Effects of organic acids and essential oils blend on growth, gut microbiota, immune response and disease resistance of Pacific white shrimp (Litopenaeus vannamei) against Vibrio parahaemolyticus

Fish & Shellfish Immunology 70 (2017) 164e173

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Full length article

Effects of organic acids and essential oils blend on growth, gut microbiota, immune response and disease resistance of Pacific white shrimp (Litopenaeus vannamei) against Vibrio parahaemolyticus Wangquan He 1, Samad Rahimnejad 1, Ling Wang, Kai Song, Kangle Lu, Chunxiao Zhang* Xiamen Key Laboratory for Feed Quality Testing and Safety Evaluation, Fisheries College, Jimei University, Xiamen 361021, China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 5 July 2017 Received in revised form 23 August 2017 Accepted 1 September 2017 Available online 4 September 2017

An 8-week feeding trial was undertaken to evaluate supplemental effects of AviPlus® (AP), a blend of organic acids [citric acid, 25%; sorbic acid, 16.7%] and essential oils [thymol, 1.7%; vanillin, 1.0%], on growth, gut microbiota, innate immunity and disease resistance of Pacific white shrimp (Litopenaeus vannamei) against Vibrio parahaemolyticus. A basal experimental diet was formulated and supplemented with 0, 0.3, 0.6, 0.9 and 1.2 g kg
1 AP to produce five test diets (Con, AP0.3, AP0.6, AP0.9 and AP1.2). Each diet was fed to triplicate groups of shrimp (0.2 ± 0.01 g, mean ± SE) to apparent satiation three times daily. Growth performance and survival rate were not significantly influenced by AP supplementation (P > 0.05). Significantly (P < 0.05) higher serum total protein was found in groups fed  0.6 g kg
1 AP compared to control. Serum alkaline phosphatase and phenoloxidase activities were significantly increased in AP0.9 and AP1.2 groups. Also, the group received AP0.6 diet showed significantly higher glutathione peroxidase activity than control. Expression of gut pro-inflammatory genes including TNF-a, LITAF and RAB6A were down-regulated by AP administration. Gut microbiota analysis showed the significant enhancement of the operational taxonomic unit (OTU) diversity and richness indices by AP application. AP supplementation led to increased abundance of Firmicutes and a reduction in abundance of Proteobacteria. Also, dietary inclusion of 1.2 g kg
1 AP led to a significant increase in the abundance of Lactobacillus in shrimp gut. The group offered AP0.3 diet showed significantly higher disease resistance than control group. Furthermore, AP application significantly enhanced relative expression of immune related genes including lysozyme, penaeidin and catalase at 48 h post challenge. In conclusion, these findings show that the tested organic acids and essential oils mixture beneficially affects intestinal microflora and improves immune response and disease resistance of L. vannamei. © 2017 Elsevier Ltd. All rights reserved.

Keywords: Litopenaeus vannamei Organic acids Essential oils Gut microbiota Immune response Disease resistance

1. Introduction Pacific white shrimp (Litopenaeus vannamei) is widely cultured all around the world and its annual aquaculture production accounts for roughly two-third of the global shrimp production [1]. Diseases caused by various bacterial, fungal, parasitic and viral species are a significant constraint to productivity of aquaculture industry imposing substantial losses, and shrimp culture is not certainly an exception [2]. It is necessary to develop environmentfriendly strategies for controlling shrimp disease which is one of

* Corresponding author. Fisheries College, Jimei University, No. 43 Yindou Road, Xiamen 361021, China. E-mail address: [email protected] (C. Zhang). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.fsi.2017.09.007 1050-4648/© 2017 Elsevier Ltd. All rights reserved.

the major problems facing the large-scale shrimp farming. Antibiotics have long been used for promoting growth and controlling disease in animals feed. However, nowadays their application is restricted due to their numerous adverse effects on the environment and the human food chain such as occurrence of antibioticresistant bacteria, accumulation of antibiotic residues in aquaculture products and suppression of aquatic animal immune systems [3e6]. Taking these into account, it is imperative to identify potential alternatives for antibiotics. Probiotics [7,8], prebiotics [9], immunostimulants [10,11], and acidifiers [5,12,13] have been identified as promising alternatives to antibiotics. These candidate compounds enhance the immune function mainly through altering the gut microbiota by selectively stimulating beneficial bacterial strains and reducing the number of potential pathogens [14,15]. Acidifiers are defined as inorganic or organic acids and their

W. He et al. / Fish & Shellfish Immunology 70 (2017) 164e173

salts. Among the dietary supplements tested in aquafeeds so far, organic acids are increasingly gaining interest because of their strong antimicrobial and prophylactic properties against various pathogenic bacteria [16e18]. Organic acids are generally composed of short-chain fatty acids (C1-C7), volatile fatty acids and weak carboxylic acids with one or more carboxyl groups in their structure. Currently, there is an increasing tendency of using organic acids in commercial aquafeeds both for controlling disease and enhancing growth performance. Improved growth, feed utilization and disease resistance have been reported in several fish species offered diets supplemented with organic acids, their salts or mixtures [13,19,20]. Organic acids inhibit microbial growth and the uptake of pathogens and their metabolites [5,21,22]. They also reduce the gastrointestinal pH thereby inhibiting the growth of pathogenic gram-negative bacteria [12]. The main antimicrobial activity of organic acids is attributed to altering the cell cytoplasm pH of bacteria thereby inhibiting sensitive bacteria to such changes [23]. Essential oils are concentrated hydrophobic liquid containing volatile aroma compounds isolated from secondary metabolites of plants [24]. Aromatic plants and the essential oils extracted from them have been suggested as potent prophylactic agents because of their anti-microbial activity and stimulating effects on animal digestive system. Currently, essential oils from aromatic plants are extensively used in medicine and food industry [25]. They are obtained from many plant materials such as flowers, buds, seeds, leaves and fruits [26]. Dietary supplementation of essential oils in animals' feed has been reported to increase antioxidant activity [27], enhance immune responses [28], and alter gut microbiota [29]. AviPlus® (AP) is a blend of organic acids (citric acid and sorbic acid) and essential oils (thymol and vanillin) that has shown promising as a dietary supplement in poultry and pigs feed [30,31]. To date, numerous studies have been conducted on individual application of organic acids and essential oils as dietary additives for aquatic animals, however, to the best of our knowledge there is no available report on the use of organic acids and essential oils mixture in shrimp feed. The aim of the present study was to examine the effects of dietary supplementation of AP on growth performance, gut microbiota, innate immunity and resistance of Pacific white shrimp to Vibrio parahaemolyticus challenge. 2. Materials and methods 2.1. Experimental diets A basal experimental diet was formulated using fish meal and soybean meal as protein sources; and fish oil and soybean oil as lipid sources (Table 1). The blend of organic acids and essential oils tested in this study consisted of citric acid (25%), sorbic acid (16.7%), thymol (1.7%), vanillin (1.0%), and hydrogenated palm oil (55.6%) as a carrier (Aviplus-S®, VetAgro SPA, 42100 Reggio Emilia, Italy). Totally five experimental diets were prepared by supplementing the basal diet with 0, 0.3, 0.6, 0.9 and 1.2 g kg
1 AP designated as Con, AP0.3, AP0.6, AP0.9 and AP1.2, respectively. AP was supplemented in the diets at the expense of wheat flour. Squid visceral paste was used as palatability enhancer in all the diets. All dry ingredients were finely ground using a hammer mill and then passed through a 180 mm mesh. Different levels of AP were added to the dietary ingredients mixture together with fish oil, soybean oil and soybean lecithin. Then an appropriate amount of water was added and pellets were produced by passing the mash through a 1- and 2- mm die, using multifunctional spiral extrusion machinery (CD4XITS, South China University of Technology, Guangzhou, China). The pellets were dried at 35  C in a dry oven overnight and stored at
20  C in airtight

165

Table 1 Formulation and proximate composition of the experimental diets (g kg
1dry matter). Ingredients

Diets Con

AP0.3

AP0.6

AP0.9

AP1.2

Fish meal Soybean mealb Shrimp meal Squid visceral paste Wheat flour Fish oil Soybean oil Lecithin Choline chloride Monocalcium phosphate Vitamin premixc Mineral premixd L-Ascorbate-2-phosphate Ethoxyquin AviPlus®

240 250 50 15 369 20 10 10 5 20 3 5 1 0.5 0

240 250 50 15 368.7 20 10 10 5 20 3 5 1 0.5 0.3

240 250 50 15 368.4 20 10 10 5 20 3 5 1 0.5 0.6

240 250 50 15 368.1 20 10 10 5 20 3 5 1 0.5 0.9

240 250 50 15 367.8 20 10 10 5 20 3 5 1 0.5 1.2

Proximate composition Dry matter Crude protein Crude lipid Ash

903 390 74.2 82

909 393 73.6 81

901 392 75.0 84

896 390 76.8 83

910 395 74.6 86

a

a Xiamen ITG group Corp., Ltd., Xiamen, China, imported from Peru (crude protein:65.3%, crude lipid:8.65%). b Soybean meal, obtained from Quanzhou Fuhai cereals and oils industry Co., Ltd. (crude protein: 46.3%, crude lipid:1.0%). c Vitamin premix (mg or g kg
1 diet): thiamin, 10 mg; riboflavin, 8 mg; pyridoxine HCl, 10 mg; vitamin B12, 0.2 mg, vitamin K3, 10 mg; inositol, 100 mg; pantothenic acid, 20 mg; niacin acid, 50 mg; folic acid, 2 mg; biotin, 2 mg; retinol acetate, 400 mg; cholecalciferol, 5 mg; alpha-tocopherol, 100 mg; ethoxyquin, 150 mg; wheat middling, 1.1328 g. d Mineral premix (mg or g kg
1 diet): Na F, 2 mg; KI,0.8 mg; Co Cl2$6H2O (1%), 50 mg; Cu SO4$5H2O, 10 mg; FeSO4$H2O, 80 mg; ZnSO4$H2O, 50 mg; Mn SO4$H2O, 25 mg; MgSO4$7H2O, 200 mg; Zoelite, 4.582 g.

polyethylene bags until use. Proximate composition of the experimental diets was analyzed according to standard methods [32]. 2.2. Experimental shrimp and feeding trial The feeding trial was conducted at the experimental station of Jimei University (Xiamen, China). Pacific white shrimp (specific pathogen free; SPF) post-larvae (PL-12) were purchased from a private hatchery in Zhangzhou (Fujian, China). The shrimp were stocked into three 1000-L round-shaped fiberglass tanks and fed a commercial diet (Dabeinong Technology Group Co., Ltd) for two weeks to adapt them to the experimental conditions. At the end of the acclimation period, 35 healthy shrimp (0.2 ± 0.01 g; mean ± SE) were stocked into each of 15 indoor circular fiberglass tanks (300 L) in a recirculating system. The recirculating system consisted of a reservoir with a biological filter, a circulation pump and an automatic temperature control device supplied with aerated water. The experiment was performed in triplicates and shrimp were hand fed with the experimental diets to apparent satiation three times daily (07:00, 13:00 and 19:00) for eight weeks. Uneaten diets and feces matter were siphoned out and 10% of water was exchanged after each feeding. During the experimental period, water temperature, salinity and pH were measured daily and the values were 28 ± 1  C (mean ± SE), 26 g L
1 and 8.0 respectively. Dissolved oxygen was not less than 6 mg L
1 and the photoperiod was natural. Feeding was stopped 24 h prior to handling and sampling to minimize the stress on shrimp. 2.3. Sample collection and analyses At the end of the feeding trial, all the shrimp in each tank were

166

W. He et al. / Fish & Shellfish Immunology 70 (2017) 164e173

counted and bulk weighted for determination of growth parameters and survival. Twenty shrimp from each tank (60 shrimp per dietary treatment) were randomly captured and hemolymph was individually withdrawn from the ventral sinus of each shrimp using sterilized 1-ml syringes and kept at 4  C overnight. Then serum was separated following centrifugation at 4000g at 4  C for 10 min and kept at
80  C for analysis of total protein (TP), and activities of alkaline phosphatase (ALP), phenoloxidase (PO) and glutathione peroxidase (GPX). Following hemolymph collection, the complete intestine was dissected from the same 20 shrimp per tank under sterile conditions, frozen immediately in liquid nitrogen, and subsequently stored at
80  C for analysis of gut microbiota and expression of pro-inflammatory genes including TNF-a, LITAF and RAB6A. All the analyses were performed in three replicates. Serum PO activity was measured by the method of Ashida and Soderhall [33] with some slight modifications. Briefly, 50 mL serum, 50 mL trypsin and 50 mL L-dopa as the substrate were mixed at room temperature. The luminosity value was recorded at every minute using a wave length of 490 nm. A unit (U) of activity was equal to 0.001 increment of the luminosity density per minute under the experimental conditions. Serum TP content and activities of GPX and ALP were analyzed spectrophotometrically using commercial diagnostic kits (Nanjing Jiancheng Bioengineering Institute, China) according to the manufacturer's instructions. For gut microbiota analysis, total genomic DNA was extracted from the intestinal contents of control, AP0.6 and AP1.2 groups with the TIANamp Stool DNA Kit (Tiangen Biotech (Beijing) Co., Ltd), following the manufacturer's recommendations and sent for 16S rRNA gene sequence analysis with high-throughput sequencing. Total RNA was isolated from the gut tissue using Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. RNA purity and concentration were measured using a ND2000 spectrophotometer (NanoDrop 2000; NanoDrop Technologies, Wilmington, DE, USA), all OD260/OD280 were between 1.8 and 2.0. RNA integrity was confirmed by gel electrophoresis (1.5% agarose gel). A 2-mg RNA sample was synthesized to cDNA using the Thermo Scientific RevertAid First-Strand Synthesis System for PCR (Invitrogen) with Oligo-(dT)18 primers according to the manufacturer's protocol. The reaction was performed at 42  C for 60 min, terminated by heating at 70  C for 5 min. The cDNA mix was diluted to 1:100 for RT-qPCR. The RT-qPCR was carried out in a Thermal Cycle System (ABIA StepOne PlusTM). Reaction times and cycling conditions were 95  C for 10 min, 40 cycles of 95  C for 15 s and 60  C for 30 s. The run was further terminated by a melting curve analysis. The primer sequences for the reference gene (b-actin) and the TNF-a, LITAF and RAB6A genes were designed based on published L. vannamei cDNA sequences on Gen Bank and are listed in Table 2. The relative mRNA expression levels were analyzed by the 2
DDCT method [34]. 2.4. Bacterial challenge and expression of immune-related genes At the end of the experiment, 10 shrimp from each tank were Table 2 Sequences of primers used for RT-qPCR in this study. Primer

Forward primer sequences (50 to 30 )

Reverse primer sequences (50 to 30 )

b-actin TNF-a

GAGCAACACGGAGTTCGTTGT CAGAGCCGTCAAGAAGATCC GCAGTCAACGCACATGATCT CTCCAGCTCTGGGATACTGC GAGGGTCAAGCCTACTGCTG CACCCTTCGTGAGACCTTG TGTTCCGATCTGATGTCC GGCTATGGTTCTCGTACTTCCAAGC

CATCACCAACTGGGACGACATGGA TGAGGGAGTACTTCCGGTTG TTGTATTTGCCAGGAAAGC TGCTTTTCGTTCACCTTCCT ACTTATCGAGGCCAGCACAC AATATCCCTTTCCCACGTGAC GCTGTTGTAAGCCACCC GCATTGTATAGGTCCCTTGTTGCA

LITAF RAB6A Cru Pen Lyz Cat

captured randomly for bacterial challenge test according to previously described methods [35]. V. parahaemolyticus was provided by Fisheries College of Jimei University. Shrimp were challenged by injecting 20 mL of the bacterium suspension containing 1.69  109 CFU mL
1 into the ventral sinus of the cephalothorax and mortality was recorded up to 48 h post-injection. The pathogenic dosage of the bacterium was determined through a preliminary test using similar size of shrimp. In addition, 30 shrimp were injected with Normal saline (NS) to serve as unchallenged control. Also, at 48 h post-injection, expression of immune-related genes including lysozyme, penaeidin, catalase and crustin were examined by RTqPCR. The entire hepatopancreas of all live shrimp of each replicate was excised, immediately frozen in liquid nitrogen, and then stored at
80  C until RT-qPCR analysis. The manufacturer's recommendations were similar to the gut RT-qPCR analysis. The primer sequences of lysozyme, penaeidin, catalase and crustin genes are listed in Table 2. 2.5. Statistical analysis All the data were analyzed by one-way analysis of variance (ANOVA) using SPSS version 19.0 software (SPSS Inc., Chicago, IL, USA). When ANOVA detected a difference among groups, Duncan's multiple range test was used to identify the difference in the means. Mapping software used GraphPad Prism version 5.00 (GraphPad software, San Diego, CA, USA). Data are presented as mean ± standard error of the mean (SE). Statistical significance was determined at P < 0.05. 3. Results 3.1. Growth performance Growth performance and feed utilization of white shrimp fed the experimental diets are shown in Table 3. AP supplementation did not significantly influence shrimp growth performance (P > 0.05). The lowest feed conversion ratio was found in group fed AP0.3 diet, however, the differences were not significant. Survival rate ranged from 94 to 99% and no significant differences could be detected among dietary treatments (Table 3). 3.2. Serum biochemical and immune parameters The groups fed 0.6 g kg
1 AP showed significantly higher serum total protein concentration than Con and AP0.3 groups (Table 4). Significantly higher ALP and PO activities were found in groups offered AP0.9 and AP1.2 diets compared to those received the control diet. Also, GPX activity was significantly increased in AP0.6 group in comparison to the control group. 3.3. Gut pro-inflammatory genes expression Expression of gut pro-inflammatory genes was significantly down-regulated by AP supplementation (Fig. 1). Expression of TNFa was significantly reduced in AP0.9 and AP1.2 groups (Fig. 1a) and expression of RAB6A was significantly down-regulated in AP0.9 group compared to control (Fig. 1c). Also, AP treated groups exhibited significantly reduced expression of LITAF gene (Fig. 1b). 3.4. Gut microbiota To examine the effects of AP on shrimp intestinal microflora, samples from control and the groups received medium (0.6 g kg
1) and high (1.2 g kg
1) levels of AP were analyzed. The total number of observed operational taxonomic units (OTUs) was 659, of which

W. He et al. / Fish & Shellfish Immunology 70 (2017) 164e173

167

Table 3 Growth performance and feed utilization of Pacific white shrimp (0.2 ± 0.01 g) fed the experimental diets for 8 weeks. Diets

FBWa(g) WGb (%) FCRc Survival (%)

P value

Con

AP0.3

AP0.6

AP0.9

AP1.2

4.43 ± 0.15 2114 ± 76 0.82 ± 0.01 94.29 ± 1.65

4.22 ± 0.12 2012 ± 59 0.80 ± 0.04 97.14 ± 1.65

4.11 ± 0.05 1956 ± 26 0.85 ± 0.00 99.05 ± 0.95

4.18 ± 0.16 1992 ± 78 0.84 ± 0.02 95.24 ± 3.43

4.18 ± 0.05 1988 ± 26 0.89 ± 0.02 96.19 ± 0.95

0.417 0.425 0.395 0.210

Values are means of triplicate groups and presented as mean ± SE. The lack of superscript letter indicates no significant differences among treatments. a Final body weight. b Weight gain ¼ [(final body weight
initial body weight)/initial body weight  100]. c Feed conversion ratio ¼ dry feed fed/wet weight gain.

Table 4 Serum biochemical, immune and antioxidant parameters of Pacific white shrimp fed the experimental diets for 8 weeks. Diets

TPa (g prot L
1) ALPb (U mL
1) POc (U mL
1) GPXd (U mL
1)

P value

Con

AP0.3

AP0.6

AP0.9

AP1.2

45.43 ± 0.61a 2.32 ± 0.04a 90.91 ± 6.04a 2192 ± 33.8a

47.64 ± 0.94a 2.40 ± 0.06ab 101.2 ± 3.37a 2296 ± 104ab

51.87 ± 1.55b 2.36 ± 0.03ab 102.3 ± 2.33a 2463 ± 8.17b

51.69 ± 0.66b 2.70 ± 0.11c 127.7 ± 2.77b 2393 ± 104ab

51.19 ± 0.98b 2.57 ± 0.05bc 118.2 ± 1.36b 2394 ± 53.74ab

0.003 0.008 0.000 0.158

Values are means of triplicate groups and presented as mean ± SE. Values in the same row having different superscript letters are significantly different (P < 0.05). a Total protein. b Alkaline phosphatase. c Phenoloxidase. d Glutathione peroxidase.

Fig. 1. Relative expression of gut pro-inflammatory genes [TNF-a (a), LITAF (b) and RAB6A (c)] in Pacific white shrimp fed the experimental diets for 8 weeks. Values are means of triplicate groups. Bars with different letters are significantly different (P < 0.05).

228 OTUs (34.6%) shared among the three treatments (Fig. 2). The numbers of unique OTUs for Con, AP0.6 and AP1.2 groups were 53, 54 and 130, respectively (Fig. 2). The Alpha diversity analysis showed that the community richness (Chao, Ace) and diversity (Shannon) in AP supplemented groups were higher than those of the control group (Table 5). The most abundant bacterial phyla

were related to Proteobactaria, Bacteroidetes, Verrucomicribia and Firmicutes, respectively (Fig. 3). The highest number of Firmicutes was observed in AP1.2 group followed by AP0.6 and control groups, respectively (Fig. 3). AP supplementation resulted in increased abundance of Lactobacillus in a dose dependant manner and a significant difference was found between Con and AP1.2 groups

168

W. He et al. / Fish & Shellfish Immunology 70 (2017) 164e173

4. Discussion

Fig. 2. Venn diagram showing the unique and shared OTUs in Control (A), AP0.6 (B) and AP1.2 (C) groups. Table 5 Data from lllumina high-throughput sequencing yields bacterial diversity and richness based on operational taxonomic units (OTU), estimated OUT richness (Chao & Ace) and diversity index (Shannon & Simpson) for the intestinal bacterial diversity of Pacific white shrimp fed the control, AP0.6 and AP1.2 diets for 8 weeks. Sampling depth

Diets Con

Mean sequence 32794 Richness estimate Chao 213.3 ± 12.2a ACE 213 ± 9.61a Diversity estimators Shannon 2.92 ± 0.29 Simpson 0.12 ± 0.04

P value AP0.6

AP1.2

32794

32794 b

328 ± 39.7 327 ± 35.0b

344.7 ± 11.8b 338.7 ± 7.8b

0.019 0.011

3.41 ± 0.04 0.06 ± 0.01

3.41 ± 0.13 0.08 ± 0.01

0.185 0.279

Values are means of triplicate groups and presented as mean ± SE. Values in the same row having different superscript letters are significantly different (P < 0.05). The lack of superscript letter indicates no significant differences among treatments.

(Fig. 4). A drastic decrease in abundance of pathogenic bacteria such as Acinetobacter was detected in AP treated groups. Also, a reduced abundance of Vibrio was observed in AP1.2 group compared to control, although the changes were not significant. 3.5. Bacterial challenge 3.5.1. Resistance to V. parahaemolyticus The results of challenge test showed significant enhancement of shrimp resistance against V. parahaemolyticus challenge in shrimp received AP0.3 diet compared to control group (Fig. 5). However, further increment of AP level resulted in a reduced survival rate in a dose dependent manner. 3.5.2. Expression of immune-related genes Expression of lysozyme and penaeidin genes was significantly up-regulated in AP0.3 and AP0.9 groups, respectively (P < 0.05) (Fig. 6a,b). Also, the groups received 0.3e0.9 g kg
1 AP exhibited significantly higher expression of catalase gene than control (Fig. 6c). However, expression of crustin gene was not significantly affected by dietary treatments (Fig. 6d).

Organic acids have been widely used as dietary supplements for promoting growth performance in pigs and poultry feed [36e39]. Beneficial effects of organic acids supplementation on growth performance have also been reported in several aquatic animals including red hybrid tilapia (Oreochromis sp.) [5,40], yellowtail (Seriola quinqueradiata) [41], Beluga (Huso huso) [42], rohu (Labeo rohita) [19], black tiger shrimp (Penaeus monodon) [43], and Pacific white shrimp [18,44e46]. However, in the present study there were no statistical difference in final weight and weight gain of shrimp nor were there any general trends in the data. Similarly, Chuchird et al. [47] could not find any significant effect of formic acid on growth performance of Pacific white shrimp. However, Romano et al. [46] reported enhanced growth of white shrimp following dietary administration of 2% organic acids blend (consisted of formic, lactic, malic and citric acids). Also, Su et al. [45] showed improved growth of white shrimp received 0.2% citric acid in the diet. The variations in the effects of organic acids on growth performance could be associated with their type and dose, different dietary compositions, and species-specific and age differences [18,43,48]. In regards to essential oils supplementation, there are several reports indicating their growth promoting effects in aquatic animals [49e51]. However, similar to our study, Kim et al. [52] could not find any significant effect of essential oils on growth performance of white leg shrimp. This is also in agreement with results of previous studies on Mozambique tilapia (Oreochromis mossambicus) [24] and red drum (Sciaenops ocellatus) [28]. The observed differences may be ascribed to the different active compounds of essential oils used in the diets (Baba et al., 2016). To date, there is no available research on the effects of organic acids and essential oils blend in aquatic animals. However, Mohammadi Gheisar et al. [31] showed that adding the same blend as our study to broiler chickens diet significantly enhances growth performance. Blood total protein is the most stable component, and few dietary factors have been reported to affect its concentration in aquatic animals. It has been suggested that increased serum total protein level is associated with enhanced innate immunity [53,54]. In the present study application of 0.6e1.2 g kg
1 AP significantly enhanced serum total protein level. This is consistent with results of previous studies on Mozambique tilapia [24,50] and rainbow trout [55,56] where dietary supplementation with essential oils significantly enhanced serum total protein level. The significant enhancement of serum total protein by AP correlated with increased non-specific immune response such as PO activity, and further confirmed the correlation between serum total protein level and immune response. Two important phosphatases are acid phosphatase and alkaline phosphatase. These enzymes are involved in a variety of metabolic functions including permeability, growth and cell differentiation, protein synthesis, and absorption and transport of nutrients [57]. In the current study, a significant enhancement in ALP activity was found at  0.9 g kg
1 AP compared to the control group. In agreement to our study, Hassaan et al. [58] showed the significant increase of serum ALP activity in Nile tilapia (Oreochromis niloticus) fed diets supplemented with malic acid and Bacillus subtilis. Also, Gao et al. [48] reported elevated ALP activity in loach (Paramisgurnus dabryanus) fed fulvic acid. However, Zhu et al. [59] found no significant effect of an organic acids blend on ALP activity of yellow catfish (Pelteobagrus fulvidraco). The underlying mechanism has not been investigated in aquatic animals. Kaya et al. [60] reported that application of organic acids mixture significantly enhances serum ALP in laying hens, and this was along with elevated blood calcium and phosphorous concentrations. They suggested that feeding of organic acids leads to decreased pH in the intestinal

W. He et al. / Fish & Shellfish Immunology 70 (2017) 164e173

169

Fig. 3. The distribution barplot of different bacterial phyla in control, AP0.6 and AP1.2 groups. Values are means of triplicate groups.

Fig. 5. Survival rate of Pacific white shrimp after 48 h of bacterial challenge. Values are means of triplicate groups. Bars with different letters are significantly different (P < 0.05).

Fig. 4. Composition of bacterial genera in intestine of shrimp fed Con, AP0.6 and AP1.2 diets for 8 weeks. Values are means of triplicate groups.

tract, which might have increased the absorption of minerals from the gut into the blood stream. Also, Rafacz-Livingston et al. [61] showed that citric acid substantially improved phosphorous utilization in commercial broiler chicks. It has been pointed out that organic acids enhance phytate phosphorus utilization resulting from a change in the pH of the gastrointestinal tract to a pH more favorable for phytases to hydrolyze phytate [62]. In agreement with abovementioned studies in poultry, Khajepour and Hosseini [42] showed that adding citric acid to diets in which fish meal was replaced with soybean meal significantly improves phosphorous digestibility in Beluga. In the current study, a substantial amount of soybean meal (25%) was used as dietary protein source which is rich in phytate. The observed enhancement in serum ALP activity in the present study may result from facilitated absorption and transport of minerals by organic acids administration. Crustaceans lack adaptive immune system, thus they are highly dependent on cellular and humoral components of non-specific immune system [63]. PO plays a key role in immune defense of invertebrates and is used as a reliable indicator of immune status in

170

W. He et al. / Fish & Shellfish Immunology 70 (2017) 164e173

Fig. 6. Expression of immune-related genes [lysozyme (a), penaeidin (b), catalase (c), and crustin (d)] in hepatopancreas of Pacific white shrimp fed the experimental diets after 48 h of challenge with V. parahaemolyticus. Values are means of triplicate groups. Bars with different letters are significantly different (P < 0.05).

shrimp. Su et al. (2014) reported significant enhancement of PO activity in white shrimp fed diets supplemented with 0.1e0.3% citric acid. Also, inclusion of formic acid in white shrimp diets resulted in significant improvement of PO activity (Chuchrid et al., 2015). Significant improvements in cellular and humeral immunity with enhanced hemolymph protein concentration, hemocyte phagocytic capacity, phenoloxidase activity and respiratory burst have also been reported in white shrimp by feeding diets containing 0.2% sodium alginate or acidic calcium sulfate [64,65]. Similarly, in the present study, AP supplementation at 0.9e1.2 g kg
1 of diet significantly enhanced PO activity. However, Silva et al. [66] found no significant changes in serum PO activity of Pacific white shrimp fed butyrate and propionate supplemented diets. It is believed that organic acids stimulate immune response through affecting indigenous intestinal flora, which is necessary for the development of the gut immune system [6,67]. Moreover, a similar function to that of b-N-acetyl glucosaminidase has been reported for citric acid, the former exerts a key role in molting, chitin digestion, and resistance to viruses and parasites [68,69], thus influencing the immune function of crustaceans [70]. Essential oils have a wide array of biological activities and their dietary administration results in varying physiological, biochemical and haemato-immunological response in fish [51]. Immunostimulating property of essential oils has been well documented in fish [24,50,71]; however, there is no earlier report on their efficiency in shrimp feed. Oxidative stress is a physiological condition that results from an imbalance between reactive oxygen species (ROS) and antioxidants concentrations. ROS are chemically reactive molecules containing oxygen ions and peroxides. Excessive accumulation of ROS results in oxidative damage, such as DNA, protein and lipid membranes damage. Cells defend themselves against ROS damage through production of radical scavenging enzymes such as superoxide dismutase and GPX. In the present study, serum GPX activity significantly enhanced at 0.6 g kg
1 AP. Improvement of antioxidant

capacity has also been shown in white shrimp by dietary supplementation of citric acid [45] and formic acid [47]. Also, Zheng et al. [49] showed enhanced antioxidant capacity in channel catfish (Ictalurus punctatus) fed diets with oregano essential oil (Origanum heracleoticum L.). Lin and Cheng [72] reported that dietary supplementation of 1.0% butyrate improves gut health in giant grouper (Epinephelus lanceolatus) fed soybean meal containing diets. In the current study, AP supplementation particularly at 0.9 g kg
1 significantly reduced the expression of gut pro-inflammatory genes such as TNF-a, RAB6A and LITAF. It has been pointed out that organic acids inhibit the growth of many pathogenic or nonpathogenic intestinal bacteria and decrease the intestinal colonization and infectious processes, which finally results in reduction of inflammatory reactions at the intestinal mucosa [73,74]. On the other hand, it has been suggested that lactic acid bacteria maintain the balance of microflora through prohibition of pathogenic bacteria translocation and adhesion, regulate the immunomodulatory properties and repress the inflammatory responses in the gut [75,76]. The results of present study showed the significant enhancement in number of Lactobacillus by AP administration, which can be partially responsible for down-regulation of pro-inflammatory genes expression in AP treated groups. Moreover, beneficial effects of essential oils have been reported on the animals' overall gastrointestinal health and productivity. Kroismayr et al. [77] reported down-regulation of TNF-a expression rates in pigs fed diets supplemented with
s et al. [78] showed the antioregano essential oils. Also, Juha inflammatory effects of Rosmarinus officinalis essential oil in mice, and the authors attributed the effects to the presence of bioactive compounds such as terpenes with anti-inflammatory activity. Gut microbiota constitute a highly complex ecosystem that interacts with the host and profoundly affects physiological, immunological, nutritional, and metabolic status of the host [79,80]. Organic acids and their salts modulate the gut microbiota through a shift in predominant bacterial hierarchies resulting from the lysing

W. He et al. / Fish & Shellfish Immunology 70 (2017) 164e173

of Gram-negative bacteria [6,81,82]. In the present study, gut microbiota richness and diversity were increased by organic acids and essential oils blend, and most of the OTUs sequences were related to Proteobacteria, Bacteroidetes, Verrucomicrobia and Firmicutes. Similar findings were reported by Gao et al. [48] for loach (Paramisgurnus dabryanus) fed a fulvic acid containing diet. Also, in the current study less abundance of pathogenic bacteria such as Acinetobacter and Vibrio were found in AP treated groups while abundance of beneficial bacteria such as Lactobacillus remarkably increased in AP1.2 group. Verstegen et al. [83] suggested that dietary organic acids can alter the intestinal environment to a less appropriate condition for pathogenic bacteria growth or killing some pathogens. This could be attributed to the pH reducing property of organic acids which is favorable for the growth of gut beneficial bacteria while suppressing the growth of pathogenic bacteria which grow at a relatively higher pH [45,84]. On the other hand, essential oil components possess lipophilic properties so that it can penetrate the membrane of the bacteria and reach the inner parts of the cell. Hence, probably they play a role in improving the number of probiotic bacteria and microbial diversity, thereby protecting intestine against pathogens damage [85]. The most recent disease that globally threatens the shrimp aquaculture industry is the acute hepatopancreatic necrosis disease (AHPND), commonly known as early mortality syndrome (EMS), that causes very high mortalities in shrimp farms and the causative agent has been identified to be certain strains of Vibrio parahaemolyticus [86]. Organic acids have been reported to possess anti-Vibrio spp. Activities [18,87,88], and increased survival rate of shrimp has been shown by organic acids application [43e46]. Results of the current study showed that adding 0.3 g kg
1 organic acids and essential oils blend to the control diet significantly enhances disease resistance of Pacific white shrimp to V. parahaemolyticus. Similar findings were documented in shrimp fed diets containing citric acid [45] and plant extracts [89]. Also, increased disease resistance against bacterial pathogens by dietary essential oils has been reported in channel catfish (Ictalurus punctatus) [49], rainbow trout (Oncorhynchus mykiss) [90], and Mozambique tilapia [24,50]. The enhancement of shrimp disease resistance by dietary AP was associated with up-regulation of immune related genes expression such as lysozyme, penaeidin and catalase genes at 48 h post challenge. In line with these results, Safari et al. [91] reported the enhancement of mucosal immune related genes expression in common carp (Cyprinus carpio L.) fed sodium propionate. In the current study, a similar trend to that of disease resistance was observed for lysozyme gene expression in hepatopancreas suggesting that lysozyme is involved in resistance of Pacific white shrimp to V. parahaemolyticus infection. In conclusion, the results of this study showed that dietary supplementation of the tested organic acids and essential oils blend beneficially influences shrimp gut microbiota and enhances nonspecific immune response and disease resistance against V. parahaemolyticus. The optimum supplementation level is suggested to be 0.3 g kg
1 of diet based on shrimp disease resistance.

[2]

[3] [4]

[5]

[6]

[7]

[8] [9]

[10]

[11]

[12]

[13] [14] [15]

[16]

[17]

[18]

[19]

[20]

Acknowledgements This study was supported by Special Fund for Agro-scientific Research in the Public Interest (Grant No. 201303053). We thank Xiamen Defuren Bio-Technology Co.,Ltd, Xiamen Jiakang Feed Co., Ltd. and Fuxing (Xiamen) Organic Feed Co., Ltd. for donating feed ingredients.

[21]

[22]

[23]

References [24] [1] J. Gao, H. Zuo, L. Yang, J.H. He, S. Niu, S. Weng, J. He, X. Xu, Long-term influence

171

of cyanobacterial bloom on the immune system of Litopenaeus vannamei, Fish. Shellfish Immunol. 61 (2017) 79e85, http://dx.doi.org/10.1016/j.fsi.2016.12. 015. T.W. Flegel, D.V. Lightner, C.F. Lo, L. Owens, Shrimp disease control: past, present and future, in: M.G. Bondad-Reantaso, C.V. Mohan, M. Crumlish, R.P. Subasinghe (Eds.), Diseases in Asian Aquaculture VI, Fish Health Section Asian Fish Soc, Manila, Philippines, 2008, p. 505. G. Rosen, The nutritional effects of tetracyclines in broiler feeds, in: XX World's Poult. Congress, WPSA, New Delhi, India, 1996, pp. 141e146. P. Li, G.S. Burr, D.M. Gatlin, M.E. Hume, S. Patnaik, F.L. Castille, A.L. Lawrence, Dietary supplementation of short-chain fructooligosaccharides influences gastrointestinal microbiota composition and immunity characteristics of Pacific white shrimp, Litopenaeus vannamei, cultured in a recirculating system, J. Nutr. 137 (12) (2007) 2763e2768. W.K. Ng, C.B. Koh, K. Sudesh, A. Siti-Zahrah, Effects of dietary organic acids on growth, nutrient digestibility and gut microflora of red hybrid tilapia, Oreochromis sp., and subsequent survival during a challenge test with Streptococcus agalactiae, Aquac. Res. 40 (13) (2009) 1490e1500, http://dx.doi.org/ 10.1111/j.1365-2109.2009.02249.x. Z. Zhou, Y. Liu, S. He, P. Shi, X. Gao, B. Yao, E. Ringø, Effects of dietary potassium diformate (KDF) on growth performance, feed conversion and intestinal bacterial community of hybrid tilapia (Oreochromis niloticus \  O. aureus _), Aquaculture 291 (1) (2009) 89e94, http://dx.doi.org/10.1016/j.aquaculture. 2009.02.043. G. Burr, D. Gatlin, S. Ricke, Microbial ecology of the gastrointestinal tract of fish and the potential application of prebiotics and probiotics in finfish aquaculture, J. World. Aquac. Soc. 36 (4) (2005) 425e436, http://dx.doi.org/ 10.1111/j.1749-7345.2005.tb00390.x. F. Gatesoupe, The use of probiotics in aquaculture, Aquaculture 180 (1) (1999) 147e165, http://dx.doi.org/10.1016/S0044-8486(99) 00187e00188. Z. Zhou, Z. Ding, L. Huiyuan, Effects of dietary short-chain fructooligosaccharides on intestinal microflora, survival, and growth performance of juvenile white shrimp, Litopenaeus vannamei, J. World Aquac. Soc. 38 (2) (2007) 296e301, http://dx.doi.org/10.1111/j.1749-7345.2007.00099.x. C.-F. Chang, H.-Y. Chen, M.-S. Su, I.-C. Liao, Immunomodulation by dietary b-1, 3-glucan in the brooders of the black tiger shrimp Penaeus monodon, Fish. Shellfish Immunol. 10 (6) (2000) 505e514, http://dx.doi.org/10.1006/fsim. 2000.0266. T. Sajeevan, R. Philip, I.B. Singh, Dose/frequency: a critical factor in the administration of glucan as immunostimulant to Indian white shrimp Fenneropenaeus indicus, Aquaculture 287 (3) (2009) 248e252, http://dx.doi.org/ 10.1016/j.aquaculture.2008.10.045. C. Lückst€ adt, Effect of organic acid containing additives in worldwide aquacultureesustainable production the non-antibiotic way, Acidifiers Anim. Nutr. (2008) 71. C. Luckstadt, The use of acidifiers in fish nutrition, CAB Rev. Perspect. Agric. veterinary Sci. Nutr. Nat. Resour. 3 (044) (2008) 1e8. G.R. Gibson, M.B. Roberfroid, Dietary modulation of the human colonic microbiota: introducing the concept of prebiotics, J. Nutr. 125 (6) (1995) 1401. K. Sritunyalucksana, W. Gangnonngiw, S. Archakunakorn, D. Fegan, T.W. Flegel, Bacterial clearance rate and a new differential hemocyte staining method to assess immunostimulant activity in shrimp, Dis. Aquat. Organ 63 (1) (2005) 89e94, http://dx.doi.org/10.3354/dao063089. T. Defoirdt, D. Halet, P. Sorgeloos, P. Bossier, W. Verstraete, Short-chain fatty acids protect gnotobiotic Artemia franciscana from pathogenic Vibrio campbellii, Aquaculture 261 (2) (2006) 804e808, http://dx.doi.org/10.1016/ j.aquaculture.2006.06.038. W. Ng, C. Koh, Application of Organic Acids in Aquafeeds: Impacts on Fish Growth, Nutrient Utilisation and Disease Resistance, Standards for Acidifiers, Principles for the Use of Organic Acids in Animal Nutrition, Nottingham University Press, Nottingham, United Kingdom, 2011, pp. 49e58. ~ o, G.S. Ferreira, B.C. da Silva, F. do Nascimento Vieira, J.L.P. Mourin W.Q. Seiffert, Salts of organic acids selection by multiple characteristics for marine shrimp nutrition, Aquaculture 384 (2013) 104e110, http://dx.doi.org/ 10.1016/j.aquaculture.2012.12.017. K. Baruah, N.P. Sahu, A.K. Pal, K.K. Jain, D. Debnath, S.C. Mukherjee, Dietary microbial phytase and citric acid synergistically enhances nutrient digestibility and growth performance of Labeo rohita (Hamilton) juveniles at sub-optimal protein level, Aquac. Res. 38 (2) (2007) 109e120, http:// dx.doi.org/10.1111/j.1365-2109.2006.01624.x. M.A. Hossain, A. Pandey, S. Satoh, Effects of organic acids on growth and phosphorus utilization in red sea bream Pagrus major, Fish. Sci. 73 (6) (2007) 1309e1317, http://dx.doi.org/10.1111/j.1444-2906.2007.01469.x. A. Malicki, W. Zawadzki, S. Bruzewicz, S. Graczyk, A. Czerski, Effect of formic and propionic acid mixture on Escherichia coli in fish meal stored at 12 C, Pak. J. Nutr. 3 (6) (2004) 353e356. M. Freitag, Organic acids and salts promote performance and health in animal €dt (Ed.), Acidifiers in Animal Nutrition e a Guide for husbandry, in: C. Lücksta Feed Preservation and Acidification to Promote Animal Production, Nottingham University Press, Nottingham, UK, 2007, pp. 1e12. I. Booth, M. Stratford, Acidulants and low pH, in: N.J. Russell, G.W. Gould (Eds.), Food Preservatives, Kluwer Academic/Plenum Publishers, NewYork, NY, USA, 2003, pp. 25e47. € E. Baba, Ü. Acar, C. Ontas ¸ , O.S. Kesbiç, S. Yılmaz, Evaluation of Citrus limon peels essential oil on growth performance, immune response of Mozambique

172

[25] [26]

[27]

[28]

[29]

[30]

[31]

[32] [33] [34]

[35]

[36]

[37]

[38]

[39]

[40]

[41]

[42]

[43]

[44]

[45]

[46]

W. He et al. / Fish & Shellfish Immunology 70 (2017) 164e173 tilapia Oreochromis mossambicus challenged with Edwardsiella tarda, Aquaculture 465 (2016) 13e18, http://dx.doi.org/10.1016/j.aquaculture.2016.08. 023. W.H. Lewis, M.P. Elvin-Lewis, Medical Botany: Plants Affecting Human Health, second ed., John Wiley & Sons, New York, 2003, p. 812. P. Rattanachaikunsopon, P. Phumkhachorn, Potential of Chinese chive oil as a natural antimicrobial for controlling Flavobacterium columnare infection in Nile tilapia Oreochromis niloticus, Fish. Sci. 75 (6) (2009) 1431e1437, http:// dx.doi.org/10.1007/s12562-009-0171-4. I. Giannenas, E. Triantafillou, S. Stavrakakis, M. Margaroni, S. Mavridis, T. Steiner, E. Karagouni, Assessment of dietary supplementation with carvacrol or thymol containing feed additives on performance, intestinal microbiota and antioxidant status of rainbow trout (Oncorhynchus mykiss), Aquaculture 350 (2012) 26e32, http://dx.doi.org/10.1016/j.aquaculture.2012.04.027. F.J. Sutili, A. Velasquez, C.G. Pinheiro, B.M. Heinzmann, D.M. Gatlin, B. Baldisserotto, Evaluation of Ocimum americanum essential oil as an additive in red drum (Sciaenops ocellatus) diets, Fish. Shellfish Immunol. 56 (2016) 155e161, http://dx.doi.org/10.1016/j.fsi.2016.07.008.
ron, X. Shi, The effect of essential oils on perS. Li, Y. Ru, M. Liu, B. Xu, A. Pe formance, immunity and gut microbial population in weaner pigs, Livest. Sci. 145 (1) (2012) 119e123, http://dx.doi.org/10.1016/j.livsci.2012.01.005. E. Grilli, B. Tugnoli, J.L. Passey, C.H. Stahl, A. Piva, A.J. Moeser, Impact of dietary organic acids and botanicals on intestinal integrity and inflammation in weaned pigs, BMC Veterinary Res. 11 (1) (2015) 96, http://dx.doi.org/10.1186/ s12917-015-0410-0. M. Mohammadi Gheisar, A. Hosseindoust, I. Kim, Evaluating the effect of microencapsulated blends of organic acids and essential oils in broiler chickens diet, J. Appl. Poult. Res. 24 (4) (2015) 511e519, http://dx.doi.org/ 10.3382/japr/pfv063. AOAC (Association of Official Analytical Chemists), Official Methods of Analysis, sixteenth ed., Association of Official Analytical Chemists, Virginia, 1995. €derha €ll, The prophenoloxidase activating system in crayfish, M. Ashida, K. So Comp. Biochem. Physiol. Part. B 77 (1) (1984) 21e26. T.D. Schmittgen, K.J. Livak, Analyzing real-time PCR data by the comparative CT method, Nat. Protoc. 3 (6) (2008) 1101e1108, http://dx.doi.org/10.1038/ nprot.2008.73. Y.-Y. Chen, J.-C. Chen, C.M. Tayag, H.-F. Li, D.F. Putra, Y.-H. Kuo, J.-C. Bai, Y.H. Chang, Spirulina elicits the activation of innate immunity and increases resistance against Vibrio alginolyticus in shrimp, Fish. Shellfish Immunol. 55 (2016) 690e698, http://dx.doi.org/10.1016/j.fsi.2016.06.042. J. Dibner, P. Buttin, Use of organic acids as a model to study the impact of gut microflora on nutrition and metabolism, J. Appl. Poult. Res. 11 (4) (2002) 453e463, http://dx.doi.org/10.1093/japr/11.4.453. L. Franco, M. Fondevila, M. Lobera, C. Castrillo, Effect of combinations of organic acids in weaned pig diets on microbial species of digestive tract contents and their response on digestibility, J. Anim. Physiol. Anim. Nutr. 89 (3e6) (2005) 88e93, http://dx.doi.org/10.1111/j.1439-0396.2005.00553.x. €dt, S. Mellor, The use of organic acids in animal nutrition, with C. Lücksta special focus on dietary potassium diformate under European and AustralAsian conditions, Recent Adv. Anim. Nutr. Aust. 18 (2011) 123e130. V.P.G. Papatsiros, C. Billinis, The prophylactic use of acidifiers as antibacterial agents in swine, in: M.G. Bondad-Reantaso, C.V. Mohan, M. Crumlish, R.P. Subasinghe (Eds.), Antimicrobial Agents, InTech, Rijeka, Croatia, 2012. C.B. Koh, N. Romano, A.S. Zahrah, W.K. Ng, Effects of a dietary organic acids blend and oxytetracycline on the growth, nutrient utilization and total cultivable gut microbiota of the red hybrid tilapia, Oreochromis sp., and resistance to Streptococcus agalactiae, Aquac. Res. 47 (2) (2016) 357e369, http://dx.doi.org/10.1111/are.12492. M. Sarker, S. Alam, S. Satoh, K. Kamata, Y. Haga, Y. Yamamoto, Supplementation effect(s) of organic acids and/or lipid to plant protein-based diets on juvenile yellowtail, Seriola quinqueradiata Temminck et Schlegel 1845, growth and, nitrogen and phosphorus excretion, Aquac. Res. 43 (4) (2012) 538e545, http://dx.doi.org/10.1111/j.1365-2109.2011.02859.x. F. Khajepour, S.A. Hosseini, Citric acid improves growth performance and phosphorus digestibility in Beluga (Huso huso) fed diets where soybean meal partly replaced fish meal, Anim. Feed. Sci. Technol. 171 (1) (2012) 68e73, http://dx.doi.org/10.1016/j.anifeedsci.2011.10.001. W.-K. Ng, C.-B. Koh, C.-Y. Teoh, N. Romano, Farm-raised tiger shrimp, Penaeus monodon, fed commercial feeds with added organic acids showed enhanced nutrient utilization, immune response and resistance to Vibrio harveyi challenge, Aquaculture 449 (2015) 69e77, http://dx.doi.org/10.1016/j.aquaculture.2015.02.006. W. Walla, W. Purivirojkul, N. Chuchird, C. Limsuwan, Effects of activate DA on growth, survival and the total number of bacteria and Vibrio spp. in rearing of pacific white shrimp (Litopenaeus vannamei), J. Fish. Environ. 36 (2) (2012) 14e22. X. Su, X. Li, X. Leng, C. Tan, B. Liu, X. Chai, T. Guo, The improvement of growth, digestive enzyme activity and disease resistance of white shrimp by the dietary citric acid, Aquacult. Int 22 (6) (2014) 1823, http://dx.doi.org/10.1007/ s10499-014-9785-3. N. Romano, C.-B. Koh, W.-K. Ng, Dietary microencapsulated organic acids blend enhances growth, phosphorus utilization, immune response, hepatopancreatic integrity and resistance against Vibrio harveyi in white shrimp, Litopenaeus vannamei, Aquaculture 435 (2015) 228e236, http://dx.doi.org/ 10.1016/j.aquaculture.2014.09.037.

[47] N. Chuchird, P. Rorkwiree, T. Rairat, Effect of dietary formic acid and astaxanthin on the survival and growth of Pacific white shrimp (Litopenaeus vannamei) and their resistance to Vibrio parahaemolyticus, SpringerPlus 4 (1) (2015) 440, http://dx.doi.org/10.1186/s40064-015-1234-x. [48] Y. Gao, J. He, Z. He, Z. Li, B. Zhao, Y. Mu, J.-Y. Lee, Z. Chu, Effects of fulvic acid on growth performance and intestinal health of juvenile loach Paramisgurnus dabryanus (Sauvage), Fish. Shellfish Immunol. 62 (2017) 47e56, http:// dx.doi.org/10.1016/j.fsi.2017.01.008. [49] Z. Zheng, J.Y. Tan, H. Liu, X. Zhou, X. Xiang, K. Wang, Evaluation of oregano essential oil (Origanum heracleoticum L.) on growth, antioxidant effect and resistance against Aeromonas hydrophila in channel catfish (Ictalurus punctatus), Aquaculture 292 (3) (2009) 214e218, http://dx.doi.org/10.1016/ j.aquaculture.2009.04.025. [50] Ü Acar, O.S. Kesbiç, S. Yılmaz, N. Gültepe, A. Türker, Evaluation of the effects of essential oil extracted from sweet orange peel (Citrus sinensis) on growth rate of tilapia (Oreochromis mossambicus) and possible disease resistance against Streptococcus iniae, Aquaculture 437 (2015) 282e286, http://dx.doi.org/ 10.1016/j.aquaculture.2014.12.015. [51] C.C. Ngugi, E. Oyoo-Okoth, M. Muchiri, Effects of dietary levels of essential oil (EO) extract from bitter lemon (Citrus limon) fruit peels on growth, biochemical, haemato-immunological parameters and disease resistance in Juvenile Labeo victorianus fingerlings challenged with Aeromonas hydrophila, Aquac. Res. 48 (5) (2017) 2253e2265, http://dx.doi.org/10.1111/are.13062. [52] J. Kim, T. Nhut, T. Hai, C. Ra, Effect of dietary essential oils on growth, feed utilization and meat yields of white leg shrimp L. vannamei, Asian Austral J. Anim. Sci. 24 (8) (2011) 1136e1141, http://dx.doi.org/10.5713/ajas.2011. 11006. [53] G.F. Wiegertjes, R.M. Stet, H.K. Parmentier, W.B. van Muiswinkel, Immunogenetics of disease resistance in fish: a comparative approach, Dev. Comp. Immunol. 20 (6) (1996) 365e381, http://dx.doi.org/10.1016/S0145-305X(96) 00032-8.
ttir, Innate immunity of fish (overview), Fish. Shellfish Immunol. [54] B. Magnado 20 (2) (2006) 137e151, http://dx.doi.org/10.1016/j.fsi.2004.09.006. [55] E. Awad, D. Austin, A.R. Lyndon, Effect of black cumin seed oil (Nigella sativa) and nettle extract (Quercetin) on enhancement of immunity in rainbow trout, Oncorhynchus mykiss (Walbaum), Aquaculture 388 (2013) 193e197, http:// dx.doi.org/10.1016/j.aquaculture.2013.01.008. [56] A.K. Güleç, D. Danabas¸, M. Ural, E. S¸eker, A. Arslan, O. Serdar, Effect of mixed use of thyme and fennel oils on biochemical properties and electrolytes in rainbow trout as a response to Yersinia ruckeri infection, Acta Veterinaria Brno 82 (3) (2013) 297e302, http://dx.doi.org/10.2754/avb201382030297. [57] R.N. Ram, A.G. Sathyanesan, Mercuric chloride, cythion and ammonium sulfate induced changes in the brain, liver and ovarian alkaline phosphatase content in the fish Channa punctatus, Envir. Ecol. 3 (2) (1985) 263e268. [58] M. Hassaan, M. Soltan, S. Jarmołowicz, H. Abdo, Combined effects of dietary malic acid and Bacillus subtilis on growth, gut microbiota and blood parameters of Nile tilapia (Oreochromis niloticus), Aquacult. Nutr. (2017), http:// dx.doi.org/10.1111/anu.12536. [59] Y. Zhu, X. Qiu, Q. Ding, M. Duan, C. Wang, Combined effects of dietary phytase and organic acid on growth and phosphorus utilization of juvenile yellow catfish Pelteobagrus fulvidraco, Aquaculture 430 (2014) 1e8, http://dx.doi.org/ 10.1016/j.aquaculture.2014.03.023. [60] H. Kaya, A. Kaya, M. Gul, S. Celebi, S. Timurkaan, B. Apaydin, Effects of supplementation of different levels of organic acids mixture to the diet on performance, egg quality parameters, serum traits and histological criteria of laying hens, Eur. Poult. Sci. 78 (2014), http://dx.doi.org/10.1399/eps.2014.46. [61] K. Rafacz-Livingston, C. Parsons, R. Jungk, The effects of various organic acids on phytate phosphorus utilization in chicks, Poult. Sci. 84 (9) (2005) 1356e1362, http://dx.doi.org/10.1093/ps/84.9.1356. [62] A. Liem, G. Pesti, H. Edwards Jr., The effect of several organic acids on phytate phosphorus hydrolysis in broiler chicks, Poult. Sci. 87 (4) (2008) 689e693, http://dx.doi.org/10.3382/ps.2007-00256. [63] T. Mekata, R. Sudhakaran, S. Okugawa, T. Kono, M. Sakai, T. Itami, Molecular cloning and transcriptional analysis of a newly identified antilipopolysaccharide factor gene in kuruma shrimp, Marsupenaeus japonicus, Lett. Appl. Microbiol. 50 (1) (2010) 112e119, http://dx.doi.org/10.1111/ j.1472-765X.2009.02763.x. [64] W. Cheng, C.-H. Liu, C.-M. Kuo, J.-C. Chen, Dietary administration of sodium alginate enhances the immune ability of white shrimp Litopenaeus vannamei and its resistance against Vibrio alginolyticus, Fish. Shellfish Immunol. 18 (1) (2005) 1e12, http://dx.doi.org/10.1016/j.fsi.2004.03.002. [65] J.D. Anuta, A. Buentello, S. Patnaik, A.L. Lawrence, A. Mustafa, M.E. Hume, D.M. Gatlin, M.C. Kemp, Effect of dietary supplementation of acidic calcium sulfate (Vitoxal) on growth, survival, immune response and gut microbiota of the Pacific white shrimp, Litopenaeus vannamei, J. World. Aquac. Soc. 42 (6) (2011) 834e844, http://dx.doi.org/10.1111/j.1749-7345.2011.00519.x. ~ o, N. Bolivar, W.Q. Seiffert, Butyrate and [66] B.C. Silva, F.d.N. Vieira, J.L.P. Mourin propionate improve the growth performance of Litopenaeus vannamei, Aquac. Res. 47 (2) (2016) 612e623, http://dx.doi.org/10.1111/are.12520.
s, J.L. Muzquiz, [67] J.L. Balc
azar, I. De Blas, I. Ruiz-Zarzuela, D. Vendrell, O. Girone Enhancement of the immune response and protection induced by probiotic lactic acid bacteria against furunculosis in rainbow trout (Oncorhynchus mykiss), FEMS Immunol. Med. Microbiol. 51 (1) (2007) 185e193, http:// dx.doi.org/10.1111/j.1574-695x.2007.00294.x. [68] I.C. Koo, Y.M. Ohol, P. Wu, J.H. Morisaki, J.S. Cox, E.J. Brown, Role for lysosomal

W. He et al. / Fish & Shellfish Immunology 70 (2017) 164e173

[69]

[70]

[71]

[72]

[73]

[74]

[75]

[76]

[77]

[78]

[79]

[80]

enzyme b-hexosaminidase in the control of mycobacteria infection, Proc. Natl. Acad. Sci. 105 (2) (2008) 710e715. Z.-Y. Zhao, Z.-X. Yin, S.-P. Weng, H.-J. Guan, S.-D. Li, K. Xing, S.-M. Chan, J.G. He, Profiling of differentially expressed genes in hepatopancreas of white spot syndrome virus-resistant shrimp (Litopenaeus vannamei) by suppression subtractive hybridisation, Fish. Shellfish Immunol. 22 (5) (2007) 520e534, http://dx.doi.org/10.1016/j.fsi.2006.07.003. X.-L. Xie, Y.-H. Hu, L.-L. Wang, C.-Q. Chen, Q.-S. Huang, H.-T. Zhou, Q.-X. Chen, Inhibitory kinetics of citric acid on b-N-acetyl-d-glucosaminidase from prawn (Litopenaeus vannamei), Fish. Shellfish Immunol. 29 (4) (2010) 674e678, http://dx.doi.org/10.1016/j.fsi.2010.07.004. G.S. de Oliveira Hashimoto, F.M. Neto, M.L. Ruiz, M. Acchile, E.C. Chagas, F.C.M. Chaves, M.L. Martins, Essential oils of Lippia sidoides and Mentha piperita against monogenean parasites and their influence on the hematology of Nile tilapia, Aquaculture 450 (2016) 182e186, http://dx.doi.org/10.1016/ j.aquaculture.2015.07.029. Y.-H. Lin, M.-Y. Cheng, Effects of dietary organic acid supplementation on the growth, nutrient digestibility and intestinal histology of the giant grouper Epinephelus lanceolatus fed a diet with soybean meal, Aquaculture 469 (2017) 106e111, http://dx.doi.org/10.1016/j.aquaculture.2016.11.032. M. Loddi, V. Maraes, I. Nakaghi, F. Tucci, M. Hannas, J. Ariki, Mannan oligosaccharide and organic acids on performance and intestinal morphometric characteristics of broiler chickens, in: Proceedings of the 20th Annual Symposium, 2004, p. 45. Suppl. E.R.L. Pelicano, P. Souza, H. Souza, D. Figueiredo, M. Boiago, S. Carvalho, V. Bordon, Intestinal mucosa development in broiler chickens fed natural growth promoters, Rev. Bras. Cienc. Avicola 7 (4) (2005) 221e229. Y.Y. Dong, C. Chen, J. Ren, Z.M. Liu, Immunomodulatory effects of lactic acid bacteria on gut-associated immune system: research progress, Chin. J. Microecol. 26 (2) (2014), 221e208. Y.C. Zhang, L.L. Wang, F. Ma, L.W. Zhang, Researches on the effect of Lactic acid bacteria regulates intestinal inflammation, In Chinese with English Abstract, China Dairy Ind. 43 (8) (2015) 31e35. A. Kroismayr, J. Sehm, M. Pfaffl, K. Schedle, C. Plitzner, W. Windisch, Effects of avilamycin and essential oils on mRNA expression of apoptotic and inflammatory markers and gut morphology of piglets, Czech J. Anim. Sci. 53 (53) (2008) 377e387.  Juh
 Ciko  s, S. Czikkova
, D. Fabian, J. Koppel, Anti-inflamS. as, A. Bukovsk
a, S. matory effects of Rosmarinus officinalis essential oil in mice, Acta Veterinaria Brno 78 (1) (2009) 121e127, http://dx.doi.org/10.2754/avb200978010121. J. Henao-Mejia, E. Elinav, C. Jin, L. Hao, W.Z. Mehal, T. Strowig, C.A. Thaiss, A.L. Kau, S.C. Eisenbarth, M.J. Jurczak, Inflammasome-mediated dysbiosis regulates progression of NAFLD and obesity, Nature 482 (7384) (2012) 179e185, http://dx.doi.org/10.1038/nature10809. S. Ma, Y. Sun, F. Wang, R. Mi, Z. Wen, X. Li, N. Meng, Y. Li, X. Du, S. Li, Effects of

[81]

[82]

[83]

[84]

[85]

[86]

[87]

[88]

[89]

[90]

[91]

173

tussah immunoreactive substances on growth, immunity, disease resistance against Vibrio splendidus and gut microbiota profile of Apostichopus japonicus, Fish. Shellfish Immunol. 63 (2017) 471e479, http://dx.doi.org/10.1016/ j.fsi.2017.02.045. P. Hellweg, D. Tats, K. Manner, W. Vahjen, J. Zentek, Impact of potassium diformate on gut flora of weaned piglets, in: Proceedings of the Society of Nutritional Physiology, 2006, p. 63. M. Owen, P. Waines, G. Bradley, S. Davies, The effect of dietary supplementation of sodium butyrate on the growth and microflora of Clarias gariepinus (Burchell 1822), in: Proceedings of the XII International Symposium Fish Nutrition and Feeding, 2006. M.W. Verstegen, B.A. Williams, Alternatives to the use of antibiotics as growth promoters for monogastric animals, Anim. Biotechnol. 13 (1) (2002) 113e127, http://dx.doi.org/10.1081/ABIO-120005774. S. Adil, T. Banday, G.A. Bhat, M.S. Mir, M. Rehman, Effect of dietary supplementation of organic acids on performance, intestinal histomorphology, and serum biochemistry of broiler chicken, Vet. Med. Int. 2010 (2010), http:// dx.doi.org/10.4061/2010/479485. I.M. Helander, H.-L. Alakomi, K. Latva-Kala, T. Mattila-Sandholm, I. Pol, E.J. Smid, L.G. Gorris, A. von Wright, Characterization of the action of selected essential oil components on Gram-negative bacteria, J. Agric. Food Chem. 46 (9) (1998) 3590e3595, http://dx.doi.org/10.1021/jf980154m. L. Tran, L. Nunan, R.M. Redman, L.L. Mohney, C.R. Pantoja, K. Fitzsimmons, D.V. Lightner, Determination of the infectious nature of the agent of acute hepatopancreatic necrosis syndrome affecting penaeid shrimp, Dis. Aquat. Organ 105 (1) (2013) 45e55. S. Mine, R. Boopathy, Effect of organic acids on shrimp pathogen, Vibrio harveyi, Curr. Microbiol. 63 (1) (2011) 1, http://dx.doi.org/10.1007/s00284011-9932-2. D. Adams, R. Boopathy, Use of formic acid to control vibriosis in shrimp aquaculture, Biologia 68 (6) (2013) 1017e1021, http://dx.doi.org/10.2478/ s11756-013-0251-x. R.-Y. Yeh, Y.-L. Shiu, S.-C. Shei, S.-C. Cheng, S.-Y. Huang, J.-C. Lin, C.-H. Liu, Evaluation of the antibacterial activity of leaf and twig extracts of stout camphor tree, Cinnamomum kanehirae, and the effects on immunity and disease resistance of white shrimp, Litopenaeus vannamei, Fish. Shellfish Immunol. 27 (1) (2009) 26e32. P. Navarrete, I. Toledo, P. Mardones, R. Opazo, R. Espejo, J. Romero, Effect of Thymus vulgaris essential oil on intestinal bacterial microbiota of rainbow trout, Oncorhynchus mykiss (Walbaum) and bacterial isolates, Aquac. Res. 41 (10) (2010), http://dx.doi.org/10.1111/j.1365e2109.2010.02590. R. Safari, S.H. Hoseinifar, S. Nejadmoghadam, M. Khalili, Non-specific immune parameters, immune, antioxidant and growth-related genes expression of common carp (Cyprinus carpio L.) fed sodium propionate, Aquac. Res. (2017), http://dx.doi.org/10.1111/are.13272.