Effects of Potamogeton crispus decline in the rhizosphere on the abundance of anammox bacteria and nirS denitrifying bacteria☆

Environmental Pollution 260 (2020) 114018

Contents lists available at ScienceDirect

Environmental Pollution journal homepage: www.elsevier.com/locate/envpol

Effects of Potamogeton crispus decline in the rhizosphere on the abundance of anammox bacteria and nirS denitrifying bacteria** Jinlong Hu , Yuhao Zhou , Ziyan Lei , Guanglong Liu , Yumei Hua , Wenbing Zhou , Xiaoqiong Wan , Duanwei Zhu , Jianwei Zhao * Laboratory of Eco-Environmental Engineering Research, College of Resources and Environment, Huazhong Agricultural University, Wuhan, 430070, China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 13 September 2019 Received in revised form 17 January 2020 Accepted 17 January 2020 Available online 18 January 2020

Bacteria involved with ecosystem N cycling in the rhizosphere of submerged macrophytes are abundant and diverse. Any declines of submerged macrophytes can have a great influence on the abundance and diversity of denitrifying bacteria and anammox bacteria. Natural decline, tardy decline, and sudden decline methods were applied to cultivated Potamogeton crispus. The abundance of anammox bacteria and nirS denitrifying bacteria in rhizosphere sediment were detected using real-time fluorescent quantitative PCR of 16S rRNA, and phylogenetic trees were constructed to analyze the diversities of these two microbes. The results indicated that the concentration of NHþ 4 in pore water gradually increased with increasing distances from the roots, whereas, the concentration of NO 3 showed a reverse trend. The abundance of anammox bacteria and nirS denitrifying bacteria in sediment of declined P. crispus populations decreased significantly over time. The abundance of these two microbes in the sudden decline group were significantly higher (P > 0.05) than the other decline treatment groups. Furthermore, the abundances of these two microbes were positively correlated, with RDA analyses finding the mole ratio  of NHþ 4 /NO3 being the most important positive factor affecting microbe abundance. Phylogenetic analysis indicated that the anammox bacteria Brocadia fuigida and Scalindua wagneri, and nirS denitrifying bacteria Herbaspirillum and Pseudomonas, were the dominant species in declined P. crispus sediment. We suggest the sudden decline of submerged macrophytes would increase the abundance of anammox bacteria and denitrifying bacteria in a relatively short time. © 2020 Published by Elsevier Ltd.

Keywords: Rhizosphere sediment Submerged macrophyte Sudden decline nirS denitrifying bacteria Anammox bacteria

1. Introduction Denitrification and anaerobic ammonia oxidation (anammox) are two key steps of ecosystem N cycling (Francis et al., 2007) that operate widely in freshwater, estuarine, and seawater ecosystems (Ahn et al., 2011; Zhu et al., 2010). The activity of anammox bacteria contributed 31e41% N2 to the production in the rhizosphere, whereas in rice fields with lower activity the non-rhizosphere anammox bacteria contributed only 2e3% N2 (Nie et al., 2015). The anammox process accounted for up to 79% of total nitrogen loss in marine sediments, whereas denitrifying bacteria contributed to over 87% of the nitrogen loss in the water columns of a freshwater

* This paper has been recommended for acceptance by Sarah Harmon. * Corresponding author. College of Resources and Environment, Huazhong Agricultural University Post address: No.1, Shizishan Street, Hongshan District, Wuhan City, Hubei Province, 430070, People’s Republic of China. E-mail address: [email protected] (J. Zhao).

https://doi.org/10.1016/j.envpol.2020.114018 0269-7491/© 2020 Published by Elsevier Ltd.

lake (Schubert et al., 2006). Recent studies have found that in many environments, nirS (encoding the cytochrome-cd1-dependent variant) bacteria are far more abundant (Abell et al., 2009), express greater activity (Huang et al., 2011; Nogales et al., 2002) and have higher diversity than nirK (encoding copper-dependent nitrite reductase) bacteria (Helen et al., 2016; Lee and Francis, 2017). Therefore, the abundance of denitrifying bacteria in this study were detected by amplification and sequencing of the nirS gene. The abundance and diversity of denitrifying bacteria and anammox bacteria are affected by organic matter, oxygen, redox  potential, concentration of NHþ 4 and NO3 in the submerged plant rhizosphere, and sediment (Lee and Francis, 2017). Dissolved oxygen is the most influential environmental parameter (Oshiki et al., 2016), with salinity (Sonthiphand et al., 2014) and the molar ratio of  NHþ 4 to NOX (Oshiki et al., 2016) also being important environmental parameters to anammox and denitrifying activity. In addition, Wu et al. (2017) reported that root exudates significantly influenced the abundance, microbial community richness, and diversity of denitrifying bacteria (Wu et al., 2017).

2

J. Hu et al. / Environmental Pollution 260 (2020) 114018

Water eutrophication is a global environmental problem, especially in developing countries, such as China (Wang et al., 2019). Submerged aquatic plants, including Potamogeton crispus, are able to assimilate nutrients (i.e. nitrogen, phosphorus, and others) in water and alleviate eutrophication (Xu et al., 2019). Assimilating nutrients has become one of the most effective tools in the ecological restoration of eutrophic water (Cao et al., 2018; Gao et al., 2017; Zhou et al., 2017). The oxygen released in the rhizosphere of submerged plants and the activity of microorganisms form a gradient of aerobic, hypoxia, and anaerobic microenvironments, where bacteria communities change accordingly (Hern
andez et al., 2015; Wang et al., 2018; Zhao et al., 2013). Therefore, the rhizosphere of submerged plants is a complex microenvironment to denitrifying bacteria and anammox bacteria, and any physiological changes (i.e. a decline) of submerged plants would influence the abundance and diversity of nitrogen cycle microorganisms in rhizosphere sediments (Yin et al., 2020; Zhao et al., 2019b). Submerged plants may have declined for various reasons, such as a sudden decline caused by mechanical damage, a tardy decline caused by herbivory, and a natural decline caused by seasonal variations. During the decline of submerged plants, the intracellular contents and other substances would be released into the rhizosphere. How the decline of submerged plants or roots affects the abundance and diversity of anammox bacteria and nirS denitrifying bacteria is still unknown. In this study we hypothesized that different types of decline would cause variations in the microenvironment in the rhizosphere that would change the abundance of anammox bacteria and nirS denitrifying bacteria. A common submerged macrophyte, P. crispus was cultured and treated to three ‘decline management’ regimes. The physicochemical properties, abundances, and diversities of anammox bacteria and nitrifying bacteria were detected and analyzed in sediment collected from different rhizosphere compartments.

buds of P. crispus were selected, and six buds showing similar germination times and growth characteristics were transplanted into one rhizobox. 2.2. Design of rhizoboxes The rhizoboxes (Fig. S1) were designed following (Wang et al., 2018) and were divided into three sections with nylon mesh (<25 mm): a root compartment (RT, 20 mm in width), a rhizosphere compartment (RZ, 5 mm in width), and a bulk sediment compartment (BS, 72.5 mm in width). The rhizosphere compartments were further separated into five sub-compartments (RZ1 to RZ5, 1 mm in width) using six nylon mesh spacers. Consequently, the rhizoboxes had seven interlayers, namely, RT, RZ1 to RZ5, and BS. In addition, every sub-compartment was filled with 15 g dried sediment, and four rhizoboxes for each ‘decline treatment’ were immersed in water tanks (575 mm  390 mm  350 mm) to simulate submerged conditions.Fig. s1 2.3. Decline treatment, sample collection, and physicochemical measurement P. crispus were initially cultivated for over 60 days. Afterwards, the decline treatments (natural decline, tardy decline, and sudden decline) began on 11 May (the natural decline of the plant began). In the ‘natural decline’ (ND) treatment no artificial processes were used; in the ‘tardy decline’ (TD) treatment half of the leaves were cut; and in the ‘sudden decline’ (SD) treatment part of the P. crispus above the sediment was cut. Leaves were removed from the water from the TD and SD groups after the decline treatments. The sediment in each interlayer was sampled at 10, 20, 30, and 40 d after the decline treatments. Physicochemical properties of pore water and the sediment organic matter content were analyzed according to (Wang et al., 2018).

2. Materials and methods

2.4. Genomic DNA extraction and PCR amplification

2.1. Sediment and plant

The residual genomic DNA of the sediments were extracted using a Fast DNA Spin Kit for Soil (MP Biomedicals, Fountain Parkway Solon, OH, USA) following the manufacturer’s instructions and stored at 20  C for further analysis. DNA concentrations were determined using a NanoDrop 2000 UVeVis Spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) with the quality being checked by electrophoresis on a 1.2% agarose gel. The 16S rRNA gene of anammox bacteria and the nirS gene of denitrifying bacteria were both amplified by PCR; the specific amplification primers are shown in Table 1. The PCR amplification

Sediment for the experiments was taken from Liangzi Lake,  Hubei Province, China. The organic matter (OM), NHþ 4 -N, and NO3 N of sediment, plus the pH of pore water in the sediment were 7.28 g/kg, 1.69 mg/L, 0.18 mg/L, and 7.58, respectively. The sediment was dried, milled, and sieved using a 100-mesh filter before being used to fill experimental rhizoboxes. P. crispus is a common submerged macrophyte in lakes of southern China and was chosen as the test plant. After cultivation for seven days, healthy and uniform

Table 1 Primers used in this study. Gene name Primers used for PCR amplification nirS Anammox 16S rRNA

Primer name nirS1F nirS6R First round Second round

Primers used for Real-time Fluorescent Quantitative PCR nirS nirS1F nirS6R Anammox 16S rRNA First round Second round

Primer sequence (50 -30 )

References

Pla46F 630R AMX368F AMX820R

CCTAYTGGCCGCCRCART CGTTGAACTTRCCGGT GGATTAGGCATGCAAGTC CAKAAAGGAGGTGATCC TTCGCAATGCCCGAAAGG AAAACCCCTCTACTTAGTGCCC

Pla46F 630R AMX809F AMX1066R

AACGYSAAGGARACSGG GASTTCGGRTGSGTCTTSAYGAA GGATTAGGCATGCAAGTC CAKAAAGGAGGTGATCC GCCGTAAACGATGGGCACT AACGTCTCACGACACGAGCTG

(Throb€ ack et al., 2004) (Juretschko et al., 1998) (Schmid et al., 2005)

(Throb€ ack et al., 2004) (Juretschko et al., 1998) (Tsushima et al., 2007)

J. Hu et al. / Environmental Pollution 260 (2020) 114018

3

Fig. 1. A)NHþ 4 concentration in pore water of declined Potamogeton crispus at 40 d. White bar: natural decline (ND); diagonally lined bar: tardy decline (TD); gray bar: sudden decline (SD). Different letters above the bars indicate significant differences (P < 0.05) between groups in the same distance to root. B)NO 3 concentration in pore water of declined Potamogeton crispus at 40 d. White bar: natural decline (ND); diagonally lined bar: tardy decline (TD); gray bar: sudden decline (SD). Different letters above the bars indicate significant differences (P < 0.05) between groups in the same distance to root.

4

J. Hu et al. / Environmental Pollution 260 (2020) 114018

solution was a 25 mL mixture containing 12.5 mL of 2  TSINGKE Master Mix (blue), 1 mL of primer F (10 mM), 1 mL of primer R (10 mM), 1 mL of template DNA (20e50 ng/mL), and 9.5 mL of sterile water. The PCR reaction conditions were as follows: 95  C for 5 min, 30 cycles at 95  C for 30 s, 50  C for 30 s, followed by 72  C for 45 s; ending with a 7 min extension at 72  C.Fig. s2

build the phylogenetic tree, respectively. The neighbor-joining method was applied in the phylogenetic analysis, and subsequently the phylogenetic tree branch confidences were tested by bootstrap analyses and repeated 1000 times.

2.6. Real-time fluorescent quantitative PCR 2.5. Cloning, sequencing and phylogenetic analysis The PCR products were purified and recycled, and samples from the same interlayers of four rhizoboxes in one group were mixed and cloned following the pClone 007 Vector connecting kit instructions (Qingke Biological, Beijing, China). One hundred clones from each DNA sample were randomly selected for sequencing the denitrifying bacteria and anammox bacteria, which was then used to construct clone libraries of these two types of bacteria. The obtained sequences were used in the Mothur v.1.35.1 software program for OTU cluster analysis with 97% similarity and in BLAST in the GenBank database to search for similar bacteria. The representative sequences of each OTU, plus the correlation sequences with high similarity to those from the GenBank database, were selected to construct a phylogenetic tree. ClustalW 2.1 and Mega 6.0 software were used to conduct a multiple sequence alignment and

The quantitative PCR analyses of denitrifying bacteria and anammox bacteria were performed by the SYBR Green method using a Real-Time PCR amplification instrument (BIO-RAD, USA), with the specific primers shown in Table 1. A standard curve was prepared using a known copy number plasmid DNA (SHENG GONG, Shanghai, China) and diluted by a factor of ten. The standard curves, samples, and negative controls were tested and repeated three times. The 10-mL quantitative PCR reaction system included: 5 mL of SYBR Green qPCR Master Mix, 1 mL of template DNA, 0.5 mL of primer F (10 mM), 0.5 mL of primer R (10 mM), and 3 mL of ddH2O. The PCR parameters were as follows: 95  C for 15 min; 40 cycles at 94  C for 10 s, 52  C for 30 s, and 72  C for 30 s. The amplification efficiency of this experiment was greater than 95%. The coefficient of determination R2 was greater than 0.99 and the dissolution curve was a single peak.Fig. s3

Fig. 2. Quantity of anammox bacteria and nirS denitrifying bacteria in rhizosphere sediments of declined P. crispus at 40 d. Red bar: abundance of anammox 16S rDNA; blue bar: abundance of nirS; ( ): ratio of anammox/nirS. Different letters above the bars indicate significant differences (P < 0.05) between different distances to root. . (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

▪

J. Hu et al. / Environmental Pollution 260 (2020) 114018

2.7. Statistical analyses The physicochemical properties and microbial abundances of the P. crispus rhizosphere sediment were analyzed by ANOVA using SPSS 22.0 (SPSS Inc., Chicago, IL, USA). A detrended correspondence analysis (DCA) of species and environmental data was conducted using the Canoco 5.0 software, and then the relationship of microbial community structure was studied using redundancy analysis (RDA). Sequences obtained in this study were compared with the NCBI BLAST databases to find similarities, then uploaded to Genbank with the accession numbers MK135830 - MK135879, MK133751 MK133800, and MK133256 - MK133305 for anammox bacteria; plus MK211419 - MK211467, MK178603 - MK178652, and MK112628 - MK112677 for nirS denitrifying bacteria. 3. Results 3.1. Physicochemical properties in the P. crispus rhizosphere The pore water NHþ 4 concentrations in the three decline treatments increased slowly with increasing distance from roots, but there were no significant differences (P > 0.05) between treatments. The NHþ 4 concentration in the rhizosphere compartment also increased with time, which averaged 0.759, 0.871, 1.141, and 1.560 mg/L, after being dead for 10, 20, 30, and 40 d, respectively. The NHþ 4 concentrations in the SD group were significantly higher than the other two groups in days 10 and 20 in the root compartment and bulk sediment compartment. There were no significant differences in the rhizosphere in day 40 among the three groups (Fig. 1A). NO 3 concentrations in pore water of the three decline treatments decreased with increasing distance from the roots. The NO concentrations in the rhizosphere compartment also 3 decreased with time, which on average was 0.104 mg/L, 0.086 mg/L, 0.040 mg/L, and 0.035 mg/L at days 10, 20, 30, and 40, respectively. Among the three treatment groups, the concentrations of NO 3 in the SD group were significantly different from the other two groups in the root, rhizosphere and bulk sediment compartments on day 40 (Fig. 1B). The organic matter in the three treatments increased gradually but showed no significant differences (P > 0.05). No significant differences (P > 0.05) were found between average pH values of 6.76, 6.93, and 6.86 in the ND, TD, and SD treatments, respectively.

5

and RZ5. However, the ratio of anammox/nirS abundance showed large fluctuations with increasing time (Fig. 2). 3.3. Ecological relationship between nirS denitrifying bacteria and anammox bacteria The abundance of denitrifying bacteria and anammox bacteria were obviously correlated with environmental factors, such as NHþ 4 concentration, NO 3 concentration, and pH (Fig. 3). The abundance and ratio of anammox/nirS were both positively correlated with each other. Samples sites were widely distributed (Fig. 3), which indicated the differences in the microenvironments in the different rhizosphere spaces and treatment groups. A positive correlation was found between the abundance of these two microbes with NHþ 4   and NHþ 4 /NO3 , whereas NO3 and pH were negatively correlated.  The mole ratio of NHþ 4 /NO3 had a strong positive influence on the abundance of the denitrifying bacteria and anammox bacteria that was more significant than with NHþ 4 concentration (Fig. 3). 3.4. Phylogenetic tree analysis of anammox bacteria and denitrifying bacteria diversity Clone libraries of these two types of bacteria were created, which contained 150 anammox gene sequences and 149 nirS gene sequences. The obtained sequences were processed using Mothur software (v.1.35.1) for OTU cluster analysis at 97% similarity; 17 and 92 OTUs were formed for anammox and nirS, respectively. OTUs and classic sequences of anammox bacteria from Genbank were selected to construct a phylogenetic tree and two clusters were formed. Cluster A covered 14 OTUs and contained 145 sequences, which were about 96.7% of the total anammox bacteria in the samples, and were grouped with Ca. Brocadia fuigida and Ca. Scalindua wagneri. This analysis indicated that Ca. Brocadia fuigida and

3.2. Abundance of anammox 16S rRNA and nirS In the ND group, the abundance of anammox bacteria decreased with increasing distance from the roots, with the greatest abundance of anammox bacteria being in the RT. However, the greatest abundances of anammox bacteria were in the TD RZ4 and RZ5 regions (Fig. 2). The anammox bacteria abundance in SD was irregular, being almost equal in the RT and BS areas after day 40, except for day 10. The average quantity of anammox in sediment of ND, TD, and SD groups at day 40 were 9.01  108, 5.79  108, and 2.03  109 cells/g, respectively (Fig. 2), which were significantly different (P < 0.05). A significant difference (P < 0.05) was also found in the abundance of nirS denitrifying bacteria in the ND, TD and SD groups, with average quantities of 1.71  107, 1.53  107, and 1.35  108 cells/g, respectively (Fig. 2). The nirS denitrifying bacteria abundance initially decreased, then increased with distance to the roots in all three groups. In the ND group, the fluctuation intensity of anammox/nirS gradually decreased over time, with the maximum ratio found in RZ1 and RZ2. Similar trends were shown in the TD group, with the maximum ratio of anammox/nirS in RZ4

Fig. 3. Redundancy analysis of bacteria abundance and environmental factors in P. crispus rhizosphere sediment. (N): natural decline; (T): tardy decline; (S): sudden þ decline. Numbers are distances to roots. (NHþ 4 ): concentration of NH4 in pore water;  þ  þ  (NO 3 ): concentration of NO3 in pore water; (NH4 /NO3 ): mole ratio of NH4 to NO3 .

6

J. Hu et al. / Environmental Pollution 260 (2020) 114018

Fig. 4. Phylogeny of anammox bacteria, estimated based on partial 16S rRNA gene sequence. RT: (root compartment); RZ: (rhizosphere compartment); BS: (bulk sediment compartment). The numbers in the brackets are the ratio of the number of sequences out of the total number in the corresponding interlayer. The numbers at the nodes are percentages based on 1000 replicates that indicate the levels of bootstrap support. Branches corresponding to partitions reproduced in <50% bootstrap replications were collapsed.

Ca. Scalindua wagneri were the dominant species in our experiment (Fig. 4). OTU 8, OTU 15, and OTU 16 showed long evolutionary distances from the other sequences and only contained five sequences, which were 3.3% of all sequences (Fig. 4). OTU 8, OTU 15, and OTU 16 were affiliated with Planctomycetes maris. Two clusters were formed in the nirS phylogenetic tree and named Cluster A and Cluster B (Fig. 5). About 88 OTUs were covered in Cluster A, which contained 141 sequences (94.3%). Cluster A was associated with Herbaspirillum, which was the dominant genus. Cluster B covered 4 OTUs and contained 8 sequences (5.37%) that were grouped with Pseudomonas. Most of the Cluster A and Cluster B sequences are closely related to sequences found in many freshwater lake sediments, including East Lake and Yangtze Lake. 4. Discussion Submerged macrophyte populations may decline due to changes in water level, sudden temperature changes, or from physiochemical damages caused by other processes. The microorganism community of the rhizosphere would change accordingly. The three kinds of decline treatments used in this study changed the physicochemical properties of pore water, as the concentrations

 of NHþ 4 increased and NO3 decreased. Intracellular substances were gradually released into the microenvironment. The combined effects of dissolved oxygen, ammonification, and nitrification resulþ ted in high concentrations of NO 3 and low concentrations of NH4 in þ the root compartment. The concentrations of NO and NH in BS 3 4 declined after a few days (Fig. 1A and B). However, over time the concentration of NHþ 4 in RT gradually increased. The concentrations of NO 3 in the SD group were significantly lower than in the other þ rhizospheres in days 10 and 20. The concentrations of NO 3 and NH4 within the same sample site for the three decline treatments were different, with microbial activity in ND being the slowest to release these compounds into the intracellular substances, followed by TD, and SD having the fastest activity and highest concentrations. These results indicated that sudden decline had the most significant  impact to sediment physicochemical properties. NHþ 4 and NO3 are two important ions affecting the abundances of anammox bacteria and denitrifying bacteria, which these two microbe types compete for in many ecological environments. The abundance of anammox bacteria were well above those of the denitrifying bacteria in all sediment samples (Fig. 2), which was distinctly different from the abundances found in freshwater riparian zones (Zhu et al., 2013) and paddy soils (Nie et al., 2015; Sato et al., 2009).

J. Hu et al. / Environmental Pollution 260 (2020) 114018

7

Fig. 5. Phylogeny of nirS denitrifying bacteria estimated based on partial 16S rRNA gene sequence. RT: (root compartment); RZ: (rhizosphere compartment); BS: (bulk sediment compartment). The numbers in the brackets represent the ratio of the number of sequences out of the total number in the corresponding interlayer. The numbers at the nodes are percentages based on 1000 replicates that indicate the levels of bootstrap support.

The abundance of anammox bacteria and nirS denitrifying bacteria in the same group are shown in Fig. 6B and D. The SD treatment increased the abundance of these two microbes, which was significantly higher (P < 0.05) than in the other two groups. Higher abundances of these two microbes in the SD group indicated

that the artificial damage of submerged macrophytes would promote the growth of these two microbes and quickly increase sediment denitrification. The abundance of anammox bacteria or nirS denitrifying bacteria in the same time within the three groups are shown in Fig. 6A and C. The abundance of these two microbes

8

J. Hu et al. / Environmental Pollution 260 (2020) 114018

Fig. 6. Abundance of anammox bacteria and nirS denitrifying bacteria in sediment. Different letters above the bars indicate significant differences (P < 0.05).

was high a short time following a decline (10 d) and decreased thereafter. Time after a decline treatment influenced the abundance of these two microbes, with a significantly higher (P < 0.05) maximum abundance being observed at day 10 than other times (Fig. 6A and C). A possible reason for these results could be a reduction in the release of some nutrients from plants or roots. 
et al. (2014) found the death of a forest would decrease Stursov a fungi abundance by 2.5 fold and (Broeckling et al., 2008) reported that root exudates regulate soil fungal community composition and diversity. Our research found the abundance of these two microbes in sediment of declined submerged macrophytes was significantly reduced compared with unaffected submerged plants. Anammox bacteria and denitrifying bacteria co-exist in a complex rhizosphere inter-relationship that is exposed to oxygen. Denitrification bacteria are not only a competitor but also a facilitator of anammox bacteria in regards to NOX-. They reduce NHþ 4 to   NO 3 and NO3 to NO2 , which is used in anammox processes (Zhou et al., 2016). The competition and cooperation of these two microbes occurs in natural ecosystems and can be used in waste water treatment facilities to significantly improve nitrogen removal efficiency and reduce costs (Ma et al., 2016; Tang et al., 2010). The abundance of denitrifying bacteria and anammox bacteria in the rhizosphere of declined P. crispus was positively correlated through RDA analysis (Fig. 3), which showed that a dominant factor was the co-operative relationship of these bacteria as has been found in studies of inland river sediments (Tang et al., 2010; Zhou et al., 2014). The concentration of NO 3 -N had a negative impact on the abundance of anammox bacteria and nirS denitrifying bacteria.  However, the mole ratio of NHþ 4 /NO3 showed a significant positive impact on the abundance of anammox bacteria and nirS denitrifying bacteria when compared to other factors, such as NHþ 4 -N

concentration (Fig. 3). These results are similar to the findings of studies of sediment in the south China sea (Hong et al., 2011; Li et al., 2013). In contrast, high concentrations of free ammonia reduced the performance of anammox bacteria in an up-flow biofilm reactor (Tang et al., 2009). Ca. Brocadia fuigida and Ca. Scalindua wagneri were the dominant species in the declined P. Crispus rhizosphere sediment (Fig. 4), while Ca. Brocadia was found in treatment plant wastewater (Kartal et al., 2008) and Ca. Scalindua is widely spread in freshwater (Hendrickx et al., 2014; Wang and Gu, 2013b), rice paddy soils (Wang and Gu, 2013a), and seawater (Dale et al., 2009). Sequences of Cluster A and Cluster B in the phylogenetic tree of anammox bacteria were closely related to sequences in paddy field soil and river estuary sediment, which demonstrated that the anammox in this research also exists in other ecological environments (Fig. 4). Herbaspirillum and Pseudomonas spp. were the domain species of Clusters A and B, respectively, in the phylogenetic tree of nirS denitrifying bacteria (Fig. 5). Genus Herbaspirillum belongs to the family Burkholderiaceae, which are usually found in rhizospheres and sediments and participate in nitrogen fixation (Huang et al., 2011; Jung et al., 2007). Bacterial genus Pseudomonas is a common aerobic and anaerobic denitrifying group (He et al., 2016) that are widely spread in freshwater (Guo et al., 2018) and marine sediments (Lin et al., 2017). Figs. 4 and 5 show the diversity of anammox bacteria and nirS denitrifying bacteria in sediment were not reduced, which indicates that the decline of P. crispus did not seem to noticeably influence the diversity of these two microbes. 5. Conclusions In summary, three decline methods were applied in cultivated

J. Hu et al. / Environmental Pollution 260 (2020) 114018

P. crispus and caused changes in sediment chemistry and ecology.  The concentrations of NHþ 4 and NO3 varied in opposite levels in pore water with increasing distance to roots, the mole ratio of NHþ 4/ NO 3 was an important positive factor influencing the abundance of anammox bacteria and nirS denitrifying bacteria, and the concentration of NO 3 -N had the largest negative impact on the abundance of these two microbes. The abundance of these microbes in sediment of the ‘sudden decline’ group was significantly higher than in the other two groups. These results supported our hypothesis of different decline (nature decline, tardy decline and sudden decline) treatments causing marked variations in bacterial abundance. Declaration competing interest The authors declare no competing financial interests. CRediT authorship contribution statement Jinlong Hu: Methodology, Investigation, Formal analysis, Data curation, Writing - original draft. Yuhao Zhou: Investigation, Resources, Data curation. Ziyan Lei: Validation, Formal analysis. Guanglong Liu: Visualization, Supervision. Yumei Hua: Writing review & editing. Wenbing Zhou: Project administration. Xiaoqiong Wan: Project administration. Duanwei Zhu: Methodology. Jianwei Zhao: Conceptualization, Visualization, Supervision, Writing - review & editing, Project administration, Funding acquisition. Acknowledgment This work was supported by the National Natural Science Foundation of China (41371452, 40901264). Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi.org/10.1016/j.envpol.2020.114018. References Abell, G.C.J., Revill, A.T., Smith, C., Bissett, A.P., Volkman, J.K., Robert, S.S., 2009. Archaeal ammonia oxidizers and nirS-type denitrifiers dominate sediment nitrifying and denitrifying populations in a subtropical macrotidal estuary. ISME J. 4, 286. Ahn, J.H., Kwan, T., Chandran, K., 2011. Comparison of partial and full nitrification processes applied for treating high-strength nitrogen wastewaters: microbial ecology through nitrous oxide production. Environ. Sci. Technol. 45, 2734e2740. Broeckling, C.D., Broz, A.K., Bergelson, J., Manter, D.K., Vivanco, J.M., 2008. Root exudates regulate soil fungal community composition and diversity. Appl. Environ. Microbiol. 74, 738e744. Cao, X., Wan, L., Xiao, J., Chen, X., Zhou, Y., Wang, Z., Song, C., 2018. Environmental effects by introducing Potamogeton crispus to recover a eutrophic Lake. Sci. Total Environ. 621, 360e367. Dale, O.R., Tobias, C.R., Song, B., 2009. Biogeographical distribution of diverse anaerobic ammonium oxidizing (anammox) bacteria in Cape Fear River Estuary. Environ. Microbiol. 11, 1194e1207. Francis, C.A., Beman, J.M., Kuypers, M.M.M., 2007. New processes and players in the nitrogen cycle: the microbial ecology of anaerobic and archaeal ammonia oxidation. ISME J. 1, 19e27. Gao, H., Qian, X., Wu, H., Li, H., Pan, H., Han, C., 2017. Combined effects of submerged macrophytes and aquatic animals on the restoration of a eutrophic water bodyda case study of Gonghu Bay, Lake Taihu. Ecol. Eng. 102, 15e23. Guo, Q., Li, N., Bing, Y., Chen, S., Zhang, Z., Chang, S., Chen, Y., Xie, S., 2018. Denitrifier communities impacted by heavy metal contamination in freshwater sediment. Environ. Pollut. 242, 426e432. He, T., Li, Z., Sun, Q., Xu, Y., Ye, Q., 2016. Heterotrophic nitrification and aerobic denitrification by Pseudomonas tolaasii Y-11 without nitrite accumulation during nitrogen conversion. Bioresour. Technol. 200, 493e499. Helen, D., Kim, H., Tytgat, B., Anne, W., 2016. Highly diverse nirK genes comprise two major clades that harbour ammonium-producing denitrifiers. BMC Genomics 17, 155.

9

Hendrickx, T.L.G., Kampman, C., Zeeman, G., Temmink, H., Hu, Z., Kartal, B., Buisman, C.J.N., 2014. High specific activity for anammox bacteria enriched from activated sludge at 10 C. Bioresour. Technol. 163, 214e221.
ndez, M., Dumont, M.G., Yuan, Q., Conrad, R., 2015. Different bacterial popHerna ulations associated with the roots and rhizosphere of rice incorporate plantderived carbon. Appl. Environ. Microbiol. 81, 2244e2253. Hong, Y.-G., Li, M., Cao, H., Gu, J.-D., 2011. Residence of habitat-specific anammox bacteria in the deep-sea subsurface sediments of the south China sea: analyses of marker gene abundance with physical chemical parameters. Microb. Ecol. 62, 36e47. Huang, S., Chen, C., Yang, X., Wu, Q., Zhang, R., 2011. Distribution of typical denitrifying functional genes and diversity of the nirS-encoding bacterial community related to environmental characteristics of river sediments. Biogeosciences 8, 3041e3051. Jung, S.-Y., Lee, M.-H., Oh, T.-K., Yoon, J.-H., 2007. Herbaspirillum rhizosphaerae sp. nov., isolated from rhizosphere soil of Allium victorialis var. platyphyllum. Int. J. Syst. Evol. Microbiol. 57, 2284e2288. Juretschko, S., Gabriele Timmermann, Markus Schmid, Karl-Heinz Schleifer, € ser, Hans-Peter Koops, 1998. Combined Molecular Andreas Pommerening-Ro and Conventional Analyses of Nitrifying Bacterium Diversity in Activated Sludge: Nitrosococcus mobilis and Nitrospira-Like Bacteria as Dominant Populations. Appl. Environ. Microbiol. 64 (8), 3042e3051. Kartal, B., van Niftrik, L., Rattray, J., van de Vossenberg, J.L.C.M., Schmid, M.C., Sin
, J., Jetten, M.S.M., Strous, M., 2008. Candidatus ‘Brocadia fulninghe Damste gida’: an autofluorescent anaerobic ammonium oxidizing bacterium. FEMS (Fed. Eur. Microbiol. Soc.) Microbiol. Ecol. 63, 46e55. Lee, J.A., Francis, C.A., 2017. Spatiotemporal characterization of san francisco bay denitrifying communities: a comparison of nirK and nirS diversity and abundance. Microb. Ecol. 73, 271e284. Li, M., Hong, Y., Cao, H., Gu, J.-D., 2013. Community structures and distribution of anaerobic ammonium oxidizing and nirS-encoding nitrite-reducing bacteria in surface sediments of the south China sea. Microb. Ecol. 66, 281e296. Lin, X., Zhang, Z., Zhang, L., Li, X., 2017. Complete genome sequence of a denitrifying bacterium, Pseudomonas sp. CC6-YY-74, isolated from Arctic Ocean sediment. Mar Genomics 35, 47e49. Ma, B., Wang, S., Cao, S., Miao, Y., Jia, F., Du, R., Peng, Y., 2016. Biological nitrogen removal from sewage via anammox: recent advances. Bioresour. Technol. 200, 981e990. Nie, S.a., Li, H., Yang, X., Zhang, Z., Weng, B., Huang, F., Zhu, G.-B., Zhu, Y.-G., 2015. Nitrogen loss by anaerobic oxidation of ammonium in rice rhizosphere. ISME J. 9, 2059. Nogales, B., Timmis, K.N., Nedwell, D.B., Osborn, A.M., 2002. Detection and diversity of expressed denitrification genes in estuarine sediments after reverse transcription-PCR amplification from mRNA. Appl. Environ. Microbiol. 68, 5017e5025. Oshiki, M., Satoh, H., Okabe, S., 2016. Ecology and physiology of anaerobic ammonium oxidizing bacteria. Environ. Microbiol. 18, 2784e2796. Sato, Y., Ohta, H., Yamagishi, T., Guo, Y., Nishizawa, T., Rahman, M.H., Kuroda, H., Kato, T., Saito, M., Yoshinaga, I., Inubushi, K., Suwa, Y., 2009. Detection of anammox activity and 16S rRNA genes in ravine paddy field soil. Microbes and Environments Advpub, 1202170358-1202170358. Schmid, M.C., Maas, B., Dapena, A., van de Pas-Schoonen, K., van de Vossenberg, J., Kartal, B., van Niftrik, L., Schmidt, I., Cirpus, I., Kuenen, J.G., Wagner, M., Damste, J.S.S., Kuypers, M., Revsbech, N.P., Mendez, R., Jetten, M.S.M., Strous, M., 2005. Biomarkers for in situ detection of anaerobic ammonium-oxidizing (ANAMMOX) bacteria. Appl. Environ. Microbiol. 71, 1677e1684. Schubert, C.J., Durisch-Kaiser, E., Wehrli, B., Thamdrup, B., Lam, P., Kuypers, M.M.M., 2006. Anaerobic ammonium oxidation in a tropical freshwater system (Lake Tanganyika). Environ. Microbiol. 8, 1857e1863. Sonthiphand, P., Hall, M.W., Neufeld, J.D., 2014. Biogeography of anaerobic ammonia-oxidizing (anammox) bacteria. Front. Microbiol. 5.   
, M., Snajdr, 
, H.P.B., 2014. When the Stursov a J., Cajthaml, T., B
arta, J., Santr u ckova forest dies: the response of forest soil fungi to a bark beetle-induced tree dieback. ISME J. 8, 1920e1931. Tang, C.-j., Zheng, P., Mahmood, Q., Chen, J.-w., 2009. Start-up and inhibition analysis of the Anammox process seeded with anaerobic granular sludge. J. Ind. Microbiol. Biotechnol. 36, 1093. Tang, C.-j., Zheng, P., Wang, C.-h., Mahmood, Q., 2010. Suppression of anaerobic ammonium oxidizers under high organic content in high-rate Anammox UASB reactor. Bioresour. Technol. 101, 1762e1768. Wang, B., Huang, S., Zhang, L., Zhao, J., Liu, G., Hua, Y., Zhou, W., Zhu, D., 2018. Diversity of NC10 bacteria associated with sediments of submerged Potamogeton crispus (Alismatales: potmogetonaceae). PeerJ 6, e6041. Throb€ ack, I.N., Enwall, K., Jarvis, Å., Hallin, S., 2004. FEMS Microbiol. Ecol. 49 (3), 401e417. Tsushima, I., Ogasawara, Y., Kindaichi, T., Satoh, H., Okabe, S., 2007. Development of high-rate anaerobic ammonium-oxidizing (anammox) biofilm reactors. Water Res. 41 (8), 1623e1634. Wang, J., Fu, Z., Qiao, H., Liu, F., 2019. Assessment of eutrophication and water quality in the estuarine area of Lake Wuli, Lake Taihu, China. Sci. Total Environ. 650, 1392e1402. Wang, J., Gu, J.-D., 2013a. Dominance of Candidatus Scalindua species in anammox community revealed in soils with different duration of rice paddy cultivation in Northeast China. Appl. Microbiol. Biotechnol. 97, 1785e1798. Wang, Y.-F., Gu, J.-D., 2013b. Higher diversity of ammonia/ammonium-oxidizing

10

J. Hu et al. / Environmental Pollution 260 (2020) 114018

prokaryotes in constructed freshwater wetland than natural coastal marine wetland. Appl. Microbiol. Biotechnol. 97, 7015e7033. Wu, H., Wang, X., He, X., Zhang, S., Liang, R., Shen, J., 2017. Effects of root exudates on denitrifier gene abundance, community structure and activity in a micropolluted constructed wetland. Sci. Total Environ. 598, 697e703. Xu, X., Zhou, Y., Han, R., Song, K., Zhou, X., Wang, G., Wang, Q., 2019. Eutrophication triggers the shift of nutrient absorption pathway of submerged macrophytes: implications for the phytoremediation of eutrophic waters. J. Environ. Manag. 239, 376e384. Yin, X., Lu, J., Wang, Y., Liu, G., Hua, Y., Wan, X., Zhao, J., Zhu, D., 2020. The abundance of nirS-type denitrifiers and anammox bacteria in rhizospheres was affected by the organic acids secreted from roots of submerged macrophytes. Chemosphere 240, 124903. Zhao, D.-Y., Liu, P., Fang, C., Sun, Y.-M., Zeng, J., Wang, J.-Q., Ma, T., Xiao, Y.-H., Wu, Q.L., 2013. Submerged macrophytes modify bacterial community composition in sediments in a large, shallow, freshwater lake. Can. J. Microbiol. 59, 237e244. Zhao, J., Xu, Y., Peng, L., Liu, G., Wan, X., Hua, Y., Zhu, D., Hamilton, D.P., 2019b. Diversity of anammox bacteria and abundance of functional genes for nitrogen

cycling in the rhizosphere of submerged macrophytes in a freshwater lake in summer. J. Soils Sediments 19, 3648e3656. Zhou, S., Borjigin, S., Riya, S., Hosomi, M., 2016. Denitrification-dependent anammox activity in a permanently flooded fallow ravine paddy field. Ecol. Eng. 95, 452e456. Zhou, S., Borjigin, S., Riya, S., Terada, A., Hosomi, M., 2014. The relationship between anammox and denitrification in the sediment of an inland river. Sci. Total Environ. 490, 1029e1036. Zhou, Y., Zhou, X., Han, R., Xu, X., Wang, G., Liu, X., Bi, F., Feng, D., 2017. Reproduction capacity of Potamogeton crispus fragments and its role in water purification and algae inhibition in eutrophic lakes. Sci. Total Environ. 580, 1421e1428. Zhu, G., Jetten, M.S.M., Kuschk, P., Ettwig, K.F., Yin, C., 2010. Potential roles of anaerobic ammonium and methane oxidation in the nitrogen cycle of wetland ecosystems. Appl. Microbiol. Biotechnol. 86, 1043e1055. Zhu, G., Wang, S., Wang, W., Wang, Y., Zhou, L., Jiang, B., Op den Camp, H.J.M., Risgaard-Petersen, N., Schwark, L., Peng, Y., Hefting, M.M., Jetten, M.S.M., Yin, C., 2013. Hotspots of anaerobic ammonium oxidation at landefreshwater interfaces. Nat. Geosci. 6, 103.