Effects of shade on plant growth and flower quality in the herbaceous peony (Paeonia lactiflora Pall.)

Plant Physiology and Biochemistry 61 (2012) 187e196

Contents lists available at SciVerse ScienceDirect

Plant Physiology and Biochemistry journal homepage: www.elsevier.com/locate/plaphy

Research article

Effects of shade on plant growth and flower quality in the herbaceous peony (Paeonia lactiflora Pall.) Daqiu Zhao, Zhaojun Hao, Jun Tao* Jiangsu Key Laboratory of Crop Genetics and Physiology, College of Horticulture and Plant Protection, Yangzhou University, Yangzhou 225009, PR China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 13 August 2012 Accepted 9 October 2012 Available online 26 October 2012

Herbaceous peony (Paeonia lactiflora Pall.) is an important ornamental plant used in urban green spaces, but little is known about whether it can grow in a shaded environment or understory. In this study, effects of shade on plant growth and flower quality in the herbaceous peony were investigated. The results showed that P. lactiflora morphology parameters, including plant height, leaf number, stem diameter, branch number, node number and plant crown width, were higher in plants grown with sun exposure compared to those grown in shade; however, opposite trends were observed for the top and middle leaf areas of the plant. Compared with sun exposure, shade decreased P. lactiflora photosynthetic capacity, light saturation point (LSP) and light compensation point (LCP) and increased the apparent quantum yield (AQY), mainly due to declined stomatal conduction (Gs). These decreases caused the soluble sugar, soluble protein and malondialdehyde (MDA) contents to decline, which led to delayed initial flowering date, prolonged flowering time, reduced flower fresh weight, increased flower diameter and faded flower color. Through cloning and expression analysis of anthocyanin biosynthetic genes, we determined that the fading of flower color was the result of reduced anthocyanin content, which was caused by the combined activity of anthocyanin biosynthesis genes and, in particular, of the upstream phenylalanine ammonialyase gene (PlPAL) and chalcone synthase gene (PlCHS). These results could provide us with a theoretical basis for further application of P. lactiflora in the greening of urban spaces and an understanding of the mechanisms behind the changes induced by shade. Ó 2012 Elsevier Masson SAS. All rights reserved.

Keywords: Herbaceous peony Flower quality Shade Photosynthesis

1. Introduction With the acceleration of the urbanization process, landscape greening, which can not only beautify the environment but also promote people’s physical and mental health, has become an essential part of urban construction. Most of urban green spaces are located between the buildings, and 50% of them are found in shaded environments, which result in plants facing being exposed to limited sunshine and light intensity [1]. Therefore, the selection of understory plants for use in green spaces is necessary to establish a stratified planting structure and improve the ecological benefits of green space per unit area. Paeonia lactiflora, commonly known as the herbaceous peony, is an important ornamental plant that is native to temperate Eurasia [2]. It is widely distributed and cultivated in many regions, such as China, New Zealand, Turkey, Europe, North America and others [3,4]. P. lactiflora possesses extremely abundant flower shapes and colors. The petal colors range from purple, red, pink and white to * Corresponding author. Tel.: þ86 514 87997219; fax: þ86 514 87347537. E-mail address: [email protected] (J. Tao). 0981-9428/$ e see front matter Ó 2012 Elsevier Masson SAS. All rights reserved. http://dx.doi.org/10.1016/j.plaphy.2012.10.005

rarer colors, such as blue, green, yellow, black and even to double colors [5]; the flower blooms in several forms, including single, semi-double, double, or bomb structures [2]. Moreover, P. lactiflora contains many bioactive compounds, including paeoniflorin [6], oleanolic and ursolic acid [7], etc., which have various pharmaceutical activities. These characteristics make the plant a popular choice among people all over the world. In addition, features of strong adaptability and minimal care requirements make P. lactiflora the new favorite of urban landscape greening. Despite its popularity, but little is known about the peony’s light requirements. Climate, soil nutrition and water have long been considered to be three main factors affecting plant growth; the latter two are relatively easy to control via fertilization and irrigation, but light, the most important factor in a climate, is more difficult to control [8,9]. Light change not only affects plant morphology, physiology and microstructure but also has an important impact on production [9e12]. This is mainly because plant growth requires an appropriate light intensity; excessively high or low intensity will prevent photosynthesis in the plant [9,13]. Shade, not only influences the amount of light received by plants but also changes other small environmental conditions, such as air and ground temperature,

188

D. Zhao et al. / Plant Physiology and Biochemistry 61 (2012) 187e196

humidity, carbon dioxide (CO2) concentrations and so on, which are important for plant growth [14]. Until now, compared with full sun exposure, the effects of shade on plant growth can be broadly classified into two categories: one is positive, such as in the cases of Plukenetia volubilis [10], Trichloris crinita [12], and Capsicum chinense [15]; the other is negative, such as in the cases of Eustoma grandiflorum [16] and Liatris spicata [17]. These categories of plants are commonly classified as shade tolerant and shade intolerant, respectively. Shade-tolerant plants have high light-induced morphological plasticity, slow relative growth rate, extensive foliar display, low net photosynthesis rate (Pn), dark respiration rate (Rd), light compensation point (LCP), and high apparent quantum yield (AQY), whereas shade-intolerant plants exhibit the opposite characteristics [18]. The low and erect plant of P. lactiflora cv. ‘Dafugui’ has a high flowering rate, red flowers, petals arrayed in an orderly fashion and a hard straight stem; it is a very suitable plant for greening purposes. However, little work has been performed investigating the effects of shade on plant growth and flower quality in P. lactiflora, it is therefore necessary for plant researchers to comprehensively understand plant changes that occur when switching between shade and sun exposure as well as the mechanism underlying such changes. In this study, ‘Dafugui’, a main P. lactiflora cultivar in Yangzhou was selected for analysis. The plant’s life was divided into four different developmental stages, including a flower-bud stage (S1), an initiating bloom stage (S2), a full-bloom stage (S3) and a withering stage (S4). First, the plant morphological parameters were measured and the physiological indices and photosynthetic characteristics were determined. Next, flower quality that focused on petal color was studied. These studies were aimed at providing a theoretical basis for the use of P. lactiflora in landscape greening. 2. Results 2.1. Morphological parameters Morphological parameters of P. lactiflora under sun exposure and shade treatments are listed in Table 1. Plant height, leaf number, stem diameter, branch number, node number and plant crown width were all higher under sun exposure than under shade; of these parameters, plant height, stem diameter, branch number and node number differed significantly. The areas of top and middle leaves were lower for plants under sun exposure than for those under shade; the opposite results were observed for the bottom leaf area.

Table 2 Physiological indices of P. lactiflora under sun exposure and shade treatments. Chl a ¼ chlorophyll a, Chl b ¼ chlorophyll b, Chl a/b ¼ chlorophyll a/b, Chl a þ b ¼ chlorophyll a þ b, MDA ¼ malondialdehyde, SP ¼ soluble protein, SS ¼ soluble sugar. The values represent the mean  SE, and different letters indicate significant differences (P < 0.05). Content

Sun exposure

Shade

Chl a (mg g1) Chl b (mg g1) Chl a/b Chl a þ b (mg g1) SP (mg g1) MDA (nmol g1) SP (mmol g1)

1.15 0.39 3.04 1.53 5.19 16.47 0.14

0.10a 0.04b 0.05a 0.10b 0.17a 4.47a 0.03a

1.26 0.45 2.79 1.71 3.89 11.65 0.12

      

      

0.17a 0.06a 0.33a 0.21a 0.46b 4.07b 0.03b

plants by 11.76, 9.57 and 15.38%, respectively. Among which, the increasing range of chlorophyll b was maximum which reached a significant level, while chlorophyll a/b of shaded leaves was reduced by 8.22% compared to sun-exposed leaves. In addition, the other three physiological indices of shaded plants, including soluble protein, malondialdehyde (MDA) and soluble sugar, were significantly decreased by 25.05, 29.27 and 14.29%, respectively, compared with sun-exposed plants. 2.3. Photosynthetic characteristics Considering the response curves of the net photosynthesis rate (Pn) versus photosynthetic photon quanta flux density (PPFD), the Pn values initially presented a tendency of straight climb in both sun-exposed and shaded plants accompanying with the rise of the irradiation between 0 and 300 mmol m2 s1; thereafter, the increase leveled off and a saturation point was gradually achieved (Fig. 1). Compared with the sun-exposed plants, shaded plants initially exhibited relatively higher Pn values in low light intensity, followed by significantly lower values with the increase of PPFD; the maximum difference observed was 6.13 mmolCO2 m2 s1. On the basis of an analysis of the response curves of the Pn versus PPFD, we obtained the relevant parameters listed in Table 3. We could found no significant change in dark respiration rate (Rd) value between sun-exposed and shaded plants. The maximum photosynthetic rate (Pmax), light compensation point (LCP) and light saturation point (LSP) were 34.13, 50.49 and 29.44% lower,

30

2.2. Physiological indices

Table 1 Morphological parameters of P. lactiflora under sun exposure and shade treatments. The values represent the mean  SE, and different letters indicate significant differences (P < 0.05). Morphological indices

Sun exposure

Plant height (cm) Leaf number Leaf area (cm2)

63.21 1174.33 18.06 35.05 21.31 0.44 0.65 0.94 11.33 16.33 77.40

Stem diameter (cm)

Branch number Node number Plant crown width (cm)

Top Middle Bottom Top Middle Bottom

          

4.10a 310.88a 5.43a 6.34a 7.11a 0.04a 0.08a 0.08a 2.52a 0.58a 3.13a

Shade 58.29 932.50 20.18 38.46 11.39 0.36 0.50 0.82 10.86 13.88 72.60

          

3.53b 155.03a 4.68a 6.85a 2.83b 0.05b 0.06b 0.09b 1.57b 1.96b 2.41a

Pn (umolCO2 m-2 s-1)

As shown in Table 2, we found that leaf chlorophyll a, b and a þ b contents of shaded plants were higher than those of sun-exposed

Sun exposure Shade

25 20 15 10 5 0 -5 0

500

1000

1500 -2

2000

-1

PPFD (umol m s ) Fig. 1. Relationship between the net photosynthesis rate (Pn) and the photosynthetic photon quanta flux density (PPFD) in P. lactiflora under sun exposure and shade treatments. The values represent the mean  SE.

D. Zhao et al. / Plant Physiology and Biochemistry 61 (2012) 187e196

189

Table 3 Light response model parameters of P. lactiflora under sun exposure and shade treatments. The values represent the mean  SE, and different letters indicate significant differences (P < 0.05). Pmax (mmol CO2 m2 s1)

LCP (mmol m2 s1)

a

27.655  0.612 18.217  0.207b

AQY (mmol mmol1)

a

13.286  1.361 6.578  2.303b

566.557  1.405 399.755  27.414b

respectively, in shaded plants compared to sun-exposed plants, while the apparent quantum yield (AQY) was increased by 27.40%. Fig. 2 shows the response curves of the gas exchange parameters versus PPFD. The trends of four parameters, including stomatal conduction (Gs), intercellular CO2 concentration (Ci), transpiration rate (Tr) and water utilization efficiency (WUE) were similar for sun-exposed and shaded plants. Gs and Tr values rose linearly with the increase of the PPFD; when PPFD was between 0 and 400 mmol m2 s1, Ci values declined rapidly and then increased slightly, while the trend observed for WUE was the opposite. Gs, Ci and Tr values were significantly higher for shaded plants, with average proportion were 49.39, 18.96 and 32.66%, respectively; WUE values of shaded plants were reduced by 19.03% in comparison to sun-exposed plants. Subsequently, we generated diurnal variation curves of Pn. As shown in Fig. 3, the trends of all environmental indicators were similar for both treatment groups. PPFD, air temperature and leaf temperature all increased initially and then decreased; their peaks mainly appeared from 13:00 to 14:00. The highest value of CO2 concentration appeared at 6:00 and then decreased; thereafter, second and third peaks were observed at 13:00 and 18:00, respectively. Compared with the sun-exposed plants, shaded plants exhibited PPFD values that were decrease by approximately 1/3; shade, similarly, had an impact on temperature and CO2 to some extent. As observed in Fig. 4, there were two obvious single peaks

1.000  0.000a 1.000  0.000a

0.073  0.005 0.093  0.013a

and a lunch break in the diurnal variation curve of sun-exposed plants, with peaks at 8:00, 15:00, and a trough at 13:00. However, for shaded plants, the diurnal variation curve of Pn experienced a single peak at 12:00, and no lunch break phenomenon was observed. Although there was no lunch break, the photosynthetic accumulation of shaded plants was lower than that of sun-exposed plants; the maximum Pn and total photosynthetic accumulation values of shaded plants were 87.15% and 95.49% of the values of sun-exposed plants, respectively. 2.4. Flower quality and color indices Through observation and analysis of P. lactiflora flower statistics during development, we found that shaded P. lactiflora plants exhibited later initial flowering date and flowered for a longer period of time (Table 4). Flower diameter and flower fresh weight increased gradually until S3 and then declined (Fig. 5). The flower diameter of shaded plants was slightly higher than that of sunexposed plants, but the difference was not significant; the flower fresh weight, on the other hand, was higher in sun-exposed plants than in shaded plants, and a significant difference was attained in S3 and S4. Fig. 6 shows the flowers of sun-exposed and shaded plants in the full-bloom stage. The color of petals was obviously lighter and brighter in shaded plants compared with sun-exposed plants. The

.06

Gs (mol H2O m-2 s-1)

Rd (mmol CO2 m2 s1)

b

600 Sun exposure Shade

.05

500

.04

400

.03

300

.02

200

100

.01 2.0

0

500

1000

1500

2000

0

500

1000

1500

2000

20

1.8

Tr (mmol H2O m-2 s-1)

Ci (umol CO2 mol-1)

Sun exposure Shade

LSP (mmol m2 s1)

a

15

1.6 1.4

10

1.2 5

1.0 .8

0

.6 .4

WUE (umol CO2 mmol-1 H2O)

Treatment

-5 0

500

1000

1500

2000

0

500

1000

1500

2000

PPFD (umol m-2 s-1) Fig. 2. Response curves of the gas exchange parameters, including stomatal conduction (Gs), intercellular CO2 concentration (Ci), transpiration rate (Tr) and water utilization efficiency (WUE) versus photosynthetic photon quanta flux density (PPFD) in P. lactiflora under sun exposure and shade treatments. The values represent the mean  SE.

D. Zhao et al. / Plant Physiology and Biochemistry 61 (2012) 187e196

450 Sun exposure Shade

1500

420 1000 390 500

Air temperature (oC)

0 06:00 38

360 08:00

10:00

12:00

14:00

16:00

18:0006:00

08:00

10:00

12:00

14:00

16:00

18:00

38

36

36

34

34

32

32

30

30

28

28

26

26

24

24

22 06:00

Leaf temperature (oC)

PPFD (umol m-2 s-1)

2000

CO2 concentration (umol m-2 s-1)

190

22 08:00

10:00

12:00

14:00

16:00

18:0006:00

08:00

10:00

12:00

14:00

16:00

18:00

Time Fig. 3. Diurnal variation of environmental conditions in P. lactiflora under sun exposure and shade treatments. The values represent the mean  SE.

color differences, expressed as L*, a*, b*, a*/b*, hue angle (H ) and C* are shown in Fig. 7. In the uniform color space, L* represented the lightness, a* represented the ratio of red/magenta and green and b* represented the ratio of yellow and blue. The larger value of a*/b*, the more red was [19]. In addition, H was as follows: 0 for reddish-purple, 90 for yellow, 180 for bluish-green and 270 for blue [20,21]. During the development of the flowers, L* and b* values of sun-exposed and shaded plants gradually increased, with shaded plants having higher values than sun-exposed plants; a* and a*/b* values of plants decreased, with shaded plants having lower values than sun-exposed plants. H and C*, both increased, with shaded plants having higher values than sun-exposed plants. These data showed that trends in flower color were similar for both

sun-exposed and shaded plants with only slight differences in quantity observed. As flower development proceeded, the flower color became gradually lighter and brighter for plants, though the changes in color were more obvious for shaded plants. These results were consistent with the visual results. Subsequently, we determined anthocyanin content of flower petals. The results showed that anthocyanin content declined with the development of the flowers; this trend was particularly evident in sun-exposed plants, where a reduction of 71.32% was observed from S1 to S4. Anthocyanin content in sun-exposed plants was higher than in shaded plants at each stage of development, with a 1.4-fold increase in the full-bloom stage (Fig. 8). 2.5. Isolation and sequence analysis of six anthocyanin biosynthetic genes

Pn (umol CO2 m-2 s-1)

20 Sun exposure Shade

16

12

8

To further understand the mechanism of the fade in flower color caused by shade, we isolated six genes of the anthocyanin biosynthetic pathway encoding phenylalanine ammonialyase (PAL; EC 4.3.1.5), chalcone synthase (CHS; EC 2.3.1.74), chalcone isomerase (CHI; EC 5.5.1.6), flavanone 3-hydroxylase (F3H; EC 1.14.11.9), flavonoid 30 -hydroxylase (F30 H; EC 1.14.13.21) and anthocyanidin synthase (ANS; EC 1.14.11.19). These fragments were successfully isolated by reverse-transcription polymerase chain reaction (RT-PCR) using cDNA of P. lactiflora cv. ‘Dafugui’ petals as templates, sequence analysis showed that the 717 bp PlPAL cDNA contained

4

0 06:00

08:00

10:00

12:00

14:00

16:00

18:00

Time Fig. 4. Diurnal variation of net photosynthesis rate (Pn) in P. lactiflora under sun exposure and shade treatments.

Table 4 Flowering time and stage of P. lactiflora under sun exposure and shade treatments. S1 ¼ flower-bud stage, S2 ¼ initiating bloom, S3 ¼ bloom stage, S4 ¼ withering stage. Treatment

S1

S2

S3

S4

Sun exposure Shade

29 April 3 May

3 May 6 May

5 May 10 May

8 May 15 May

D. Zhao et al. / Plant Physiology and Biochemistry 61 (2012) 187e196

191

ab a

Flower diameter (cm)

12

c

Sun exposure Shade 25

a

bc

d d

10

20

b cd

8 de

6 4

e

c

cd

c

15 10

e e

5

2

Flower fresh weight (g)

30

14

0

0 S1

S2

S3

S4

S1

S2

S3

S4

Flower developmental stage Fig. 5. Flower diameter and fresh weight of P. lactiflora under sun exposure and shade treatments. S1 ¼ flower-bud stage, S2 ¼ initiating bloom, S3 ¼ bloom stage, S4 ¼ withering stage. The values represent the mean  SE, and different letters indicate significant differences (P < 0.05).

a 605 part open reading frame (ORF) that encoded 201 amino acids. The 528 bp PlCHS cDNA encoded 175 amino acids and contained part of an ORF. Similarly, the 699 bp PlCHI cDNA contained a 654 bp ORF that encoded 217 amino acids. The 783 bp PlF3H cDNA encoded 260 amino acids and belonged to a part of the ORF. The 756 bp PlF30 H cDNA encoded 252 amino acids and contained part of an ORF. The 624 bp PlANS cDNA contained a 567 bp part ORF that encoded 188 amino acids. The comparison of identities between the fragments isolated in this study and those reported from other species is shown in Table 5, revealing that these fragments in P. lactiflora had shared high identities with those in other plant species. 2.6. Anthocyanin biosynthetic gene expression analysis To examine whether anthocyanin accumulation in the flower during its development and differences between sun-exposed and shaded plants could be related to the expression patterns of anthocyanin biosynthetic genes, the transcript levels of six genes in this study and three genes including dihydroflavonol 4-reductase gene (PlDFR, GenBank Accession No. JQ070804), UDP-glucose: flavonoid 3-O-glucosyltransferase gene (PlUF3GT, GenBank Accession No. JQ070806) together with UDP-glucose: flavonoid 5-O-glucosyltransferase gene (PlUF5GT, GenBank Accession No. JQ070807) which our laboratory registered in NCBI were analyzed by real-time quantitative polymerase chain reaction (Q-PCR) (Fig. 9). Throughout the development of the flowers, the expression

levels of the nine anthocyanin biosynthetic genes differed. The overall expression level of PlCHS was the highest, and that of PlF5GT was the lowest with almost undetectable levels in S3 and S4; the other seven genes transcripts were expressed at various levels throughout the development of the flowers. During the different developmental stages, the detected genes were all expressed with a certain regularity with the exception of PlF3GT. PlPAL and PlF3’H, which were initially abundantly expressed, and then subsequently gradually expressed at lower levels and finally slightly increased levels in S4. Expression levels of PlCHS, PlF3H, PlDFR, PlANS and PlF5GT declined with the development of the flowers; only PlCHI expression level increased, but this increase did not affect the overall trend of the declining anthocyanin content. Considering the effects of shade and the developmental stages of the flowers together, we found that anthocyanin biosynthetic gene expression levels were consistent with anthocyanin contents; in S1 and S2, the expression levels of upstream PlPAL and PlCHS and of downstream PlF3H and PlF3’H were much higher in sun-exposed plants than in shaded plants, while other gene expression levels were slightly lower. These differences caused anthocyanin contents in sunexposed plants to be much higher than those in shaded plants (1.91 times higher in S1 and 1.67 times higher in S2); in S3 and S4, the expression levels of PlPAL and PlCHS in sun-exposed plants were still far higher than those in shaded plants, but the expression levels of other downstream genes were either far lower than or equal to those of shaded plants, which caused anthocyanin contents in sun-exposed plants to be only slightly higher than those found in shaded plants (1.40 times higher in S3 and 1.17 times higher in S4). Therefore, the anthocyanin contents, influenced by shade, were coordinately regulated by all genes in the anthocyanin biosynthetic pathway. 3. Discussion

Fig. 6. Flowers of P. lactiflora in the bloom stage under sun exposure and shade treatments. Bar ¼ 2 cm.

Shade is a commonly used tool in the cultivation of horticultural plants; it can influence plant growth and development by changing the plant niche [14], and its most visual effect is plant morphological change. Previous studies have suggested that shaded plants preferentially supplied photosynthetic products to leaves that were beneficial to their growth, which could partially compensate for the decrease in growth rate due to reduced light energy; additionally, shade could also decrease the plant canopy and distribute assimilated carbon to the vertical growth to furthest capture light energy [22,23]. These observations were all confirmed by our present study. Additionally, other morphological parameters of P. lactiflora,

192

D. Zhao et al. / Plant Physiology and Biochemistry 61 (2012) 187e196

16 14

10

Sun exposure b Shade

c a

e

a

b

d

12 10

b

e f e

f

a a 8

c

d

6

8 4

6 4

2

2 0

0 S1 3

a

S2

S3

S4

S1

S3

S4 .6

a

a

S2

b

b 2

.4

c

c

1

d

.2

0 0.0

-1

d e

-2

e

-3 S1

S2

S3

e

-.2

f

e

S4

S1

S2

S3

10

a a

f

d

b a

c g

e

e

-.4

S4 120 100

d

c d

6

a

b

8

a

f

f

80 60

4 40 2

20

0

0 S1

S2

S3

S4

S1

S2

S3

S4

Flower developmental stage Fig. 7. Flower color changes of P. lactiflora under sun exposure and shade treatments. S1 ¼ flower-bud stage, S2 ¼ initiating bloom, S3 ¼ bloom stage, S4 ¼ withering stage. The values represent the mean  SE, and different letters indicate significant differences (P < 0.05).

such as plant height, leaf number, stem diameter, branch number and node number, all decreased in shaded plants, indicating that shade reduced P. lactiflora growth vigor. Previous studies had shown that shade could greatly alter the contents of leaf photosynthetic pigments, of which chlorophyll a þ b and a/b were important indicators for assessing plant shade tolerance, and shade tolerant plants had high chlorophyll a þ b contents and low chlorophyll a/b values [24,25]. In this study, leaf chlorophyll a þ b, a and b contents all increased in shaded plants compared to sun-exposed plants, and increasing range of chlorophyll b was maximum, while chlorophyll a/b was decreased. These differences were consistent with those observed in studies of Acer pseudoplatanus, Fagus sylvatica, Tilia cordata, Abies alba [26], indicating that P. lactiflora had shade-tolerant capabilities to some extent. In addition, soluble protein levels in plants were relatively stable, the contents of shaded plant leaves declining indicated that various enzymes contents including Rubisco gradually declined [27]. Subsequently, leaf photosynthesis and soluble sugar content decreased. However, leaf MDA content was lower in shaded plants

than in sun-exposed plants, which might be associated with the adaptive physiological regulation of plant, and this shade did not appear to harm P. lactiflora. Photosynthesis is an indicator of plant growth capacity. Generally, the sun-exposed leaf is described as requiring a higher PPFD and having a higher Pn than the corresponding shaded leaf [28]. Under the shade treatment, the leaf light response curve of P. lactiflora was significantly lower than under sun exposure, with lower Pmax, LSP and LCP and higher AQY observed. These results were consistent with the results obtained in studies of P. volubilis [10], and suggested that P. lactiflora improved light use efficiency in shade. However, the Rd of the leaf light response curve was the same for sun-exposed and shaded plants, suggesting that the accumulation of photosynthetic products was relatively low. Stomata are the main gas exchange channels between plant leaves and the outside world; the larger the Gs value, the more beneficial the gas exchange of CO2 in the air to maintain normal life activities [25]. Gas exchange parameter analysis showed that sun-exposed leaves had higher Tr and Ci, lower WUE, and significantly higher

Anthocyanin content (OD530 g-1 FW)

D. Zhao et al. / Plant Physiology and Biochemistry 61 (2012) 187e196

.8 Sun exposure Shade

.7 .6 .5 .4 .3 .2 .1 S1

S2

S3

S4

Flower developmental stage Fig. 8. Flower anthocyanin content of P. lactiflora under sun exposure and shade treatments. S1 ¼ flower-bud stage, S2 ¼ initiating bloom, S3 ¼ bloom stage, S4 ¼ withering stage. The values represent the mean  SE.

Gs than shaded plant leaves. Therefore, we speculated that decreased Gs caused by shade might be the main reason for the decline in photosynthetic capacity. Although shade eliminated the lunch break phenomenon, photosynthetic accumulation and Pmax in diurnal variation of shaded plant leaves were lower than in leaves of sun-exposed plants. On the other hand, our results showed that a higher photosynthetic capacity exhibited higher values for chlorophyll a/b [26]. Shade still has some impact on flower quality of ornamental plants. Baloch et al. found that shade could achieve prolonged flowering time in long-day plants while short-day plants could be grown under shade if an early flowering was required [29]. In P. volubilis, shade delayed initial flowering date and decreased flower biomass [10]. In Paeonia suffruticosa, a plant from the same family as P. lactiflora, shade could delay flowering stage by 4e6 days and decrease or increase flower diameter [30,31]. The results of this study were similar to the results reported in studies of these other plants, and only flower diameter slightly increased in shaded plants compared with sun-exposed plants, although this difference was not significant. These effects were mainly due to decreased leaf photosynthesis, which was not conducive to the accumulation of photosynthetic products, especially soluble sugar, resulting in an inadequate supply of growth substrate supply. In addition, shade

Table 5 Identities of anthocyanin biosynthetic genes in P. lactiflora and other plant species. Gene

Species

Identity (%)

Accession no.

PAL

Populus tremuloides Populus trichocarpa Vitis vinifera Paeonia suffruticosa Populus alba Populus trichocarpa P. suffruticosa Camellia nitidissima Camellia sinensis Rubus occidentalis Vitis vinifera Pyrus pyrifolia Camellia nitidissima Camellia sinensis Vitis vinifera Vitis vinifera Theobroma cacao Pyrus communis

82 81 75 98 83 83 95 79 78 82 81 80 78 77 75 83 81 80

AF480619 EU603319 XM_003633939 JN105300 DQ371803 XM_002321045 JN105297 HQ269805 DQ120521 FJ554630 XM_002267604 GU390545 HQ290518 GQ438849 XM_002284115 EF192468 GU324350 DQ230994

CHS

CHI

F3H

F30 H

ANS

193

faded P. suffruticosa flower color, mainly due to the significant reduction in anthocyanin content; spraying sucrose could markedly increase petal anthocyanin content [30,32]. In the sweet potato [33] and amaranth [34], the anthocyanin contents of shaded plant leaves also significantly declined. The flower color of P. lactiflora also faded and anthocyanin content significantly declined in shaded plants; this was mainly a result of an inadequate soluble sugar supply that was material basis needed to be translated into anthocyanin [30,32]; However, light could regulate related anthocyanin biosynthetic enzymes activities according to a certain mechanism; PAL, which is the first enzyme of the phenylpropanoid pathway and closely related to the synthesis of lignin, stilbenes, coumarins and anthocyanins, could have been particularly affected [30,35]. CHS catalyzes the first and key regulatory step of the anthocyanin biosynthetic pathway; its expression level determines the content of anthocyanins directly and influences the formation of flower color. In many plants, flower petals become white or have irregular white stripes when the expression of CHS is inhibited [36]. Our molecular biology studies showed that the fade of flower color in shaded plants was the result of the cooperative action of all anthocyanin biosynthetic genes, especially the upstream PlPAL and PlCHS. The expression levels of these two genes were significantly decreased, which induced significant decline of the upstream substrate of anthocyanin synthesis, thereby reducing the content of anthocyanins and fading the flower color. Meanwhile, PlCHI, PlDFR and PlF3GT were up-regulated under shady conditions, which could have resulted in the content change of various anthocyanin components in P. lactiflora. In conclusion, shade caused P. lactiflora morphology parameters, soluble protein content, photosynthetic capacity and soluble sugar content to decrease, and flower color to fade. These changes all revealed that shade had some harmful effects on P. lactiflora, which is a high-light demanding species. However, increased top and middle leaf areas and chlorophyll content, as well as reduced MDA content suggested that P. lactiflora also had a certain adaptability to shade through auto-regulation. Moreover, prolonged flowering time and increased flower diameter not only delayed period of viewing flowers but also improved ornamental quality. Shade could be used to control flower color. Therefore, an optimized plant management practice should be adopted to ensure that P. lactiflora be successfully grown in urban green spaces or understories with part shade. 4. Materials and methods 4.1. Plant materials P. lactiflora was grown in the germplasm repository of Horticulture and Plant Protection College, Yangzhou University, Jiangsu Province, P. R. China (32 300 N, 119 250 E). ‘Dafugui’ were used as materials in this study, the plants were grown in the similar conditions, some plants were shaded while others grew in the open ground upon emergence of buds in March. Transmittance of the black shade net used in this experiment was approximately 60%, and the height of the shade-frame was 1.2 m. In the full-bloom stage, plant morphological parameters were measured and leaves were used for determination of physiological indices. Flower petals of four different developmental stages were taken and used to study flower color, after flower quality and color parameter measurements, all samples were immediately frozen in liquid nitrogen and stored at 80  C until analysis. 4.2. Measurement of morphological parameters Plant height and crown width were measured using a meter stick (Zhejiang Yuyao Sanxin Measuring Tools Co., Ltd., China); stem

10

1.2 1.0

8

.8

6 .6

4 .4

2

.2

0

0.0 S3

S4

S1

S2

S3

S4

.45

1.6 1.4 1.2

.30

1.0 .8 .6

.15

.4 .2

0.00

0.0 S2

S3

S4

S1

S2

S3

S4 25

.12

20 .10

15 10

.08

5 1 0.07

.06 .04 .02

0

0.00

PlANS relative expression level

S1

S2

S3

S4

S1

S2

S3

S4

4

.9

3 .6 2 .3 1

0

0.0 S1

S2

S3

S4

S1

S2

S3

PlDFR relative expression level

PlF3'H relative expression level

S1

PlF5GT relative expression level

PlF3H relative expression level

S2

PlF3GT relative expression level

PlCHI relative expression level

S1

PlCHS relative expression level

D. Zhao et al. / Plant Physiology and Biochemistry 61 (2012) 187e196

PlPAL relative expression level

194

S4

.06 .05 .04

Sun exposure Shade

.03 .02 .01 0.00 S1

S2

S3

S4

Flower developmental stage Fig. 9. Anthocyanin biosynthetic genes expression patterns of P. lactiflora under sun exposure and shade treatments. S1 ¼ flower-bud stage, S2 ¼ initiating bloom, S3 ¼ bloom stage, S4 ¼ withering stage. The values represent the mean  SE.

D. Zhao et al. / Plant Physiology and Biochemistry 61 (2012) 187e196

diameter was measured using a micrometer scale (Taizhou Xinshangliang Measuring Tools Co., Ltd., China); and leaf area was determined according to a paper weighing method. 4.3. Determination of physiological indices Chlorophyll, soluble protein, MDA and soluble sugar contents were determined according to the method reported by Zou [37], and anthocyanin content analysis was performed with the method reported by Meng et al. [38].

195

Table 7 Primers sequence for detection by real-time quantitative polymerase chain reaction. Gene

Forward primer (50 e30 )

Reverse primer (50 e30 )

Actin PAL CHS CHI F3H F3’H DFR ANS F3GT F5GT

GCAGTGTTCCCCAGTATT ACATTCTCGCCACTACCA CACCCACCTTGTTTTCTG TCCCACCTGGTTCTTCTA AGTTCTTCGCTTTACCGC TGGCTACTACATTCCAAAAG CTTCCTGTGGAAAAGAACC AGGAGAAGATCATACTCAAG AACACCGAATGCCTAAAC GAAGCGTCTCTGTTTTACC

TCTTTTCCATGTCATCCC CTTCCGAAATTCCTCCAC CCCTTTGTTGTTCTCTGC AACTCTGCTTTGCTTCCG CAATCTCGCACAGCCTCT CCAAACGGTATAACCTCAA CCAAAAACAAACCAGAGATC ACAAAGAAGCACAAAGGCAC AGCCACCCATCACTAAAT CTCCTTGTCTCCATCTCG

4.4. Determination of photosynthetic characteristics In the full-bloom stage, the fully expanded leaves at the fourth apical node were selected to measure photosynthetic characteristics using a portable photosynthesis system (LI-6400, Li-Cor, Lincoln, NE, USA) on a clear day. On a light response curve, PPFD was located on the horizontal axis and Pn was on the vertical axis (PnePPFD curve); the Pmax, LSP, LCP, AQY and Rd were determined. A diurnal curve of Pn was measured from 06:00 to 18:00 once an hour. The curves of some environmental factors, such as PPFD, CO2 concentration, air temperature and leaf temperature, were also recorded.

4.8. Purifying, cloning and sequencing

4.5. Measurements of flower quality and color indices

4.9. Gene expression analysis

Flower fresh weight was the average value of ten flowers determined using a balance (Gandg Testing Instrument Factory, China), and the diameter was measured by a micrometer scale. Flower color indices were measured on a TC-P2A chroma meter (Beijing Optical Instrument Factory, China) using three color parameters including L*, a* and b* values. The hue angle (H ¼ arctangent (b*/a*)) and chroma (C*¼(a*2 þ b*2)1/2) were calculated according to the methods reported previously [39].

Gene transcript levels were analyzed using Q-PCR with a BIORAD CFX96Ô Real-Time System (C1000Ô Thermal Cycler) (BioRad, USA). The cDNA was synthesized from 1 mg RNA using a PrimeScriptÒ RT reagent Kit with gDNA Eraser (TaKaRa, Japan). P. lactiflora Actin (JN105299) was used as an internal control. All gene-specific primers used in this study for Q-PCR are shown in Table 7. Q-PCR was performed using the SYBRÒ Premix Ex TaqÔ (Perfect Real Time) (TaKaRa, Japan) and contained 2 SYBR Premix Ex TaqÔ 12.5 ml, 50 ROX Reference Dye II 0.5 ml, 2 ml cDNA solution as a template, 2 ml mix solution of target gene primers and 8 ml ddH2O in a final volume of 25 ml. The amplification was carried out under the following conditions: 50  C for 2 min followed by an initial denaturation step at 95  C for 5 min, 40 cycles at 95  C for 15 s, 51  C for 15 s, and 72  C for 40 s. Relative expression levels of target genes were calculated by the 2DDCt comparative threshold cycle (Ct) method, and the expression level of PAL in S1 of sunexposed plants was used as the control. The Ct values of the triplicate reactions were gathered using the Bio-Rad CFX Manager V1.6.541.1028 software.

4.6. RNA extraction and purification Total RNA was extracted according to a modified CTAB extraction protocol used in our laboratory [40]. Prior to reverse-transcription, RNA samples were treated with DNase using a DNase I kit (TaKaRa, Japan) according to the manufacturer’s guidelines, and then quantified with a spectrophotometer (Eppendorf, Germany) at 260 nm. 4.7. Isolation of six anthocyanin biosynthetic genes RT-PCR was performed with 1 mg total RNA using a PrimeScriptÔ 1st Strand cDNA Synthesis Kit (TaKaRa, Japan) with specific primers (Table 6); amplification was performed under the following conditions: 94  C denaturation for 3 min, 35 running cycles of 94  C for 30 s, 50  C for 30 s, 72  C for 70 s, and an elongation cycle of 72  C for 10 min.

Table 6 Primers sequence for isolation of six anthocyanin biosynthetic genes. Gene

Forward primer (50 e30 )

Reverse primer (50 e30 )

PAL CHS CHI F3H F3’H ANS

TCAACAGCCTCAGGGAAA CCACCCCTGCTCATTGTA GTAACAGCTAACACCAGAAG GAACAATGGCTCCTACGG ATGAAGAATCTACACGCCAG GATTACATTGAGGCAACCAG

GCAATGTAGGACAGTGGG GTCCACGAAATGTCACCG GGCAGGGTATATATAAGTGATGC CAAGGTTGACGACGAAAG CAGGGTCAATCCATAAGC ACAAAGAAGCACAAAGGCAC

PCR products were separated by 1% agarose gel electrophoresis, and the incised gels were purified using a TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.3.0 (TaKaRa, Japan). The extracted products were cloned into pEASYÔ-T5 Zero vector (Trans, China) and transformed into competent Escherichia coli Trans1-T1 cells (Trans, China). The recombinant plasmids were sent Shanghai Sangon Biological Engineering Technology & Services Co., Ltd. (Shanghai, China) to sequence.

4.10. Sequence and statistical analysis Sequence splicing and analysis were performed by DNAMAN 5.0 software (Lynnon Corporation, Canada). Homology analysis was carried out using the GenBank BLAST (http://www.ncbi.nlm.nih. gov/blast/). Light response curve fitting and related parameter estimation were completed by SigmaPlot 10.0 (SPSS Inc., USA) and SPSS16.0 (IBM Co., USA). All data were means of three replicates at least with standard deviations. The results were analyzed for variance using the SAS/STAT statistical analysis package (version 6.12, SAS Institute, Cary, NC, USA). Acknowledgments This work was financially supported by Agricultural Science & Technology Independent Innovation Fund of Jiangsu Province (CX [11]1017, CX [12]4052), Agricultural Science & Technology Support Project of Jiangsu Province (BE2011325), and A Project Funded by

196

D. Zhao et al. / Plant Physiology and Biochemistry 61 (2012) 187e196

the Priority Academic Program Development of Jiangsu Higher Education Institutions. References [1] Y.G. Liu, J. Lv, H.P. Zhang, J.H. Xu, Distribution law of air anions in a large artificial garden, J. Cent. South For. Univ. 23 (2003) 89e92 (in Chinese). [2] J. Eason, T. Pinkney, J. Heyes, D. Brash, B. Bycroft, Effect of storage temperature and harvest bud maturity on bud opening and vase life of Paeonia lactiflora cultivars, New Zealand, J. Crop Hortic. Sci. 30 (2002) 61e67. [3] E.F. Waltona, H.L. Boldinghb, G.F. McLarenc, M.H. Williamsa, R. Jackman, The dynamics of starch and sugar utilisation in cut peony (Paeonia lactiflora Pall.) stems during storage and vase life, Postharvest Biol. Technol. 58 (2010) 142e146. [4] N. Jia, Q.Y. Shu, D.H. Wang, L.S. Wang, Z.A. Liu, H.X. Ren, Identification and characterization of anthocyanins by high-performance liquid chromatographyeelectrospray ionization-mass spectrometry in herbaceous peony species, J. Am. Soc. Hortic. Sci. 133 (2008) 418e426. [5] J.G. Wang, Z.S. Zhang, in: J.G. Wang, Z.S. Zhang (Eds.), Herbaceous Peonies of China, China Forestry Publishing House, Beijing, 2005, p. 3 (in Chinese). [6] S. Lee, C.S. Khoo, J.R. Hennell, J.L. Pearson, M. Jarouche, C.W. Halstead, A. Bensoussan, LC determination of albiflorin and paeoniflorin in bai shao (Paeonia lactiflora) as a raw herb and dried aqueous extract, J. AOAC. Int. 92 (2009) 1027e1034. [7] C.H. Zhou, Y. Zhang, Y.L. Sheng, D.Q. Zhao, S.S. Lv, Y. Hu, J. Tao, Herbaceous peony (Paeonia lactiflora Pall.) as an alternative source of oleanolic and ursolic acids, Int. J. Mol. Sci. 12 (2011) 655e667. [8] J.S. Boyer, Plant productivity and environment, Science 218 (1982) 443e448. [9] Y.J. Dai, Z.G. Shen, Y. Liu, L.L. Wang, D. Hannaway, H.F. Lu, Effects of shade treatments on the photosynthetic capacity, chlorophyll fluorescence, and chlorophyll content of Tetrastigma hemsleyanum Diels et Gilg, Environ. Exp. Bot. 65 (2009) 177e182. [10] Z.Q. Cai, Shade delayed flowering and decreased photosynthesis, growth and yield of Sacha Inchi (Plukenetia volubilis) plants, Ind. Crop Prod. 34 (2011) 1235e1237. [11] Y.M. Deng, C.C. Li, Q.S. Shao, X.Q. Ye, J.M. She, Differential responses of double petal and multi petal jasmine to shading: I. Photosynthetic characteristics and chloroplast ultrastructure, Plant Physiol. Biochem. 55 (2012) 93e102. [12] J.B. Cavagnaro, S.O. Trione, Physiological, morphological and biochemical responses to shade of Trichloris crinita, a forage grass from the arid zone of Argentina, J. Arid Environ. 68 (2007) 337e347. [13] M. Bertaminia, K. Muthuchelianb, M. Rubinigga, R. Zorera, R. Velascoa, N. Nedunchezhiana, Low-night temperature increased the photoinhibition of photosynthesis in grapevine (Vitis vinifera L. cv Riesling) leaves, Environ. Exp. Bot. 57 (2006) 25e31. [14] R. Song, D. Kelman, K.L. Johns, A.D. Wright, Correlation between leaf age, shade levels, and characteristic beneficial natural constituents of tea (Camellia sinensis) grown in Hawaii, Food Chem. 133 (2012) 707e714. [15] R.E. Jaimez, F. Rada, Flowering and fruit production dynamics of sweet pepper (Capsicum chinense Jacq) under different shade conditions in a humid tropical region, J. Sustain. Agric. 27 (2006) 97e108. [16] M. Lugassi-Ben-Hamo, M. Kitron, A. Bustan, M. Zaccai, Effect of shade regime on flower development, yield and quality in lisianthus, Sci. Hortic-Amsterdam 124 (2010) 248e253. [17] S.C. Flavia, C.S. Gilda, C.C. Fabiola, Effect of four shading levels on flower stem and corm quality of liatris (Liatris spicata), Agric. Téc. 67 (2007) 100e104. [18] H.M. Joesting, B.C. McCarthy, K.J. Brown, Determining the shade tolerance of American chestnut using morphological and physiological leaf parameters, Forest Ecol. Manage. 257 (2009) 280e286.

[19] M.J. Rodrigo, J.F. Marcos, L. Zacarías, Biochemical and molecular analysis of carotenoid biosynthesis in flavedo of orange (Citrus sinensis L.) during fruit development and maturation, J. Agric. Food Chem. 52 (2004) 6724e6731. [20] C.H. Crisosto, D. Garner, G.M. Crisosto, S. Sibbett, K.R. Day, Late harvest and delayed cooling induce internal browning of ‘Ya Li’ and ‘Seuri’ Chinese pears, HortScience 29 (1994) 667e670. [21] D. Intelmann, D. Jaros, H. Rohm, Identification of color optima of commercial tomato catsup, Eur. Food Res. Technol. 22 (2005) 662e666. [22] D.A. King, Allometry of sap lings and understory trees of a Panamanian forest, Funct. Ecol. 4 (1990) 27e32. [23] N.B. Wu, F. Tan, Studies of water regimes of Cinnamomum pauciflorum seedlings grown under different light intensity conditions, J. Southwest Agric. Univ. 27 (2002) 755e758 (in Chinese). [24] C. Wittmann, G. Aschan, H. Pfanz, Leaf and twig photosynthesis of young beech (Fagus sylvatica) and aspen (Populus tremula) trees grown under different light regime, Basic Appl. Ecol. 2 (2001) 145e154. [25] B.B. Zhang, W.B. Jiang, M.L. Weng, J. Han, Research progress on photosynthetic characteristics of horticulture and landscape tree species under shading condition, Nonwood Forest Res. 27 (2009) 115e119 (in Chinese). [26] H.K. Lichtenthaler, A. Ac, M.V. Marek, J. Kalina, O. Urban, Differences in pigment composition, photosynthetic rates and chlorophyll fluorescence images of sun and shade leaves of four tree species, Plant Physiol. Biochem. 45 (2007) 577e588. [27] H. Wang, Y.P. Jiang, K. Shi, Y.H. Zhou, J.Q. Yu, Effects of light quality on leaf senescence and activities of antioxidant enzymes in cucumber plants, Sci. Agric. Sin. 43 (2010) 529e534 (in Chinese). [28] H.K. Lichtenthaler, Adaptation of leaves and chloroplasts to high quanta fluence rates, in: G. Akoyunoglou (Ed.), Photosynthesis, Balaban International Science Services, Philadelphia, 1981, pp. 273e287. [29] J.U.D. Baloch, M.Q. Khan, M. Zubair, M. Munir, Effects of different shade levels (light integrals) on time to flowering of important ornamental annuals, Int. J. Agric. Biol. 11 (2009) 138e144. [30] X.F. Guo, G.A. Shi, X.S. Kong, C.P. Bai, X.Y. Liu, Z.W. Jin, Effects of sucrose on physiological characters and flower quality of tree peony in shady condition, J. Henan Univ. Sci. Tech. (Agric. Sci.) 23 (2003) 15e18 (in Chinese). [31] Y. Zhu, H. Song, S.W. Zhao, L.Y. Wang, Effect of shading treatment on photosynthetic characteristics and flower quality of Paeonia suffruticosa, Acta Bot. Boreal. -Occid. Sin. 32 (2012) 0731e0738 (in Chinese). [32] Q.S. Yang, L.J. Zhu, L. Lu, X.Z. Lu, Effects of shading and extraneous source sucrose on petal color and the photosynthetic characteristics in Paeonia suffruticosa, J. Henan Agric. Univ. 39 (2005) 249e252 (in Chinese). [33] M.S. Islam, M. Jalaluddin, J.O. Garner, M. Yoshimoto, O. Yamakawa, Artificial shading and temperature influence on anthocyanin compositions in sweetpotato leaves, HortScience 40 (2005) 176e180. [34] M.B. Ali, L. Khandaker, S. Oba, Changes in pigments, total polyphenol, antioxidant activity and color parameters of red and green edible amaranth leaves under different shade levels, J. Food Agric. Environ. 8 (2010) 217e222. [35] S.L. Zhang, K.S. Chen, in: S.L. Zhang, K.S. Chen (Eds.), Molecular Physiology of Fruit Quality Development and Regulation, China Agriculture Press, Beijing, 2007, p. 168 (in Chinese). [36] K. Hu, L. Meng, K.T. Han, Y. Sun, S.L. Dai, Isolation and expression analysis of key genes involved in anthocyan in biosynthesis of cineraria, Acta Hortic. Sin. 36 (2009) 1013e1022 (in Chinese). [37] Q. Zou, in: Q. Zou (Ed.), Plant Physiology Experimental Guidance, China Agricultural Press, Beijing, 2000, pp. 102e103 (in Chinese). [38] X.C. Meng, X.J. Wang, Regulation of flower development and anthocyanin accumulation in Gerbera hybrida, J. Hortic. Sci. Biotech. 79 (2004) 131e137. [39] R.G. McGuire, Reporting of objective colour measurements, HortScience 27 (1992) 1254e1255. [40] D.Q. Zhao, C.H. Zhou, F. Kong, J. Tao, Cloning of phytoene desaturase and expression analysis of carotenogenic genes in persimmon (Diospyros kaki L.) fruits, Mol. Biol. Rep. 38 (2011) 3935e3943.