Effects of prebiotics, probiotics, and their combination on growth performance, small intestine morphology, and resident Lactobacillus of male broilers1

Effects of prebiotics, probiotics, and their combination on growth performance, small intestine morphology, and resident Lactobacillus of male broilers1 X. Wang,∗ Y. Z. Farnell,† E. D. Peebles,∗ A. S. Kiess,∗ K. G. S. Wamsley,∗ and W. Zhai∗,2 ∗

Department of Poultry Science, Mississippi State University, 39762; and † Department of Biochemistry, Molecular Biology, Entomology, and Plant Pathology, Mississippi State University, 39762

Key words: small intestine, Lactobacillus, performance, prebiotics, probiotics 2016 Poultry Science 00:1–9 http://dx.doi.org/10.3382/ps/pew030

INTRODUCTION

Food and Drug Administration at the end of 2013. Now the poultry industry is looking for alternative products, such as prebiotics, probiotics, essential oils, and plant extracts, which may help to maintain chicken intestine health and improve immunity and growth. Prebiotics are non-digestible carbohydrates with selective influences on intestinal bacteria and immunity of chickens (Kim et al., 2011; Bozkurt et al., 2014). Mannan oligosaccharide (MOS), a commercial prebiotic yeast extract ingredient, has been reported to prevent gram-negative pathogenic infection by competitive exclusion in chicken gastrointestinal (GI) tracts (Baurhoo et al., 2007a). Inclusion of MOS in chicken diets also may enhance immune function and improve the growth of the intestinal mucosa layer and intestinal microbiota diversity (Baurhoo et al., 2007b; Pourabedin et al., 2014). Beta-glucan, another commercial prebiotic active ingredient, is also reported to benefit broilers by improving innate immunity and body growth (Chae et al., 2006). Benefits of the combined use of MOS and β -glucans on growth performance have been reported for aquatic animals (Van Hai and Fotedar, 2009;

Administration of antibiotics and anticoccidials has facilitated intensification of modern broiler farming. A sub-therapeutic dose of antibiotics in chicken feed is used to inhibit bacterial growth and improve feed conversion and meat production (Stutz and Lawton, 1984; Gaskins et al., 2002). However, concerns of consumers over antibiotic-resistant bacteria and drug residues in poultry meat in recent years have generated controversial viewpoints concerning antibiotic usage. The European Union has banned the use of human antibiotics as growth promotants in animal feed since 2006. In the United States, a voluntary plan was initiated to remove human antibiotics in feed as growth promotants by the  C 2016 Poultry Science Association Inc. Received August 26, 2015. Accepted December 22, 2015. 1 Approved for publication as Journal Article No. J-12712 of the Mississippi Agricultural and Forestry Experiment Station, Mississippi State University. 2 Corresponding author: [email protected]

1

Downloaded from http://ps.oxfordjournals.org/ at University of Pennsylvania Library on March 7, 2016

improved the relative level of Lactobacillus in ileal mucosa as compared to NC, Pro, or PC diets (P = 0.045) without improving broiler BW. Broilers fed PC diets exhibited the highest BW gain from d 15 to 27, the lowest duodenum, jejunum, and ileum relative weights as percentage of BW at d 27, and the highest breast weight at d 42 (P = 0.026, 0.035, 0.002, 0.025, and 0.035, respectively). Broilers fed Pro or Pre + Pro diets exhibited higher BW gain from d 28 to 41 (P = 0.005) and higher overall BW gain from d zero to 41 (P = 0.039) than those fed other diets. Dietary treatments did not affect jejunal morphology or ileal resident Escherichia coli level at any age. From our results, including spores of Bacillus subtilis in feed may stimulate growth at a later age and may facilitate broilers in reaching their target weight sooner. Therefore, probiotics are recommended as potential alternatives to antimicrobials in chicken diets, especially in grower and finisher feed.

ABSTRACT Effects of commercial antimicrobials and the individual and combinational use of commercial prebiotics and probiotics in feed from d zero to 41 on the growth performance, small intestine size, jejunal morphology, and ileal resident bacteria population of broiler chickens were determined. A total of 1,040 one-day-old male Ross × Ross 708 broilers were randomly distributed to 80 floor pens (5 treatments, 16 replications per treatment, 13 chicks per pen). Five dietary treatments were employed: 1) a corn soybeanmeal basal diet (served as a negative control diet, NC); 2) a basal diet supplemented with a commercial prebiotic product (Pre); 3) a basal diet supplemented with a probiotic product containing Bacillus subtilis spores (Pro); 4) a basal diet supplemented with both prebiotic and probiotic products (Pre + Pro); and 5) a basal diet supplemented with commercial antimicrobials (served as a positive control diet, PC). At d 14, Pre diets

2

WANG ET AL.

MATERIALS AND METHODS

Table 1. Feed ingredient composition and calculated nutrient contents of basal diets. Item Ingredient1 , % Corn Soybean meal Meat and bone meal Poultry fat Dicalcium phosphate Calcium carbonate Salt L-Lysine hydrochloride Premix2 DL-Methionine L-Threonine Phytase3 Xylanase4 Sand5 Nutrient contents6 ME (Kcal/kg) CP, % Crude fiber, % Crude fat, % Ca, % Available P, % Na, % Digestible lysine, % Digestible methionine, % Digestible TSAA, % Digestible threonine, %

D 0 to 14

D 15 to 28

D 29 to 41

65.00 27.06 5.00 0.500 0.220 0.658 0.379 0.230 0.250 0.302 0.150 0.000 0.010 0.020

65.00 26.90 5.00 1.246 0.000 0.557 0.342 0.092 0.250 0.243 0.082 0.020 0.020 0.020

66.54 24.78 5.00 1.862 0.000 0.568 0.343 0.096 0.250 0.213 0.066 0.020 0.020 0.020

3,044 21.90 2.19 3.46 0.819 0.391 0.210 1.174 0.576 0.846 0.784

3,100 21.59 2.18 4.19 0.732 0.350 0.195 1.062 0.518 0.787 0.713

3,148 20.60 2.15 4.83 0.732 0.347 0.195 1.010 0.478 0.737 0.666

1 Ingredient nutrient compositions were analyzed before formulating the diet. 2 Premix provided the following per kilogram of finished diet: retinyl acetate, 2.654 μ g; cholecalciferol, 110 μ g; DL-α -tocopherol acetate, 9.9 mg; menadione, 0.9 mg; vitamin B12, 0.01 mg; folic acid, 0.6 μ g; choline, 379 mg; D-pantothenic acid, 8.8 mg; riboflavin, 5.0 mg; niacin, 33 mg; thiamine, 1.0 mg; D-biotin, 0.1 mg; pyridoxine, 0.9 mg; ethoxyquin, 28 mg; manganese, 55 mg; zinc, 50 mg; iron, 28 mg; copper, 4 mg; iodine, 0.5 mg; selenium, 0.1 mg. 3 The phytase product contained 10,000 FTY/g phytase. One unit of FYT is the amount of enzyme that liberates one mM of inorganic phosphate per min from sodium phytate at pH 5.5 and 37o C. 4 The Xylanase product contained 160,000 BXU/g xylanase. One unit of BXU is the amount of enzyme that liberates 0.06 mM of reducing sugars from birch xylan per min at pH 5.3 and 50o C. 5 Experimental additives [commercial prebiotics (mannan oligosaccharides and β -glucans, 170 and 250 g/ton of finished feed, respectively), probiotics (3 Bacillus subtilis strains of 2084, LSSAOl, and 15A-P4 at equal amounts, 300,000 CFU/g of finished feed), and antimicrobials (bacitracin, nicarbazin, and narasin, 50, 54, and 54 g/ton of finished feed, respectively) were added in replacement of sand. 6 Nutrient contents were calculated on a dry matter basis.

Birds, Diets, and Management A total of 1,040 Ross × Ross 708 male broiler chicks were obtained from a commercial hatchery and randomly distributed into 80 floor pens with 13 birds/pen (0.0846 m2 /bird). The 80 pens were divided into 16 blocks by their locations in an environmentally controlled broiler house. Nutrient compositions of ingredients were analyzed before formulating the diets. Basal diets (Table 1) were formulated to meet the nutritional requirements of male broilers exhibiting a standard performance (Rostagno et al., 2011) from d zero to 42. The following 5 experimental diets were randomly assigned to 5 pens in each block: 1) a corn and soybean-meal basal diet containing no additives (served as a negative control diet, NC); 2) a basal diet supplemented with a prebiotic product containing mannan oligosaccharides (MOS) and β -glucans, at 170 and 250 g/ton of

finished feed, respectively (Pre); 3) a basal diet supplemented with a probiotic product containing spores of 3 Bacillus subtilis strains at equal amounts, at 300,000 CFU/g of finished feed (Pro); 4) a basal diet supplemented with both prebiotic and probiotic products (Pre + Pro); and 5) a basal diet supplemented with commercial antimicrobials containing bacitracin, nicarbazin, and narasin, at 50, 54, and 54 g/ton of finished feed, respectively (served as a positive control diet, PC). The 3 Bacillus subtilis strains used were Bacillus strains 2084, LSSAO1, and 15A-P4. All additives were added at product recommended levels. Bacillus strains and spore counts in the finished feed were confirmed by plate counting. Each pen was equipped with one hanging feeder and 4 nipple drinkers. Used litter obtained from a

Downloaded from http://ps.oxfordjournals.org/ at University of Pennsylvania Library on March 7, 2016

Refstie et al., 2010). However, effects of the combined use of MOS and β -glucans have not been reported for broilers. Probiotics are live microbial feed additives that maintain microbial balance in digesta in the GI tract of the host animal (Fuller, 1989). Bacillus subtilis spores are the most common probiotic supplement used in the poultry industry due to their heat-resistance during feed pelleting. Administration of the spores of different strains of Bacillus subtilis in chicken feed has been reported to benefit chickens by lowering Escherichia coli (Bacillus subtilis PB6, Teo and Tan, 2007) and Salmonella populations (Bacillus subtilis B2A, Park and Kim, 2014) in their intestines, with the subsequent improvements of feed conversion and BW gain (Bacillus subtilis C-3102, Fritts et al., 2000). Recently, research has shown that combining an Enterococus mixture (as probiotics) with MOS alleviates heat stress (Sohail et al., 2012) and that combining a Lactobacillus mixture (as probiotics) with isomaltooligosaccharides (as prebiotics) improves the growth of broilers (Mookiah et al., 2014). However, the effects of the specific combination of commercial prebiotics (MOS and β -glucans) and probiotics products (spores of 3 Bacillus subtilis strains) on broiler growth performance have not been studied. Moreover, only the microflora of the intestinal lumen has been previously evaluated. In this study, dietary treatment effects on bacteria in ileal mucosa were determined. Limited attention has been paid to the resident bacteria that attach to the mucosa layer of the intestine. In the current study, effects of commercial antimicrobials (bacitracin as the antibiotic, nicarbazin and narasin as anticoccidials) and the individual and combinational use of prebiotic and probiotic products on broiler growth performance, carcass production, small intestine morphology, and resident Lactobacillus and Escherichia coli in mucosa of intestines were determined.

PREBIOTICS AND PROBIOTICS ON PERFORMANCE AND INTESTINE

commercial broiler house was used to simulate the commercial broiler production environment; however, chicks were not challenged by any extra pathogens. Water and feed were provided on an ad libitum basis. A 24L:0D photoperiod from d zero to 7 and a 20L:4D photoperiod from d 8 to 42 were provided. All bird husbandries, handling methods, and experimental procedures were approved by the Institutional Animal Care and Use Committee of Mississippi State University.

3

were performed at a 40 × magnification, and goblet cell measurements were performed at a 400 × magnification. All measurements were analyzed using Image J software (National Institutes of Health, Bethesda, MD). Morphometric measurements including villus length, mid-point villus width, crypt depth, and goblet cell size were recorded according to the procedure of Fasina et al. (2010). Also, the muscle thickness of the jejunum was measured according to the method of Wang et al. (2015).

Growth Performance and Carcass

Tissue Sampling At d 14, 27, and 40, one bird of average size per pen (80 pens, 16 chicks/dietary treatment) was dissected to determine the lengths and weights of the duodenum, jejunum, and ileum. Birds were weighed, euthanized by CO2 asphyxiation, and dissected. The 3 segments of small intestine were excised and measured (Wang et al., 2015). For gut morphology analysis, a 1.0 cm intestinal tissue sample was collected from the proximal end of the jejunum. For PCR analysis, a 2.5 cm tissue sample was obtained from the distal end of the ileum of each bird. Each tissue sample was serially rinsed 3 times in 10 mL glass tubes containing 1 × PBS to remove the digesta. Samples for morphology analysis were stored in 10% buffered formalin phosphate (Fisher Scientific, Fair Lawn, NJ). Samples for PCR analysis were stored in 5 mL cryo-vials, dipped in liquid nitrogen for 5 s, and placed on dry ice until being stored at −80◦ C. Ileum digesta were squeezed into a 10 mL conical tube and stored at −20◦ C for viscosity testing.

Jejunum Morphological Examination Histological slides were prepared for the jejunum samples of the dissected birds from the first 5 blocks (5 replications) at d 14, 27, and 40 (5 replications × 5 treatments at each of 3 ages, 75 slides in total). Each jejunum sample was embedded in paraffin and serially cut into 5 μm sections. Two sections from each jejunum sample were mounted on a glass slide and stained with Alcian Blue stain. Villi and goblet cells were photographed using a light microscope (Micromaster, Fisher Scientific, Fair Lawn, NJ) according to the method described by Fasina et al. (2010). Morphometric measurements of jejunum villi

Collection of Bacteria, DNA Extraction, and PCR Bacterial DNA was extracted from the ileum samples of the dissected birds from the first 5 blocks (5 replications) at d 14, 27, and 40 (5 replications × 5 treatments at each of 3 ages, 75 samples in total). Resident bacteria from mucosa layer were prepared using a modified method of Gong et al. (2002). Briefly, the ileum section was vigorously washed 3 times in 15 mL of saline containing 0.1% Tween 80 (30 s/time). The washing solutions from the same sample were pooled, and the bacterial cells were collected by centrifugation at 27,000 × g for 20 min at 4◦ C. The cell pellets were stored at -20◦ C until DNA extraction. Bacterial genomic DNA was extracted using a QIAamp Fast DNA Stool Mini Kit following the manufacturer’s instructions (Qiagen, Germantown, MD). Concentrations and purities of genomic DNA were measured using a Nanodrop Spectrophotometer (ND 1000; Wilmington, DE). Primers for Escherichia coli and Lactobacillus were designed using a 16S rRNA region for each bacterium. The universal primers were used to determine the total bacteria population. The primers used in this study are listed in Table 2. To amplify the bacterial DNA sequence, 120 ng of DNA extract was added to 50 μL PCR mixture containing 400 nM of each primer, 25 mM of nucleotide mix (dNTP), 1 × PCR buffer, 1.25 U of Tag DNA polymerase, and supplemental nucleasefree water. The amplification conditions of the PCR thermal cycle were as follows: one cycle at 95◦ C for 3 min, 40 cycles of a thermal program (94◦ C for 30 s, the specific annealing temperature (Table 2) for one min, and extending temperature at 72◦ C for one min), and then another cycle at 72◦ C for 7 min. The PCR products were separated on a 1% agarose electrophoresis gel stained with ethidium bromide, and were photographed under UV light with a BioDoc-it Imaging System (UVP, Upland, CA). Intensities of the DNA bands, indicating microbial populations, were quantitated using an Image J program (National Institutes of Health). The bacterial level of each individual bird was determined by dividing its specific bacterial PCR band intensity by its universal bacteria PCR band intensity (Figure 1-a). Lactobacillus levels of each treatment group were expressed as percentages of the NC group (Figure 1-b).

Downloaded from http://ps.oxfordjournals.org/ at University of Pennsylvania Library on March 7, 2016

Body weight and feed weight were recorded at d zero, 14, 27, and 41 on a pen basis. Body weight gain, feed intake (FI), and feed conversion ratio (FCR) were determined at each age interval, daily mortality was recorded, and FCR was adjusted by accounting for the BW of each dead bird. At d 42, 4 birds per pen were randomly selected for processing and deboning. Carcass, fat pad, breast, tender, wing, drumstick, and thigh weights were recorded.

4

WANG ET AL. Table 2. Bacterial 16S rRNA Primers used for PCR. Bacterial group Universal

Primers

UnivF UnivR Escherichia coli EclF EclR Lactobacillus LacF LacR

Sequence (5 -3 ) CGTGCCAGCCGCGGTAATACG GGGTTGCGCTCGTTGCGGGACTTAACCCAACAT GTTAATACCTTTGCTCATTGA ACCAGGGTATCTAATCCTGTT GCAGCAGTAGGGAATCTTCCA GCATTTCACCGCTACAGATG

Amplicon (bp)

Annealing temperature (◦ C)

611

60

Amit-Romach et al., 2004

340

53

Malinen et al., 2003

340

55

Walter et al., 2001

References

Ileum Viscosity Test All ileum digesta samples were thawed and centrifuged at 7,200 × g for 10 min for supernatant extraction. The viscosity of each 0.5 mL supernatant was measured at 20 rpm and 25◦ C using a Brookfield Programmable Viscometer (model: LVDV-II + Pro; Brookfield Engineering Laboratories, Stoughton, MA).

Statistical Analysis A randomized complete block design with 16 replications (blocks) was used to test for the effects of diet on BW gain, FI, FCR, intestinal length and weights as percentages of BW, and ileal digesta viscosity. A randomized complete block design with 5 replications (blocks) was used to determine the effects of diets on jejunal

morphology and resident Escherichia coli and Lactobacillus level in ileal mucosa at each of 3 ages (14, 27, and 40 d). Dietary treatment was designated as a fixed effect and the block was designated as a random effect. All data were analyzed by using a PROC GLM procedure in SAS version 9.2 (SAS Institute, 2010). When significant differences existed among treatments, Fisher’s least significant difference test was used to separate treatment means. Dietary treatment effects were considered to be significantly different at P ≤ 0.05.

RESULTS Growth Performance and Carcass Weights In the current trial, there was no dietary effect in the FI of the broilers (Table 3). Furthermore, from d zero

Downloaded from http://ps.oxfordjournals.org/ at University of Pennsylvania Library on March 7, 2016

Figure 1. The dietary effects [a negative control diet (NC, a basal diet without supplements); a prebiotics diet (Pre, a basal diet supplemented with mannan oligosaccharides and β -glucans, 170 and 250 g/ton of finished feed, respectively); a probiotics diet (Pro, a basal diet supplemented with spores of 3 Bacillus subtilis strains, 300,000 CFU/g of finished feed); a combined diet (Pre + Pro, a basal diet supplemented with both prebiotic and probiotic products); and a positive control diet (PC, a basal diet supplemented with bacitracin, nicarbazin, and narasin, 50, 54, and 54 g/ton of finished feed, respectively)] on ileal resident bacteria at d 14. (a) Representative PCR results showing the ileal resident Lactobacillus 16S rRNA band intensity (above) and responding universal 16S rRNA band (below). (b) Lactobacillus relative levels at d 14. Lactobacillus level was determined by dividing Lactobacillus band intensity by universal band intensity. Relative Lactobacillus levels of each treatment group were Lactobacillus levels relative to NC group (NC = 100%). a,b Means not sharing a common superscript are different (P ≤ 0.05).

5

PREBIOTICS AND PROBIOTICS ON PERFORMANCE AND INTESTINE Table 3. Growth performance of broilers fed experimental diets: a negative control diet (NC, a basal diet without supplements); a prebiotics diet (Pre, a basal diet supplemented with mannan oligosaccharides and β -glucans, 170 and 250 g/ton of finished feed, respectively); a probiotics diet (Pro, a basal diet supplemented with spores of 3 Bacillus subtilis strains, 300,000 CFU/g of finished feed); a combined diet (Pre + Pro, a basal diet supplemented with both prebiotic and probiotic products); and a positive control diet (PC, a basal diet supplemented with bacitracin, nicarbazin, and narasin, 50, 54, and 54 g/ton of finished feed, respectively).1 D 0 to 14 BW Feed gain conversion (kg) ratio

Feed intake (kg)

D 15 to 27 BW Feed gain conversion (kg) ratio

Feed intake (kg)

D 28 to 41 BW Feed gain conversion (kg) ratio

Feed intake (kg)

Diets NC Pre Pro Pre + Pro PC SEM P-value

0.543 0.559 0.557 0.562 0.559 0.0077 0.454

0.422 0.431 0.433 0.431 0.423 0.0064 0.650

1.747 1.762 1.778 1.752 1.783 0.0165 0.480

1.173b 1.177b 1.185b 1.191a,b 1.221a 0.0109 0.026

2.363 2.348 2.406 2.403 2.348 0.0241 0.232

1.252b 1.229b 1.310a 1.312a 1.237b 0.0197 0.005

4.653 4.675 4.740 4.717 4.689 0.0403 0.582

1.303 1.301 1.293 1.308 1.304 0.0083 0.772

1.492a–c 1.505a 1.497a,b 1.486b,c 1.475c 0.0067 0.033

1.873a,b 1.904a 1.855a,b 1.847b 1.884a,b 0.0140 0.034

D 0 to 41 BW Feed gain conversion (kg) ratio 2.847b 2.837b 2.928a 2.933a 2.881a,b 0.0271 0.039

1.620a,b 1.634a 1.611b 1.604b 1.610b 0.0064 0.020

Means in a column not sharing a common superscript are different (P ≤ 0.05). Observed means are calculated from 16 replicate values using the pen as the experimental unit.

a–c 1

to 14, dietary treatment did not affect the BW gain or FCR of the broilers. However, from d 15 to 27, broilers fed PC diets gained more weight than did those fed NC, Pre, or Pro diets. Broilers fed PC diets also exhibited a lower FCR than those fed Pre or Pro diets. Broilers fed Pre + Pro diets exhibited an FCR that was similar to those fed NC or Pro diets, but was lower than those fed Pre diets. From d 28 to 41, broilers fed Pro or Pre + Pro diets gained more weight than other broilers. Broilers fed Pre + Pro diets exhibited a lower FCR than those fed Pre diets. Overall, broilers fed Pro or Pre + Pro diets gained more weight from d zero to 41 than those fed NC or Pre diets. In addition, Pro, Pre + Pro, and PC diets decreased the FCR from d zero to 41 when compared to the Pre diet. Dietary treatment did not affect the absolute or relative (percentage of BW) weights of the carcass, fat pad, tender, wing, drumstick, and thigh at d 42 (Table 4). Broilers fed PC diets had a similar breast weight as those fed Pre + Pro diets, but had a higher breast weight than those fed NC, Pre, or Pro diets at d 42.

and PC diets exhibited higher relative ileum weights at d 40 than the other groups. At all broiler ages, dietary treatment did not affect jejunal villus length, width, crypt depth, muscle thickness, or goblet cell size, and did not affect ileal digesta viscosity (Table 6).

Ileal Resident Bacteria Dietary treatment did not affect the relative level of Escherichia coli in ileum mucosa at d 14, 27, or 40 (data not shown). Dietary treatment also did not affect the relative level of Lactobacillus in the ileal mucosa at d 27 or 40 (data not shown). Nevertheless, compared to the NC diet, the Pre diet increased the relative level of Lactobacillus in the ileal mucosa at d 14 by 227% (P = 0.046, Figure 1-b). In addition, except for the Pre + Pro dietary treatment, broilers fed Pre diets exhibited higher relative Lactobacillus levels than other birds fed all other dietary treatments.

DISCUSSION Small Intestine Size and Morphology Exam and Digesta Viscosity Dietary treatment did not affect the relative (percentage of BW) weights or the lengths of the duodenum, jejunum, ileum, or small intestine at d 14 (Table 5). At d 27, broilers fed Pro diets exhibited longer jejuna than those fed Pre, Pre + Pro, or PC diets and they also exhibited the longest small intestines. Broilers fed PC diets exhibited lower duodenum relative weight than those fed Pre, Pro, and Pre + Pro diets and broilers fed PC diets also exhibited the lowest jejunum, ileum, and small intestine relative weights at d 27. At d 40, the duodena of broilers fed PC diets were shorter than those fed NC, Pre or Pre + Pro diets, and the duodena of broilers fed Pro diets were shorter than those of broilers fed Pre + Pro diets. Broilers fed Pre diets

Bacitracin has been used in poultry feed as an antibiotic growth-promotant to control Clostridium perfringens and prevent necrotic enteritis (Nairn and Bamford, 1967). A combination of narasin and nicarbazin has been used as a commercial anticoccidial growthpromotant to prevent Eimeria damage (Guneratne and Gard, 1991). In the current experiment, a corn and soybean-meal basal diet supplemented with bacitracin, nicarbazin, and narasin was considered as a positive control diet and also as an industry practical diet. The positive control diets decreased broilers’ small intestine relative weight as percentage of BW at d 27 and improved their BW gain from d 15 to 27 in this study. Few studies have been conducted to evaluate the effects of anticoccidials on broiler intestine size. Miles et al. (2006) observed the reduced intestinal lengths and weights in broilers fed diets containing bacitracin.

Downloaded from http://ps.oxfordjournals.org/ at University of Pennsylvania Library on March 7, 2016

Items

Feed intake (kg)

6

WANG ET AL. Table 4. Absolute and relative weights of the carcass and parts of broilers fed experimental diets: a negative control diet (NC, a basal diet without supplements); a prebiotics diet (Pre, a basal diet supplemented with mannan oligosaccharides and β -glucans, 170 and 250 g/ton of finished feed, respectively); a probiotics diet (Pro, a basal diet supplemented with spores of 3 Bacillus subtilis strains, 300,000 CFU/g of finished feed); a combined diet (Pre + Pro, a basal diet supplemented with both prebiotic and probiotic products); and a positive control diet (PC, a basal diet supplemented with bacitracin, nicarbazin, and narasin, 50, 54, and 54 g/ton of finished feed, respectively)] at 42 d of age.1 Diets

Carcass

Absolute weight (g) NC 2087 Pre 2094 Pro 2131 Pre + Pro 2134 PC 2151 SEM 190.0 P-value 0.084

Breast

Tender

Wing

Drumstick

Thigh

31.81 33.39 32.91 32.75 32.49 1.170 0.912

548.7b 548.3b 549.7b 565.6a,b 576.4a 7.83 0.035

120.3 119.9 118.6 121.4 119.2 2.03 0.927

223.4 225.9 228.8 228.1 227.5 2.12 0.393

263.2 263.7 271.8 268.2 269.6 2.77 0.126

328.0 327.3 339.1 336.7 334.7 4.20 0.122

1.071 1.121 1.080 1.067 1.059 0.0370 0.779

18.48 18.40 18.08 18.46 18.87 0.197 0.096

4.052 4.034 3.907 3.971 3.911 0.0721 0.482

7.533 7.595 7.547 7.459 7.473 0.0558 0.476

8.873 8.863 8.962 8.763 8.836 0.07563 0.468

11.04 11.00 11.16 11.00 10.98 0.114 0.803

Means in a column not sharing a common superscript are different (P ≤ 0.05). Observed means are calculated from 16 replicate values using the pen as the experimental unit.

a,b 1

Table 5. Small intestine lengths and relative weights to BW of broilers fed experimental diets: a negative control diet (NC, a basal diet without supplements); a prebiotics diet (Pre, a basal diet supplemented with mannan oligosaccharides and β -glucans, 170 and 250 g/ton of finished feed, respectively); a probiotics diet (Pro, a basal diet supplemented with spores of 3 Bacillus subtilis strains, 300,000 CFU/g of finished feed); a combined diet (Pre + Pro, a basal diet supplemented with both prebiotic and probiotic products); and a positive control diet (PC, a basal diet supplemented with bacitracin, nicarbazin, and narasin, 50, 54, and 54 g/ton of finished feed, respectively).1 Age

Variable

NC

Pre

Pro

D 14

Duodenum length (cm) Jejunum length (cm) Ileum length (cm) Small intestine length (cm) Duodenum weight to BW (%) Jejunum weight to BW (%) Ileum weight to BW (%) Small intestine weight to BW (%) Duodenum length (cm) Jejunum length (cm) Ileum length (cm) Small intestine length (cm) Duodenum weight to BW (%) Jejunum weight to BW (%) Ileum weight to BW (%) Small intestine weight to BW (%) Duodenum length (cm) Jejunum length (cm) Ileum length (cm) Small intestine length (cm) Duodenum weight to BW (%) Jejunum weight to BW (%) Ileum weight to BW (%) Small intestine weight to BW (%)

23.16 48.36 44.01 116.94 1.332 2.052 1.479 4.883 26.74 67.03a,b 65.14 158.91b 0.782a,b 1.433a 1.061a 3.304a 31.93a,b 72.48 71.01 175.41 0.569 1.140 0.849b 2.521

23.56 52.58 44.44 120.58 1.320 2.089 1.482 4.891 27.29 61.60b 62.64 151.54b 0.809a 1.379a 1.062a 3.250a 31.98a,b 73.01 72.12 177.12 0.566 1.104 0.952a 2.622

22.53 49.63 41.95 114.11 1.368 2.066 1.505 4.939 28.44 71.02a 69.98 169.44a 0.837a 1.434a 1.077a 3.408a 30.66b,c 70.80 71.50 172.96 0.557 1.117 0.844b 2.519

D 27

D 40

Pre + Pro 23.76 49.30 45.39 118.46 1.337 2.082 1.537 4.956 27.72 65.14b 65.37 158.23b 0.799a 1.399a 1.102a 3.301a 32.98a 75.33 72.21 180.53 0.591 1.150 0.833b 2.574

PC

SEM

22.84 48.98 46.31 118.13 1.299 2.012 1.501 4.812 26.17 64.26b 64.71 155.14b 0.719b 1.238b 0.993b 2.949b 30.00c 75.28 81.02 186.29 0.545 1.128 0.938a 2.612

0.561 1.188 1.445 2.362 0.0314 0.0517 0.0380 0.0937 0.785 1.966 1.931 3.648 0.0263 0.0367 0.0224 0.0725 0.677 2.166 2.776 4.595 0.0160 0.0379 0.0293 0.0717

P-value 0.411 0.121 0.283 0.412 0.637 0.843 0.828 0.835 0.299 0.020 0.115 0.015 0.035 0.002 0.025 0.001 0.024 0.530 0.071 0.293 0.354 0.907 0.008 0.764

Means in a row not sharing a common superscript are different (P ≤ 0.05). Observed means are calculated from 16 replicate values using the pen as the experimental unit.

a-c 1

Reduced intestinal size in fast-growing chickens may reflect a more efficient absorption and utilization of nutrients (Dibner and Richards, 2005). A decrease in intestine size suggests that more energy may have been partitioned towards growth rather than maintenance, which may lead to an increase in BW gain. Furthermore, antibiotic supplements have been shown to in-

hibit growth of bacteria and to subsequently channel energy towards growth instead of bolstering immune function (Baurhoo et al., 2009; Kim et al., 2011). However, in the current study, the inclusion of commercial antimicrobials did not affect Lactobacillus or Escherichia coli level in the ileal mucosa layer. Previous studies have shown that the inclusion of bacitracin in

Downloaded from http://ps.oxfordjournals.org/ at University of Pennsylvania Library on March 7, 2016

Relative weight to BW (%) NC 70.22 Pre 70.18 Pro 70.12 Pre + Pro 69.76 PC 70.41 SEM 0.297 P-value 0.629

Fat pad

7

PREBIOTICS AND PROBIOTICS ON PERFORMANCE AND INTESTINE Table 6. Jejunum morphology and ileum digesta viscosity of broilers fed experimental diets: a negative control diet (NC, a basal diet without supplements); a prebiotics diet (Pre, a basal diet supplemented with mannan oligosaccharides and β -glucans, 170 and 250 g/ton of finished feed, respectively); a probiotics diet (Pro, a basal diet supplemented with spores of 3 Bacillus subtilis strains, 300,000 CFU/g of finished feed); a combined diet (Pre + Pro, a basal diet supplemented with both prebiotic and probiotic products); and a positive control diet (PC, a basal diet supplemented with bacitracin, nicarbazin, and narasin, 50, 54, and 54 g/ton of finished feed, respectively).1 Variable

NC

Pre

Pro

D 14

Villus length (μ m) Villus width (μ m) Crypt depth (μ m) Muscle thickness (μ m) Goblet cell size (μ m2 ) Viscosity (centipoise) Villus length (μ m) Villus width (μ m) Crypt depth (μ m) Muscle thickness (μ m) Goblet cell size (μ m2 ) Viscosity (centipoise) Villus length (μ m) Villus width (μ m) Crypt depth (μ m) Muscle thickness (μ m) Goblet cell size (μ m2 ) Viscosity (centipoise)

1,487 135 204 195 3,760 2.14 2,091 215 216 201 3,288 2.89 1,711 263 365 249 2,777 2.06

1,510 148 212 201 6,109 2.54 1,870 258 191 208 3,196 2.31 1,579 269 340 246 3,191 1.95

1,651 122 191 210 3,929 2.44 1,878 199 226 198 4,312 2.79 1,353 582 360 254 3,483 2.20

D 27

D 40

Pre + Pro 1,646 166 189 180 4,270 2.50 1,912 230 202 212 3,295 2.55 1,895 313 451 237 4,405 2.18

PC

SEM

P-value

1,685 151 163 131 3,024 2.37 1,655 281 201 203 2,806 2.75 1,579 302 324 226 3,840 2.03

107.4 18.7 16.2 25.0 817.3 0.110 157.2 42.9 18.1 23.2 672.0 0.167 189.5 17.5 50.0 29.0 741.8 0.105

0.588 0.538 0.305 0.196 0.113 0.087 0.365 0.546 0.669 0.992 0.553 0.115 0.420 0.990 0.576 0.954 0.325 0.422

1 Observed means of morphology measurements are calculated from 5 replicate values using the pen as the experimental unit. Observed mean of viscosity is calculated from16 replicate values.

chicken diets may inhibit the growth of Lactobacillus in the contents of the ileum (Engberg et al., 2000). This inconsistency suggests that the effectiveness of an antibiotic in the intestinal lumen and mucosa layer can exhibit considerable variation. The positive control diet, containing antimicrobial additives, increased final breast weight, which is consistent with previous research (Nissen et al., 1994; Belay and Teeter, 1996). However, the antimicrobial additives did not increase the absolute or relative weights of other carcass parts. Without affecting total BW, the relative contribution of the various carcass parts to total BW has been shown in other studies to be affected by the inclusion of specific antibiotics in broiler diets (Izat et al., 1990, 1991). Inclusion of antimicrobials in chicken feed may primarily promote growth of the pectoralis muscle, which may be more sensitive to dietary manipulation. The use of prebiotics (MOS and β -glucans) alone did not improve BW in this study. Previous studies also have shown that using isomalto-oligosaccharides or oligochitosan alone did not improve BW of broilers (Zhang et al., 2003; Huang et al., 2005). Improving broiler performance by the use of β -glucans or MOS has been well documented and been found to be associated with improved innate immune function (Lowry et al., 2005; Kim et al., 2011; Bozkurt et al., 2012). In the current study, the experimental broilers were not subjected to any exogenous bacteria or environmental challenge. Therefore, the inability to demonstrate any benefits from the use of prebiotics in this study may be due to the limited exposure of the birds to these challenges. Even though no improvement in growth performance was observed, the inclusion of MOS and β -glucans in

chicken feed increased the ratio of Lactobacillus in the ileal mucosa layer at an early age. Mannan oligosaccharides also have been reported to promote Lactobacillus growth in the contents of the chicken cecum (Baurhoo et al., 2007a,b; Pourabedin et al., 2014). Mannan oligosaccharide is not considered as a direct substrate for microbial fermentation. However, it may inhibit the growth of gram negative pathogenic bacteria by offering them a competitive binding site (White et al., 2002). More enteric binding sites may have further been exposed so as to favor Lactobacillus colonization in the mucosal layer. Although effects of β -glucans on chicken intestinal microflora were not reported in broilers, it has been shown that β -glucans may enrich Lactobacillus populations in rat ceca (Snart et al., 2006). In comparison to other groups in this experiment, broilers fed diets containing spores of 3 Bacillus subtilis strains exhibited a longer small intestine at d 27 and experienced compensatory growth at a latter age. Other commercial direct-fed microbial additives used in previous research have been shown to improve villi length, width, and total intestine weights (Sharifi et al., 2012; Salim et al., 2013). Although mucosa layer improvements were not observed, the probiotics used in this study may benefit intestine development by increasing total small intestine length. A longer small intestine is indicative of larger digestive and absorptive areas, which would subsequently improve nutrient utilization and absorption, and would thereby allow greater cumulative growth as result of compensatory growth at a later age. Other strains also were reported to improve BW gain, such as Bacillus subtilis C-3102 (Fritts et al., 2000) and Bacillus subtilis natto (Chen et al., 2009). Bacillus subtilis also may improve chicken performance

Downloaded from http://ps.oxfordjournals.org/ at University of Pennsylvania Library on March 7, 2016

Age

8

WANG ET AL.

ACKNOWLEDGMENTS This is journal article number No. J-12712 from the Mississippi Agricultural and Forestry Experiment

Station (Mississippi State), financially supported by Special Research Initiative, under MIS-322280. We thank Ms. Donna Morgan of the Mississippi State University, Department of Poultry Science, for her technical assistance during this study.

REFERENCES Amit-Romach, E., D. Sklan, and Z. Uni. 2004. Microflora ecology of the chicken intestine using 16S ribosomal DNA primers. Poult. Sci. 83:1093–1098. Baurhoo, B., A. Letellier, X. Zhao, and C. C. Ruiz-Feria. 2007a. Cecal populations of Lactobacilli and Bifidobacteria and Escherichia coli populations after in vivo Escherichia coli challenge in birds fed diets with purified lignin or mannaoligosaccharides. Poult. Sci. 86:2509–2516. Baurhoo, B., L. Phillip, and C. A. Ruiz-Feria. 2007b. Effects of purified lignin and mannan oligosaccharides on intestinal integrity and microbial populations in the ceca and litter of broiler chickens. Poult. Sci. 86:1070–1078. Baurhoo, B., P. R. Ferket, and X. Zhao. 2009. Effects of diets containing different concentrations of mannan oligosaccharide or antibiotics on growth performance, intestinal development, cecal and litter microbial populations, and carcass parameters of broilers. Poult. Sci. 88:2262–2272. Belay, T., and R. G. Teeter. 1996. Virginiamycin and caloric density effects on live performance, blood serum metabolite concentration, and carcass composition of broilers reared in thermoneutral and cycling ambient temperatures. Poult. Sci. 75: 1383–1392. Bozkurt, M., K. Kucukyilmaz, A. U. Catli, M. Cinar, E. Bintas, and F. Coven. 2012. Performance egg quality, and immune response of laying hens fed diets supplemented with mannan-oligosaccharide or an essential oil ixture under moderate and hot environmental conditions. Poult. Sci. 91:1379–1386. Bozkurt, M., N. Aysul, K. Kucukyilmaz, S. Aypak, G. Ege, A. U. Catli, H. Aksit, F. Coven, K. Seyrek, and M. Cinar. 2014. Efficacy of in-feed preparations of an anticoccidial, multienzyme, prebiotic, probiotic, and herbal essential oil mixture in healthy and Eimeria spp.-infected broilers. Poult. Sci. 93:389–399. Chae, B. J., J. D. Lohakare, W. K. Moon, S. L. Lee, Y. H. Park, and T. W. Hahn. 2006. Effects of supplementation of beta-glucan on the growth performance and immunity in broilers. Res. Vet. Sci. 80:291–298. Chen, K. L., W. L. Kho, S. H. You, R. H. Yeh, S. W. Tang, and C. W. Hsieh. 2009. Effects of Bacillu subtilis var. natto and Saccharomyces cerevisiae mixed fermented feed on the enhanced growth performance of broilers. Poult. Sci. 88:309–315. Dibner, J. J., and J. D. Richards. 2005. Antibiotic growth promoters in agriculture: history and mode of action. Poult. Sci. 84:634–643. Engberg, R. M., M. S. Hedemann, T. D. Leser, and B. B. Jensen. 2000. Effect of zinc bacitracin and salinomycin on intestinal microflora and performance of broilers. Poult. Sci. 79:1311–1319. Fasina, Y. O., F. J. Hoerr, S. R. McKee, and D. E. Conner. 2010. Influence of Salmonella enterica serovar Typhimurium infection on intestinal goblet cells and villous morphology in broiler chicks. Avian Dis. 54:841–847. Femia, A. P., C. Luceri, P. Dolara, A. Giannini, A. Biggeri, M. Salvadori, Y. Clune, K. J. Collins, M. Paglierani, and G. Caderni. 2002. Antitumorigenic activity of the prebiotic inulin enriched with oligofructose in combination with the probiotics Lactobacillus rhamnosus and Bifidobacterium lactis on azoxymethaneinduced colon carcinogenesis in rats. Carcinog. 23:1953–1960. Fritts, C. A., J. H. Kersey, M. A. Motl, E. C. Kroger, F. Yan, J. Si, Q. Jiang, M. M. Campos, A. L. Waldroup, and P. W. Waldroup. 2000. Bacillus subtilis C-3102 (Calsporin) improves live performance and microbiological status of broiler chickens. J. Appl. Poult. Res. 9:149–155. Fuller, R. 1989. Probiotic in man and animal. J. Appl. Bacteriol. 66:365–378. Gallaher, D. D., and J. Khil. 1999. The effect of synbiotics on colon carcinogenesis in rats. J. Nutr. 129:1483S–1487S.

Downloaded from http://ps.oxfordjournals.org/ at University of Pennsylvania Library on March 7, 2016

by improving microflora balance in the GI tract (Teo and Tan, 2007; Park and Kim, 2014). Although Bacillus subtilis spores in this study did not affect Lactobacillus or Escherichia coli levels in the ileal mucosa, they may help in regulating microbial growth in the digesta. Teo and Tan (2007) reported that supplemental Bacillus subtilis PB6 (one strain isolated from a healthy chicken) elevated the level of Lactobacillus in the intestinal contents. With this in mind, both Lactobacillus and Escherichia coli populations in digesta and in intestinal mucosa should be determined in the future. Although broilers fed diets containing a combination of prebiotic and probiotic products (MOS, β -glucans, and spores of 3 Bacillus subtilis strains) also experienced a compensatory growth in the later growout period, they did not exhibit a higher BW gain than those fed Pre or Pro diets alone. Furthermore, the combination of prebiotic and probiotic products did not improve resident Lactobacillus levels when compared to the individual use of prebiotic product or probiotic product. These results are consistent with those of a previous study in which Lactobacillus and isomalto-oligosaccharides exhibited no synergistic effect on broiler growth (Mookiah et al., 2014). However, the broiler results contrast with other studies in which rats were used to test for the effects of Bifidobacterium and oligofructose. The results of rat studies showed that Bifidobacterium and oligofructose acted synergistically to improve intestine microbial activity (Gallaher and Khil, 1999; Femia et al., 2002). Synergism may depend on the specific combination of prebiotics and probiotics that are employed in chicken feed. Intestine viscosity may be affected by the inflammatory status of enterocytes and microbiological activity. No dietary effects on viscosity or mortality were found in the current study. The lack of response may be due to the fact that this study was conducted in an environmentally controlled house and the birds did not experience any pathogen or environmental challenges. Therefore, more studies should be conducted to understand the role of direct-fed microbial additives and prebiotic supplements in intestine inflammatory status and microbial balance under various conditions. In conclusion, supplementation of MOS and β glucans in the feed may enhance Lactobacillus colonization in the ileal mucosa of young broilers without affecting their growth. The use of antimicrobial feed additives may have decreased chicken intestine size at an early age, thereby allocating more maintenance energy towards body growth. Bacillus subtilis spore inclusion in broiler diets may facilitate growth during later stages of the growout period by promoting compensatory growth.

PREBIOTICS AND PROBIOTICS ON PERFORMANCE AND INTESTINE

Refstie, S., G. Baeverfjord, R. R. Seim, and O. Elvebo. 2010. Effects of dietary yeast cell wall β -glucans and MOS on performance, gut health, and salmon lice resistance in Atlantic salmon (Salmo salar) fed sunflower and soybean meal. Aquacult. 305: 109–116. Rostagno, H. S., L. F. T. Albino, J. L. Donzele, P. C. Gomes, R. F. De Oliveira, D. C. Lopes, A. S. Ferreira, S. L. T. Barreto, and R. F. Euclides. 2011. Brazilian tables for poultry and swine: Feed composition and nutritional requirements. 3rd ed. Vicosa Federal University, Vicosa, MG, Brazil. Salim, H. M., H. K. Kang, N. Akter, D. W. Kim, J. H. Kim, M. J. Kim, J. C. Na, H. B. Jong, H. C. Choi, O. S. Suh, and W. K. Kim. 2013. Supplementation of direct-fed microbials as an alternative to antibiotic on growth performance, immune response, cecal microbial population, and ileal morphology of broiler chickens. Poult. Sci. 92:2084–2090. SAS Institute. 2010. SAS Proprietary Software Release 9.2. SAS Inst. Inc., Cary, NC. Sharifi, S. D., A. Dibamehr, H. Lotfollahian, and B. Baurhoo. 2012. Effects of flavomycin and probiotic supplementation to diets containing different sources of fat on growth performance, intestinal morphology, apparent metabolizable energy, and fat digestibility in broiler chickens. Poult. Sci. 91:918–927. Snart, J., R. Bibiloni, T. Grayson, C. Lay, H. Zhang, G. E. Allison, J. K. Laverdiere, F. Temilli, T. Asanthan, R. Bell, and G. W. Tannock. 2006. Supplementation of the diet with high-viscosity beta-glucan results in enrichment for lactobacilli in the rat cecum. Appl. Environ. Microbiol. 72:1925–1931. Sohail, M. U., M. E. Hume, J. A. Byrd, D. J. Nisbet, A. Ijaz, A. Sohail, M. Z. Shabbir, and H. Rehman. 2012. Effect of supplementation of prebiotic mannan-oligosaccharides and probiotic mixture on growth performance of broilers subjected to chronic heat stress. Poult. Sci. 91:2235–2240. Stutz, M. W., and G. C. Lawton. 1984. Effects of diet and antimicrobials on growth, feed efficiency, intestinal Clostridium perfringens and ileal weight of broiler chicks. Poult. Sci. 63:2036–2042. Teo, A. Y., and H. M. Tan. 2007. Evaluation of the performance and intestinal gut microflora of broilers fed on corn-soy diets supplemented with Bacillus subtilis PB6 (CloSTAT). J. Appl. Poult. Res. 16:296–303. Van Hai, N., and R. Fotedar. 2009. Comparison of the effects of the prebiotics (Bio-Mos and β -1, 3-D-glucan) and the customized probiotics (Pseudomonas synxantha and P. aeruginosa) on the culture of juvenile western king prawns (Penaeus latisulcatus Kishinouye, 1896). Aquacult. 289:310–316. Walter, J., C. Hertel, G. W. Tannock, C. M. Lis, K. Munro, and W. P. Hammes. 2001. Detection of Lactobacillus, Pediococcus, Leuconostoc, and Weissella species in human feces by using groupspecific PCR primers and denaturing gradient gel electrophoresis. Appl. Environ. Microbiol. 67:2578–2585. Wang, X., E. D. Peebles, T. W. Morgan, R. L. Harkess, and W. Zhai. 2015. Protein source and nutrient density in the diets of male broilers from 8 to 21 d of age: Effects on small intestine morphology. Poult. Sci. 94:61–67. White, L. A., M. C. Newman, G. L. Cromwell, and M. D. Lindemann. 2002. Brewers dried yeast as a source of mannan oligosaccharides for weanling pigs. J. Anim. Sci. 80:2619–2628. Zhang, W. F., D. F. Li, W. Q. Lu, and G. F. Yi. 2003. Effects of isomalto-oligosaccharides on broiler performance and intestinal microflora. Poult. Sci. 82:657–663.

Downloaded from http://ps.oxfordjournals.org/ at University of Pennsylvania Library on March 7, 2016

Gaskins, H. R., C. T. Collier, and D. B. Anderson. 2002. Antibiotics as growth promotants: mode of action. Anim. Biotechnol. 13:29– 42. Gong, J., R. J. Forster, H. Yu, J. R. Chambers, P. M. Sabour, R. Wheatcroft, and S. Chen. 2002. Diversity and phylogenetic analysis of bacteria in the mucosa of chicken ceca and comparison with bacteria in the cecal lumen. FEMS Microbiol. Lett. 208:1–7. Guneratne, J. R. M., and D. I. Gard. 1991. A comparison of three continuous and four shuttle anticoccidial programs. Poult. Sci. 70:1888–1894. Huang, R. L., Y. L. Yin, G. Y. Wu, Y. G. Zhang, T. J. Li, L. L. Li, M. X. Li, Z. R. Tang, J. Zhang, B. Wang, J. H. He, and X. Z. Nie. 2005. Effect of dietary oligochitosan supplementation on ileal digestibility of nutrients and performance in broilers. Poult. Sci. 84:1383–1388. Izat, A., M. Colberg, M. Reiber, M. Adams, J. Skinner, M. Cabel, H. Stilborn, and P. Waldroup. 1990. Effects of different antibiotics on performance, processing characteristics, and parts yield of broiler chickens. Poult. Sci. 69:1787–1791. Izat, A. L., M. Colberg, M. A. Reiber, M. H. Adams, J. T. Skinner, M. C. Cabel, H. L. Stilborn, and P. W. Waldroup. 1991. Comparison of different anticoccidials on processing characteristics and parts yield of broiler chickens. Poult. Sci. 70:1419–1423. Kim, G. B., Y. M. Seo, C. H. Kim, and I. K. Paik. 2011. Effect of dietary prebiotic supplementation on the performance, intestinal microflora, and immune response of broilers. Poult. Sci. 90:75–82. Lowry, V. K., M. B. Farnell, P. J. Ferro, C. L. Swaggerty, A. Bahl, and M. H. Kogut. 2005. Purified β -glucan as an abiotic feed additive up-regulates the innate immune response in immature chickens against Salmonella enterica serovar Enteritidis. Int. J. Food Microbiol. 98:309–318. Malinen, E., A. Kassinen, T. Rinttila, and A. Palva. 2003. Comparison of real-time PCR with SYBR Green I or 5 -nuclease assays and dot-blot hybridization with rDNA-targeted oligonucleotide probes in quantification of selected faecal bacteria. Microbiol. 149:269–277. Miles, R. D., G. D. Butcher, P. R. Henry, and R. C. Littell. 2006. Effect of antibiotic growth promoters on broiler performance, intestinal growth parameters, and quantitative morphology. Poult. Sci. 85:476–485. Mookiah, S., C. C. Sieo, K. Ramasamy, N. Abdullah, and Y. W. Ho. 2014. Effects of dietary prebiotics, probiotic and synbiotics on performance, caecal bacterial populations and caecal fermentation concentrations of broiler chickens. J. Sci. Food Agri. 94:341– 348. Nairn, M. E., and V. W. Bamford. 1967. Necrotic enteritis of broiler chickens in Western Australia. Austr. Vet. J. 43:49–54. Nissen, S., J. C. Fuller, J. E. Sell, P. R. Ferket, and D. V. Rives. 1994. The effect of beta-hydroxy-beta-methyl butyrate on growth, mortality, and carcass qualities of broiler chickens. Poult. Sci. 73:137–155. Park, J. H., and I. H. Kim. 2014. Supplemental effect of probiotic Bacillus subtilis B2A on productivity, organ weight, intestinal Salmonella microflora, and breast meat quality of growing broiler chicks. Poult. Sci. 93:2054–2059. Pourabedin, M., Z. Xu, B. Baurhoo, E. Chevaux, and X. Zhao. 2014. Effects of mannan oligosaccharide and virginiamycin on the cecal microbial community and intestinal morphology of chickens raised under suboptimal conditions. Can. J. Mcrobiol. 60:255– 266.

9