instruction.
2.7. 631
Measurement of NO content
Statistical analysis
Values are expressed as mean ± S.D. One-way analysis of variance followed by the Student–Newman–Keuls test was used to determine the statistical significance between various groups. A value of P < 0.05 was considered to be statistically significant.
3.
Results
3.1.
Expression of cell receptors in TM4 cells
Determination of ABP, inhibin B and cytokine
Levels of ABP, inhibin B and related cytokines in the culture supernatants were determined by ELISA kits according to the manufacturer’s instructions.
To investigate the effects of NP on the expression of cell receptors, RT-PCR was used to examine mRNA expression of ER-␣, ER-, AR, PR and TLR-4. As shown in Fig. 1, no significant
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 608–616
Fig. 2 – Effect of NP on cell receptors expression in TM4 Cells. (A) Protein levels of FSHR were determined by western blot analysis. (B) Protein levels of ER-␣ and ER- were determined by western blot analysis. (C) Histogram represents quantification of FSHR, ER-␣ and ER- protein levels in NP-stimulated TM4 cell samples using Quantity One software (levels of control cells/-actin defined as 1). Results are presented as mean ± S.D. with triplicate measurement. * P < 0.05, # P < 0.01 vs. control group.
changes were found in ER-␣ and TLR4 mRNA expression levels in NP treated groups as compared with control group. The expression of ER- mRNA was dramatically down-regulated in NP stimulated groups as compared with control group (P < 0.01). Additionally, AR and PR mRNA levels were decreased in NP challenged TM4 cells, which were statistically significant at 10, 20 M NP groups (P < 0.01) and 1, 10, 20 M (P < 0.05) NP groups, respectively. To further investigate the effects of NP exposure on the cell receptor proteins in Sertoli TM4 cells, we analyzed the protein expression levels of FSHR, ER-␣ and ER- by western blot. Our results showed that the expression of FSHR was significantly increased in 0.1, 1 and 10 M NP treated groups as compared with control group (P < 0.05, Fig. 2). Interestingly, the expression of FSHR was markedly reduced in the cells exposed to 20 M NP (P < 0.05). Similar to the results observed in the mRNA levels of ER-␣, no significant differences in the protein expression of ER-␣ were found in any exposure groups compared with the control group. The protein expression levels of ER- were down-regulated markedly in the 10 and 20 M NP treated groups compared with that in control cells (P < 0.05, Fig. 2).
611
Fig. 3 – mRNA expression in TM4 Cells. (A) mRNA expression of junction associated molecules in TM4 Cells was determined by RT-PCR. (B) mRNA expression of Trf and MIS in TM4 Cells was determined by RT-PCR. (C) Histogram represents quantification of mRNA levels using Quantity One software (levels of control cells/-actin defined as 1). Results are presented as mean ± S.D. with triplicate measurement. * P < 0.05, # P < 0.01 vs. control group.
3.2. mRNA expression of function associated molecules in TM4 cells Vinculin, N-cadherin, occludin and vimentin play a key role in the formation of BTB. Thus, the mRNA levels of vinculin, N-cadherin, occludin and vimentin were determined in our study. Results showed that NP markedly reduced the mRNA levels of N-cadherin and vinculin in a dose dependent manner (P < 0.05, Fig. 3). In addition, occludin mRNA levels were down-regulated in 1, 10 and 20 M NP treated groups (P < 0.01). On the other hand, no obvious effect was found in the mRNA expression of vimentin in NP treated groups as compared with control group. These interesting findings implied that NP may influence the expression of N-cadherin, vinculin and occludin to impair the normal function of BTB.
612
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 608–616
Table 2 – Effects of NP on cytokine secretion in TM4 cells. NP (M)
IL-1␣ (pg/ml)
Control 0.1 1 10 20
4.59 5.29 7.20 9.77 10.38
± ± ± ± ±
0.16 0.47 1.86 1.10# 0.43#
TGF-1(pg/ml) 56.16 58.78 111.65 124.02 127.63
± ± ± ± ±
10.45 5.56 4.29# 12.28# 18.13#
TNF-␣ (pg/ml) 13.04 21.96 69.39 108.52 133.43
± ± ± ± ±
4.56 5.07 7.05# 5.97# 8.99#
Values are expressed as mean ± S.D. for triplicate experiments. P < 0.01 vs. control group.
#
apoptosis, steroidogenesis and cell division (Sarkar et al., 2008). The levels of interleukin (IL)-1␣, transforming growth factor (TGF)-1 and tumor necrosis factor (TNF)-␣ were determined in the present study. Our data showed that treatment of NP dose-dependently induced IL-1␣, TGF-1 and TNF-␣ secretion in TM4 cells as compared with control group (P < 0.01, Table 2). The levels of IL-1␣, TGF-1 and TNF-␣ in control group were 4.59 ± 0.16, 56.16 ± 10.45 and 13.04 ± 4.56 (pg/ml), and those in 20 M NP group were 10.38 ± 0.43, 127.63 ± 18.13 and 133.43 ± 8.99 (pg/ml), respectively.
3.5.
Fig. 4 – Levels of ABP and inhibin B in NP-stimulated TM4 cells. Cultured cells were exposed to NP for 24 h. After treatment, culture supernatants were collected and analyzed for ABP and inhibin B contents by ELISA. Results are presented as mean ± S.D. with triplicate measurement. * P < 0.05, # P < 0.01 vs. control group.
Two specific secretion proteins in TM4 cells, Trf and MIS were also analyzed by RT-PCR in the study. The mRNA levels of Trf were significantly reduced in cells exposed to 1, 10 and 20 M NP compared with control group (P < 0.01). However, no significant changes were observed in expression of MIS mRNA levels.
3.3.
Levels of ABP and inhibin B
ABP and inhibin B are functional proteins synthesized and secreted by Sertoli cells. ABP, a specific marker for Sertoli cells, has important physiological roles. It is a carrier of testosterone within the Sertoli cells and transporter of testosterone from the testis into epididymis (Bardin et al., 1981). Inhibin B was also considered as a marker of Sertoli cell damage and spermatogenic disturbance. Therefore, levels of ABP and inhibin B were determined by using ELISA kits in our study. Levels of ABP were increased in 10 and 20 M NP treated groups as compared with control group (P < 0.01, Fig. 4A). On the contrary, inhibin B contents decreased in 20 M NP treated group as compared with control group (P < 0.01, Fig. 4B).
3.4.
Levels of cytokines
Cytokines are known to regulate an array of physiological functions in the testis, including cell differentiation,
NO production and iNOS mRNA expression
The effect of NP on NO production in TM4 cells was determined by using commercial kit. The NO concentration of the culture supernatant was significantly decreased by NP (P < 0.01, Fig. 5A), suggesting that NP may inhibit NO production in TM4 cells. To confirm the decrease of NO production, RT-PCR was performed to analyze mRNA expression of inducible nitric oxide synthase (iNOS), which is the most crucial enzyme in the synthesis of NO. As shown in Fig. 5B, the iNOS mRNA expression levels were dose-dependently reduced by NP in TM4 cells. The results indicated that the production of NO in TM4 cells may be mediated by the expression of the iNOS gene.
4.
Discussion
Testis is the target organ for most male reproductive toxicants. Sertoli cells and Leydig cells are two types of very important cells in testes. Disruption of these cells will cause damage to spermatogenesis and ultimately disrupt the male reproductive system. Leydig cells mainly produce androgen. The level of testosterone is responsible for the maintnance of spermatogenesis and secondary sexual characteristics in the male. Several studies have expounded that NP treatment led to disrupt testosterone secretion both in vivo and in vitro in Leydig cells (Gong and Han, 2006; Wu et al., 2010), which indicated that NP may impair spermatogenesis via Leydig cell dysfunction causing testosterone imbalance, the molecule mechanism of which, at least in part, due to affect the enzymes required for the biosynthesis of testosterone in Leydig cells. However, the present study was focused on the effects of NP on the expression of cell receptors and secretory function in Sertoli cells. Sertoli cells are a target for various toxicants and serve as a well-established model for toxicity studies in male reproductive systems in vitro. They are in contact with each other
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 608–616
Fig. 5 – Effects of NP on NO production and iNOS expression in TM4 cells. (A) NO levels in supernatant were determined using commercial kit. (B) mRNA expression of iNOS was determined by RT-PCR. (C) Histogram represents quantification of mRNA levels using Quantity One software (levels of control cells/-actin defined as 1). Results are presented as mean ± S.D. with triplicate measurement. * P < 0.05, # P < 0.01 vs. control group.
via the Sertoli cell-junctional complex that consists of tight, adherens and gap junctions constituting the anatomical basis of BTB (Griswold, 1998). Disruption of these junctions leads to impairment of spermatogenesis, and may ultimately lead to sterility in the male. Besides, alterations in the BTB may be considered as indirect effects resulting in a reduced fertility. Vinculin and N-cadherin are involved in the formation of adherens junctions. It was found that mRNA levels of vinculin and N-cadherin were reduced significantly in a dose dependent manner by NP treatment (Fig. 3), implying that vinculin and N-cadherin may be sensitive to NP treatment and serve as a target of NP exposure to cause impairment of cell junctions and BTB in testis. Vimentin, one of the cytoskeleton-associated proteins in cells, plays an important
613
role in maintaining the cellular morphology, the process of spermatogenesis and the integrity of adhesion plaque (Wang et al., 2002). Pathologic conditions may result in altered expression of vimentin filaments. Alteration in vimentin level was considered as one of the parameters to identify the early toxic effect of testicular toxicants. However, our results suggested that vimentin was not sensitive to NP. Occludin is the main tight junctions associated component. Disruption of occludin regulation is an important aspect of a number of diseases. Strategies to prevent and/or reverse occludin down-regulation may be an important therapeutic target. Our study demonstrated that occludin was a target molecule of NP, as evidenced by the decreased mRNA expression levels of occludin in a dose dependent manner in TM4 cells exposed to NP. However, the mechanism of these changes appears to be complex and is not clear at this time. Hejmej et al. (Hejmej et al., 2013) reported that 4-tert–octylphenol acted directly on adherens and gap junction proteins in the testes, and the biological effects of 4-tert–octylphenol on -catenin and Cx43 involved an ERmediated response. Further studies are required to determine the molecular mechanisms involved in the altered expression of junction-associated molecules induced by NP in Sertoli TM4 cells. Sertoli cells synthetize and release specific proteins to regulate or respond to pituitary hormone release and further influence spermatogenesis (Feng et al., 2010; Krishnamoorthy et al., 2011). MIS was secreted by Sertoli cells specifically and the elevation of MIS level was a marker of the decrease in testicular androgen concentration. Our results suggested that MIS may not be involved in the altered secretory function of Sertoli cells following NP exposure. Testicular Trf is a major secretory product of Sertoli cells and is thought to play a critical role in the delivery of iron from the somatic compartment to the germ cells sequestered by the BTB (Skinner and Griswold, 1980). A mutant mouse that was unable to synthesize normal levels of Trf exhibited a reduced ability to produce functional spermatozoa. The reduced Trf mRNA expression levels in the study suggested that NP exposure impaired the synthesis and secretion of Trf. This exposure may further affect the development of germ cells in testes, and then underlie the reproductive toxicity caused by NP. ABP, a glycoprotein secreted by Sertoli cells into the lumen of the tubule, had important biological effects on differentiation and maturity of sperm (Griswold, 1988). It is also considered to be a biological marker of Sertoli cell function. ABP binds, transports and protects androgen from degradation and also controls their bioavailability in the testis, which facilitates the development and maturation of spermatogenic cells. Alteration in the levels of ABP in the current study suggested that a change in Sertoli cell function may be a result of NP treatment. The overexpression of ABP in Sertoli cells exposed to NP may result in androgen deficiency by possibly sequestering the free testosterone in testis. Inhibin, also a secretory product of Sertoli cells, is a gonadotrophin regulating hormone consisting of either a ßA (inhibin A) or a ßB subunit (inhibin B) (Pfaff et al., 2013). Inhibin B was considered as a biomarker of testicular toxicity. The concentration of inhibin B correlates with testicular histology, sperm concentration and sperm count. Markedly decreased
614
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 608–616
inhibin B levels were associated with severe damage of testes. In addition, inhibin B levels were lower in infertile individuals and in men with hypogonadotrophic hypogonadism. The decreased inhibin B levels in the current study (Fig. 4A) suggested that impaired secretory function of TM4 cells may result from NP exposure. These results also highlighted the toxicity of NP to the male reproductive system. NP is estrogenic, it mimics estrogens, hormones that are responsible for the development and maintenance of secondary sexual characteristics and behavior. Actions of hormones are mediated by hormone receptors. Androgens are critical steroid hormones that determine the expression of the male phenotype, including the outward development of secondary sex characteristics as well as the initiation and maintenance of spermatogenesis. The actions of androgens are mediated by AR. AR in Sertoli cells was reported to be essential for germ cell nursery and junctional complex formation in mouse testes (Wang et al., 2006). The impact of lacking AR in Sertoli cells mainly affects Sertoli cell functions to support and nurture germ cells, leading to spermatogenesis arrest at the diplotene primary spermatocyte stage prior to the accomplishment of first meiotic division. The alteration of AR expression in NP stimulated TM4 cells (Fig. 1) implied that NP may exert reproductive toxicity to TM4 cells. The similar results were found in the PR expression. Estrogen influences the growth, differentiation and function of many target tissues, such as mammary gland, uterus, vagina, ovary, testes, epididymis and prostate. Estrogens diffuse in and out of cells but are retained with high affinity and specificity in target cells by ER. Both ER-␣ and ER- were found to be expressed in Sertoli TM4 cells in the current study. Previous studies showed that NP induced ER mRNA expression (Ren et al., 1997) and acted as agonists for ER-␣ (Vivacqua et al., 2003) in human breast cancer cells-MCF-7. However, in the present study, NP showed no effect on ER-␣ expression in TM4 cells. On the contrary, NP significantly inhibited the expression of ER- in TM4 cells. These data suggested that NP may have high affinity to ER- in TM4 cells. FSH is important for the maturation of Sertoli cells, production of specific proteins in Sertoli cells and normal spermatogenesis (Dierich et al., 1998). FSHR is expressed only in Sertoli cells in the testis, and this receptor regulates many functions of Sertoli cells through interaction with FSH. Dual effects of NP on FSHR expression according to the concentration of NP were observed in our study, i.e. the expression levels of FSHR were significantly increased in low dose of NP treated groups, but markedly reduced in the cells exposed to high dose of NP group. We hypothesized that the effect of NP on the up-regulated expression of FSHR might be through the direct estrogenic actions or due to the self-protection of cells, however, high dose of NP-mediated suppression of FSHR expression was due to a NP cytotoxic effect. In the present assay, the change of FSHR may be related to the changing of the secretory function of Sertoli cells. Tolllike receptors (TLRs) play essential roles in activating signal transduction pathways leading to the killing and clearance of pathogens. Various studies have identified expression of TLRs in testis, recent studies reported that mouse Sertoli cells express TLR-2, TLR-4, TLR-5 and TLR-6 (Riccioli et al., 2006; Wu et al., 2008). We have demonstrated that TLR-4 may not be related to NP toxicity.
NO produced by Sertoli and germ cells may play a role in regulating the homeostasis of tight junction-integral membrane proteins at the site of the BTB (Lee and Cheng, 2003). In mammals, three types of NOS are found, namely neuronal NOS (nNOS), iNOS and endothelial NOS (eNOS). These NOSs differ in molecular size, physicochemical properties and cellular distribution, and are regulated differently. iNOS was found in the testis and implicated in spermatogenesis, infertility, sperm maturation and programmed cell death of Sertoli and germ cells (Herrero and Gagnon, 2001). Studies found that NP could increase NO production in the mouse brain (Zhang et al., 2008) but had no effect on the production of NO and the levels of iNOS gene expression in mouse macrophages (You et al., 2002). However, NP reduced NO production and iNOS mRNA expression in the present study. Sertoli cells have been shown to produce several cytokines, which probably participate in spermatogenesis. These cytokines play an important role in junction restructuring events during spermatogenesis in the seminiferous epithelium of testes. These include the regulation of cell–cell adhesion and tight junction permeability barriers in multiple epithelia and endothelia, such as those found in the small intestine, kidney, skin and testis (Cheng et al., 2008). Earlier studies have shown that the levels of TGF3 and TNF-␣ in Sertoli cells could perturb the Sertoli cell tight junction barrier formation (Li et al., 2006; Lui et al., 2003). Most recent studies were focused on TGF-3 and TNF-␣. However, this is not to rule out the participation of other cytokines, such as IL-1, TGF-1 and so on. IL-1␣ was identified as a regulator of the BTB (Lie et al., 2011). Our study proposed that IL-1␣, TGF-1 and TNF-␣ were related to cell junctions in TM4 cells, as evidenced by the changes of the cytokine levels in TM4 cells. On the other hand, NO and these cytokines are involved in many physiological and pathological processes, especially in immunology. Changes of NO and these cytokines in cells with NP exposure implied that NP may influence the immune system in Sertoli cells. Previous studies have demonstrated that hormone receptors were associated with the secretory function and BTB formation in Sertoli cells. Loss of AR specifically in Sertoli cells could affect junction complex formation of Sertoli cells, Sertoli cell-specific transport protein and paracrine factor production and/or secretion, leading to impaired Sertoli cells nursery functions for developing germ cells and functional integrity of the BTB (Wang et al., 2006). Additionally, the expression levels of ER and FSHR were related to the changing expression levels of ABP, transferrin and the alteration of the secretory function of Sertoli cells (Hejmej et al., 2013; Krishnamoorthy et al., 2011). In our study, the expression levels of ER-, PR, and AR were significantly decreased in NP exposure groups, as well as FSHR level at high NP concentration. Therefore, we proposed that the down-regulation of cell receptors was involved in the decrease of BTB-associated elements. Moreover, decreased cell receptors may be related to the changing levels of inhibinB, ABP, transferrin and the alteration of the secretory function in TM4 cells, and thereby disturbing the spermatogenic process. It has been reported that NP is seriously threatening reproductive health of human and animals, especially to male reproduction. The molecular mechanism of reproductive damage in male induced by EDCs is complex, and mainly
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 608–616
include the following mechanisms (Diamanti-Kandarakis et al., 2009; Welshons et al., 2003): regulating the hormone levels by altering hormone bioavailability, changing the hormone metabolism and the body’s own metabolism, mediated by cell receptors and affecting cell signal transduction pathways. The effects of NP on male reproductive dysfunction are not fully understood. The results from the study suggested that NP may exert reproductive toxicity in Sertoli cells by changing expression of junction related molecules, secretory function and cell receptors.
5.
Conclusion
In this study, we found NP exposure could influence the expression of ER-, PR, AR and FSHR in TM4 cells. Additionally, NP exposure led to the changes in the levels of BTB-associated elements including vinculin, N-cadherin and occludin. Meanwhile, NP had effects on secretory function as evidenced by the changes in the levels of ABP, inhibin B, Trf, NO and some cytokines in TM4 cells. These effects may be associated with the male-specific reproductive toxicity of NP. Further studies are required to elucidate the specific molecular mechanism of these effects from NP in TM4 cells.
Conflict of Interest The authors declare that there are no conflicts of interest.
Acknowledgements The financial support for this study by the National Basic Research Program of China (973 program) (No.: 2012CB720805), International Science & Technology Cooperation Program of China (No.: 2010DFA31780), the Joint Sino-German Research Project of National Natural Science Foundation of China (No.: GZ 731), and the Program for New Century Excellent Talents in University (NCET-12-0749), is gratefully acknowledged.
Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/ j.etap.2014.01.017.
references
Bardin, W., Musto, N., Gunsalus, G., Kotite, N., Cheng, S., Larrea, F., Becker, R., 1981. Extracellular androgen binding proteins. Annu. Rev. Physiol. 43, 189–198. Carlsen, E., Giwercman, A., Keiding, N., Skakkebæk, N.E., 1992. Evidence for decreasing quality of semen during past 50 years. BMJ. 305, 609. Cheng, C., Li, M.W., Mruk, D.D., 2008. Unlocking the blood-testis barrier and the ectoplasmic specialization by cytokines during spermatogenesis: emerging targets for male contraception. Immunol. Endocr. Metab. Agents-Med. Chem. 8, 20–27. Cox, C., 1996. Nonyl phenol and related chemicals. J. Pestic. Reform. 16, 15–20.
615
Diamanti-Kandarakis, E., Bourguignon, J.P., Giudice, L.C., Hauser, R., Prins, G.S., Soto, A.M., Zoeller, R.T., Gore, A.C., 2009. Endocrine-disrupting chemicals: an endocrine society scientific statement. Endocr. Rev. 30, 293–342. Dierich, A., Sairam, M.R., Monaco, L., Fimia, G.M., Gansmuller, A., LeMeur, M., Sassone-Corsi, P., 1998. Impairing follicle-stimulating hormone (FSH) signaling in vivo: targeted disruption of the FSH receptor leads to aberrant gametogenesis and hormonal imbalance. P. Natl. Acad. Sci. 95, 13612–13617. Feng, Y., Fang, X., Shi, Z., Xu, M., Dai, J., 2010. Effects of PFNA exposure on expression of junction-associated molecules and secretory function in rat Sertoli cells. Reprod. Toxicol. 30, 429–437. Gong, Y., Han, X.-D., 2006. Effect of nonylphenol on steroidogenesis of rat Leydig cells. J. Environ. Sci. Heal. B. 41, 705–715. Griswold, M.D., 1988. Protein secretions of Sertoli cells. Int. Rev. Cytol. 110, 133–156. Griswold, M.D., 1998. The central role of Sertoli cells in spermatogenesis. Cell. Dev. Biol. 9, 411–416. Guenther, K., Heinke, V., Thiele, B., Kleist, E., Prast, H., Raecker, T., 2002. Endocrine disrupting nonylphenols are ubiquitous in food. Environ. Sci. Technol. 36, 1676–1680. Han, X.D., Tu, Z.G., Gong, Y., Shen, S.N., Wang, X.Y., Kang, L.N., Hou, Y.Y., Chen, J.X., 2004. The toxic effects of nonylphenol on the reproductive system of male rats. Reprod. Toxicol. 19, 215–221. Hejmej, A., Kotula-Balak, M., Chojnacka, K., Kuras, P., Lydka-Zarzycka, M., Bilinska, B., 2013. Photoperiod-dependent effects of 4-tert-octylphenol on adherens and gap junction proteins in bank vole seminiferous tubules. Int. J. Endocrinol. 2013, 11pages, Article ID 134589. Herrero, M.B., Gagnon, C., 2001. Nitric oxide: a novel mediator of sperm function. J. Androl. 22, 349–356. Hu, Y., Li, D.M., Han, X.D., 2012. Analysis of combined effects of nonylphenol and Monobutyl phthalate on rat Sertoli cells applying two mathematical models. Food. Chem. Toxicol. 50, 457–463. Krishnamoorthy, G., Selvakumar, K., Elumalai, P., Venkataraman, P., Arunakaran, J., 2011. Protective role of lycopene on polychlorinated biphenyls (Aroclor 1254)-induced adult rat Sertoli cell dysfunction by increased oxidative stress and endocrine disruption. Biomed. Prev. Nutr. 1, 116–125. Lee, N.P., Cheng, C.Y., 2003. Regulation of Sertoli cell tight junction dynamics in the rat testis via the nitric oxide synthase/soluble guanylate cyclase/3’, 5’-cyclic guanosine monophosphate/protein kinase G signaling pathway: an in vitro study. Endocrinology. 144, 3114–3129. Li, M.W., Xia, W., Mruk, D.D., Wang, C.Q., Yan, H.H., Siu, M.K., Lui, W.-y., Lee, W.M., Cheng, C.Y., 2006. Tumor necrosis factor ␣ reversibly disrupts the blood–testis barrier and impairs Sertoli–germ cell adhesion in the seminiferous epithelium of adult rat testes. J. Endocrinol. 190, 313–329. Lie, P.P., Cheng, C.Y., Mruk, D.D., 2011. Interleukin-1␣ is a regulator of the blood-testis barrier. FASEB J. 25, 1244–1253. Lipshultz, L.I., Howards, S.S., Niederberger, C.S., 1997. Infertility in the Male, 3rd ed. St. Louis, Mosby–Year Book, pp. 336–359. Lui, W.Y., Lee, W.M., Cheng, C.Y., 2003. TGF-s: their role in testicular function and Sertoli cell tight junction dynamics. Int. J. Androl. 26, 147–160. Mruk, D.D., Cheng, C.Y., 2004. Sertoli-Sertoli and Sertoli-germ cell interactions and their significance in germ cell movement in the seminiferous epithelium during spermatogenesis. Endoc. Rev. 25, 747–806. Pfaff, T., Rhodes, J., Bergmann, M., Weinbauer, G.F., 2013. Inhibin B as a marker of Sertoli cell damage and spermatogenic disturbance in the rat. Birth. Defects Res. B. 98, 91–103.
616
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 608–616
Pflieger-Bruss, S., Schuppe, H., Schill, C.W.B., 2004. The male reproductive system and its susceptibility to endocrine disrupting chemicals. Andrologia. 36, 337–345. Ren, L., Marquardt, M.A., Lech, J.J., 1997. Estrogenic effects of nonylphenol on pS2. ER and MUC1 gene expression in human breast cancer cells-MCF-7. Chem-Biol. Interact. 104, 55–64. Riccioli, A., Starace, D., Galli, R., Fuso, A., Scarpa, S., Palombi, F., De Cesaris, P., Ziparo, E., Filippini, A., 2006. Sertoli cells initiate testicular innate immune responses through TLR activation. J. Immunol. 177, 7122–7130. Sarkar, O., Mathur, P.P., Cheng, C.Y., Mruk, D.D., 2008. IL-1␣ is a novel regulator of the blood-testis barrier in the rat. Biol. Reprod. 78, 445–454. Sharpe, R.M., 2001. Hormones and testis development and the possible adverse effects of environmental chemicals. Toxicol. Lett. 120, 221–232. Skinner, M.K., Griswold, M.D., 1980. Sertoli cells synthesize and secrete transferrin-like protein. J. Biol. Chem. 255, 9523–9525. Soares, A., Guieysse, B., Jefferson, B., Cartmell, E., Lester, J., 2008. Nonylphenol in the environment: a critical review on occurrence, fate, toxicity and treatment in wastewaters. Environ. Int. 34, 1033. Vivacqua, A., Recchia, A.G., Fasanella, G., Gabriele, S., Carpino, A., Rago, V., Di Gioia, M.L., Leggio, A., Bonofiglio, D., Liguori, A., 2003. The food contaminants bisphenol A and 4-nonylphenol act as agonists for estrogen receptor ␣ in MCF7 breast cancer cells. Endocrine. 22, 275–284. Wang, R.S., Yeh, S.Y., Chen, L.M., Lin, H.Y., Zhang, C.X., Ni, J., Wu, C.C., di Sant’Agnese, P.A., Tzeng, C., Chang, C., 2006. Androgen receptor in Sertoli cell is essential for germ cell nursery and
junctional complex formation in mouse testes. Endocrinology. 147, 5624–5633. Wang, Z.Q., Watanabe, Y., Toki, A., Itano, T., 2002. Altered distribution of Sertoli cell vimentin and increased apoptosis in cryptorchid rats. J. Pediatr. Surg. 37, 648–652. Welshons, W.V., Thayer, K.A., Judy, B.M., Taylor, J.A., Curran, E.M., Vom Saal, F.S., 2003. Large effects from small exposures. I. Mechanisms for endocrine-disrupting chemicals with estrogenic activity. Environ. Health Persp. 111, 994. Wu, H., Wang, H., Xiong, W., Chen, S., Tang, H., Han, D., 2008. Expression patterns and functions of toll-like receptors in mouse sertoli cells. Endocrinology. 149, 4402–4412. Wu, J.-J., Wang, K.-L., Wang, S.-W., Hwang, G.-S., Mao, I., Chen, M.-L., Wang, P.S., 2010. Differential effects of nonylphenol on testosterone secretion in rat Leydig cells. Toxicology. 268, 1–7. Xiong, X., Wang, A., Liu, G., Liu, H., Wang, C., Xia, T., Chen, X., Yang, K., 2006. Effects of p, p’-dichlorodiphenyldichloroethylene on the expressions of transferrin and androgen-binding protein in rat Sertoli cells. Environ. Res. 101, 334–339. You, H.J., Choi, C.Y., Jeon, Y.J., Chung, Y.C., Kang, S.K., Hahm, K.-S., Jeong, H.G., 2002. Suppression of inducible nitric oxide synthase and tumor necrosis factor-␣ expression by 4-nonylphenol in macrophages. Biochem. and Bioph. Res. Co. 294, 753–759. Zhang, Y.Q., Mao, Z., Zheng, Y.L., Han, B.P., Chen, L.T., Li, J., Li, F., 2008. Elevation of inducible nitric oxide synthase and cyclooxygenase-2 expression in the mouse brain after chronic nonylphenol exposure. Int. J. Mol. Sci. 9, 1977–1988.
Available online at www.sciencedirect.com
ScienceDirect journal homepage: www.elsevier.com/locate/etap
Effects of nonylphenol exposure on expression of cell receptors and secretory function in mouse Sertoli TM4 cells Xiaozhen Liu, Shaoping Nie, Danfei Huang, Mingyong Xie ∗ State Key Laboratory of Food Science and Technology, Nanchang University, Nanchang 330047, China
a r t i c l e
i n f o
a b s t r a c t
Article history:
The aim of this study was to investigate the effects of nonylphenol (NP) exposure on the
Received 19 November 2013
expression of cell receptors and secretory function in mouse Sertoli TM4 cells. There were
Received in revised form
no significant changes in mRNA expression of estrogen receptor (ER)-␣ and toll like receptor
17 January 2014
(TLR)-4 in the cells exposed to NP for 24 h. However, the mRNA expression levels of ER-,
Accepted 24 January 2014
progesterone receptor (PR) and androgen receptor (AR) were down-regulated in NP groups.
Available online 3 February 2014
Furthermore, NP treatment evoked significant changes in protein expression levels of ER and follicle-stimulating hormone receptor (FSHR). There were significant changes in the
Keywords:
mRNA expression levels of vinculin, N-cadherin and occludin, but not vimentin. Levels of
Nonylphenol
inhibin B, androgen binding protein (ABP) and transferrin (Trf) were found to change signifi-
Cell receptors
cantly in NP challenged cells. Additionally, the decrease of nitric oxide (NO) production and
Secretory function
inducible nitric oxide synthase (iNOS) mRNA expression and increase of cytokine levels were
TM4 cells
simultaneously found in NP stimulated TM4 cells. In conclusion, these findings have shown that NP exposure affected expression of cell receptors and may damage specific secretory function of Sertoli TM4 cells, which may be associated with the male-specific reproductive toxicity of NP. © 2014 Elsevier B.V. All rights reserved.
1.
Introduction
Endocrine disrupting compounds (EDCs) are an emerging problem with serious consequences for the environment. They are widely dispersed in the environment and are persistent organic pollutants. Previous studies showed that EDCs exhibited potential hazardous effect on animal reproduction and development (Cox, 1996), and on reproductive function
in men (Carlsen et al., 1992). Male reproductive parameters that have been reported as altered include a decrease in sperm count, increased incidence of congenital malformations of the male reproductive tract and testicular cancer among young men (Pflieger-Bruss et al., 2004; Sharpe, 2001). While it is not clear what factors or changes in lifestyle may be responsible for these changes, it has been suggested that among the different classes of reproductive toxicants present in the environment, those that act as EDCs have been singled out as
Abbreviations: EDCs, endocrine-disrupting compounds; NP, nonylphenol; ER, estrogen receptor; TLR, toll like receptor; PR, progesterone receptor; AR, androgen receptor; FSHR, follicle-stimulating hormone receptor; ABP, androgen binding protein; Trf, transferrin; MIS, mullerian inhibiting substance; BTB, blood-testis barrier; DMEM/F-12, Dulbecco’s modified Eagle’s medium nutrient mixture F-12 HAM; HRP, horseradish peroxidase; RT-PCR, reverse transcription polymerase chain reaction; IL-1, interleukin-1; TGF, transforming growth factor; TNF, tumor necrosis factor; iNOS, inducible nitric oxide synthase; nNOS, neuronal NOS; eNOS, endothelial NOS. ∗ Corresponding author at: State Key Laboratory of Food Science and Technology, Nanchang University, 235 Nanjing East Road, Nanchang 330047, China. Tel.: +86 791 83969009; fax: +86 791 83969009. E-mail address: [email protected] (M. Xie). 1382-6689/$ – see front matter © 2014 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.etap.2014.01.017
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 608–616
contributing to male reproductive dysfunction. In recent years, there has been increased interest in assessing the relationship between impaired male fertility and environmental factors. Nonylphenol (NP), the major degradation product of alkylphenol ethoxylates, is a potential endocrine disruptor (Hu et al., 2012). NP has been used as emulsifier and modifier in paints, pesticides, textiles, and some personal care products, and has been also used as plasticizer and antioxidant in plastics and resins. It was found that NPs, which may leach from plastics used in food processing and packing and from commercially available polystyrene tubes, were ubiquitous in food (Guenther et al., 2002). A previous study showed that NP could result in potential reproduction problem (Han et al., 2004). Additionally, recent studies have shown that the impacts of NP in the environment include feminization of aquatic organisms and decrease in male fertility (Soares et al., 2008). Based on these observations, it is important to study the effects of NP and clearly understand its action mechanism. Testis is the target organ for most male reproductive toxicants. Sertoli cells, located in the seminiferous tubules of the testis, provide nutritional as well as morphogenetic support for germ cells during spermatogenesis (Lipshultz et al., 1997). Furthermore, they are involved in the synthesis and release of proteins including inhibin, androgen binding protein (ABP) and transferrin (Trf), which regulate or respond to pituitary hormone release and further influence spermatogenesis (Xiong et al., 2006). In addition, one major function of Sertoli cells is to establish blood-testis barrier (BTB) which provides a specialized and stable environment for germ cell development (Mruk and Cheng, 2004). Due to the importance of Sertoli cells in the testis, any agent that impairs the viability and/or function of these cells may have profound effects on spermatogenesis. NP is a toxic compound classified as being capable of interfering with the hormonal system of numerous organisms. Therefore, the goal of this study was to determine whether NP exposure has adverse effects on the levels of BTB-associated elements including vimentin, vinculin, N-cadherin and occludin, cell receptors including estrogen receptor (ER)-␣, ER-, androgen receptor (AR), progesterone receptor (PR), toll like receptor (TLR)4 and follicle-stimulating hormone receptor (FSHR), and specific secretion associated molecules including mullerian inhibiting substance (MIS), Trf, ABP, inhibin B and some cytokines. The present study has provided some prerequisite information for understanding the molecular mechanisms by which NP exposure causes reproductive toxicity.
2.
Materials and methods
2.1.
Reagents and chemicals
NP (99.9% purity), penicillin and streptomycin sulfate were obtained from Sigma–Aldrich Inc (St. Louis, MO, USA). Dulbecco’s modified Eagle’s medium nutrient mixture F-12 HAM (DMEM/F-12 medium), fetal bovine serum and horse serum were purchased from Hyclone (Waltham, MA, USA).
609
Antibodies against ER-␣, ER-, FSHR, -actin and horseradish peroxidase (HRP)-conjugated goat anti-rabbit/mouse IgG antibody were purchased from Abcam (Beverly, MA, USA). ABP and inhibin B ELISA kits were obtained from Westang (Shanghai, China), cytokine ELISA kits were from Boster (Wuhan, China). All other chemicals were of analytical grade.
2.2.
Cell culture
The Sertoli cell line, TM4 was obtained from American Type Culture Collection (ATTC, Rockville, MD). Cells were maintained in DMEM/F-12 medium, supplemented with 1% penicillin–streptomycin, 5% (v/v) horse serum and 2.5% (v/v) fetal bovine serum in an atmosphere with 95% humidity and 5% CO2 at 37 ◦ C. Cells were treated with NP at different concentrations (0, 0.1, 1, 10, or 20 M) for 24 h for subsequent experiments.
2.3.
Protein extraction and western blot analysis
Cells were collected and whole cell homogenates were extracted on ice in lysis buffer (Cell lysis buffer for Western and IP, Beyotime, Shanghai, China) containing 1 mM PMSF. Nuclear extracts were prepared using the commercial kit according to the manufacturer’s instruction (Nuclear and cytoplasmic extraction kit, Beyotime). Protein concentrations were determined by BCA protein assay (Beyotime). In the study, nuclear extracts were used to determine the ER-␣ and ER- expression levels, whole cell homogenates were used for the determination of the FSHR expression levels. Proteins were denatured by boiling in loading buffer (20 mM Tris–HCl, pH 6.8, 10% glycerol, 4% SDS, 100 mM DTT and 0.04% bromophenol blue). Samples (approximately 40 g protein) were loaded onto 10% SDS polyacrylamide gel followed by electroblotting onto nitrocellulose membrane. After blocking of non-specific binding with 5% bovine serum albumin (prepared in TBS containing 0.1% Tween 20) for 1 h at room temperature, the membranes were applied with antibodies against ER-␣, ER-, FSHR and -actin, followed by incubation with anti-rabbit/mouse IgG-HRP antibody. Then the protein was detected using enhanced chemiluminescence. Densitometry was performed using the software Quantity One.
2.4. Reverse transcription polymerase chain reaction (RT-PCR) analysis Total RNA was extracted using Trizol Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. The cDNA was synthesized from 2 g of total RNA in 20 L reaction mixture using ReverAidTM First Strand cDNA Synthesis Kit according to the manufacturer’s instruction (Thermo Scientific, Maryland, USA). PCR primer sets were shown in Table 1. PCR products were analyzed by GoldView-agarose gel electrophoresis on 2% (w/v) agarose gel, and visualized under UV light. The signals of target genes were measured by scanning densitometry and normalized to -actin using Quantity One software.
610
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 608–616
Table 1 – List of primers used in polymerase chain reactions. Genes
Actin
ER␣
ER
AR
PR
TLR-4
Vinculin
N-cadherin
Vimentin
Ocln
Trf
MIS
iNOS
2.5. levels
Sequence (5’- > 3’)
Forward primer: TGGCACCACACCTTCTACAATG Reverse primer: CCTGCTTGCTGATCCACAATCTG Forward primer: AATGCAAGAACGTTGTGCCC Reverse primer: TCTGCTTCCGGGGGTATGTA Forward primer: CTGTCCAGCCACGAATCAGT Reverse primer: CCTCATCCCTGTCCAGAACG Forward primer: GGACCATGTTTTACCCATCG Reverse primer: TCGTTTCTGCTGGCACATAG Forward primer: ACCAGAACTCGCTGGGATTG Reverse primer: GGTCTTGGTCAGCTCCTGTC Forward primer: GCTTTCACCTCTGCCTTCAC Reverse primer: GAAACTGCCATGTTTGAGCA Forward primer: ACCAAGCGGGCACTTATTCA Reverse primer: AAAGCCAGCATCTGTTCGGA Forward primer: GGAATCCCGCCTATGAGTGG Reverse primer: CGTCTAGCCGTCTGATTCCC Forward primer: CAGCAGTATGAAAGCGTGG Reverse primer: GGAAGAAAAGGTTGGCAGAG Forward primer: TGTCCGTGAGGCCTTTTGAA Reverse primer: GGGCGACGTCCATTTGTAGA Forward primer: GGCATCGGACACTAGCATCA Reverse primer: TGGGCCAATACACAGGTCAC Forward primer: ATTTGGCTCTGATTCCCGCT Reverse primer: ATAGGGGTTCCTCCCAGTCG Forward primer: CTCGGAACTGTAGCACAGCA Reverse primer: TGGAGCACAGCCACATTGAT
Product length (bp) 800
181
548
171
385
174
336
691
441
182
205
338
Fig. 1 – Effect of NP on mRNA expression of cell receptors in TM4 Cells. (A) mRNA levels of cell receptors were determined by RT-PCR. (B) Histogram represents quantification of mRNA expression of cell receptors in NP-stimulated TM4 cells using Quantity One software (levels of control cells/-actin defined as 1). Results are presented as mean ± S.D. with triplicate measurement. * P < 0.05, # P < 0.01 vs. control group.
2.6.
Cells were treated with NP for 24 h, and then supernatants were collected and immediately assayed for the levels of NO using commercial kit (JianCheng Bioengineering Institute, Nanjing, China) with an automated microplate reader, following the manufacturer’s instruction.
2.7. 631
Measurement of NO content
Statistical analysis
Values are expressed as mean ± S.D. One-way analysis of variance followed by the Student–Newman–Keuls test was used to determine the statistical significance between various groups. A value of P < 0.05 was considered to be statistically significant.
3.
Results
3.1.
Expression of cell receptors in TM4 cells
Determination of ABP, inhibin B and cytokine
Levels of ABP, inhibin B and related cytokines in the culture supernatants were determined by ELISA kits according to the manufacturer’s instructions.
To investigate the effects of NP on the expression of cell receptors, RT-PCR was used to examine mRNA expression of ER-␣, ER-, AR, PR and TLR-4. As shown in Fig. 1, no significant
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 608–616
Fig. 2 – Effect of NP on cell receptors expression in TM4 Cells. (A) Protein levels of FSHR were determined by western blot analysis. (B) Protein levels of ER-␣ and ER- were determined by western blot analysis. (C) Histogram represents quantification of FSHR, ER-␣ and ER- protein levels in NP-stimulated TM4 cell samples using Quantity One software (levels of control cells/-actin defined as 1). Results are presented as mean ± S.D. with triplicate measurement. * P < 0.05, # P < 0.01 vs. control group.
changes were found in ER-␣ and TLR4 mRNA expression levels in NP treated groups as compared with control group. The expression of ER- mRNA was dramatically down-regulated in NP stimulated groups as compared with control group (P < 0.01). Additionally, AR and PR mRNA levels were decreased in NP challenged TM4 cells, which were statistically significant at 10, 20 M NP groups (P < 0.01) and 1, 10, 20 M (P < 0.05) NP groups, respectively. To further investigate the effects of NP exposure on the cell receptor proteins in Sertoli TM4 cells, we analyzed the protein expression levels of FSHR, ER-␣ and ER- by western blot. Our results showed that the expression of FSHR was significantly increased in 0.1, 1 and 10 M NP treated groups as compared with control group (P < 0.05, Fig. 2). Interestingly, the expression of FSHR was markedly reduced in the cells exposed to 20 M NP (P < 0.05). Similar to the results observed in the mRNA levels of ER-␣, no significant differences in the protein expression of ER-␣ were found in any exposure groups compared with the control group. The protein expression levels of ER- were down-regulated markedly in the 10 and 20 M NP treated groups compared with that in control cells (P < 0.05, Fig. 2).
611
Fig. 3 – mRNA expression in TM4 Cells. (A) mRNA expression of junction associated molecules in TM4 Cells was determined by RT-PCR. (B) mRNA expression of Trf and MIS in TM4 Cells was determined by RT-PCR. (C) Histogram represents quantification of mRNA levels using Quantity One software (levels of control cells/-actin defined as 1). Results are presented as mean ± S.D. with triplicate measurement. * P < 0.05, # P < 0.01 vs. control group.
3.2. mRNA expression of function associated molecules in TM4 cells Vinculin, N-cadherin, occludin and vimentin play a key role in the formation of BTB. Thus, the mRNA levels of vinculin, N-cadherin, occludin and vimentin were determined in our study. Results showed that NP markedly reduced the mRNA levels of N-cadherin and vinculin in a dose dependent manner (P < 0.05, Fig. 3). In addition, occludin mRNA levels were down-regulated in 1, 10 and 20 M NP treated groups (P < 0.01). On the other hand, no obvious effect was found in the mRNA expression of vimentin in NP treated groups as compared with control group. These interesting findings implied that NP may influence the expression of N-cadherin, vinculin and occludin to impair the normal function of BTB.
612
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 608–616
Table 2 – Effects of NP on cytokine secretion in TM4 cells. NP (M)
IL-1␣ (pg/ml)
Control 0.1 1 10 20
4.59 5.29 7.20 9.77 10.38
± ± ± ± ±
0.16 0.47 1.86 1.10# 0.43#
TGF-1(pg/ml) 56.16 58.78 111.65 124.02 127.63
± ± ± ± ±
10.45 5.56 4.29# 12.28# 18.13#
TNF-␣ (pg/ml) 13.04 21.96 69.39 108.52 133.43
± ± ± ± ±
4.56 5.07 7.05# 5.97# 8.99#
Values are expressed as mean ± S.D. for triplicate experiments. P < 0.01 vs. control group.
#
apoptosis, steroidogenesis and cell division (Sarkar et al., 2008). The levels of interleukin (IL)-1␣, transforming growth factor (TGF)-1 and tumor necrosis factor (TNF)-␣ were determined in the present study. Our data showed that treatment of NP dose-dependently induced IL-1␣, TGF-1 and TNF-␣ secretion in TM4 cells as compared with control group (P < 0.01, Table 2). The levels of IL-1␣, TGF-1 and TNF-␣ in control group were 4.59 ± 0.16, 56.16 ± 10.45 and 13.04 ± 4.56 (pg/ml), and those in 20 M NP group were 10.38 ± 0.43, 127.63 ± 18.13 and 133.43 ± 8.99 (pg/ml), respectively.
3.5.
Fig. 4 – Levels of ABP and inhibin B in NP-stimulated TM4 cells. Cultured cells were exposed to NP for 24 h. After treatment, culture supernatants were collected and analyzed for ABP and inhibin B contents by ELISA. Results are presented as mean ± S.D. with triplicate measurement. * P < 0.05, # P < 0.01 vs. control group.
Two specific secretion proteins in TM4 cells, Trf and MIS were also analyzed by RT-PCR in the study. The mRNA levels of Trf were significantly reduced in cells exposed to 1, 10 and 20 M NP compared with control group (P < 0.01). However, no significant changes were observed in expression of MIS mRNA levels.
3.3.
Levels of ABP and inhibin B
ABP and inhibin B are functional proteins synthesized and secreted by Sertoli cells. ABP, a specific marker for Sertoli cells, has important physiological roles. It is a carrier of testosterone within the Sertoli cells and transporter of testosterone from the testis into epididymis (Bardin et al., 1981). Inhibin B was also considered as a marker of Sertoli cell damage and spermatogenic disturbance. Therefore, levels of ABP and inhibin B were determined by using ELISA kits in our study. Levels of ABP were increased in 10 and 20 M NP treated groups as compared with control group (P < 0.01, Fig. 4A). On the contrary, inhibin B contents decreased in 20 M NP treated group as compared with control group (P < 0.01, Fig. 4B).
3.4.
Levels of cytokines
Cytokines are known to regulate an array of physiological functions in the testis, including cell differentiation,
NO production and iNOS mRNA expression
The effect of NP on NO production in TM4 cells was determined by using commercial kit. The NO concentration of the culture supernatant was significantly decreased by NP (P < 0.01, Fig. 5A), suggesting that NP may inhibit NO production in TM4 cells. To confirm the decrease of NO production, RT-PCR was performed to analyze mRNA expression of inducible nitric oxide synthase (iNOS), which is the most crucial enzyme in the synthesis of NO. As shown in Fig. 5B, the iNOS mRNA expression levels were dose-dependently reduced by NP in TM4 cells. The results indicated that the production of NO in TM4 cells may be mediated by the expression of the iNOS gene.
4.
Discussion
Testis is the target organ for most male reproductive toxicants. Sertoli cells and Leydig cells are two types of very important cells in testes. Disruption of these cells will cause damage to spermatogenesis and ultimately disrupt the male reproductive system. Leydig cells mainly produce androgen. The level of testosterone is responsible for the maintnance of spermatogenesis and secondary sexual characteristics in the male. Several studies have expounded that NP treatment led to disrupt testosterone secretion both in vivo and in vitro in Leydig cells (Gong and Han, 2006; Wu et al., 2010), which indicated that NP may impair spermatogenesis via Leydig cell dysfunction causing testosterone imbalance, the molecule mechanism of which, at least in part, due to affect the enzymes required for the biosynthesis of testosterone in Leydig cells. However, the present study was focused on the effects of NP on the expression of cell receptors and secretory function in Sertoli cells. Sertoli cells are a target for various toxicants and serve as a well-established model for toxicity studies in male reproductive systems in vitro. They are in contact with each other
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 608–616
Fig. 5 – Effects of NP on NO production and iNOS expression in TM4 cells. (A) NO levels in supernatant were determined using commercial kit. (B) mRNA expression of iNOS was determined by RT-PCR. (C) Histogram represents quantification of mRNA levels using Quantity One software (levels of control cells/-actin defined as 1). Results are presented as mean ± S.D. with triplicate measurement. * P < 0.05, # P < 0.01 vs. control group.
via the Sertoli cell-junctional complex that consists of tight, adherens and gap junctions constituting the anatomical basis of BTB (Griswold, 1998). Disruption of these junctions leads to impairment of spermatogenesis, and may ultimately lead to sterility in the male. Besides, alterations in the BTB may be considered as indirect effects resulting in a reduced fertility. Vinculin and N-cadherin are involved in the formation of adherens junctions. It was found that mRNA levels of vinculin and N-cadherin were reduced significantly in a dose dependent manner by NP treatment (Fig. 3), implying that vinculin and N-cadherin may be sensitive to NP treatment and serve as a target of NP exposure to cause impairment of cell junctions and BTB in testis. Vimentin, one of the cytoskeleton-associated proteins in cells, plays an important
613
role in maintaining the cellular morphology, the process of spermatogenesis and the integrity of adhesion plaque (Wang et al., 2002). Pathologic conditions may result in altered expression of vimentin filaments. Alteration in vimentin level was considered as one of the parameters to identify the early toxic effect of testicular toxicants. However, our results suggested that vimentin was not sensitive to NP. Occludin is the main tight junctions associated component. Disruption of occludin regulation is an important aspect of a number of diseases. Strategies to prevent and/or reverse occludin down-regulation may be an important therapeutic target. Our study demonstrated that occludin was a target molecule of NP, as evidenced by the decreased mRNA expression levels of occludin in a dose dependent manner in TM4 cells exposed to NP. However, the mechanism of these changes appears to be complex and is not clear at this time. Hejmej et al. (Hejmej et al., 2013) reported that 4-tert–octylphenol acted directly on adherens and gap junction proteins in the testes, and the biological effects of 4-tert–octylphenol on -catenin and Cx43 involved an ERmediated response. Further studies are required to determine the molecular mechanisms involved in the altered expression of junction-associated molecules induced by NP in Sertoli TM4 cells. Sertoli cells synthetize and release specific proteins to regulate or respond to pituitary hormone release and further influence spermatogenesis (Feng et al., 2010; Krishnamoorthy et al., 2011). MIS was secreted by Sertoli cells specifically and the elevation of MIS level was a marker of the decrease in testicular androgen concentration. Our results suggested that MIS may not be involved in the altered secretory function of Sertoli cells following NP exposure. Testicular Trf is a major secretory product of Sertoli cells and is thought to play a critical role in the delivery of iron from the somatic compartment to the germ cells sequestered by the BTB (Skinner and Griswold, 1980). A mutant mouse that was unable to synthesize normal levels of Trf exhibited a reduced ability to produce functional spermatozoa. The reduced Trf mRNA expression levels in the study suggested that NP exposure impaired the synthesis and secretion of Trf. This exposure may further affect the development of germ cells in testes, and then underlie the reproductive toxicity caused by NP. ABP, a glycoprotein secreted by Sertoli cells into the lumen of the tubule, had important biological effects on differentiation and maturity of sperm (Griswold, 1988). It is also considered to be a biological marker of Sertoli cell function. ABP binds, transports and protects androgen from degradation and also controls their bioavailability in the testis, which facilitates the development and maturation of spermatogenic cells. Alteration in the levels of ABP in the current study suggested that a change in Sertoli cell function may be a result of NP treatment. The overexpression of ABP in Sertoli cells exposed to NP may result in androgen deficiency by possibly sequestering the free testosterone in testis. Inhibin, also a secretory product of Sertoli cells, is a gonadotrophin regulating hormone consisting of either a ßA (inhibin A) or a ßB subunit (inhibin B) (Pfaff et al., 2013). Inhibin B was considered as a biomarker of testicular toxicity. The concentration of inhibin B correlates with testicular histology, sperm concentration and sperm count. Markedly decreased
614
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 608–616
inhibin B levels were associated with severe damage of testes. In addition, inhibin B levels were lower in infertile individuals and in men with hypogonadotrophic hypogonadism. The decreased inhibin B levels in the current study (Fig. 4A) suggested that impaired secretory function of TM4 cells may result from NP exposure. These results also highlighted the toxicity of NP to the male reproductive system. NP is estrogenic, it mimics estrogens, hormones that are responsible for the development and maintenance of secondary sexual characteristics and behavior. Actions of hormones are mediated by hormone receptors. Androgens are critical steroid hormones that determine the expression of the male phenotype, including the outward development of secondary sex characteristics as well as the initiation and maintenance of spermatogenesis. The actions of androgens are mediated by AR. AR in Sertoli cells was reported to be essential for germ cell nursery and junctional complex formation in mouse testes (Wang et al., 2006). The impact of lacking AR in Sertoli cells mainly affects Sertoli cell functions to support and nurture germ cells, leading to spermatogenesis arrest at the diplotene primary spermatocyte stage prior to the accomplishment of first meiotic division. The alteration of AR expression in NP stimulated TM4 cells (Fig. 1) implied that NP may exert reproductive toxicity to TM4 cells. The similar results were found in the PR expression. Estrogen influences the growth, differentiation and function of many target tissues, such as mammary gland, uterus, vagina, ovary, testes, epididymis and prostate. Estrogens diffuse in and out of cells but are retained with high affinity and specificity in target cells by ER. Both ER-␣ and ER- were found to be expressed in Sertoli TM4 cells in the current study. Previous studies showed that NP induced ER mRNA expression (Ren et al., 1997) and acted as agonists for ER-␣ (Vivacqua et al., 2003) in human breast cancer cells-MCF-7. However, in the present study, NP showed no effect on ER-␣ expression in TM4 cells. On the contrary, NP significantly inhibited the expression of ER- in TM4 cells. These data suggested that NP may have high affinity to ER- in TM4 cells. FSH is important for the maturation of Sertoli cells, production of specific proteins in Sertoli cells and normal spermatogenesis (Dierich et al., 1998). FSHR is expressed only in Sertoli cells in the testis, and this receptor regulates many functions of Sertoli cells through interaction with FSH. Dual effects of NP on FSHR expression according to the concentration of NP were observed in our study, i.e. the expression levels of FSHR were significantly increased in low dose of NP treated groups, but markedly reduced in the cells exposed to high dose of NP group. We hypothesized that the effect of NP on the up-regulated expression of FSHR might be through the direct estrogenic actions or due to the self-protection of cells, however, high dose of NP-mediated suppression of FSHR expression was due to a NP cytotoxic effect. In the present assay, the change of FSHR may be related to the changing of the secretory function of Sertoli cells. Tolllike receptors (TLRs) play essential roles in activating signal transduction pathways leading to the killing and clearance of pathogens. Various studies have identified expression of TLRs in testis, recent studies reported that mouse Sertoli cells express TLR-2, TLR-4, TLR-5 and TLR-6 (Riccioli et al., 2006; Wu et al., 2008). We have demonstrated that TLR-4 may not be related to NP toxicity.
NO produced by Sertoli and germ cells may play a role in regulating the homeostasis of tight junction-integral membrane proteins at the site of the BTB (Lee and Cheng, 2003). In mammals, three types of NOS are found, namely neuronal NOS (nNOS), iNOS and endothelial NOS (eNOS). These NOSs differ in molecular size, physicochemical properties and cellular distribution, and are regulated differently. iNOS was found in the testis and implicated in spermatogenesis, infertility, sperm maturation and programmed cell death of Sertoli and germ cells (Herrero and Gagnon, 2001). Studies found that NP could increase NO production in the mouse brain (Zhang et al., 2008) but had no effect on the production of NO and the levels of iNOS gene expression in mouse macrophages (You et al., 2002). However, NP reduced NO production and iNOS mRNA expression in the present study. Sertoli cells have been shown to produce several cytokines, which probably participate in spermatogenesis. These cytokines play an important role in junction restructuring events during spermatogenesis in the seminiferous epithelium of testes. These include the regulation of cell–cell adhesion and tight junction permeability barriers in multiple epithelia and endothelia, such as those found in the small intestine, kidney, skin and testis (Cheng et al., 2008). Earlier studies have shown that the levels of TGF3 and TNF-␣ in Sertoli cells could perturb the Sertoli cell tight junction barrier formation (Li et al., 2006; Lui et al., 2003). Most recent studies were focused on TGF-3 and TNF-␣. However, this is not to rule out the participation of other cytokines, such as IL-1, TGF-1 and so on. IL-1␣ was identified as a regulator of the BTB (Lie et al., 2011). Our study proposed that IL-1␣, TGF-1 and TNF-␣ were related to cell junctions in TM4 cells, as evidenced by the changes of the cytokine levels in TM4 cells. On the other hand, NO and these cytokines are involved in many physiological and pathological processes, especially in immunology. Changes of NO and these cytokines in cells with NP exposure implied that NP may influence the immune system in Sertoli cells. Previous studies have demonstrated that hormone receptors were associated with the secretory function and BTB formation in Sertoli cells. Loss of AR specifically in Sertoli cells could affect junction complex formation of Sertoli cells, Sertoli cell-specific transport protein and paracrine factor production and/or secretion, leading to impaired Sertoli cells nursery functions for developing germ cells and functional integrity of the BTB (Wang et al., 2006). Additionally, the expression levels of ER and FSHR were related to the changing expression levels of ABP, transferrin and the alteration of the secretory function of Sertoli cells (Hejmej et al., 2013; Krishnamoorthy et al., 2011). In our study, the expression levels of ER-, PR, and AR were significantly decreased in NP exposure groups, as well as FSHR level at high NP concentration. Therefore, we proposed that the down-regulation of cell receptors was involved in the decrease of BTB-associated elements. Moreover, decreased cell receptors may be related to the changing levels of inhibinB, ABP, transferrin and the alteration of the secretory function in TM4 cells, and thereby disturbing the spermatogenic process. It has been reported that NP is seriously threatening reproductive health of human and animals, especially to male reproduction. The molecular mechanism of reproductive damage in male induced by EDCs is complex, and mainly
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 608–616
include the following mechanisms (Diamanti-Kandarakis et al., 2009; Welshons et al., 2003): regulating the hormone levels by altering hormone bioavailability, changing the hormone metabolism and the body’s own metabolism, mediated by cell receptors and affecting cell signal transduction pathways. The effects of NP on male reproductive dysfunction are not fully understood. The results from the study suggested that NP may exert reproductive toxicity in Sertoli cells by changing expression of junction related molecules, secretory function and cell receptors.
5.
Conclusion
In this study, we found NP exposure could influence the expression of ER-, PR, AR and FSHR in TM4 cells. Additionally, NP exposure led to the changes in the levels of BTB-associated elements including vinculin, N-cadherin and occludin. Meanwhile, NP had effects on secretory function as evidenced by the changes in the levels of ABP, inhibin B, Trf, NO and some cytokines in TM4 cells. These effects may be associated with the male-specific reproductive toxicity of NP. Further studies are required to elucidate the specific molecular mechanism of these effects from NP in TM4 cells.
Conflict of Interest The authors declare that there are no conflicts of interest.
Acknowledgements The financial support for this study by the National Basic Research Program of China (973 program) (No.: 2012CB720805), International Science & Technology Cooperation Program of China (No.: 2010DFA31780), the Joint Sino-German Research Project of National Natural Science Foundation of China (No.: GZ 731), and the Program for New Century Excellent Talents in University (NCET-12-0749), is gratefully acknowledged.
Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/ j.etap.2014.01.017.
references
Bardin, W., Musto, N., Gunsalus, G., Kotite, N., Cheng, S., Larrea, F., Becker, R., 1981. Extracellular androgen binding proteins. Annu. Rev. Physiol. 43, 189–198. Carlsen, E., Giwercman, A., Keiding, N., Skakkebæk, N.E., 1992. Evidence for decreasing quality of semen during past 50 years. BMJ. 305, 609. Cheng, C., Li, M.W., Mruk, D.D., 2008. Unlocking the blood-testis barrier and the ectoplasmic specialization by cytokines during spermatogenesis: emerging targets for male contraception. Immunol. Endocr. Metab. Agents-Med. Chem. 8, 20–27. Cox, C., 1996. Nonyl phenol and related chemicals. J. Pestic. Reform. 16, 15–20.
615
Diamanti-Kandarakis, E., Bourguignon, J.P., Giudice, L.C., Hauser, R., Prins, G.S., Soto, A.M., Zoeller, R.T., Gore, A.C., 2009. Endocrine-disrupting chemicals: an endocrine society scientific statement. Endocr. Rev. 30, 293–342. Dierich, A., Sairam, M.R., Monaco, L., Fimia, G.M., Gansmuller, A., LeMeur, M., Sassone-Corsi, P., 1998. Impairing follicle-stimulating hormone (FSH) signaling in vivo: targeted disruption of the FSH receptor leads to aberrant gametogenesis and hormonal imbalance. P. Natl. Acad. Sci. 95, 13612–13617. Feng, Y., Fang, X., Shi, Z., Xu, M., Dai, J., 2010. Effects of PFNA exposure on expression of junction-associated molecules and secretory function in rat Sertoli cells. Reprod. Toxicol. 30, 429–437. Gong, Y., Han, X.-D., 2006. Effect of nonylphenol on steroidogenesis of rat Leydig cells. J. Environ. Sci. Heal. B. 41, 705–715. Griswold, M.D., 1988. Protein secretions of Sertoli cells. Int. Rev. Cytol. 110, 133–156. Griswold, M.D., 1998. The central role of Sertoli cells in spermatogenesis. Cell. Dev. Biol. 9, 411–416. Guenther, K., Heinke, V., Thiele, B., Kleist, E., Prast, H., Raecker, T., 2002. Endocrine disrupting nonylphenols are ubiquitous in food. Environ. Sci. Technol. 36, 1676–1680. Han, X.D., Tu, Z.G., Gong, Y., Shen, S.N., Wang, X.Y., Kang, L.N., Hou, Y.Y., Chen, J.X., 2004. The toxic effects of nonylphenol on the reproductive system of male rats. Reprod. Toxicol. 19, 215–221. Hejmej, A., Kotula-Balak, M., Chojnacka, K., Kuras, P., Lydka-Zarzycka, M., Bilinska, B., 2013. Photoperiod-dependent effects of 4-tert-octylphenol on adherens and gap junction proteins in bank vole seminiferous tubules. Int. J. Endocrinol. 2013, 11pages, Article ID 134589. Herrero, M.B., Gagnon, C., 2001. Nitric oxide: a novel mediator of sperm function. J. Androl. 22, 349–356. Hu, Y., Li, D.M., Han, X.D., 2012. Analysis of combined effects of nonylphenol and Monobutyl phthalate on rat Sertoli cells applying two mathematical models. Food. Chem. Toxicol. 50, 457–463. Krishnamoorthy, G., Selvakumar, K., Elumalai, P., Venkataraman, P., Arunakaran, J., 2011. Protective role of lycopene on polychlorinated biphenyls (Aroclor 1254)-induced adult rat Sertoli cell dysfunction by increased oxidative stress and endocrine disruption. Biomed. Prev. Nutr. 1, 116–125. Lee, N.P., Cheng, C.Y., 2003. Regulation of Sertoli cell tight junction dynamics in the rat testis via the nitric oxide synthase/soluble guanylate cyclase/3’, 5’-cyclic guanosine monophosphate/protein kinase G signaling pathway: an in vitro study. Endocrinology. 144, 3114–3129. Li, M.W., Xia, W., Mruk, D.D., Wang, C.Q., Yan, H.H., Siu, M.K., Lui, W.-y., Lee, W.M., Cheng, C.Y., 2006. Tumor necrosis factor ␣ reversibly disrupts the blood–testis barrier and impairs Sertoli–germ cell adhesion in the seminiferous epithelium of adult rat testes. J. Endocrinol. 190, 313–329. Lie, P.P., Cheng, C.Y., Mruk, D.D., 2011. Interleukin-1␣ is a regulator of the blood-testis barrier. FASEB J. 25, 1244–1253. Lipshultz, L.I., Howards, S.S., Niederberger, C.S., 1997. Infertility in the Male, 3rd ed. St. Louis, Mosby–Year Book, pp. 336–359. Lui, W.Y., Lee, W.M., Cheng, C.Y., 2003. TGF-s: their role in testicular function and Sertoli cell tight junction dynamics. Int. J. Androl. 26, 147–160. Mruk, D.D., Cheng, C.Y., 2004. Sertoli-Sertoli and Sertoli-germ cell interactions and their significance in germ cell movement in the seminiferous epithelium during spermatogenesis. Endoc. Rev. 25, 747–806. Pfaff, T., Rhodes, J., Bergmann, M., Weinbauer, G.F., 2013. Inhibin B as a marker of Sertoli cell damage and spermatogenic disturbance in the rat. Birth. Defects Res. B. 98, 91–103.
616
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 608–616
Pflieger-Bruss, S., Schuppe, H., Schill, C.W.B., 2004. The male reproductive system and its susceptibility to endocrine disrupting chemicals. Andrologia. 36, 337–345. Ren, L., Marquardt, M.A., Lech, J.J., 1997. Estrogenic effects of nonylphenol on pS2. ER and MUC1 gene expression in human breast cancer cells-MCF-7. Chem-Biol. Interact. 104, 55–64. Riccioli, A., Starace, D., Galli, R., Fuso, A., Scarpa, S., Palombi, F., De Cesaris, P., Ziparo, E., Filippini, A., 2006. Sertoli cells initiate testicular innate immune responses through TLR activation. J. Immunol. 177, 7122–7130. Sarkar, O., Mathur, P.P., Cheng, C.Y., Mruk, D.D., 2008. IL-1␣ is a novel regulator of the blood-testis barrier in the rat. Biol. Reprod. 78, 445–454. Sharpe, R.M., 2001. Hormones and testis development and the possible adverse effects of environmental chemicals. Toxicol. Lett. 120, 221–232. Skinner, M.K., Griswold, M.D., 1980. Sertoli cells synthesize and secrete transferrin-like protein. J. Biol. Chem. 255, 9523–9525. Soares, A., Guieysse, B., Jefferson, B., Cartmell, E., Lester, J., 2008. Nonylphenol in the environment: a critical review on occurrence, fate, toxicity and treatment in wastewaters. Environ. Int. 34, 1033. Vivacqua, A., Recchia, A.G., Fasanella, G., Gabriele, S., Carpino, A., Rago, V., Di Gioia, M.L., Leggio, A., Bonofiglio, D., Liguori, A., 2003. The food contaminants bisphenol A and 4-nonylphenol act as agonists for estrogen receptor ␣ in MCF7 breast cancer cells. Endocrine. 22, 275–284. Wang, R.S., Yeh, S.Y., Chen, L.M., Lin, H.Y., Zhang, C.X., Ni, J., Wu, C.C., di Sant’Agnese, P.A., Tzeng, C., Chang, C., 2006. Androgen receptor in Sertoli cell is essential for germ cell nursery and
junctional complex formation in mouse testes. Endocrinology. 147, 5624–5633. Wang, Z.Q., Watanabe, Y., Toki, A., Itano, T., 2002. Altered distribution of Sertoli cell vimentin and increased apoptosis in cryptorchid rats. J. Pediatr. Surg. 37, 648–652. Welshons, W.V., Thayer, K.A., Judy, B.M., Taylor, J.A., Curran, E.M., Vom Saal, F.S., 2003. Large effects from small exposures. I. Mechanisms for endocrine-disrupting chemicals with estrogenic activity. Environ. Health Persp. 111, 994. Wu, H., Wang, H., Xiong, W., Chen, S., Tang, H., Han, D., 2008. Expression patterns and functions of toll-like receptors in mouse sertoli cells. Endocrinology. 149, 4402–4412. Wu, J.-J., Wang, K.-L., Wang, S.-W., Hwang, G.-S., Mao, I., Chen, M.-L., Wang, P.S., 2010. Differential effects of nonylphenol on testosterone secretion in rat Leydig cells. Toxicology. 268, 1–7. Xiong, X., Wang, A., Liu, G., Liu, H., Wang, C., Xia, T., Chen, X., Yang, K., 2006. Effects of p, p’-dichlorodiphenyldichloroethylene on the expressions of transferrin and androgen-binding protein in rat Sertoli cells. Environ. Res. 101, 334–339. You, H.J., Choi, C.Y., Jeon, Y.J., Chung, Y.C., Kang, S.K., Hahm, K.-S., Jeong, H.G., 2002. Suppression of inducible nitric oxide synthase and tumor necrosis factor-␣ expression by 4-nonylphenol in macrophages. Biochem. and Bioph. Res. Co. 294, 753–759. Zhang, Y.Q., Mao, Z., Zheng, Y.L., Han, B.P., Chen, L.T., Li, J., Li, F., 2008. Elevation of inducible nitric oxide synthase and cyclooxygenase-2 expression in the mouse brain after chronic nonylphenol exposure. Int. J. Mol. Sci. 9, 1977–1988.