- Email: [email protected]
Effects of pre-incubation with C-type natriuretic peptide on nuclear maturation, mitochondrial behavior, and developmental competence of sheep oocytes
Biochemical and Biophysical Research Communications xxx (2018) 1e7
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Effects of pre-incubation with C-type natriuretic peptide on nuclear maturation, mitochondrial behavior, and developmental competence of sheep oocytes Tong Zhang a, Xiaomei Fan b, Ruilan Li a, Chunqiang Zhang a, Jiaxin Zhang a, * a Key Laboratory of Animal Genetics, Breeding and Reproduction, College of Animal Science, Inner Mongolia Agricultural University, Hohhot 010018, Inner Mongolia, China b Basic Medical College, Inner Mongolia Medical University, Hohhot 010110, Inner Mongolia, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 30 January 2018 Accepted 6 February 2018 Available online xxx
In vitro produced mammalian embryos suffer from developmental failure, with a large proportion showing embryonic retardation, degradation, or apoptosis. This failure is due, in part, to incomplete oocyte cytoplasmic maturation. C-type natriuretic peptide (CNP) has been reported to act as a meiotic inhibitor. Here we explored the potential effects of CNP pre-treatment sheep oocytes on nuclear maturation, changes in mitochondrial behavior and developmental competence of in vitro fertilized embryos. Sheep cumuluseoocyte complexes (COCs) were aspirated from abattoir-derived ovaries. Nuclear progression was assessed using DAPI chromatin staining, the expression of natriuretic peptide receptor 2 (NPR2) was evaluated by RT-qPCR, active mitochondria localization was assessed with a confocal laser scanning microscopy using MitoTracker Red, and the developmental competence of sheep oocytes subjected to one-step IVM or two-step IVM with or without CNP pretreatment was also investigated. Our results showed that 200 nM CNP could effectively maintain meiotic arrest of sheep COCs in vitro within 4 h. Furthermore, NPR2 mRNA was mainly expressed in cumulus cells. COCs pretreated with 200 nM CNP for 4 h followed by 24 h IVM showed significantly higher (P < 0.05) cleavage rate and blastocyst rate after in vitro fertilization (IVF), and significantly lower (P < 0.05) proportion of DNA-fragmented nuclei in blastocysts when compared to the conventional 24 h IVM (standard IVM). Non-matured oocytes mainly displayed brilliant circumferential and fine diffuse distribution of mitochondria throughout the cytoplasm. By comparison, 200 nM CNP pre-treated COCs for 4 h led to cytoplasmic mitochondrial granule localization to the peripheral and perinuclear regions. Moreover, oocytes pre-treated with 200 nM CNP for 4 h followed by 24 h IVM, showed mitochondrial organization were similar to those of conventional 24 h matured oocytes in which mitochondria were aggregated more toward the cortical regions of the oocytes, but with larger clumps of stained mitochondria. These results indicate that CNP pre-treatment improves the quality and developmental competence of sheep oocytes and has great potential for facilitating in vitro embryo production. © 2018 Elsevier Inc. All rights reserved.
Keywords: C-type natriuretic peptide Sheep oocyte Meiotic arrest Cytoplasmic maturation Mitochondria
1. Introduction
Abbreviations: cAMP, cyclic adenosine monophosphate; CCs, cumulus cells; cGMP, cyclic guanosine monophosphate; CNP, C-type natriuretic peptide; COCs, cumulus oocyte complexes; DOs, denuded oocytes; GV, germinal vesicle; GVBD, germinal vesicle breakdown; MII, Metaphase-II; MGCs, mural granulosa cells; NPR2, natriuretic peptide receptor 2; PDE3A, phosphodiesterase 3A. * Corresponding author. Department of Animal Genetics, Breeding and Reproduction, College of Animal Science, Inner Mongolia Agricultural University, 306 Zhaowuda Road, Saihan District, Hohhot 010018, China. E-mail address: [email protected] (J. Zhang).
In mammals, oocytes isolated from the natural inhibitory follicular environment spontaneously resume and complete meiotic progression and simultaneously acquire the competence required for fertilization and subsequent embryonic development [1]. However, approximately 50e70% of fertilized oocytes exhibited failure to develop to the blastocyst stage. This low efficiency of embryos produced in vitro has largely been related to the poor quality of oocyte maturation as compared with in vivo counterparts [2]. Moreover, poor oocyte quality results in many potential
https://doi.org/10.1016/j.bbrc.2018.02.054 0006-291X/© 2018 Elsevier Inc. All rights reserved.
Please cite this article in press as: T. Zhang, et al., Effects of pre-incubation with C-type natriuretic peptide on nuclear maturation, mitochondrial behavior, and developmental competence of sheep oocytes, Biochemical and Biophysical Research Communications (2018), https://doi.org/ 10.1016/j.bbrc.2018.02.054
2
T. Zhang et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
complications, including embryo aneuploidy, perturbed genomic imprinting, epigenetic disorders, spontaneous abortion, and fetal malformation [3,4]. Therefore, investigators have attempted to simulate the internal physiological environment for oocyte maturation to determine what factors are optimal for oocyte survival and development. Recently, C-type natriuretic peptide (CNP) has been identified as a meiotic inhibitor that delays meiotic resumption of oocytes in several species, including mice [5,6], pig [7], bovine [8,9], cat [10] and goat [11]. Previous studies have demonstrated that elevated cyclic adenosine monophosphate (cAMP) levels maintain meiotic prophase arrest in oocytes of preovulatory ovarian follicles [12]. Exploration of mouse oocytes has shown that CNP generated by follicular mural granulosa cells (MGCs), binds to the transmembrane guanylyl cyclase natriuretic peptide receptor 2 (NPR2) expressed throughout the follicle to stimulate the generation of cyclic guanosine monophosphate (cGMP). Cyclic GMP is produced by the surrounding granulosa cells, and transferred to the oocyte via gap junctions. Cyclic GMP inhibits the activity of the phosphodiesterase 3A (PDE3A) in the oocyte and cAMP hydrolysis, and maintains meiotic arrest [5,13]. Oocytes maturation is a complex and precisely regulated process involving nuclear and cytoplasmic maturation [14]. Growing evidence has shown the regional redistribution of cytoplasmic mitochondria as determinants of the developmental capacity of mammalian oocytes [15]. Mitochondria play important roles in various biological processes during oocyte in vitro maturation (IVM). In particular, mitochondria are responsible for the generation of ATP, which is required for oocyte maturation and embryogenesis [16]. Whether CNP pre-treatment of sheep oocytes will affect the behavior of mitochondria is still unknown. In vitro embryo production of small ruminants is also a key area of research for studies on assisted reproductive technologies. The objective of this study was to investigate the potential effects of pre-incubation with CNP on nuclear maturation, active mitochondria localization and developmental capacity of sheep oocytes. 2. Materials and methods 2.1. Oocyte collection Sheep ovaries were obtained from a local slaughterhouse and transported to the laboratory within 2e3 h in sterile, pre-warmed (30e35 C) physiological saline containing 1% (v/v) penicillinstreptomycin (Penicillin-Streptomycin; Gibco, Cat. No. 15140-122). COCs were collected after surface puncture of 3e6 mm diameter ovarian follicles. Oocytes with homogeneous cytoplasm and more than three layers of compact cumulus oophorus were retrieved and rinsed three times in Dulbecco phosphate buffered saline (D-PBS; Gibco, Cat. No. 14287-080, Grand Island, NY) supplemented 0.1% (w/v) polyvinyl alcohol (PVA, Sigma, P-8136) and 1% (v/v) penicillin-streptomycin before being transferred to respective treatments. 2.2. CNP pre-treatment and in vitro maturation To determine the effect of CNP pre-treatment sheep oocytes on nuclear meiosis, dose-response and time-dependent effect of CNP pre-treatment on meiotic resumption of sheep oocytes was conducted. C-type natriuretic peptide (Sigma, N-8768) was dissolved in water (Sigma, W-1503) for 20 mM stock solution and stored at 20 C before use. COCs were exposed to a series of concentrations of CNP (0, 50, 100, 200, and 400 nM) for 6 h. To further determine the optimal duration of CNP pre-incubation of oocytes, the COCs were cultured for 0, 2, 4, 6, and 8 h with 200 nM CNP.
Simultaneously, the nuclear maturation of denuded oocytes (DOs) and COCs preincubated with 200 nM CNP for 6 h, as well as the conventional maturation of oocytes for 6 h were also compared. The percentage of oocytes in meiotic arrest at the germinal vesicle (GV) stage was evaluated by using DAPI staining. For the conventional group (one-step IVM method), the COCs were cultured in maturation medium for 24 (standard IVM), 26, or 28 h IVM. For the CNP pre-treatment group (two-step IVM method), COCs were cultured in Medium 199 (with Earle's salts, Lglutamine, and 2.2 g/L sodium bicarbonate; Gibco, 11150-059, Grand Island, NY) supplemented with 0.1% (w/v) fatty acid free bovine serum albumin (BSA, Sigma, A-6003) and 1% (v/v) penicillin-streptomycin and 200 nM CNP for 4 h (CNP 4 h), and then were incubated with maturation medium for 24, 26, or 28 h IVM. As a negative control, COCs were cultured in Medium 199 (with Earle's salts, L-glutamine, and 2.2 g/L sodium bicarbonate; Gibco, 11150059, Grand Island, NY) supplemented with 0.1% (w/v) BSA and 1% (v/v) penicillin-streptomycin for 4 h (NC 4 h), and then were incubated with maturation medium for 24, 26, or 28 h IVM. Approximately 50 COCs were placed in each 4-well culture dish (Nunc cat. no. 176740, Thermo Scientific, Roskilde, Denmark) that contained 600 mL of medium covered with 300 mL of mineral oil (Sigma, M8410), and incubated in a humidified environment containing 5% CO2, 95% air at 38.6 C. The maturation medium consisted of Medium 199 (with Earle's salts, L-glutamine, and 2.2 g/L sodium bicarbonate; Gibco, 11150-059, Grand Island, NY) supplemented 10% (v/v) FBS (Gibco, Cat. No. 10099-141), 10 mg/mL Folltropin-V (FSH; Vetoquinol, Lavaltrie, QC, Canada), 10 mg/mL Lutropin-V (LH; Vetoquinol, Lavaltrie, QC, Canada), 1 mg/mL 17b-estradiol (Sigma, E8875), 100 mM cysteamine (Sigma, M-9768), and 1% (v/v) penicillinstreptomycin. 2.3. Sperm preparation, in vitro fertilization, and in vitro culture Procedures were similar to those previously reported [2,17]. Sheep semen was prepared by a ‘swim-up’ procedure. Briefly, frozen semen was thawed at 39 C for 1 min and layered below 1 mL of fertilization medium consisting of synthetic oviductal fluid (SOF), 20% oestrous sheep serum (OSS) and 6 IU/mL heparin (Sigma, H-4784) in a 10 mL tube. Motile spermatozoa was retrieved from the upper portion after 45 min and separated by centrifugation at 250g for 5 min. The sperm pellet was washed once at 250 g for 5 min using the fertilization medium. Then, the sperm concentration was adjusted to approximately 1 106 spermatozoa/mL. Matured oocytes were partially denuded in 0.1% hyaluronidase by gentle pipetting and transferred into fertilization medium. The oocytes were co-incubated with the spermatozoa for 20 h in a 38.6 C humidified 5% CO2 incubator. Denuded and presumptive zygotes were transferred to SOF supplemented with 1% (v/v) BME-essential amino acids, 1% (v/v) MEM-nonessential amino acids, 1 mM glutamine and 3 mg/mL of BSA and cultured at 38.6 C in a humidified environment with a 90% N2, 5% CO2, 5% O2 atmosphere. The cleavage rate was recorded at 48 h, and the blastocyst rate and total blastocyst cell counts were recorded on day 7 after IVF. 2.4. Assessment of oocyte meiotic progression Oocyte meiotic status was assessed according to the method previously described [18]. The cumulus oophorus was mechanically removed from oocytes using a Vortex in 0.1% hyaluronidase and then fixing in 4% paraformaldehyde (PFA) for 15 min at room temperature. Thereafter, fixed oocytes were incubated in 1 mg/mL 40 , 6-diamidino-2-phenylindole (DAPI) solution for 10 min. Oocytes were washed in 0.01% (w/v) BSA in PBS, and mounted on a slide
Please cite this article in press as: T. Zhang, et al., Effects of pre-incubation with C-type natriuretic peptide on nuclear maturation, mitochondrial behavior, and developmental competence of sheep oocytes, Biochemical and Biophysical Research Communications (2018), https://doi.org/ 10.1016/j.bbrc.2018.02.054
T. Zhang et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
with antifade. Chromosome configurations were assessed using an €ttingen, Germany) Axio Imager A2 (Carl Zeiss Microscopy GmbH, Go fluorescence microscopy (DAPI, Ex: 365 nm, Em: 445 nm). Chromatin configurations were classified as follows (Fig. 1a): immature or germinal vesicle (GV), when the vesicle was clearly visible; resumption of meiosis or germinal vesicle break down (GVBD), when the chromatin was dispersed and initiating condensation; metaphase Ⅱ (MⅡ) stages were identified by the presence of an extruded polar body. 2.5. Total RNA extraction and cDNA synthesis Mural granulosa cells were isolated from follicular fluid of sheep ovary and cumulus cells were obtained by mechanically removed from COCs using a Vortex. Total RNA was extracted from each sample using Trizol Reagent (Takara, Dalian, China). The quality of isolated RNA was verified by measuring the absorbance at 260 and 280 nm and evaluating integrity by 2% agarose gel electrophoresis simultaneously. RNA samples were immediately used for the cDNA synthesis reaction. Reverse transcription polymerase chain reaction (RT-PCR) was performed using the PrimeScript® RT reagent Kit with gDNA Eraser (Takara, Dalian, China) according to the
3
manufacturer's procedure. 2.6. Real-time PCR mRNA quantification To quantify expression of NPR2 mRNA, the sequence-specific primers were designed and synthesized by Shanghai Generay Biotech Co. Ltd. b-actin mRNA was quantified in parallel as a reference gene. Primer sequences were as follows: AGAGCACGGGAGGATTTTGG (NPR2: F), AACGACCAGTCCAGTCACAC (NPR2: R). GTCATCACCATCGGCA ATGA (b-actin: F), CGTGAATGCCGCAGGATT (b-actin: R). The PCR product sizes for NPR2 and b-actin were 198 bp and 88 bp, respectively. RT-qPCR was performed using the SYBR® Premix Ex Taq™ (Takara, Dalian, China). The amplification program was as follows: 40 cycles at 94 C for 5 s, 62 C for 20 s, and 72 C for 15 s, and additional extension at 72 C for 5 min. Negative control reactions lacking template DNA were run in parallel. Relative gene expression was calculated by the 2DDCt method. 2.7. TUNEL assay The apoptotic status of blastocysts were assessed using a combined technique for simultaneous terminal deoxynucleotidyl
Fig. 1. Dose-response and time-dependent effect of CNP pre-treatment on meiotic resumption of sheep oocytes. a Different maturation stages of the sheep oocyte. (A) Germinal vesicle (GV): chromosome shows the dispersion state and large size of the nucleus. (B) Germinal vesicle breakdown (GVBD): chromatin condensation and smaller volume nucleus. (C) Metaphase II (MII): oocytes with visible first polar body extrusion. Red circles mark the karyoplasts; scale bar, 30 mm b The percentage of GV-stage oocytes was assessed after pre-treatment of COCs for 6 h with various concentrations (0, 50, 100, 200, and 400 nM) of CNP. c The percentage of GV-stage oocytes was assessed after pre-treatment of COCs with 200 nM CNP for different time (0, 2, 4, 6, and 8 h). d Effect of 200 nM CNP pre-treatment for 6 h on GV-stage arrest rate of denuded oocytes (DOs) or cumulus oocyte complexes (COCs). All values are represented as mean ± SEM of three replicate experiments. Asterisk indicates signifcant difference; *P < 0.05, **P < 0.01 and ***P < 0.001. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
Please cite this article in press as: T. Zhang, et al., Effects of pre-incubation with C-type natriuretic peptide on nuclear maturation, mitochondrial behavior, and developmental competence of sheep oocytes, Biochemical and Biophysical Research Communications (2018), https://doi.org/ 10.1016/j.bbrc.2018.02.054
4
T. Zhang et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
transferase mediated UTP nick end labeling (TUNEL, In Situ Cell Death Detection Kit, Fluorescein, Roche Applied Science, Mannheim, Germany) and propidium iodide (PI) nuclear staining modified from the procedures previously described [19]. Briefly, blastocysts were fixed with 4% PFA in PBS for 1 h at room temperature. Fixed blastocysts were permeabilized in 0.5% (v/v) TritonX100 diluted in PBS for 40 min at room temperature. Permeabilised blastocysts were incubated overnight at 4 C in PBS containing 10 mg/mL BSA. The blastocysts were subsequently incubated in the TUNEL mixture (deoxynucleotidyl transferase enzyme and fluorescein-dUTP in a 1: 9 ratio) for 1 h at 37 C in the dark. After TUNEL staining, the blastocysts were counterstained with 5 mg/mL PI for 40 min at 37 C. Labeled blastocysts were mounted on a glass slide and imaged using a Zeiss Imager A2 fluorescence microscope (TUNEL, Ex: 499 nm, Em: 520 nm; PI, Ex: 537 nm, Em: 619 nm). The proportion of DNA fragmentation in blastocysts was calculated by dividing the number of cells containing DNA-fragmented nuclei by the total number of blastocyst cells. 2.8. Mitochondrial staining Sheep COCs were denuded in 0.1% hyaluronidase by vortexing. The denuded oocytes were stained with 500 nM MitoTracker Red CMX Ros (Cat #M7512, Invitrogen, USA) for 30 min in fresh PBS at 38.6 C under 5% CO2 in air. Thereafter, oocytes were washed three times in PBS buffer with 0.01% PVA, and then fixed in 4% (w/v) PFA diluted with PBS for 15 min at room temperature. Nuclei were stained with 1 mg/mL DAPI for 10 min then washed in PBS/PVA. Stained oocytes were transferred to a 35-mm confocal dish and observed under the Olympus FluoView FV10i confocal laser scanning microscope system (Olympus, Tokyo, Japan). Each oocyte was captured in the middle of the focal plane to detect DAPI (Ex: 359 nm, Em: 461 nm) and MitoTracker Red (Ex: 578 nm; Em: 598 nm). Image analysis was performed using FV10-ASW 4.2 Viewer software (Olympus, Tokyo, Japan). 2.9. Statistical analysis Data are represented as the mean ± SEM. Statistical significance was analyzed by ANOVA using SPSS software (SPSS Inc. Chicago, IL) followed by student-Newman-Keuls test. Differences between means were considered statistically significant when P < 0.05. 3. Results 3.1. CNP pre-incubation of COCs delayed meiotic resumption Germinal vesicle breakdown (GVBD) is a significant indicator of resumption of meiosis in oocytes (Fig. 1a). Our results showed that pre-incubation of COCs with 200 nM and 400 nM CNP for 6 h experienced a significant (P < 0.001) arrest in GV stage (56.8 ± 4.4%, 57.5 ± 2.9%) more than 0, 50, and 100 nM CNP (9.0 ± 1.8%, 22.6 ± 2.8% and 28.4 ± 4.6%). But there was no significant difference observed between 200 nM and 400 nM CNP pre-incubation on the efficiency of meiotic inhibition of oocytes (P > 0.05) (Fig. 1b). As shown in Fig. 1c, we found that 200 nM CNP could effectively maintain meiotic arrest of sheep COCs cultured in vitro within 4 h and the inhibition efficiency decreased significantly after 4 h. In addition, the percentage of COCs arrested in the GV stage was significantly higher (P < 0.001) when pre-treated with 200 nM CNP for 6 h (59.2 ± 5.2%) compared with DOs pre-treated with 200 nM CNP for 6 h (13.3 ± 3.3%) or the control group (8.3 ± 2.1%) (Fig. 1d).
3.2. NPR2 expression NPR2 mRNA levels were measured in mural granulosa cells (MGCs) and cumulus cells (CCs) by RT-qPCR. The relative abundance of NPR2 mRNA was significantly higher in CCs than MGCs (P < 0.05; Fig. 2). 3.3. CNP pre-incubation improved the developmental competence of sheep oocytes Based on the dose response experiment, we pre-treated COCs with or without 200 nM CNP for 4 h, followed by 24, 26 or 28 h IVM as well as the conventional 24, 26 or 28 h IVM, to observe the developmental competence of sheep oocytes. As shown in Table 1, oocytes pre-incubated with 200 nM CNP for 4 h followed by 24 h IVM exhibited significantly higher (P < 0.05) cleavage rate and blastocyst formation of IVF embryos than those of conventionally matured oocytes and negative control oocytes. 200 nM CNP pretreated COCs for 4 h followed by 26 h IVM displayed a very similar (P > 0.05) development outcomes to that of 200 nM CNP pre-treated COCs for 4 h followed by 24 h IVM, but the blastocyst formation of COCs pre-treated with 200 nM CNP for 4 h followed by 28 h IVM significantly decreased (P < 0.05). However, the blastocyst cell number of COCs pre-treated with 200 nM CNP for 4 h followed by 24 or 26 h IVM were similar to that of conventional 24 h IVM (P > 0.05) (Table 1). 3.4. Apoptosis in blastocysts To evaluate the quality of blastocysts, we investigated the presence of DNA-fragmented nuclei in blastocysts derived from oocytes matured by one-step method or two-step method with or without CNP pretreatment. As shown in Table 2, oocytes preincubated with 200 nM CNP for 4 h followed by 24 h IVM exhibited a significantly lower (P < 0.05) proportion of DNA-fragmented nuclei in blastocysts than those of oocytes from conventional 24, 26, or 28 h IVM and other experimental groups. These results suggested that oocytes pre-treated with 200 nM CNP for 4 h followed by 24 IVM was superior to other treatments and significantly improved the quality of blastocysts. 3.5. Changes in mitochondrial behavior DOs were stained by MitoTracker Red and DAPI to visualize the mitochondria and nucleus, respectively. Representative photomicrographs of mitochondrial localization and nuclear morphology are shown in Fig. 3. In the control group, the overwhelming majority of immature oocytes exhibited a peripheral and fine diffuse mitochondrial distribution (Fig. 3. A3). However, fully matured oocytes showed clustered distribution with small clumps surrounding the cortical regions (Fig. 3. B3). Aggregation of the cytoplasmic mitochondrial granules in the pericytoplasmic and perinuclear regions was observed in a great deal of oocytes pre-treated with 200 nM CNP for 4 h with the nucleus in the germinal vesicle (GV) stage (Fig. 3. C3). Oocytes pretreated with 200 nM CNP for 4 h followed by 24 h IVM exhibited a clustered mitochondrial distribution that corresponded to the conventional 24 h matured oocytes. However, larger clumps were observed with even more stained mitochondria (Fig. 3. D3). These results suggested that CNP pre-treatment improved the mitochondrial activity of sheep oocytes. 4. Discussion The aim of this study was to synchronize the maturation of
Please cite this article in press as: T. Zhang, et al., Effects of pre-incubation with C-type natriuretic peptide on nuclear maturation, mitochondrial behavior, and developmental competence of sheep oocytes, Biochemical and Biophysical Research Communications (2018), https://doi.org/ 10.1016/j.bbrc.2018.02.054
T. Zhang et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
5
Fig. 2. Quantification by real-time PCR analysis of the expression of NPR2 receptor mRNA in MGCs and CCs. a NPR2 mRNAs were detected in mural granulosa cells and cumulus cells. b NPR2 mRNA abundance was significantly (P < 0.05) higher in CCs than in MGCs. Asterisk indicates signifcant difference; *P < 0.05.
Table 1 Effect of CNP pretreatment on developmental capacity of sheep IVF embryos. Treatment 24 h IVM (Standard IVM) 26 h IVM 28 h IVM NC 4 h þ 24 h IVM NC 4 h þ 26 h IVM NC 4 h þ 28 h IVM CNP 4 h þ 24 h IVM CNP 4 h þ 26 h IVM CNP 4 h þ 28 h IVM
No. of examined oocytes 312 216 253 262 232 209 304 286 303
No. of Cleavage (%) 239 168 185 217 172 151 277 249 248
a
(76.28 ± 3.49) (78.15 ± 2.91)a (73.30 ± 3.08)a (82.44 ± 2.02)b (74.19 ± 4.34)a (72.53 ± 5.31)a (90.79 ± 2.38)c (86.36 ± 4.24)b,c (82.17 ± 2.31)b
No. of Blastocyst (%) a
79 (33.19 ± 2.26) 49 (29.39 ± 4.27)a 36 (19.63 ± 2.49)b 62 (28.70 ± 2.54)a 33 (19.14 ± 3.17)b 16 (10.72 ± 2.18)c 132 (47.29 ± 4.27)d 110 (44.53 ± 2.15)d 29 (11.65 ± 3.23)c
No. of Blastocyst cells 115.38 ± 10.57a,b 104.05 ± 8.63a,b 107.52 ± 9.36a,b 112.53 ± 9.83a,b 110.82 ± 8.94a,b 99.23 ± 5.32b 121.63 ± 13.71a 117.83 ± 9.74a 95.43 ± 8.39b
Data are expressed as mean ± SEM of three replicate experiments. Values with different superscript letters (a, b, c, d) within the same column are significantly different (P < 0.05).
Table 2 TUNEL analysis of blastocyst apoptotic rate. Treatment
Number of examined embryos
DNA-fragmented nuclei (%)a in blastocyst
24 h IVM (Standard IVM) 26 h IVM 28 h IVM NC 4 h þ 24 h IVM NC 4 h þ 26 h IVM NC 4 h þ 28 h IVM CNP 4 h þ 24 h IVM CNP 4 h þ 26 h IVM CNP 4 h þ 28 h IVM
65 43 36 52 39 33 83 78 46
16.2 ± 6.4a 16.7 ± 8.3a 19.4 ± 5.2a 14.7 ± 5.8a 19.4 ± 4.3a 23.8 ± 6.9a 6.6 ± 2.8b 19.8 ± 9.3a 17.8 ± 8.7a
Values with different superscript letters (a, b) within the same column are significantly different (P < 0.05). a Percentages are expressed as mean ± SEM of three replicate experiments.
nuclear and cytoplasm by the application of CNP pre-incubation of sheep oocytes. Previous studies have demonstrated that CNP maintains meiotic arrest in many species, but the potential role of CNP on sheep oocytes has not yet been reported. Utilizing this meiosis inhibitor, we observed significantly greater improvement in oocyte developmental competence in sheep oocytes. Inhibition of meiotic resumption is an approach used to promote the synchronization of nuclear and cytoplasmic maturation [10,11]. In our study, various concentrations of CNP were added to the pre-incubation medium without the addition of any hormone component. Our results indicated that 200 nM CNP could effectively inhibit meiotic resumption of sheep oocytes cultured in vitro within 4 h. Previous studies reported that CNP binding to its receptor NPR2 played a functional role in maintaining the arrest of meiosis [5,20]. The present study showed that CCs had significantly higher levels of NPR2 mRNA compared with MGCs. Consistent with our results, recent studies (mouse [5], cat [10]) also showed that NPR2 mRNA was predominantly expressed in CCs rather than in
MGCs. In addition, COCs or DOs were cultured with CNP, the inhibitory effect was observed in the COCs group, but not in the DOs group, confirming that CNP indirectly inhibits GVBD via cumulus cells. This evidence also indicates that the CNP-NPR2 pathway is involved in meiotic arrest in sheep oocytes. Based on the established CNP pre-treatment strategy, the IVF embryos cleavage rate, blastocyst rate as well as blastocyst cell number were investigated to evaluate the impact of CNP preincubation on developmental competence of sheep oocytes. Compared with the conventional one-step maturation method (24, 26, or 28 h IVM) and other experimental groups, 200 nM CNP pretreatment of oocytes for 4 h followed by 24 or 26 h IVM resulted in a significantly increased cleavage rate and blastocyst formation rate (P < 0.05). Similar discoveries have been reported in other animals (cat [10], goat [11]). In addition, DNA fragmentation of embryos, a biochemical hallmark of apoptosis, can be used to reflect the quality of blastocyst [21]. Our result showed that oocytes pre-treated with 200 nM CNP for 4 h followed by 24 h IVM reduced the proportion of
Please cite this article in press as: T. Zhang, et al., Effects of pre-incubation with C-type natriuretic peptide on nuclear maturation, mitochondrial behavior, and developmental competence of sheep oocytes, Biochemical and Biophysical Research Communications (2018), https://doi.org/ 10.1016/j.bbrc.2018.02.054
6
T. Zhang et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
Fig. 3. CNP pretreatment sheep oocytes improve the activity of mitochondria. All images were acquired in the middle of the focal plane. Bright field images indicate oocytes contours and morphology (A1-A4) with mitochondrial localization labeled by MitoTracker Red (B1-B4), nuclear morphology stained by DAPI (C1-C4), and mitochondrial/nuclear merged images (D1-D4). In the control group (C1-C2), mitochondria mainly presented as a brilliant peripheral and fine diffuse distribution pattern throughout the cytoplasm at the germinal vesicle stage (Non-matured, C1), while mitochondria with clumps were aggregated more toward the cortical regions after IVM (24 h IVM, C2). In the CNP pre-treatment group (C3-C4), most of the cytoplasmic mitochondrial granules were localized in the pericytoplasmic and perinuclear regions (CNP 4 h, C3); mitochondria localization was similar to the conventionally matured oocytes (CNP 4 h þ 24 h IVM, C4). Yellow arrows mark the peripheral region, the yellow box marks the perinuclear region, and the blue arrows label the first polar body. The scale bar represents 40 mm. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
DNA-fragmented nuclei in blastocysts compared with blastocysts from conventional 24, 26, or 28 h IVM and other experimental groups. Therefore, the increase in blastocyst formation was possibly due to improved oocyte maturation quality. Cytoplasmic maturation is an indispensable part of oocyte maturation, which involves the redistribution of cytoplasmic organelles and the accumulation of the mRNAs and proteins necessary for early development before the onset of embryonic transcription [14,22]. Therefore, CNP applied in vitro may be able to guarantee the synchronous maturation of oocyte nuclear and cytoplasm. Mitochondria are the richest cellular organelles in mammalian oocytes, involved in crucial events of oocyte maturation and embryonic development [16]. Evaluation of mitochondrial activity reveals the relationship between energy demand and oogenesis or early embryogenesis [23,24]. In this study, we found that sheep oocyte mitochondrial distribution changed significantly during IVM. Therefore, specific patterns of mitochondrial localization in oocytes are consistent with the developmental needs of oocytes. In the control group, a pattern of brilliant peripheral and fine diffuse distribution of mitochondria was observed mainly in immature
oocytes. This pattern was observed in immature oocytes in others species [25] as well. However, mitochondria were aggregated more toward the cortical regions, forming clumps after IVM. Interestingly, cytoplasmic mitochondrial granules of oocytes pre-treated with 200 nM CNP for 4 h were localized to the pericytoplasmic and perinuclear regions. Under the inhibited state of oocyte nuclei in GV stage, this change in mitochondrial distribution may be due to the higher requirement prepared for cytoplasmic metabolism and energy storage within oocytes. In oocytes pre-treated with 200 nM CNP for 4 h followed by 24 h IVM, mitochondrial distribution was similar to that of the conventional one-step matured oocytes; however, larger clumps were observed. This result indicated that higher numbers of active mitochondria accumulated in the cytoplasm when sheep oocytes were pre-treated with CNP followed by IVM. Changes in mitochondrial distribution represent the process of oocyte-acquired cytoplasmic maturation. Stage-specific mitochondrial distribution in the oocyte can meet the higher energy requirement to support cytoplasmic remodeling processes, such as assembly of the cytoskeleton, molecular and protein synthesis, and kinetic activities associated with nuclear maturation
Please cite this article in press as: T. Zhang, et al., Effects of pre-incubation with C-type natriuretic peptide on nuclear maturation, mitochondrial behavior, and developmental competence of sheep oocytes, Biochemical and Biophysical Research Communications (2018), https://doi.org/ 10.1016/j.bbrc.2018.02.054
T. Zhang et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
[15,25]. These effects showed that CNP pretreatment facilitated the synchronous maturation between the nuclear and cytoplasm by prolonging the cytoplasmic maturation time, especially the activity of mitochondria. In summary, our results demonstrated that pre-incubation of sheep oocytes with CNP not only inhibited meiotic resumption, but also improved the subsequent developmental competence of oocytes. Therefore, our two-step IVM system, using the nonpharmacologic meiotic inhibitor CNP, serves as an effective method to further enhance developmental potential of sheep oocyte in vitro.
[9]
[10] [11]
[12]
[13]
Conflicts of interest [14]
The authors declare that they have no competing interests. [15]
Acknowledgements This work was supported by the National Natural Science Foundation of China (No. 31460598). References [1] M. Buell, J.L. Chitwood, P.J. Ross, cAMP modulation during sheep in vitro oocyte maturation delays progression of meiosis without affecting oocyte parthenogenetic developmental competence, Anim. Reprod. Sci. 154 (2015) 16e24. , D. Izquierdo, M. Rodríguez-Prado, et al., Effect of oocyte quality on [2] M.G. Catala blastocyst development after in vitro fertilization (IVF) and intracytoplasmic sperm injection (ICSI) in a sheep model, Fertil. Steril. 97 (2012) 1004e1008. [3] Z. Song, L. Min, Q. Pan, et al., Maternal imprinting during mouse oocyte growth in vivo and in vitro, Biochem. Biophys. Res. Commun. 387 (2009) 800e805. [4] R. Urrego, N. Rodriguez-Osorio, H. Niemann, Epigenetic disorders and altered gene expression after use of assisted reproductive technologies in domestic cattle, Epigenetics 9 (2014) 803e815. [5] M. Zhang, Y.Q. Su, K. Sugiura, et al., Granulosa cell ligand NPPC and its receptor NPR2 maintain meiotic arrest in mouse oocytes, Science 330 (2010) 366e369. [6] Q. Wei, C. Zhou, M. Yuan, et al., Effect of C-type natriuretic peptide on maturation and developmental competence of immature mouse oocytes in vitro, Reprod. Fertil. Dev. 29 (2017) 319e324. [7] Y. Hiradate, Y. Hoshino, K. Tanemura, et al., C-type natriuretic peptide inhibits porcine oocyte meiotic resumption, Zygote 22 (2014) 372e377. [8] F. Franciosi, G. Coticchio, V. Lodde, et al., Natriuretic peptide precursor C
[16] [17]
[18]
[19] [20]
[21]
[22] [23] [24] [25]
7
delays meiotic resumption and sustains gap junction-mediated communication in bovine cumulus-enclosed Oocytes1, Biol. Reprod. 91 (2014) 1e9. T. Zhang, C. Zhang, X. Fan, et al., Effect of C-type natriuretic peptide pretreatment on in vitro bovine oocyte maturation, In Vitro Cell. Dev. Biol. Anim. 53 (2017) 199e206. Y. Zhong, J. Lin, X. Liu, et al., C-Type natriuretic peptide maintains domestic cat oocytes in meiotic arrest, Reprod. Fertil. Dev. 28 (2016) 1553e1559. J. Zhang, Q. Wei, J. Cai, et al., Effect of C-Type natriuretic peptide on maturation and developmental competence of goat oocytes matured in vitro, PLoS One 10 (2015), e0132318. R.P. Norris, W.J. Ratzan, M. Freudzon, et al., Cyclic GMP from the surrounding somatic cells regulates cyclic AMP and meiosis in the mouse oocyte, Development 136 (2009) 1869e1878. J.W. Robinson, M. Zhang, L.C. Shuhaibar, et al., Luteinizing hormone reduces the activity of the NPR2 guanylyl cyclase in mouse ovarian follicles, contributing to the cyclic GMP decrease that promotes resumption of meiosis in oocytes, Dev. Biol. 366 (2012) 308e316. E.M. Ferreira, A.A. Vireque, P.R. Adona, et al., Cytoplasmic maturation of bovine oocytes: structural and biochemical modifications and acquisition of developmental competence, Theriogenology 71 (2009) 836e848. K.H. Choi, S.H. Hong, H.R. Lee, et al., Neogenin regulates mitochondrial activity in pre-implantation mouse embryos, Biochem. Biophys. Res. Commun. 482 (2017) 1060e1066. E. Babayev, E. Seli, Oocyte mitochondrial function and reproduction, Curr. Opin. Obstet. Gynecol. 27 (2015) 175e181. J. Zhang, T.L. Nedambale, M. Yang, et al., Improved development of ovine matured oocyte following solid surface vitrification (SSV): effect of cumulus cells and cytoskeleton stabilizer, Anim. Reprod. Sci. 110 (2009) 46e55. M.D. los Reyes, J. Palomino, V.H. Parraguez, et al., Mitochondrial distribution and meiotic progression in canine oocytes during in vivo and in vitro maturation, Theriogenology 75 (2011) 346e353. C. Matwee, D.H. Betts, W.A. King, Apoptosis in the early bovine embryo, Zygote 8 (2000) 57e68. M. Conti, M. Hsieh, A. Musa Zamah, et al., Novel signaling mechanisms in the ovary during oocyte maturation and ovulation, Mol. Cell. Endocrinol. 356 (2012) 65e73. T. Takahashi, H. Igarashi, M. Amita, et al., Molecular mechanism of poor embryo development in postovulatory aged oocytes: mini review, J. Obstet. Gynaecol. Res. 39 (2013) 1431e1439. A.J. Watson, Oocyte cytoplasmic maturation: a key mediator of oocyte and embryo developmental competence, J. Anim. Sci. 85 (2007) E1eE3. B.D. Bavister, J.M. Squirrell, Mitochondrial distribution and function in oocytes and early embryos, Hum. Reprod. 15 (Suppl 2) (2000) 189e198. Q. Wang, Q.Y. Sun, Evaluation of oocyte quality: morphological, cellular and molecular predictors, Reprod. Fertil. Dev. 19 (2007) 1e12. U. Eichenlaub-Ritter, M. Wieczorek, S. Lüke, et al., Age related changes in mitochondrial function and new approaches to study redox regulation in mammalian oocytes in response to age or maturation conditions, Mitochondrion 11 (2011) 783e796.
Please cite this article in press as: T. Zhang, et al., Effects of pre-incubation with C-type natriuretic peptide on nuclear maturation, mitochondrial behavior, and developmental competence of sheep oocytes, Biochemical and Biophysical Research Communications (2018), https://doi.org/ 10.1016/j.bbrc.2018.02.054
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Effects of pre-incubation with C-type natriuretic peptide on nuclear maturation, mitochondrial behavior, and developmental competence of sheep oocytes Tong Zhang a, Xiaomei Fan b, Ruilan Li a, Chunqiang Zhang a, Jiaxin Zhang a, * a Key Laboratory of Animal Genetics, Breeding and Reproduction, College of Animal Science, Inner Mongolia Agricultural University, Hohhot 010018, Inner Mongolia, China b Basic Medical College, Inner Mongolia Medical University, Hohhot 010110, Inner Mongolia, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 30 January 2018 Accepted 6 February 2018 Available online xxx
In vitro produced mammalian embryos suffer from developmental failure, with a large proportion showing embryonic retardation, degradation, or apoptosis. This failure is due, in part, to incomplete oocyte cytoplasmic maturation. C-type natriuretic peptide (CNP) has been reported to act as a meiotic inhibitor. Here we explored the potential effects of CNP pre-treatment sheep oocytes on nuclear maturation, changes in mitochondrial behavior and developmental competence of in vitro fertilized embryos. Sheep cumuluseoocyte complexes (COCs) were aspirated from abattoir-derived ovaries. Nuclear progression was assessed using DAPI chromatin staining, the expression of natriuretic peptide receptor 2 (NPR2) was evaluated by RT-qPCR, active mitochondria localization was assessed with a confocal laser scanning microscopy using MitoTracker Red, and the developmental competence of sheep oocytes subjected to one-step IVM or two-step IVM with or without CNP pretreatment was also investigated. Our results showed that 200 nM CNP could effectively maintain meiotic arrest of sheep COCs in vitro within 4 h. Furthermore, NPR2 mRNA was mainly expressed in cumulus cells. COCs pretreated with 200 nM CNP for 4 h followed by 24 h IVM showed significantly higher (P < 0.05) cleavage rate and blastocyst rate after in vitro fertilization (IVF), and significantly lower (P < 0.05) proportion of DNA-fragmented nuclei in blastocysts when compared to the conventional 24 h IVM (standard IVM). Non-matured oocytes mainly displayed brilliant circumferential and fine diffuse distribution of mitochondria throughout the cytoplasm. By comparison, 200 nM CNP pre-treated COCs for 4 h led to cytoplasmic mitochondrial granule localization to the peripheral and perinuclear regions. Moreover, oocytes pre-treated with 200 nM CNP for 4 h followed by 24 h IVM, showed mitochondrial organization were similar to those of conventional 24 h matured oocytes in which mitochondria were aggregated more toward the cortical regions of the oocytes, but with larger clumps of stained mitochondria. These results indicate that CNP pre-treatment improves the quality and developmental competence of sheep oocytes and has great potential for facilitating in vitro embryo production. © 2018 Elsevier Inc. All rights reserved.
Keywords: C-type natriuretic peptide Sheep oocyte Meiotic arrest Cytoplasmic maturation Mitochondria
1. Introduction
Abbreviations: cAMP, cyclic adenosine monophosphate; CCs, cumulus cells; cGMP, cyclic guanosine monophosphate; CNP, C-type natriuretic peptide; COCs, cumulus oocyte complexes; DOs, denuded oocytes; GV, germinal vesicle; GVBD, germinal vesicle breakdown; MII, Metaphase-II; MGCs, mural granulosa cells; NPR2, natriuretic peptide receptor 2; PDE3A, phosphodiesterase 3A. * Corresponding author. Department of Animal Genetics, Breeding and Reproduction, College of Animal Science, Inner Mongolia Agricultural University, 306 Zhaowuda Road, Saihan District, Hohhot 010018, China. E-mail address: [email protected] (J. Zhang).
In mammals, oocytes isolated from the natural inhibitory follicular environment spontaneously resume and complete meiotic progression and simultaneously acquire the competence required for fertilization and subsequent embryonic development [1]. However, approximately 50e70% of fertilized oocytes exhibited failure to develop to the blastocyst stage. This low efficiency of embryos produced in vitro has largely been related to the poor quality of oocyte maturation as compared with in vivo counterparts [2]. Moreover, poor oocyte quality results in many potential
https://doi.org/10.1016/j.bbrc.2018.02.054 0006-291X/© 2018 Elsevier Inc. All rights reserved.
Please cite this article in press as: T. Zhang, et al., Effects of pre-incubation with C-type natriuretic peptide on nuclear maturation, mitochondrial behavior, and developmental competence of sheep oocytes, Biochemical and Biophysical Research Communications (2018), https://doi.org/ 10.1016/j.bbrc.2018.02.054
2
T. Zhang et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
complications, including embryo aneuploidy, perturbed genomic imprinting, epigenetic disorders, spontaneous abortion, and fetal malformation [3,4]. Therefore, investigators have attempted to simulate the internal physiological environment for oocyte maturation to determine what factors are optimal for oocyte survival and development. Recently, C-type natriuretic peptide (CNP) has been identified as a meiotic inhibitor that delays meiotic resumption of oocytes in several species, including mice [5,6], pig [7], bovine [8,9], cat [10] and goat [11]. Previous studies have demonstrated that elevated cyclic adenosine monophosphate (cAMP) levels maintain meiotic prophase arrest in oocytes of preovulatory ovarian follicles [12]. Exploration of mouse oocytes has shown that CNP generated by follicular mural granulosa cells (MGCs), binds to the transmembrane guanylyl cyclase natriuretic peptide receptor 2 (NPR2) expressed throughout the follicle to stimulate the generation of cyclic guanosine monophosphate (cGMP). Cyclic GMP is produced by the surrounding granulosa cells, and transferred to the oocyte via gap junctions. Cyclic GMP inhibits the activity of the phosphodiesterase 3A (PDE3A) in the oocyte and cAMP hydrolysis, and maintains meiotic arrest [5,13]. Oocytes maturation is a complex and precisely regulated process involving nuclear and cytoplasmic maturation [14]. Growing evidence has shown the regional redistribution of cytoplasmic mitochondria as determinants of the developmental capacity of mammalian oocytes [15]. Mitochondria play important roles in various biological processes during oocyte in vitro maturation (IVM). In particular, mitochondria are responsible for the generation of ATP, which is required for oocyte maturation and embryogenesis [16]. Whether CNP pre-treatment of sheep oocytes will affect the behavior of mitochondria is still unknown. In vitro embryo production of small ruminants is also a key area of research for studies on assisted reproductive technologies. The objective of this study was to investigate the potential effects of pre-incubation with CNP on nuclear maturation, active mitochondria localization and developmental capacity of sheep oocytes. 2. Materials and methods 2.1. Oocyte collection Sheep ovaries were obtained from a local slaughterhouse and transported to the laboratory within 2e3 h in sterile, pre-warmed (30e35 C) physiological saline containing 1% (v/v) penicillinstreptomycin (Penicillin-Streptomycin; Gibco, Cat. No. 15140-122). COCs were collected after surface puncture of 3e6 mm diameter ovarian follicles. Oocytes with homogeneous cytoplasm and more than three layers of compact cumulus oophorus were retrieved and rinsed three times in Dulbecco phosphate buffered saline (D-PBS; Gibco, Cat. No. 14287-080, Grand Island, NY) supplemented 0.1% (w/v) polyvinyl alcohol (PVA, Sigma, P-8136) and 1% (v/v) penicillin-streptomycin before being transferred to respective treatments. 2.2. CNP pre-treatment and in vitro maturation To determine the effect of CNP pre-treatment sheep oocytes on nuclear meiosis, dose-response and time-dependent effect of CNP pre-treatment on meiotic resumption of sheep oocytes was conducted. C-type natriuretic peptide (Sigma, N-8768) was dissolved in water (Sigma, W-1503) for 20 mM stock solution and stored at 20 C before use. COCs were exposed to a series of concentrations of CNP (0, 50, 100, 200, and 400 nM) for 6 h. To further determine the optimal duration of CNP pre-incubation of oocytes, the COCs were cultured for 0, 2, 4, 6, and 8 h with 200 nM CNP.
Simultaneously, the nuclear maturation of denuded oocytes (DOs) and COCs preincubated with 200 nM CNP for 6 h, as well as the conventional maturation of oocytes for 6 h were also compared. The percentage of oocytes in meiotic arrest at the germinal vesicle (GV) stage was evaluated by using DAPI staining. For the conventional group (one-step IVM method), the COCs were cultured in maturation medium for 24 (standard IVM), 26, or 28 h IVM. For the CNP pre-treatment group (two-step IVM method), COCs were cultured in Medium 199 (with Earle's salts, Lglutamine, and 2.2 g/L sodium bicarbonate; Gibco, 11150-059, Grand Island, NY) supplemented with 0.1% (w/v) fatty acid free bovine serum albumin (BSA, Sigma, A-6003) and 1% (v/v) penicillin-streptomycin and 200 nM CNP for 4 h (CNP 4 h), and then were incubated with maturation medium for 24, 26, or 28 h IVM. As a negative control, COCs were cultured in Medium 199 (with Earle's salts, L-glutamine, and 2.2 g/L sodium bicarbonate; Gibco, 11150059, Grand Island, NY) supplemented with 0.1% (w/v) BSA and 1% (v/v) penicillin-streptomycin for 4 h (NC 4 h), and then were incubated with maturation medium for 24, 26, or 28 h IVM. Approximately 50 COCs were placed in each 4-well culture dish (Nunc cat. no. 176740, Thermo Scientific, Roskilde, Denmark) that contained 600 mL of medium covered with 300 mL of mineral oil (Sigma, M8410), and incubated in a humidified environment containing 5% CO2, 95% air at 38.6 C. The maturation medium consisted of Medium 199 (with Earle's salts, L-glutamine, and 2.2 g/L sodium bicarbonate; Gibco, 11150-059, Grand Island, NY) supplemented 10% (v/v) FBS (Gibco, Cat. No. 10099-141), 10 mg/mL Folltropin-V (FSH; Vetoquinol, Lavaltrie, QC, Canada), 10 mg/mL Lutropin-V (LH; Vetoquinol, Lavaltrie, QC, Canada), 1 mg/mL 17b-estradiol (Sigma, E8875), 100 mM cysteamine (Sigma, M-9768), and 1% (v/v) penicillinstreptomycin. 2.3. Sperm preparation, in vitro fertilization, and in vitro culture Procedures were similar to those previously reported [2,17]. Sheep semen was prepared by a ‘swim-up’ procedure. Briefly, frozen semen was thawed at 39 C for 1 min and layered below 1 mL of fertilization medium consisting of synthetic oviductal fluid (SOF), 20% oestrous sheep serum (OSS) and 6 IU/mL heparin (Sigma, H-4784) in a 10 mL tube. Motile spermatozoa was retrieved from the upper portion after 45 min and separated by centrifugation at 250g for 5 min. The sperm pellet was washed once at 250 g for 5 min using the fertilization medium. Then, the sperm concentration was adjusted to approximately 1 106 spermatozoa/mL. Matured oocytes were partially denuded in 0.1% hyaluronidase by gentle pipetting and transferred into fertilization medium. The oocytes were co-incubated with the spermatozoa for 20 h in a 38.6 C humidified 5% CO2 incubator. Denuded and presumptive zygotes were transferred to SOF supplemented with 1% (v/v) BME-essential amino acids, 1% (v/v) MEM-nonessential amino acids, 1 mM glutamine and 3 mg/mL of BSA and cultured at 38.6 C in a humidified environment with a 90% N2, 5% CO2, 5% O2 atmosphere. The cleavage rate was recorded at 48 h, and the blastocyst rate and total blastocyst cell counts were recorded on day 7 after IVF. 2.4. Assessment of oocyte meiotic progression Oocyte meiotic status was assessed according to the method previously described [18]. The cumulus oophorus was mechanically removed from oocytes using a Vortex in 0.1% hyaluronidase and then fixing in 4% paraformaldehyde (PFA) for 15 min at room temperature. Thereafter, fixed oocytes were incubated in 1 mg/mL 40 , 6-diamidino-2-phenylindole (DAPI) solution for 10 min. Oocytes were washed in 0.01% (w/v) BSA in PBS, and mounted on a slide
Please cite this article in press as: T. Zhang, et al., Effects of pre-incubation with C-type natriuretic peptide on nuclear maturation, mitochondrial behavior, and developmental competence of sheep oocytes, Biochemical and Biophysical Research Communications (2018), https://doi.org/ 10.1016/j.bbrc.2018.02.054
T. Zhang et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
with antifade. Chromosome configurations were assessed using an €ttingen, Germany) Axio Imager A2 (Carl Zeiss Microscopy GmbH, Go fluorescence microscopy (DAPI, Ex: 365 nm, Em: 445 nm). Chromatin configurations were classified as follows (Fig. 1a): immature or germinal vesicle (GV), when the vesicle was clearly visible; resumption of meiosis or germinal vesicle break down (GVBD), when the chromatin was dispersed and initiating condensation; metaphase Ⅱ (MⅡ) stages were identified by the presence of an extruded polar body. 2.5. Total RNA extraction and cDNA synthesis Mural granulosa cells were isolated from follicular fluid of sheep ovary and cumulus cells were obtained by mechanically removed from COCs using a Vortex. Total RNA was extracted from each sample using Trizol Reagent (Takara, Dalian, China). The quality of isolated RNA was verified by measuring the absorbance at 260 and 280 nm and evaluating integrity by 2% agarose gel electrophoresis simultaneously. RNA samples were immediately used for the cDNA synthesis reaction. Reverse transcription polymerase chain reaction (RT-PCR) was performed using the PrimeScript® RT reagent Kit with gDNA Eraser (Takara, Dalian, China) according to the
3
manufacturer's procedure. 2.6. Real-time PCR mRNA quantification To quantify expression of NPR2 mRNA, the sequence-specific primers were designed and synthesized by Shanghai Generay Biotech Co. Ltd. b-actin mRNA was quantified in parallel as a reference gene. Primer sequences were as follows: AGAGCACGGGAGGATTTTGG (NPR2: F), AACGACCAGTCCAGTCACAC (NPR2: R). GTCATCACCATCGGCA ATGA (b-actin: F), CGTGAATGCCGCAGGATT (b-actin: R). The PCR product sizes for NPR2 and b-actin were 198 bp and 88 bp, respectively. RT-qPCR was performed using the SYBR® Premix Ex Taq™ (Takara, Dalian, China). The amplification program was as follows: 40 cycles at 94 C for 5 s, 62 C for 20 s, and 72 C for 15 s, and additional extension at 72 C for 5 min. Negative control reactions lacking template DNA were run in parallel. Relative gene expression was calculated by the 2DDCt method. 2.7. TUNEL assay The apoptotic status of blastocysts were assessed using a combined technique for simultaneous terminal deoxynucleotidyl
Fig. 1. Dose-response and time-dependent effect of CNP pre-treatment on meiotic resumption of sheep oocytes. a Different maturation stages of the sheep oocyte. (A) Germinal vesicle (GV): chromosome shows the dispersion state and large size of the nucleus. (B) Germinal vesicle breakdown (GVBD): chromatin condensation and smaller volume nucleus. (C) Metaphase II (MII): oocytes with visible first polar body extrusion. Red circles mark the karyoplasts; scale bar, 30 mm b The percentage of GV-stage oocytes was assessed after pre-treatment of COCs for 6 h with various concentrations (0, 50, 100, 200, and 400 nM) of CNP. c The percentage of GV-stage oocytes was assessed after pre-treatment of COCs with 200 nM CNP for different time (0, 2, 4, 6, and 8 h). d Effect of 200 nM CNP pre-treatment for 6 h on GV-stage arrest rate of denuded oocytes (DOs) or cumulus oocyte complexes (COCs). All values are represented as mean ± SEM of three replicate experiments. Asterisk indicates signifcant difference; *P < 0.05, **P < 0.01 and ***P < 0.001. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
Please cite this article in press as: T. Zhang, et al., Effects of pre-incubation with C-type natriuretic peptide on nuclear maturation, mitochondrial behavior, and developmental competence of sheep oocytes, Biochemical and Biophysical Research Communications (2018), https://doi.org/ 10.1016/j.bbrc.2018.02.054
4
T. Zhang et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
transferase mediated UTP nick end labeling (TUNEL, In Situ Cell Death Detection Kit, Fluorescein, Roche Applied Science, Mannheim, Germany) and propidium iodide (PI) nuclear staining modified from the procedures previously described [19]. Briefly, blastocysts were fixed with 4% PFA in PBS for 1 h at room temperature. Fixed blastocysts were permeabilized in 0.5% (v/v) TritonX100 diluted in PBS for 40 min at room temperature. Permeabilised blastocysts were incubated overnight at 4 C in PBS containing 10 mg/mL BSA. The blastocysts were subsequently incubated in the TUNEL mixture (deoxynucleotidyl transferase enzyme and fluorescein-dUTP in a 1: 9 ratio) for 1 h at 37 C in the dark. After TUNEL staining, the blastocysts were counterstained with 5 mg/mL PI for 40 min at 37 C. Labeled blastocysts were mounted on a glass slide and imaged using a Zeiss Imager A2 fluorescence microscope (TUNEL, Ex: 499 nm, Em: 520 nm; PI, Ex: 537 nm, Em: 619 nm). The proportion of DNA fragmentation in blastocysts was calculated by dividing the number of cells containing DNA-fragmented nuclei by the total number of blastocyst cells. 2.8. Mitochondrial staining Sheep COCs were denuded in 0.1% hyaluronidase by vortexing. The denuded oocytes were stained with 500 nM MitoTracker Red CMX Ros (Cat #M7512, Invitrogen, USA) for 30 min in fresh PBS at 38.6 C under 5% CO2 in air. Thereafter, oocytes were washed three times in PBS buffer with 0.01% PVA, and then fixed in 4% (w/v) PFA diluted with PBS for 15 min at room temperature. Nuclei were stained with 1 mg/mL DAPI for 10 min then washed in PBS/PVA. Stained oocytes were transferred to a 35-mm confocal dish and observed under the Olympus FluoView FV10i confocal laser scanning microscope system (Olympus, Tokyo, Japan). Each oocyte was captured in the middle of the focal plane to detect DAPI (Ex: 359 nm, Em: 461 nm) and MitoTracker Red (Ex: 578 nm; Em: 598 nm). Image analysis was performed using FV10-ASW 4.2 Viewer software (Olympus, Tokyo, Japan). 2.9. Statistical analysis Data are represented as the mean ± SEM. Statistical significance was analyzed by ANOVA using SPSS software (SPSS Inc. Chicago, IL) followed by student-Newman-Keuls test. Differences between means were considered statistically significant when P < 0.05. 3. Results 3.1. CNP pre-incubation of COCs delayed meiotic resumption Germinal vesicle breakdown (GVBD) is a significant indicator of resumption of meiosis in oocytes (Fig. 1a). Our results showed that pre-incubation of COCs with 200 nM and 400 nM CNP for 6 h experienced a significant (P < 0.001) arrest in GV stage (56.8 ± 4.4%, 57.5 ± 2.9%) more than 0, 50, and 100 nM CNP (9.0 ± 1.8%, 22.6 ± 2.8% and 28.4 ± 4.6%). But there was no significant difference observed between 200 nM and 400 nM CNP pre-incubation on the efficiency of meiotic inhibition of oocytes (P > 0.05) (Fig. 1b). As shown in Fig. 1c, we found that 200 nM CNP could effectively maintain meiotic arrest of sheep COCs cultured in vitro within 4 h and the inhibition efficiency decreased significantly after 4 h. In addition, the percentage of COCs arrested in the GV stage was significantly higher (P < 0.001) when pre-treated with 200 nM CNP for 6 h (59.2 ± 5.2%) compared with DOs pre-treated with 200 nM CNP for 6 h (13.3 ± 3.3%) or the control group (8.3 ± 2.1%) (Fig. 1d).
3.2. NPR2 expression NPR2 mRNA levels were measured in mural granulosa cells (MGCs) and cumulus cells (CCs) by RT-qPCR. The relative abundance of NPR2 mRNA was significantly higher in CCs than MGCs (P < 0.05; Fig. 2). 3.3. CNP pre-incubation improved the developmental competence of sheep oocytes Based on the dose response experiment, we pre-treated COCs with or without 200 nM CNP for 4 h, followed by 24, 26 or 28 h IVM as well as the conventional 24, 26 or 28 h IVM, to observe the developmental competence of sheep oocytes. As shown in Table 1, oocytes pre-incubated with 200 nM CNP for 4 h followed by 24 h IVM exhibited significantly higher (P < 0.05) cleavage rate and blastocyst formation of IVF embryos than those of conventionally matured oocytes and negative control oocytes. 200 nM CNP pretreated COCs for 4 h followed by 26 h IVM displayed a very similar (P > 0.05) development outcomes to that of 200 nM CNP pre-treated COCs for 4 h followed by 24 h IVM, but the blastocyst formation of COCs pre-treated with 200 nM CNP for 4 h followed by 28 h IVM significantly decreased (P < 0.05). However, the blastocyst cell number of COCs pre-treated with 200 nM CNP for 4 h followed by 24 or 26 h IVM were similar to that of conventional 24 h IVM (P > 0.05) (Table 1). 3.4. Apoptosis in blastocysts To evaluate the quality of blastocysts, we investigated the presence of DNA-fragmented nuclei in blastocysts derived from oocytes matured by one-step method or two-step method with or without CNP pretreatment. As shown in Table 2, oocytes preincubated with 200 nM CNP for 4 h followed by 24 h IVM exhibited a significantly lower (P < 0.05) proportion of DNA-fragmented nuclei in blastocysts than those of oocytes from conventional 24, 26, or 28 h IVM and other experimental groups. These results suggested that oocytes pre-treated with 200 nM CNP for 4 h followed by 24 IVM was superior to other treatments and significantly improved the quality of blastocysts. 3.5. Changes in mitochondrial behavior DOs were stained by MitoTracker Red and DAPI to visualize the mitochondria and nucleus, respectively. Representative photomicrographs of mitochondrial localization and nuclear morphology are shown in Fig. 3. In the control group, the overwhelming majority of immature oocytes exhibited a peripheral and fine diffuse mitochondrial distribution (Fig. 3. A3). However, fully matured oocytes showed clustered distribution with small clumps surrounding the cortical regions (Fig. 3. B3). Aggregation of the cytoplasmic mitochondrial granules in the pericytoplasmic and perinuclear regions was observed in a great deal of oocytes pre-treated with 200 nM CNP for 4 h with the nucleus in the germinal vesicle (GV) stage (Fig. 3. C3). Oocytes pretreated with 200 nM CNP for 4 h followed by 24 h IVM exhibited a clustered mitochondrial distribution that corresponded to the conventional 24 h matured oocytes. However, larger clumps were observed with even more stained mitochondria (Fig. 3. D3). These results suggested that CNP pre-treatment improved the mitochondrial activity of sheep oocytes. 4. Discussion The aim of this study was to synchronize the maturation of
Please cite this article in press as: T. Zhang, et al., Effects of pre-incubation with C-type natriuretic peptide on nuclear maturation, mitochondrial behavior, and developmental competence of sheep oocytes, Biochemical and Biophysical Research Communications (2018), https://doi.org/ 10.1016/j.bbrc.2018.02.054
T. Zhang et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
5
Fig. 2. Quantification by real-time PCR analysis of the expression of NPR2 receptor mRNA in MGCs and CCs. a NPR2 mRNAs were detected in mural granulosa cells and cumulus cells. b NPR2 mRNA abundance was significantly (P < 0.05) higher in CCs than in MGCs. Asterisk indicates signifcant difference; *P < 0.05.
Table 1 Effect of CNP pretreatment on developmental capacity of sheep IVF embryos. Treatment 24 h IVM (Standard IVM) 26 h IVM 28 h IVM NC 4 h þ 24 h IVM NC 4 h þ 26 h IVM NC 4 h þ 28 h IVM CNP 4 h þ 24 h IVM CNP 4 h þ 26 h IVM CNP 4 h þ 28 h IVM
No. of examined oocytes 312 216 253 262 232 209 304 286 303
No. of Cleavage (%) 239 168 185 217 172 151 277 249 248
a
(76.28 ± 3.49) (78.15 ± 2.91)a (73.30 ± 3.08)a (82.44 ± 2.02)b (74.19 ± 4.34)a (72.53 ± 5.31)a (90.79 ± 2.38)c (86.36 ± 4.24)b,c (82.17 ± 2.31)b
No. of Blastocyst (%) a
79 (33.19 ± 2.26) 49 (29.39 ± 4.27)a 36 (19.63 ± 2.49)b 62 (28.70 ± 2.54)a 33 (19.14 ± 3.17)b 16 (10.72 ± 2.18)c 132 (47.29 ± 4.27)d 110 (44.53 ± 2.15)d 29 (11.65 ± 3.23)c
No. of Blastocyst cells 115.38 ± 10.57a,b 104.05 ± 8.63a,b 107.52 ± 9.36a,b 112.53 ± 9.83a,b 110.82 ± 8.94a,b 99.23 ± 5.32b 121.63 ± 13.71a 117.83 ± 9.74a 95.43 ± 8.39b
Data are expressed as mean ± SEM of three replicate experiments. Values with different superscript letters (a, b, c, d) within the same column are significantly different (P < 0.05).
Table 2 TUNEL analysis of blastocyst apoptotic rate. Treatment
Number of examined embryos
DNA-fragmented nuclei (%)a in blastocyst
24 h IVM (Standard IVM) 26 h IVM 28 h IVM NC 4 h þ 24 h IVM NC 4 h þ 26 h IVM NC 4 h þ 28 h IVM CNP 4 h þ 24 h IVM CNP 4 h þ 26 h IVM CNP 4 h þ 28 h IVM
65 43 36 52 39 33 83 78 46
16.2 ± 6.4a 16.7 ± 8.3a 19.4 ± 5.2a 14.7 ± 5.8a 19.4 ± 4.3a 23.8 ± 6.9a 6.6 ± 2.8b 19.8 ± 9.3a 17.8 ± 8.7a
Values with different superscript letters (a, b) within the same column are significantly different (P < 0.05). a Percentages are expressed as mean ± SEM of three replicate experiments.
nuclear and cytoplasm by the application of CNP pre-incubation of sheep oocytes. Previous studies have demonstrated that CNP maintains meiotic arrest in many species, but the potential role of CNP on sheep oocytes has not yet been reported. Utilizing this meiosis inhibitor, we observed significantly greater improvement in oocyte developmental competence in sheep oocytes. Inhibition of meiotic resumption is an approach used to promote the synchronization of nuclear and cytoplasmic maturation [10,11]. In our study, various concentrations of CNP were added to the pre-incubation medium without the addition of any hormone component. Our results indicated that 200 nM CNP could effectively inhibit meiotic resumption of sheep oocytes cultured in vitro within 4 h. Previous studies reported that CNP binding to its receptor NPR2 played a functional role in maintaining the arrest of meiosis [5,20]. The present study showed that CCs had significantly higher levels of NPR2 mRNA compared with MGCs. Consistent with our results, recent studies (mouse [5], cat [10]) also showed that NPR2 mRNA was predominantly expressed in CCs rather than in
MGCs. In addition, COCs or DOs were cultured with CNP, the inhibitory effect was observed in the COCs group, but not in the DOs group, confirming that CNP indirectly inhibits GVBD via cumulus cells. This evidence also indicates that the CNP-NPR2 pathway is involved in meiotic arrest in sheep oocytes. Based on the established CNP pre-treatment strategy, the IVF embryos cleavage rate, blastocyst rate as well as blastocyst cell number were investigated to evaluate the impact of CNP preincubation on developmental competence of sheep oocytes. Compared with the conventional one-step maturation method (24, 26, or 28 h IVM) and other experimental groups, 200 nM CNP pretreatment of oocytes for 4 h followed by 24 or 26 h IVM resulted in a significantly increased cleavage rate and blastocyst formation rate (P < 0.05). Similar discoveries have been reported in other animals (cat [10], goat [11]). In addition, DNA fragmentation of embryos, a biochemical hallmark of apoptosis, can be used to reflect the quality of blastocyst [21]. Our result showed that oocytes pre-treated with 200 nM CNP for 4 h followed by 24 h IVM reduced the proportion of
Please cite this article in press as: T. Zhang, et al., Effects of pre-incubation with C-type natriuretic peptide on nuclear maturation, mitochondrial behavior, and developmental competence of sheep oocytes, Biochemical and Biophysical Research Communications (2018), https://doi.org/ 10.1016/j.bbrc.2018.02.054
6
T. Zhang et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
Fig. 3. CNP pretreatment sheep oocytes improve the activity of mitochondria. All images were acquired in the middle of the focal plane. Bright field images indicate oocytes contours and morphology (A1-A4) with mitochondrial localization labeled by MitoTracker Red (B1-B4), nuclear morphology stained by DAPI (C1-C4), and mitochondrial/nuclear merged images (D1-D4). In the control group (C1-C2), mitochondria mainly presented as a brilliant peripheral and fine diffuse distribution pattern throughout the cytoplasm at the germinal vesicle stage (Non-matured, C1), while mitochondria with clumps were aggregated more toward the cortical regions after IVM (24 h IVM, C2). In the CNP pre-treatment group (C3-C4), most of the cytoplasmic mitochondrial granules were localized in the pericytoplasmic and perinuclear regions (CNP 4 h, C3); mitochondria localization was similar to the conventionally matured oocytes (CNP 4 h þ 24 h IVM, C4). Yellow arrows mark the peripheral region, the yellow box marks the perinuclear region, and the blue arrows label the first polar body. The scale bar represents 40 mm. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
DNA-fragmented nuclei in blastocysts compared with blastocysts from conventional 24, 26, or 28 h IVM and other experimental groups. Therefore, the increase in blastocyst formation was possibly due to improved oocyte maturation quality. Cytoplasmic maturation is an indispensable part of oocyte maturation, which involves the redistribution of cytoplasmic organelles and the accumulation of the mRNAs and proteins necessary for early development before the onset of embryonic transcription [14,22]. Therefore, CNP applied in vitro may be able to guarantee the synchronous maturation of oocyte nuclear and cytoplasm. Mitochondria are the richest cellular organelles in mammalian oocytes, involved in crucial events of oocyte maturation and embryonic development [16]. Evaluation of mitochondrial activity reveals the relationship between energy demand and oogenesis or early embryogenesis [23,24]. In this study, we found that sheep oocyte mitochondrial distribution changed significantly during IVM. Therefore, specific patterns of mitochondrial localization in oocytes are consistent with the developmental needs of oocytes. In the control group, a pattern of brilliant peripheral and fine diffuse distribution of mitochondria was observed mainly in immature
oocytes. This pattern was observed in immature oocytes in others species [25] as well. However, mitochondria were aggregated more toward the cortical regions, forming clumps after IVM. Interestingly, cytoplasmic mitochondrial granules of oocytes pre-treated with 200 nM CNP for 4 h were localized to the pericytoplasmic and perinuclear regions. Under the inhibited state of oocyte nuclei in GV stage, this change in mitochondrial distribution may be due to the higher requirement prepared for cytoplasmic metabolism and energy storage within oocytes. In oocytes pre-treated with 200 nM CNP for 4 h followed by 24 h IVM, mitochondrial distribution was similar to that of the conventional one-step matured oocytes; however, larger clumps were observed. This result indicated that higher numbers of active mitochondria accumulated in the cytoplasm when sheep oocytes were pre-treated with CNP followed by IVM. Changes in mitochondrial distribution represent the process of oocyte-acquired cytoplasmic maturation. Stage-specific mitochondrial distribution in the oocyte can meet the higher energy requirement to support cytoplasmic remodeling processes, such as assembly of the cytoskeleton, molecular and protein synthesis, and kinetic activities associated with nuclear maturation
Please cite this article in press as: T. Zhang, et al., Effects of pre-incubation with C-type natriuretic peptide on nuclear maturation, mitochondrial behavior, and developmental competence of sheep oocytes, Biochemical and Biophysical Research Communications (2018), https://doi.org/ 10.1016/j.bbrc.2018.02.054
T. Zhang et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
[15,25]. These effects showed that CNP pretreatment facilitated the synchronous maturation between the nuclear and cytoplasm by prolonging the cytoplasmic maturation time, especially the activity of mitochondria. In summary, our results demonstrated that pre-incubation of sheep oocytes with CNP not only inhibited meiotic resumption, but also improved the subsequent developmental competence of oocytes. Therefore, our two-step IVM system, using the nonpharmacologic meiotic inhibitor CNP, serves as an effective method to further enhance developmental potential of sheep oocyte in vitro.
[9]
[10] [11]
[12]
[13]
Conflicts of interest [14]
The authors declare that they have no competing interests. [15]
Acknowledgements This work was supported by the National Natural Science Foundation of China (No. 31460598). References [1] M. Buell, J.L. Chitwood, P.J. Ross, cAMP modulation during sheep in vitro oocyte maturation delays progression of meiosis without affecting oocyte parthenogenetic developmental competence, Anim. Reprod. Sci. 154 (2015) 16e24. , D. Izquierdo, M. Rodríguez-Prado, et al., Effect of oocyte quality on [2] M.G. Catala blastocyst development after in vitro fertilization (IVF) and intracytoplasmic sperm injection (ICSI) in a sheep model, Fertil. Steril. 97 (2012) 1004e1008. [3] Z. Song, L. Min, Q. Pan, et al., Maternal imprinting during mouse oocyte growth in vivo and in vitro, Biochem. Biophys. Res. Commun. 387 (2009) 800e805. [4] R. Urrego, N. Rodriguez-Osorio, H. Niemann, Epigenetic disorders and altered gene expression after use of assisted reproductive technologies in domestic cattle, Epigenetics 9 (2014) 803e815. [5] M. Zhang, Y.Q. Su, K. Sugiura, et al., Granulosa cell ligand NPPC and its receptor NPR2 maintain meiotic arrest in mouse oocytes, Science 330 (2010) 366e369. [6] Q. Wei, C. Zhou, M. Yuan, et al., Effect of C-type natriuretic peptide on maturation and developmental competence of immature mouse oocytes in vitro, Reprod. Fertil. Dev. 29 (2017) 319e324. [7] Y. Hiradate, Y. Hoshino, K. Tanemura, et al., C-type natriuretic peptide inhibits porcine oocyte meiotic resumption, Zygote 22 (2014) 372e377. [8] F. Franciosi, G. Coticchio, V. Lodde, et al., Natriuretic peptide precursor C
[16] [17]
[18]
[19] [20]
[21]
[22] [23] [24] [25]
7
delays meiotic resumption and sustains gap junction-mediated communication in bovine cumulus-enclosed Oocytes1, Biol. Reprod. 91 (2014) 1e9. T. Zhang, C. Zhang, X. Fan, et al., Effect of C-type natriuretic peptide pretreatment on in vitro bovine oocyte maturation, In Vitro Cell. Dev. Biol. Anim. 53 (2017) 199e206. Y. Zhong, J. Lin, X. Liu, et al., C-Type natriuretic peptide maintains domestic cat oocytes in meiotic arrest, Reprod. Fertil. Dev. 28 (2016) 1553e1559. J. Zhang, Q. Wei, J. Cai, et al., Effect of C-Type natriuretic peptide on maturation and developmental competence of goat oocytes matured in vitro, PLoS One 10 (2015), e0132318. R.P. Norris, W.J. Ratzan, M. Freudzon, et al., Cyclic GMP from the surrounding somatic cells regulates cyclic AMP and meiosis in the mouse oocyte, Development 136 (2009) 1869e1878. J.W. Robinson, M. Zhang, L.C. Shuhaibar, et al., Luteinizing hormone reduces the activity of the NPR2 guanylyl cyclase in mouse ovarian follicles, contributing to the cyclic GMP decrease that promotes resumption of meiosis in oocytes, Dev. Biol. 366 (2012) 308e316. E.M. Ferreira, A.A. Vireque, P.R. Adona, et al., Cytoplasmic maturation of bovine oocytes: structural and biochemical modifications and acquisition of developmental competence, Theriogenology 71 (2009) 836e848. K.H. Choi, S.H. Hong, H.R. Lee, et al., Neogenin regulates mitochondrial activity in pre-implantation mouse embryos, Biochem. Biophys. Res. Commun. 482 (2017) 1060e1066. E. Babayev, E. Seli, Oocyte mitochondrial function and reproduction, Curr. Opin. Obstet. Gynecol. 27 (2015) 175e181. J. Zhang, T.L. Nedambale, M. Yang, et al., Improved development of ovine matured oocyte following solid surface vitrification (SSV): effect of cumulus cells and cytoskeleton stabilizer, Anim. Reprod. Sci. 110 (2009) 46e55. M.D. los Reyes, J. Palomino, V.H. Parraguez, et al., Mitochondrial distribution and meiotic progression in canine oocytes during in vivo and in vitro maturation, Theriogenology 75 (2011) 346e353. C. Matwee, D.H. Betts, W.A. King, Apoptosis in the early bovine embryo, Zygote 8 (2000) 57e68. M. Conti, M. Hsieh, A. Musa Zamah, et al., Novel signaling mechanisms in the ovary during oocyte maturation and ovulation, Mol. Cell. Endocrinol. 356 (2012) 65e73. T. Takahashi, H. Igarashi, M. Amita, et al., Molecular mechanism of poor embryo development in postovulatory aged oocytes: mini review, J. Obstet. Gynaecol. Res. 39 (2013) 1431e1439. A.J. Watson, Oocyte cytoplasmic maturation: a key mediator of oocyte and embryo developmental competence, J. Anim. Sci. 85 (2007) E1eE3. B.D. Bavister, J.M. Squirrell, Mitochondrial distribution and function in oocytes and early embryos, Hum. Reprod. 15 (Suppl 2) (2000) 189e198. Q. Wang, Q.Y. Sun, Evaluation of oocyte quality: morphological, cellular and molecular predictors, Reprod. Fertil. Dev. 19 (2007) 1e12. U. Eichenlaub-Ritter, M. Wieczorek, S. Lüke, et al., Age related changes in mitochondrial function and new approaches to study redox regulation in mammalian oocytes in response to age or maturation conditions, Mitochondrion 11 (2011) 783e796.
Please cite this article in press as: T. Zhang, et al., Effects of pre-incubation with C-type natriuretic peptide on nuclear maturation, mitochondrial behavior, and developmental competence of sheep oocytes, Biochemical and Biophysical Research Communications (2018), https://doi.org/ 10.1016/j.bbrc.2018.02.054