Effects of ranibizumab on the extracellular matrix production by human Tenon's fibroblast

Experimental Eye Research 127 (2014) 236e242

Contents lists available at ScienceDirect

Experimental Eye Research journal homepage: www.elsevier.com/locate/yexer

Effects of ranibizumab on the extracellular matrix production by human Tenon's fibroblast Siti Munirah Md Noh a, Siti H. Sheikh Abdul Kadir a, Zakaria M. Bannur a, Gabriele Anisah Froemming a, Narimah Abdul Hamid Hasani a, Hapizah Mohd Nawawi a, Jonathan G. Crowston b, Sushil Vasudevan a, * a b

Faculty of Medicine, Brain and Neuroscience Communities of Research, Universiti Teknologi MARA (UiTM) Shah Alam, Selangor, Malaysia Centre for Eye Research Australia, The University of Melbourne, Melbourne, VIC, Australia

a r t i c l e i n f o

a b s t r a c t

Article history: Received 12 April 2014 Accepted in revised form 7 August 2014 Available online 16 August 2014

Anti-Vascular Endothelial Growth Factors (Anti-VEGF) agents have received recent interest as potential anti-fibrotic agents for their concurrent use with trabeculectomy. Preliminary cohort studies have revealed improved bleb morphology following trabeculectomy augmented with ranibizumab. The effects of this humanized monoclonal antibody on human Tenon's fibroblast (HTF), the key player of post trabeculectomy scar formation, are not fully understood. This study was conducted to understand the effects of ranibizumab on extracellular matrix production by HTF. The effect of ranibizumab on HTF proliferation and cell viability was determined using MTT assay (3-(4,5-dimethylthiazone-2-yl)-2,5diphenyl tetrazolium). Ranibizumab at concentrations ranging from 0.01 to 0.5 mg/mL were administered for 24, 48 and 72 h in serum and serum free conditions. Supernatants and cell lysates from samples were assessed for collagen type 1 alpha 1 and fibronectin mRNA and protein level using quantitative real time polymerase chain reaction (qRT-PCR) and enzyme-linked immunosorbent assay (ELISA). After 48-h, ranibizumab at 0.5 mg/mL, significantly induced cell death under serum-free culture conditions (p < 0.05). Ranibizumab caused significant reduction of collagen type 1 alpha 1 (COL1A1) mRNA, but not for fibronectin (FN). Meanwhile, COL1A1 and FN protein levels were found upregulated in treated monolayers compared to control monolayers. Ranibizumab at 0.5 mg/mL significantly reduced cell viability in cultured HTF. From this study, we found that single application of ranibizumab is inadequate to induce the anti-fibrotic effects on HTF, suggesting the importance of adjunctive therapy. Further studies are underway to understand mechanism of actions of ranibizumab on HTF. © 2014 Elsevier Ltd. All rights reserved.

Keywords: human Tenon's fibroblast trabeculectomy ranibizumab collagen type 1 alpha 1 fibronectin quantitative real time polymerase chain reaction enzyme-linked immunosorbent assay

1. Introduction Trabeculectomy is the gold standard procedure performed when medical and laser therapy fail to maintain the ideal intraocular pressure for glaucoma (Skuta and Parrish Ii, 1987). The success of this surgery largely depends on the degree of fibrosis at the filtering bleb (Nilforushan et al., 2012). Excessive proliferation of human Tenon's fibroblast (HTF) at the surgical site is believed to be one of the most common causes of failure and the most difficult problem which limits the success rate of this intervention (Choritz et al., 2010). The antimetabolites, mitomycin C and 5-Flurouracil

* Corresponding author. Faculty of Medicine, Universiti Teknologi MARA, 47000, Sungai Buloh, Selangor, Malaysia. Tel.: þ60 361265000. E-mail address: [email protected] (S. Vasudevan). http://dx.doi.org/10.1016/j.exer.2014.08.005 0014-4835/© 2014 Elsevier Ltd. All rights reserved.

have showed their astonishing ability in inducing apoptotic cell death (Crowston et al., 1998). Despite the excellent success rate of trabeculectomy achieved upon their application, severe postsurgical and potentially blinding complications such as hypotony, wound leaking and blebitis are frequently reported (Jampel et al., 1992; Parrish and Minckler, 1996; Stamper et al., 1992). The endpoint of normal wound healing is scar formation which is characterized by an excessive accumulation of extracellular matrix components mainly collagen type 1 and fibronectin. This aberrant fibrosis is the product from a complex physiological process called angiogenesis. This mechanism involves the growth of new blood vessel which occurs in both normal development and pathological processes (Folkman, 1995). Several angiogenic activators including the members of VEGF family have been identified as the key players in angiogenesis regulation with VEGF-A as the primary regulator, driving angiogenesis (Horsley and Kahook, 2010;

S.M. Md Noh et al. / Experimental Eye Research 127 (2014) 236e242

Inai et al., 2004). VEGF and its receptors represent one of the bestvalidated signaling pathways in angiogenesis (Ferrara et al., 2003). Thus, this offered an idea in targeting VEGF-A as the best strategy to treat VEGF-A driven ocular pathology (Kerbel and Folkman, 2002). The use of anti-VEGF agents has been expanded greatly over recent years to include neovascular glaucoma, diabetic macular edema, and corneal neovascularization (Horsley and Kahook, 2010). It was found that anti-VEGF/VEGFR therapies not only prohibit angiogenesis, but additionally cause substantial thinning of preexisting vessels (Inai et al., 2004; Oshima et al., 2006). Bevacizumab (Avastin; Genetech, Inc, South Francisco, CA) is a full length humanized monoclonal antibody designed specifically to block all isoforms of VEGF-A and its high affinity receptors. It is approved by US FDA for the treatment of metastatic colorectal and breast cancer (Hurwitz et al., 2004; Valachis et al., 2010). Several case reports have described the success of, off-label intravitreal use of bevacizumab for the treatment of neovascularization associated with proliferative diabetic retinopathy, age-related macular degeneration, and neovascular glaucoma (Avery et al., 2006; Davidorf et al., 2006; Oshima et al., 2006). In glaucoma filtering surgery, bevacizumab has been recognized as an effective anti-fibrotic agent in vivo and in vitro. Animal model studies have revealed that bevacizumab at concentration of 12.5 mg/mL, prolonged bleb survival with lesser vascularity (Memarzadeh et al., 2009). How et al. (2010) reported that bevacizumab in combination with 5-FU has a greater anti-scarring effect than monotherapy in vivo with relevant decreased in collagen type 1 and fibronectin mRNA level. In vitro analysis of antifibrotic properties of bevacizumab has been well elaborated by Evelyn et al. Bevacizumab has significantly induced the dose-related reduction of HTF cell number at the human intravitreal dose of 12.5 mg/mL. This monoclonal antibody also inhibits HTF proliferation, induces cell death at low level and inhibits cell-mediated gel contraction in vitro (O'Neill et al., 2010). Ranibizumab (Lucentis; Genetech, Inc, South Fransicco, CA) is a recombinant, humanized monoclonal antibody Fab derived from the same precursor of bevacizumab (Kaiser et al., 2007). It has been approved by FDA for the treatment of choroidal neovascularization (CNV) due to age-related macular degeneration (AMD). Intravitreal use of ranibizumab has demonstrated a very good safety profile and is effective as an anti-angiogenic and anti-proliferative mediator in AMD (Desai et al., 2013). Kahook et al. demonstrated that intravitreal ranibizumab as an adjunct therapy with MMC causes a more diffuse bleb with less vascularity (Kahook, 2010). Despite all the positive outcomes regarding ranibizumab in the management of AMD, its involvement in extracellular matrix component deposition post-trabeculectomy, is yet to be explored. In this study, we describe the effects of ranibizumab on collagen type 1 alpha 1 and fibronectin production by HTF. 2. Materials and methods 2.1. Human Tenon's explant culture Primary HTF's were propagated from Tenon's capsule explanted from primary open-angle glaucoma (POAG) patients undergoing trabeculectomy as describe previously (Khaw et al., 1992). This study was approved by local research ethical guidelines and patients gave their written informed consent. Explanted tissue was attached to the bottom of six-well plate (Jet Biofil Co Ltd, China) with a sterile cover slip and overlaid with Roswell Park Memorial Institution (RPMI) culture media (Gibco, Life Technology, USA). Culture media were supplemented with fetal bovine serum FBS; 20% of final volume (Gibco, Life Technology, USA) and penicillin 100,000 U/I, and streptomycin 10 mL/L (Gibco) and then placed in a 37  C, 5% CO2 containing incubator (Binder, Germany) and fed every

237

four days. When HTF had reached about 80% confluence, cells were transferred into 25 cm2 culture flasks (Orange Scientific Ltd, Belgium). HTF at passage 3 to 6 were used in all experiments. 2.2. Immunofluorescence for vimentin antibody staining The purity of the cultured Tenon's fibroblast was verified by unconjugated monoclonal anti-vimentin antibody [V9] (ab8069) from (Abcam, United Kingdom). HTF were cultured in four chambers culture chamber at the concentration of 10  103 cells/well in a complete culture media and incubated at 37  C, 5% CO2 for 24 h. The culture media was removed and the slides were left to dry (approximately about 30 min). The slides were fixed with 100% acetone (R&M, Essex UK), and again were left to dry. The slides then were washed with Phosphate Buffered Saline (PBS); (DAKO, USA) and subsequently incubated with anti-vimentin antibody with 1:100 dilutions in wet chamber. After that, the slides were washed again with PBS and then were incubated with goat polyclonal secondary antibody to mouse (Abcam, Ab96879) in 1:100 dilutions in wet chamber. All these steps were performed in a dark room. After the final washing step, the slides were mounted with 4'6diamidino-2-phenylindole-dilactate (DAPI); (DAKO, USA) and fluorescence mounting medium and covered with cover slip. The slides then were viewed immediately. HTF cytoplasm which stained positively with anti-vimentin antibody will appear in green and the nucleus will appear in blue. 2.3. Ranibizumab effects on HTF viability The MTT assay is a convenient and accurate way of determining mammalian cell viability. This colometric assay is based on the reduction of yellow tetrazolium salt 3-(4,5-dimethylthiazone-2yl)-2,5-diphenyltetrazolium bromide to purple formazan crystals. The assay was performed according to the manufacturer's instruction (Promega, USA). HTF's were seeded at a concentration of 5  103 cells/well into 96 well plate (Thermo Scientific, USA) and incubated overnight in 100 ml complete culture media. The fibroblast monolayers were then washed to remove serum and replaced with serum free culture media overnight for starvation. Finally, HTF were incubated in 100 ml media diluted with various concentrations of ranibizumab for 24, 48 and 72 h 0.5 mg/mL was chosen as the ranibizumab starting concentration based on the human intravitreal dose. The cells were also tested at 1/2 (0.25 mg/mL), 1/10 (0.05 mg/mL) and 1/50 (0.01 mg/mL) of the human intravitreal dose of ranibizumab. Experiments were performed in both 5% FBS media and serum-free media conditions. The samples were analyzed in triplicate with three biological replicates and the optical density was determined with Victor X5, Multilabel Reader Spectrophotometer (Perkin Elmer, USA) at 570 nm. Viability experiments were repeated comparing ranibizumab with non-humanized control IgG isotype (Invitrogen Co, USA). Furthermore, mRNA and protein study were conducted according to the optimum concentration and condition (time and culture media) of ranibizumab on HTF obtained from this assay. 2.4. mRNA extraction and quantification from HTF For gene expression study, cells were seeded into 6-well plates at a density of 3  105 cells/well and allowed to attach for 24 h. After serum deprivation for 24 h, the cells were treated with ranibizumab at a concentration of 0.5 mg/mL for 48 h. In the control wells, cells were treated with control IgG antibody with the same concentration. Total mRNA was isolated by using Nucleospin RNA isolation kit (MachereyeNagel, Germany). Briefly, 353 mL of buffer and b-mercaptoethanol (b-ME) was added to the cell pellet and vigorously

238

S.M. Md Noh et al. / Experimental Eye Research 127 (2014) 236e242

vortex for 30 s. The mixture then was filtered through nucleospin filter and the lysate was centrifuged for one minute at 11,000  g. The homogenized lysate then was added with 350 mL ethanol and mixed thoroughly. The lysate was then loaded into the column and centrifuged for 30 s at 11,000  g. 350 mL of membrane desalting buffer (DMB) was added to the lysate, centrifuged at 11,000  g for one minute. Then the lysate was incubated with 95 mL of DNase reaction mixture at room temperature for 15 min. After three steps of wash and centrifuge, the lysate finally was eluted with 40 uL of RNase-free H2O and centrifuge at 11,000  g for one minute. Total mRNA was quantified using Agilent 2100 Bioanalyzer. Control and treatment samples were set to 200 pg/mL for normalization.

antibody which was prior diluted 1:100 in Biotin-antibody diluent were added to each well. Plates were further incubated for one hour at 37  C. Then, the plates were washed with wash buffer for three cycles. Horseradish peroxidase (HRP)-avidin working solution that was prior diluted 1:100 with HRP-diluent was added to each well and the plate was further incubated for one hour at 37  C. After final washing steps, 3,30 ,5,50 -Tetramethylbenzidine (TMB) substrate was added to each well, and further incubated for 15e30 min at 37  C in the dark. Finally, stop solution was added to each well and within five minutes, the optical density was determined with Victor X5, Multilabel Reader Spectrophotomer (Perkin Elmer, USA) at 450 nm.

2.5. Real Time Polymerase Chain Reaction (RT-PCR)

2.9. Statistical analysis

cDNA was synthesized from mRNA with iScript Reverse Transcription Supermix (BIO-RAD’ USA). Amplification and analysis of cDNA fragments were carried out with CFX96 Real Time PCR. Cycling conditions were initial denaturation at 95  C for 5 min, followed by 44 cycles consisting of 10 s annealing and extension at 60  C. Amplification of the housekeeping gene GAPDH and ACTIN mRNAs which served as a normalization standard was carried out with GAPDH forward (GAAGGTGAAGGTCGGAGTC) and GAPDH reverse (GAAGATGGTGATGGGATTTC), ACTIN forward (CATGTACGTTGCT ATCCAGGC) and ACTIN reverse (CTCCTTAATGTCACGCACGAT). These two housekeeping genes were chosen by consideration that they were the most established and reliable genes used in PCR analysis. As most papers reported, these two genes are the most stable housekeeping genes used in HTF (Jing et al., 2013; Kottler et al., 2005; Seet et al., 2012). Side strand specific primers for collagen type 1 alpha 1 (COL1A1) and fibronectin (FN) are as follows: COL1A1 forward (ACATCCCACCAATCACCT), COL1A1 reverse (GTCATCGCACAACA CCTT), FN1 forward (CTAAAGGACTGGCATTCA) and FN1 reverse (GGGAATAGCTCATGGATT). COL1A1 and FN mRNA levels were measured as CT values. Data generated from each PCR was analyzed using Gene study, BIO-RAD CFX Manager (BIO-RAD, USA).

Data were presented as means ± standard deviation (S.D). Statistical evaluation of significant differences was performed using the Kruskal Wallis for mean comparison and Mann Whitey for multiple comparisons. P values less than 0.05 were considered statistically significant. The statistical analysis was done by using SPSS version 16.0.

2.6. Protein extraction and quantification of HTF Cells were seeded into 6-well plates at a density of 3  105 cells/ well and allowed to attach for 24 h. After 24 h in serum free medium, the cells were treated with ranibizumab at a concentration of 0.5 mg/mL for 48 h. Wells served as control were treated with control IgG antibody with the same concentration. Supernatants were collected after 48 h incubation in serum free culture media and spun at 1000  g for 15 min in 15  C to remove particulates. Total soluble proteins in samples were quantified by Nanodrop 1000 Spectrophotometer (Thermo Scientific, USA) and immediately stored at 80  C until use. Samples were standardized to 1 mg/mL to normalize ELISA results. 2.7. Enzyme-linked immunosorbent assays The supernatants were analyzed in triplicate for collagen type 1 alpha 1 and fibronectin protein by solid phase sandwich enzyme linked immunosorbent assays (ELISA) (Cusabio Biotech Co, China). Purified human collagen type 1 alpha 1 and fibronectin (Cusabio Biotech Co, China) were used as standards. 2.8. ELISA for collagen type 1 alpha 1 and fibronectin Standards and samples were incubated in a high-binding 96 well microtitre plate pre-coated with antibody specific to human collagen type 1 alpha 1 and fibronectin for two hours in 37  C. Subsequently, liquid from each well were removed and Biotin-

3. Results 3.1. Immunofluorescence for vimentin antibody staining Immunocytochemistry assay of vimentin, a special cell marker of HTF, was used in our study to identify HTF. As shown in Fig. 1, the fibroblast isolated from Tenon's capsule expressed vimentin in the cytoplasm which indicate HTF in vitro. Fibroblast produced vimentin stained positively in green. Nuclei stained with DAPI were seen in blue. 3.2. Effects of ranibizumab on HTF's viability Untreated HTF appeared as a spindle-type shape cells (Fig. 1B(I)) as observed by phase contrast pictures. This shape did not change after the treatment of ranibizumab (Fig. 1B(II)). The effect of ranibizumab on Tenon's fibroblast viability was quantified with MTT assay to determine the number of viable cells (Fig. 2). Application of ranibizumab caused a significant reduction in HTF viability only at 24 and 48 h. At 72 h, HTF showed a non-specific proliferation trend following the treatment (result not shown). For all the concentration, cell viability was significantly reduced at the human intravitreal dose of 0.5 mg/mL. At 24 h incubation, a statistically significant decrease in fibroblast number was observed with ranibizumab concentration of 0.5 mg/mL (p < 0.05) in cells with 5% FBS; Fig. 2A(I). In serum free conditions, a significant reduction of ranibizumab-treated fibroblast number was observed at a concentration of 0.5 mg/mL (p < 0.05); Fig. 2A(II). At 48 h, a statistically significant decrease in HTF viability was observed at a concentration of 0.5 mg/mL (p < 0.05) in cells with 5% FBS; Fig. 2B(I). Meanwhile in serum free condition, relevant reduction in viable HTF was observed at 0.05 mg/mL and 0.5 mg/mL (p < 0.05); Fig. 2B(II). From this investigation, we found that ranibizumab caused a significant reduction in HTF's viability at 24 and 48 h incubation, but not at 72 h. However the degree of reduction is a way much higher at 48 h compared to 24 h. This evidence showed that ranibizumab exerts its optimum anti-proliferative property at 48 h. With regard to serum and serum free media, a greater impact of ranibizumab on HTF viability could be observed in serum free media. In order to confirm the fibroblast death was specific to ranibizumab and not due to a nonspecific consequence of high antibody concentration, we compared viability assays of ranibizumab with an isotype control antibody. Experiments were performed in serum-free conditions

S.M. Md Noh et al. / Experimental Eye Research 127 (2014) 236e242

239

Fig. 1. Characterization of human Tenon's fibroblast by vimentin and DAPI staining and cells morphological changes due to ranibizumab treatment. A) Spindle shaped HTF stained with anti-vimentin antibody and DAPI. I) Cytoplasm stained in green (Vimentin). II) Nucleus stained in blue (DAPI). III) Merge. IV) Monochrome. B) Effect of ranibizumab treatment on HTF morphology. I) Untreated. II) Ranibizumab 0.5 mg/mL. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

comparing the effect of 0.5 mg/mL ranibizumab with 0.5 mg/mL isotype control antibody. The isotype control antibody had no significant effect on the number of viable cells. There was a statistically significant decrease in the number of viable fibroblast with ranibizumab-treated cells only; (p < 0.05); Fig. 3.

collagen type 1 alpha 1 in ranibizumab was elevated 2.05 ng/ mL ± 0.09515 compared to control 1.41 ng/mL ± 0.04236 (p < 0.01); Fig. 5A. Additionally, fibronectin level in ranibizumab treated cultures showed an increase 1.60 pg/mL ± 0.0474 compared to control 1.52 pg/mL ± 0.04638; (p < 0.05); Fig. 5B.

3.3. Effect of ranibizumab on collagen type 1 alpha 1 and fibronectin mRNA expression

4. Discussion

Due to the importance of collagen production and deposition, for scar formation, we additionally analyzed the quantitative mRNA expression of COL1A1 using Sybergreen PCR technology. COL1A1 mRNA was significantly down-regulated in cultures treated with ranibizumab at 0.5 mg/mL for 48 h. On the other hand, ranibizumab treatment showed no significant impact on fibronectin mRNA level (p < 0.05); Fig. 4. 3.4. Effect on collagen type 1 alpha 1 and fibronectin protein expression A significant increase in the production of collagen type 1 alpha 1 and soluble fibronectin was observed. Protein expression of

This study demonstrated the effects of ranibizumab on HTF and its role in extracellular matrix components collagen type 1 alpha 1 and fibronectin. Among the important findings of this study is the observation of ranibizumab to reduce the viability of cultured HTF. Application of ranibizumab did not caused alteration in cell morphology, however a relevant decrease in cell viability was documented. Greater significant reduction in HTF viability was found in serum free media compared to serum because VEGF in serum binds to anti-VEGF and inactivates it (O'Neill et al., 2010). At the highest dose tested, ranibizumab reduces the cell viability at the maximum as compared to other concentrations. This finding is in consistence with previous established data concerned with the effective dose of ranibizumab. Investigations on dose efficacy and safety of 0.5 mg and 2.0 mg ranibizumab administered monthly or

240

S.M. Md Noh et al. / Experimental Eye Research 127 (2014) 236e242

Fig. 2. Ranibizumab effects on HTF's viability in different concentrations and conditions (incubation time and culture media). (A) Ranibizumab-treated HTFs (continuous 24 h) MTT assay. A(I) 5% FBS media conditions. Reduction in MTT absorbance at 0.5 mg/mL ranibizumab in cells in media with 5% FBS (p < 0.05; n ¼ 3) *P < 0.05 with respect to cells in media with 5% FBS with no ranibizumab treatment. A(II) Serum-free condition MTT assay. Reduction in MTT absorbance at concentration 0.5 mg/mL in cells in serum-free media (p < 0.05; n ¼ 3).*P < 0.05 with respect to cells in serum-free media with no ranibizumab treatment. (B) Ranibizumab-treated HTFs (continuous 48 h) MTT assay. B(I) 5% FBS media conditions. Reduction in MTT absorbance at 0.5 mg/mL ranibizumab in cells in media with 5% FBS (p < 0.05; n ¼ 3) *P < 0.05 with respect to cells in media with 5% FBS with no ranibizumab treatment. B(II) Serum-free condition MTT assay. Reduction in MTT absorbance at concentration 0.05 mg/mL and 0.5 mg/mL in cells in serum-free media (p < 0.05; n ¼ 3).*P < 0.05 with respect to cells in serum-free media with no ranibizumab treatment.

on an as-needed basis in patients with subfoveal neovascular agerelated macular degeneration confirmed that ranibizumab 0.5 mg monthly provides optimum results in patients with wet AMD (Busbee et al., 2013). Recent animal studies on histopathological aspect of wound tension during cutaneous wound healing in rabbit model demonstrated that 0.5 mg/mL of intravitreal ranibizumab significantly suppress neovascularization and exerted significant reduction of cutaneous wound tensile strength (Christoforidis et al., 2013). We found that COL1A1 mRNA expressions were significantly reduced in treated HTF compared to control. However, collagen type 1 alpha 1 protein level was found to be overexpressed. The discrepancy in the net collagen production and COL1A1 mRNA level was also reported in other cell lines. The effects of ranibizumab on COL1A1 protein level could not be entirely accounted by changes in the transcription rate of the respective genes, indicating that this

anti-VEGF modulate the expression of collagen protein synthesis by a combination of translational and post-translational control mechanisms, such as alterations in the rate of intracellular breakdown or secretion of newly synthesized collagen. On the other hand, we found that ranibizumab does not really affect the synthesis of fibronectin protein. This change was generally accompanied by insignificant alteration in the corresponding mRNA levels. Similar pattern was reported where Smad 7 effectively reduces the collagen type 1 alpha 2 (COL1A2) mRNA expression but the mRNA level of FN remain unchanged (Chen and Sun, 2007). Tissue fibrosis is a complex process which depends upon a number of factors including growth factors, chemokines and cytokines. The findings described here suggest that collagen and fibronectin expression following ranibizumab treatment is regulated by stimulatory and inhibitory factors released by Tenon's fibroblast. Human Tenon's fibroblasts have been demonstrated to

S.M. Md Noh et al. / Experimental Eye Research 127 (2014) 236e242

241

Fig. 3. Comparison between the effects of ranibizumab and control antibody on HTF (Continuous 48 h) in serum free condition. Ranibizumab 0.5 mg/mL induced significant HTF death at 48 h in serum-free condition compared to control isotype (n ¼ 3).

Fig. 5. Collagen type 1 alpha 1 (COL1A1) and fibronectin protein expression evaluated by ELISA (continuous 48 h) in serum free condition. (A) HTF treated with ranibizumab concentration 0.5 mg/mL demonstrated significant increase on level of COL1A1 compared to control antibody (p < 0.01; n ¼ 3). (B) HTF treated with ranibizumab concentration 0.5 mg/mL for 48 h in serum-free condition demonstrated significant increase on level of fibronectin compared to control antibody (p < 0.05; n ¼ 3). Fig. 4. Collagen type 1A1 (COL1A1) and fibronectin (FN) mRNA investigated by RT-PCR (continuous 48 h) in serum free condition. Ranibizumab regulates collagen type 1 alpha 1 mRNA expression in vitro. HTF treated with ranibizumab concentration 0.5 mg/ mL demonstrated significant decreased in mRNA level of COL1A1 (p < 0.05; n ¼ 3). However no significant changes distinguished in mRNA level of fibronectin (p < 0.05; n ¼ 3).

significantly express not just VEGF, but also several other growth factors mRNA in vitro including transforming growth factor (TGF-b), basic fibroblast growth factor (bFGF) and platelet-derived growth factor (PDGF) (Tripathi et al., 1996). The influence of TGF-b family in the pathogenesis of wound healing is very well documented. TGF-b is best described as a key player in the differentiation of fibroblast to myofibroblast (Jester et al., 1995; Skalli and Gabbiani, 1988) and induces matrix contraction involved in scarring (Jester et al., 1999). Therefore it can be postulated that in the early stages of tissue response to injury, the influence of these growth factors resulted in vast accumulation of extracellular matrix and connective tissue. Subsequently, introduction of anti-VEGF abrogates the collagen mRNA synthesis and arrest further connective tissue accumulation. Hence, targeting VEGF and its receptor could be one of the strategies to limit the post-surgical scarring regardless of the involvement of other growth factors. Recently, Deissler et al. (2013) have reported the efficiency of ranibizumab to blocks migration of retinal endothelial cells, not its proliferation. Meanwhile, Seong et al. (2005) has reported that, anti-metabolite MMC caused significant reduction in viable cells of HTF through the activation of intrinsic and extrinsic caspase

cascades with mitochondrial dysfunction. Therefore, we suggest that adjunctive therapy of ranibizumab and other anti-fibrotic agents would be more effective. This combination is important as ranibizumab is capable to inhibit the migration of HTF while antifibrotic agents act through additional pathway and resulted in better synergistic effect.

5. Conclusion In conclusion, to date anti-VEGF’s have turned out to be a potentially successful agents in managing scarring following trabeculectomy. We have shown that ranibizumab efficiently reduces HTF viability in vitro. However, tissue fibrosis is a complex process which depends upon a number of factors. Our findings suggest that a single application of ranibizumab may be insufficient to prevent extracellular matrix deposition following filtering surgery, hence suggesting the use of adjunctive synergistic agents. Further investigation is warranted to identify related pathways involved in scar modulation by ranibizumab.

Acknowledgement This research was funded by The Ministry of Science, Technology and Innovation (MOSTI), Malaysia. Project code: 100-RMI/SF 16/6/2.

242

S.M. Md Noh et al. / Experimental Eye Research 127 (2014) 236e242

References Avery, R.L., Pieramici, D.J., Rabena, M.D., Castellarin, A.A., Nasir, M. a. A., Giust, M.J., 2006. Intravitreal bevacizumab (Avastin) for neovascular age-related macular degeneration. Ophthalmology 113 (3), 363e372 e365. ~ er, I.J., Li, Z., Lai, P., 2013. TwelveBusbee, B.G., Ho, A.C., Brown, D.M., Heier, J.S., Sun month efficacy and safety of 0.5 mg or 2.0 mg ranibizumab in patients with subfoveal neovascular age-related macular degeneration. Ophthalmology 120 (5), 1046e1056. Chen, J.Y., Sun, X.H., 2007. Changes of type I collagen and fibronectin expressions on cultured human Tenon's capsule fibroblasts transfected with Smad 7 vector [Zhonghua yan ke za zhi] Chin. J. Ophthalmol. 43 (2), 124e128. Choritz, L., Grub, J., Wegner, M., Pfeiffer, N., Thieme, H., 2010. Paclitaxel inhibits growth, migration and collagen production of human Tenon's fibroblastsdpotential use in drug-eluting glaucoma drainage devices. Graefe's Arch. Clin. Exp. Ophthalmol. 248 (2), 197e206. Christoforidis, J.B., Wang, J., Jiang, A., Willard, J., Pratt, C., Abdel-Rasoul, M., Powell, H., 2013. The effect of intravitreal bevacizumab and ranibizumab on cutaneous tensile strength during wound healing. Clin. Ophthalmol. (Auckland, NZ) 7, 185. Crowston, J.G., Akbar, A.N., Constable, P.H., Occleston, N.L., Daniels, J.T., Khaw, P.T., 1998. Antimetabolite-induced apoptosis in Tenon's capsule fibroblasts. Investigative Ophthalmol. Vis. Sci. 39 (2), 449e454. Davidorf, F.H., Mouser, J.G., Derick, R.J., 2006. Rapid improvement of rubeosis iridis from a single bevacizumab (Avastin) injection. Retina 26 (3), 354e356. Deissler, H.L., Deissler, H., Lang, G.K., Lang, G.E., 2013. Ranibizumab efficiently blocks migration but not proliferation induced by growth factor combinations including VEGF in retinal endothelial cells. Graefe's Archive Clin. Exp. Ophthalmol. 251 (10), 2345e2353. Desai, R.U., Singh, K., Lin, S.C., 2013. Intravitreal ranibizumab as an adjunct for Ahmed valve surgery in open-angle glaucoma: a pilot study. Clin. Exp. Ophthalmol. 41 (2), 155e158. Ferrara, N., Gerber, H.-P., LeCouter, J., 2003. The biology of VEGF and its receptors. Nat. Med. 9 (6), 669e676. Folkman, J., 1995. Angiogenesis in cancer, vascular, rheumatoid and other disease. Nat. Med. 1 (1), 27e30. Horsley, M.B., Kahook, M.Y., 2010. Anti-VEGF therapy for glaucoma. Curr. Opin. Ophthalmol. 21 (2), 112e117. How, A., Chua, J.L.L., Charlton, A., Su, R., Lim, M., Kumar, R.S., Wong, T.T., 2010. Combined treatment with bevacizumab and 5-fluorouracil attenuates the postoperative scarring response after experimental glaucoma filtration surgery. Invest. Ophthalmol. Vis. Sci. 51 (2), 928e932. Hurwitz, H., Fehrenbacher, L., Novotny, W., Cartwright, T., Hainsworth, J., Heim, W., Holmgren, E., 2004. Bevacizumab plus irinotecan, fluorouracil, and leucovorin for metastatic colorectal cancer. N. Engl. J. Med. 350 (23), 2335e2342. Inai, T., Mancuso, M., Hashizume, H., Baffert, F., Haskell, A., Baluk, P., Yancopoulos, G.D., 2004. Inhibition of vascular endothelial growth factor (VEGF) signaling in cancer causes loss of endothelial fenestrations, regression of tumor vessels, and appearance of basement membrane ghosts. Am. J. Pathol. 165 (1), 35e52. Jampel, H.D., Pasquale, L.R., Dibernardo, C., 1992. Hypotony maculopathy following trabeculectomy with mitomycin C. Arch. Ophthalmol. 110 (8), 1049. Jester, J.V., Petroll, W.M., Barry, P.A., Cavanagh, H.D., 1995. Expression of alphasmooth muscle (alpha-SM) actin during corneal stromal wound healing. Invest. Ophthalmol. Vis. Sci. 36 (5), 809e819.

Jester, J.V., Petroll, W.M., Cavanagh, H.D., 1999. Corneal stromal wound healing in refractive surgery: the role of myofibroblasts. Prog. Retin. Eye Res. 18 (3), 311e356. Jing, J., Li, P., Li, T., Sun, Y., Guan, H., 2013. RNA interference targeting connective tissue growth factor inhibits the transforming growth factor-b 2 induced proliferation in human tenon capsule fibroblasts. J. Ophthalmol. 2013. Kahook, M.Y., 2010. Bleb morphology and vascularity after trabeculectomy with intravitreal ranibizumab: a pilot study. Am. J. Ophthalmol. 150 (3), 399e403 e391. Kaiser, P.K., Blodi, B.A., Shapiro, H., Acharya, N.R., 2007. Angiographic and optical coherence tomographic results of the MARINA study of ranibizumab in neovascular age-related macular degeneration. Ophthalmology 114 (10), 1868e1875 e1864. Kerbel, R., Folkman, J., 2002. Clinical translation of angiogenesis inhibitors. Nat. Rev. Cancer 2 (10), 727e739. Khaw, P., Ward, S., Porter, A., Grierson, I., Hitchings, R., Rice, N., 1992. The long-term effects of 5-fluorouracil and sodium butyrate on human Tenon's fibroblasts. Invest. Ophthalmol. Vis. Sci. 33 (6), 2043e2052. € tzerKottler, U.B., Jünemann, A.G., Aigner, T., Zenkel, M., Rummelt, C., Schlo Schrehardt, U., 2005. Comparative effects of TGF-b1 and TGF-b2 on extracellular matrix production, proliferation, migration, and collagen contraction of human Tenon's capsule fibroblasts in pseudoexfoliation and primary open-angle glaucoma. Exp. Eye Res. 80 (1), 121e134. Memarzadeh, F., Varma, R., Lin, L.-T., Parikh, J.G., Dustin, L., Alcaraz, A., Eliott, D., 2009. Postoperative use of bevacizumab as an antifibrotic agent in glaucoma filtration surgery in the rabbit. Invest. Ophthalmol. Vis. Sci. 50 (7), 3233e3237. Nilforushan, N., Yadgari, M., Kish, S.K., Nassiri, N., 2012. Subconjunctival bevacizumab versus mitomycin C adjunctive to trabeculectomy. Am. J. Ophthalmol. 153 (2), 352e357 e351. O'Neill, E.C., Qin, Q., Van Bergen, N.J., Connell, P.P., Vasudevan, S., Coote, M.A., Crowston, J.G., 2010. Antifibrotic activity of bevacizumab on human Tenon's fibroblasts in vitro. Invest. Ophthalmol. Vis. Sci. 51 (12), 6524e6532. Oshima, Y., Sakaguchi, H., Gomi, F., Tano, Y., 2006. Regression of iris neovascularization after intravitreal injection of bevacizumab in patients with proliferative diabetic retinopathy. Am. J. Ophthalmol. 142 (1), 155e157 e151. Parrish, R., Minckler, D., 1996. “Late endophthalmitis”efiltering surgery time bomb? Ophthalmology 103 (8), 1167e1168. Seet, L.F., Su, R., Toh, L.Z., Wong, T.T., 2012. In vitro analyses of the anti-fibrotic effect of SPARC silencing in human Tenon's fibroblasts: comparisons with mitomycin C. J. Cell. Mol. Med. 16 (6), 1245e1259. Seong, G.J., Park, C., Kim, C.Y., Hong, Y.J., So, H.-S., Kim, S.-D., Park, R., 2005. Mitomycin-C induces the apoptosis of human Tenon's capsule fibroblast by activation of c-Jun N-terminal kinase 1 and caspase-3 protease. Invest. Ophthalmol. Vis. Sci. 46 (10), 3545e3552. Skalli, O., Gabbiani, G., 1988. The biology of the myofibroblast relationship to wound contraction and fibrocontractive diseases. In: The Molecular and Cellular Biology of Wound Repair. Springer, pp. 373e402. Skuta, G.L., Parrish Ii, R.K., 1987. Wound healing in glaucoma filtering surgery. Surv. Ophthalmol. 32 (3), 149e170. Stamper, R., McMenemy, M., Lieberman, M., 1992. Hypotonous maculopathy after trabeculectomy with subconjunctival 5-fluorouracil. Am. J. Ophthalmol. 114 (5), 544e553. Tripathi, R.C., Li, J., Chalam, K., Tripathi, B.J., 1996. Expression of growth factor mRNAs by human Tenon's capsule fibroblasts. Exp. Eye Res. 63 (3), 339e346. Valachis, A., Polyzos, N., Patsopoulos, N., Georgoulias, V., Mavroudis, D., Mauri, D., 2010. Bevacizumab in metastatic breast cancer: a meta-analysis of randomized controlled trials. Breast Cancer Res. Treat. 122 (1), 1e7.