Effects of short term triiodothyronine administration to broiler chickens fed methimazole

Comparative Biochemistry and Physiology, Part C 150 (2009) 72–78

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part C j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / c b p c

Effects of short term triiodothyronine administration to broiler chickens fed methimazole☆ R.W. Rosebrough ⁎, B.A. Russell, M.P. Richards Animal Biosciences and Biotechnology Laboratory, Animal and Natural Resources Institute, United States Department of Agriculture–Agricultural Research Service, Beltsville Agricultural Research Center, Beltsville, MD 20705, USA

a r t i c l e

i n f o

Article history: Received 12 September 2008 Received in revised form 19 February 2009 Accepted 20 February 2009 Available online 6 March 2009 Keywords: Triiodothyronine Methimazole Broiler chickens (Galus galus) Metabolic changes

a b s t r a c t The purposes of these experiments were to determine possible relationships among certain indices of lipid metabolism and specific gene expression in chickens (Gallus gallus) fed methimazole (MMI) and the subsequent effects of providing supplemental T3 to relieve the effects of MMI. Male, broiler chickens growing from 14 to 28 days of age were fed diets containing 18% crude protein and either 0 or 1 g MMI/kg of diet. At 28 days, birds received 18% crude protein diets containing either 0 or 1 mg triiodothyronine (T3)/kg. Birds were sampled at 0, 1, 2 & 4 days post relief from MMI or at 0, 3, 6, 9, 24 & 48 h. Measurements taken in the first experiment included in vitro lipogenesis (IVL), malic enzyme (ME), isocitrate dehydrogenase (ICDNADP), aspartate aminotransferase (AST) enzyme activities and the expression of the genes for ME, fatty acid synthase (FAS) and acetyl coenzyme carboxylase (ACC), ICD and AST. The same enzyme activities and gene expressions were assayed over the intervals mentioned above. In vitro lipogenesis was eliminated due to constraints imposed by sampling times. Gene expression was estimated with real time RT-PCR assays. Dietary MMI decreased IVL and ME at 28 days of age. T3 supplementation for 1 day restored both IVL and ME. Continuing T3 replenishment decreased IVL without affecting ME activity. Although MMI decreased ME gene expression, there was only a transitory relationship between enzyme activity and gene expression when apparent thyroid function was restored with exogenous T3. Metabolic changes in response to feeding T3 occurred within a short period, suggesting that changes in intermediary metabolism preceded morphological changes. Furthermore, the thyroid state of the animal will determine responses to exogenous T3. Published by Elsevier Inc.

1. Introduction Although the thyroid gland partially controls avian growth, artificial changes in thyroid hormone levels do not always change growth predictably. Leung et al. (1985) reported that dietary triiodothyronine (T3) and thyroxine (T4) decreased body weight and feed efficiency of chickens. Feeding T3 to increase plasma T3 failed to improve growth of dwarf chickens according Leung et al. (1984a). On the other hand, long-term, dietary administration of thyroid hormones in another study decreased both growth and fat deposition, with T3 being more effective than T4 (Decuypere et al., 1987). Other sets of early data also suggested that dietary T3 decreased body fat (Leung et al., 1984b) as well as plasma GH concentrations (Harvey, 1983). It should also be noted that chemical hypothyroidism, caused by either

☆ Mention of a trade name, proprietary product or vendor does not constitute a guarantee or warranty of the product by USDA or imply its approval to the exclusion of other suitable products or vendors. ⁎ Corresponding author. Bldg 200 Rm 212, BARC-EAST, 10300 Baltimore Avenue, Beltsville, MD 20705, USA. Fax: +1 301 504 8623. E-mail address: [email protected] (R.W. Rosebrough). 1532-0456/$ – see front matter. Published by Elsevier Inc. doi:10.1016/j.cbpc.2009.02.009

propylthiouracil (PTU) or MMI, also decreased growth (Leung et al., 1984a,b; Chiasson et al., 1979). What is lacking from these reports is information concerning birds' recovery from thyroid hormone perturbations (inhibition of T3 production by feeding MMI). Recently, we have proposed and tested the hypothesis that feeding T3 after a 3-week MMI challenge would rapidly restore circulating levels of T3. Methimazole (1-methyl-2mercaptimidazole), used to induce hypothyroid status in the present experiments, inhibits thyroidal production of thyroid hormones, but does not directly affect extrathyroidal 5′deiodination of T4. Malic (ME) enzyme activity was monitored because of its role in providing reducing equivalents (NADPH) for the synthesis of fatty acids. Isocitrate: NADP+ oxidoreductase-[decarboxylating] (ICD) may function as both a residual source for the provision of NADPH and for a coreactant for transamination (α-ketoglutarate). Aspartate aminotransferase (AAT) aids in the removal of excess amine groups formed by feeding high-protein diets by using the previously mentioned αketoglutarate as an amine acceptor (Rosebrough et al., 1988). The purposes of this experiment were to further study the metabolic effects of feeding MMI and repletion of plasma thyroid hormones and to determine if changes in the levels of mRNA for certain lipogenic enzymes relate to changes in metabolic rates associated with

R.W. Rosebrough et al. / Comparative Biochemistry and Physiology, Part C 150 (2009) 72–78

altered thyroid states. We chose to analyze ME, ACC, FAS, ICD and AAT gene expressions because of its central role in providing reducing equivalents, metabolic intermediates and cofactors either supporting or inhibiting de novo lipogenesis. In addition, the rate limiting enzymes of lipogenesis (ACC and FAS) were estimated in vitro by noting lipids formed in vitro when the substrate is acetate (Rosebrough et al., 1988). 2. Materials and methods Experiment 1. At 14 days of age, male, broiler chickens (Gallus gallus) were assigned to one of two dietary treatments (Table 1; 18% crude protein + 0 or 1 g MMI/kg diet) for a 14–28-day growth trial. At 28 days, the chickens were given a diet containing 18% crude protein + 0 or 1 mg T3 (T3)/kg to result in two treatment groups (MMIControl, MMI-T3). The first letter denoted the treatment from 7 to 28 days and the second letter the treatment from 28 to 32 days. The chickens were housed in battery-brooders (4 birds/pen, 900 cm2/ pen) in an environmentally controlled room maintained at 20–23 C with a 12-h light–dark cycle (0600–1800 h light). Chickens were selected at 0800 to minimize diurnal variation. One chicken was then randomly selected from each of four pen replicates at 28, 29, 30 and 32 days, weighed, and killed by decapitation. The livers were rapidly removed, sectioned into a PBS buffer and washed to remove blood and debris or snap frozen in liquid N2. Experiment 2. Birds were sampled at 0, 3, 6, 9, 24 & 48 h post relief from MMI. The same enzyme activities and gene expressions were assayed over the intervals mentioned above. IVL was eliminated due to constraints imposed by sampling times. 2.1. In vitro techniques 2.1.1. In vitro metabolism—lipogenesis Livers were sliced (MacIlwain Tissue Chopper; 0.3 mm). Quadruplicate explants were incubated at 37 °C for 2 h in Hanks' balanced salts containing 10 mM-HEPES and 10 mM-sodium [2-14C] acetate (166 MBq/mol). All incubations were conducted in 3-mL volumes at 37 °C for 2 h under a 95% O2-5% CO2 atmosphere. At the end of the stated incubation periods, the explants were placed in 10 mL of 2:1

Table 1 Composition of the basal diet. Ingredient (g/kg) Soybean meal Corn meal Corn oil Sand Dicalcium phosphate Limestone Sodium Chloride L-methioninea Selenium premixb Mineral premixc Vitamin premixd Cellulose

258 628 35 7 40 10 3 5 1 1 5 7

Calculated composition Metabolizable energy (MJ/kg) Crude protein (g/kg) Lysine (g/kg) Sulfur amino acids (g/kg)

13.0 183 9.6 9.5

73

Table 2 Oligonucleotide PCR primers1. Gene

Accession number

Primer sequence (5′ → 3′)

Orientation

Product size (bp)

β actin

L08165 J03541

FAS

J04485

ME

AF408407

AST

M12105

ICD

XM42196C5

Sense Anti sense Sense Anti sense Sense Anti sense Sense Anti sense Sense Anti sense Sense Anti sense

300

ACC

TGCGTGACATCAAGGAGAAG TGCCAGGGTACATTGTGGTA ACCCCTTCATAGACCCCATC CACTTCGAGGCGAAAAACTC GGAGTCAAACTACTTATCCATGGCC AAAGGAGATTCCAGCATCGTGCAGC AAGATTGCAGTGAGGATTGC TTCAGGCCAGGTGTATGAGT ATCCTCATCCGTCCCATGTA GTCAGTGATGTGCTGCCAGT CCAGTTTGAAGCCAAGAAG TCAACAGTCTTGCCATCAGG

447 423 200 201 197

1 ACC = Acetyl-CoA Carboxylase; FAS = Fatty Acid Synthase; ME = Malic Enzyme, AST = Aspartate Aminotransferase, NADP-ICD = NADP-Isocitrate dehydrogenase.

chloroform: methanol for 18 h according to Folch et al. (1957). The extracts were evaporated to dryness and dispersed in scintillation fluid. Radioactivity in the extracts was measured by liquid scintillation spectroscopy. In vitro lipogenesis (IVL) was expressed as μmol of acetate incorporated into lipids/g of tissue. 2.1.2. In vitro metabolism—enzyme assays Remaining liver tissues were homogenized (1:10, wt/vol.) in 50 mM-HEPES (pH 7.5)-3.3 mM-β-mercaptoethanol and centrifuged at 12,000 g for 30 min. The supernatant fractions were kept at −80 °C until analyzed for the activities of malic enzyme (EC 1.1.1.40), isocitrate dehydrogenase (EC 1.1.1.42) and aspartate aminotransferase (EC 2.6.1.1). Malic enzyme (ME) activity was determined by a modification of the method of Hsu and Lardy (1969). Reactions contained 50 mMHEPES (pH 7.5), 1 mM NADP, 10 mM MgCl2 and the substrate, 2.2 mM L-malate (disodium salt) in a total volume of 1 mL. Portions (50 μL) of the 12,000 g supernatants (diluted 1:10) were preincubated in the presence of the first three ingredients. Reactions were initiated by adding the substrate and following the rate of reduction of NADP at 340 nm at 30 °C. Isocitrate: NADP+ oxidoreductase-[decarboxylating] (ICD) activity was determined by a modification of the method of Cleland et al. (1969). Reactions contained 50 mM HEPES (pH 7.5), 1 mM NADP, 10 mM MgCl2 and the substrate, 4.4 mM DL-isocitrate in a total volume of 1 mL. Portions (50 μL) of the 12,000 g supernatants (diluted 1:10) were preincubated in the presence of the first three ingredients. Reactions were initiated by adding the substrate and following the rate of reduction of NADP at 340 nm at 30 °C. Aspartate aminotransferase (AAT) activity was determined by a modification of the method of Martin and Herbein (1976). Reactions contained 50 mM-HEPES (pH 7.4), 200 mM-L-aspartate, 0.2 mMNADH, 1000 units/liter malate: NAD+ oxidoreductase (EC 1.1.1.37) and the substrate, 15 mM-2-oxoglutarate in a total volume of 1.025 mL. Portions (25 μL) of the 12,000 g supernatants (diluted 1:20) were preincubated in the presence of the first four ingredients. Reactions were initiated by adding the substrate and following the rate of oxidation of NADH at 340 nm at 30 °C. Enzyme activities are expressed as μmoles of product formed/min under the assay conditions (Rosebrough and Steele, 1985, 1987). 2.2. Lipogenic enzyme gene expression

a

L-methionine (18915), US Biochemicals, PO Box 22400, Cleveland, Ohio 44122, USA. Provided 0.2 mg Se/kg of diet. c Provided (mg/kg of diet): manganese 100, iron 100, copper 10, cobalt 1, iodine 1, zinc 100 and calcium 89. d Provided (mg/kg of diet): retinol 3.6, cholecalciferol 0.075, biotin 1, vitamin E 10, riboflavin 10, pantothenic acid 20, choline 2 g, niacin 100, thiamine 10, vitamin B6 10, menadione sodium bisulfite 1.5, cyanocobalamin 0.1, folic acid 2 and ethoxyquin 150. b

Total RNA was isolated using the Tri-Reagent procedure (Life Technologies, Rockville, MD, USA) and measured spectrophotometrically and qualitatively by agarose gel electrophoresis. RT-PCR reactions (25 μL) consisted: of 1–2 μg total RNA, 1x QuantiTect SYBR Green RTPCR Master Mix, variable amounts of RNase water, QuantiTect RT mix,

74

R.W. Rosebrough et al. / Comparative Biochemistry and Physiology, Part C 150 (2009) 72–78

Table 3 Dietary methimazole (MMI) and supplemental T3 on chicken growtha. Feed Consumption

b

Body weight

c

Control

+MMI

Control

+MMI

850 ± 8.3

724 ± 12.5⁎

1014 ± 28.7

803 ± 17.6⁎

Supplemental T3 given to birds fed MMI from 14–28 days d

Time following T3 initiation

Body weights

Days

Control

+T3

1 2 4

786 ± 31.0 815 ± 39.5 864 ± 24.4

703 ± 38.2 760 ± 41.5 850 ± 36.0

⁎Significant difference (P b 0.05) at an age period. a Chickens were initially offered diets containing 18% crude protein and 0 or 1 g/kg methimazole from 14 to 28 days. Chickens given methimazole were then offered diets containing the same level of crude protein with or without 1 mg T3/kg. b Feed consumption from 14 to 28 days. c 28-day body weight. d Body weights at indicated time intervals post initiation of supplemental T3.

2.5 mM Mg and 0.5 µM each of each gene specific primer including a set for β-actin, the internal standard. Reverse transcription proceeded for 30 min at 50 °C in the presence of both Omniscript and Sensiscript. Initially, a 15 min incubation at 95 °C was used to inactivate the RT reaction and to activate the HotStarTaq DNA Polymerase. The following comprised 45–50 PCR cycles: Denaturation for 15 s at 94 °C, followed by annealing for 30 s at 58 °C and extension for 30 s at 72 °C. Fluorescence data were collected in the latter stage by noting SYBR Green incorporation into the extended DNA. RT-PCR produced dsDNA amplicons of 423, 200, 447, 300, 201 and 197 bp for fatty acid synthase, malic enzyme, acetyl-CoA carboxylase, β-actin, aspartate amino transferase and isocitrate dehydrogenase (NADP) respectively using the primers described previously (Table 2 and Richards et al., 2003). Polymerase chain amplified product melting temperatures were determined by derivative calculations to determine homogeneity of amplified products. Aliquots of the RT-PCR reactions were loaded onto 1% agarose gels and electrophoresed at 10 v/cm length of gel. Ethidium bromide was used to visualize DNA and orange g was used as the tracking dye. All amplicons were compared to a ladder comprised of known sized DNA standards.

indicative of greater rates of gene expression. Treatment effects can be determined by noting differences in transformed expression rates. The real time PCR reactions were validated by several techniques. Reactions were run in the absence of RNA to preclude interference by primer dimerization. Apparent Ct's in the absence of RNA gave a rate that was several orders of magnitude removed from that noted for gene of interest (presence of RNA and primer of interest). Linearity of reactions rates was noted by using serial dilutions of isolated RNA (0.25, 0.5, 1 & 2 µg of RNA per reaction). Products of the PCR reaction were compared to known DNA standards and DNA melting temperatures were monitored to rule out multiple products. Finally, preliminary reaction samples were sequenced and compare to reported sequences for the respective genes. 2.4 Data analyses used to test the null hypotheses of equality of treatments means Analyses of variance as described by Remington and Schork (1970) were used to compare the effects of MMI on metabolism at 28 days. The comparisons of interest also involved the effects of restoring thyroid function with either a control diet or supplemental T3 and time following initiation of the latter treatments. 3. Results and discussion Table 3 describes 1) the effect of dietary MMI on growth of 28 day old broiler chickens and 2) the effect of dietary T3 on growth following relief from MMI feeding. As expected and agreement with our past experiments (Rosebrough et al., 2007), MMI depressed both growth and feed intake (P b 0.05) when fed to broiler chickens growing from 14 to 28 days of age. Likewise, supplemental T3 did not increase body weights over those seen in MMI treated birds repleted with just the control diet. In general, based on previously noted, but unpublished data, metabolic parameters were not affected by feed intakes per se. In other words, we have never noted any dose-response effects of feed intake on

2.3. Data analyses and assay validation for gene expression Real time detects polymerase chain reaction (RT/PCR) amplification during early phases of reaction while traditional PCR is measured at an end (Bustin, 2000). In addition, Real time PCR is potentially more sensitive due to a greater dynamic range (6–8 logs) and an automated procedure for data analysis. Most installed software provides an output value known as C(t) which is the first calculated point of deflection from baseline. The PCR cycle number corresponding to this value may be indicative of gene expression (Bustin, 2000). For example, a small Ct would indicate a high rate of expression because more products would be available to bind the indicator (SYBR green). Fluorescence data were used to derive the C(t) or the PCR cycle to threshold which is noted as the first significant deviation in fluorescence from a base line value. The C(t)'s were then transformed to their respective antilogarithmic values. The resultant value was expressed relative to β actin. β actin was chosen as a control gene because its Ct was closer to those of the genes studied than other control genes (particularly 18 s RNA). RT-PCR of 18 s RNA gives a C(t) far removed from the genes of interest and would mask any changes in rates of gene expression. Lastly, β actin has not been affected by any treatments that we have imposed in previous experiments. The final values were transformed to their respective reciprocals such that larger values are

Fig. 1. In vitro lipogenesis in chickens fed methimazole to deplete thyroid hormones. Chickens were initially offered diets containing 18% crude protein and 0 or 1 g/kg methimazole from 14 to 28 days. Chickens given methimazole were then offered diets containing the same level of crude protein with or without 1 mg T3/kg. Birds were selected and killed at intervals from 0 to 4 days following initiation of the latter treatments. The first part of each legend denotes the treatment for the 14 to 28-day period and the second part denotes whether or not the birds were given supplemental T3. Values for in vitro lipogenesis (IVL) are expressed as μmol of [2-14C]acetate incorporated/g of liver into lipids. Data are means four chickens at each time point. Bars represent SEM. a,b Common superscripts at a time point are not different (P N 0.05). c, Superscript indicates an effect of treatment used to relieve MMI effect (P b 0.05).

R.W. Rosebrough et al. / Comparative Biochemistry and Physiology, Part C 150 (2009) 72–78

metabolism unless intakes were less than 30% of those noted in the ad libitum state. With the exception of IVL measured only in Experiment 1 (Fig. 1), data are summarized and discussed for both experiments in a common graph for a particular enzyme activity and its corresponding rate of gene expression. It was felt that the two time intervals could be better compared if data were shown together for both experiments on the same graph. Dietary MMI depressed IVL (Fig. 1, P b 0.05) at 28 days. Supplementing diets with T3 increased (P b 0.05) IVL 1 day following initiation of the supplementation. This same supplementation decreased (P b 0.05) IVL 4 days post initiation of the supplementation compare to the unsupplemented control diet. In contrast, birds previously fed MMI and fed a control diet required at least 4 days to restore IVL. The present study shows that supplemental T3 enhanced lipogenesis in the birds fed MMI, but that enhancement only lasted until restoration of apparent normal levels of plasma T3. At some point, thyroid function in birds fed MMI appears to have been restored by exogenous T3 and further T3 supplementation decreased lipogenesis to that noted in the euthyroid bird. Previous work from our laboratory (Rosebrough and McMurtry, 200) demonstrated that the thyroid status of the bird could be changed with exogenous T3, resulting in alterations in lipid metabolism. Fig. 2 summarizes the effects of MMI and subsequent T3 supplementation on both long and short-term adaptations in ME activity and ME gene expression. Dietary MMI lowered ME activity in 28-day-old birds. This effect persisted (P b 0.05) until 2 days following the feeding of the same diet without MMI. In contrast, supplementing the diet with T3 increased ME activity (P b 0.05) in birds previously fed MMI. This effect was first noted 1 day after initiating the supplementation (Experiment 1). Subsequently, sampling over a shorter interval (Experiment 2) indicated that supplemental T3 exerted its positive effect on ME activity as early as 9 h post initiation of supplementation. Fig. 2 also indicates that dietary MMI depressed (P b 0.05) ME gene expression in 28-day-old broilers and T3 supplementation for as little

75

as 1 day restored expression to that noted in the controls at 28 days of age. After 2 days, there was no difference in expression rates resulting from feeding supplemental T3 or just the control diet. In fairness, it should be mentioned that rates for both dietary treatment groups were still greater than that noted in birds fed the MMI diet at 28 days. An examination of short term (particularly from 0 to 24 h) rates of ME gene expression revealed a dramatic increase at 6 h and a further increase at 9 h and a fall in expression 24 h post initiation of T3 supplementation. Malic enzyme, along with other enzymes controlling lipogenesis, responds to both hypo and hyperthyroid conditions. Thus, ME gene expression and activity are another useful tool in assessing thyroid function in the bird. In contrast to the rat, however, T3 administration did not increase ME activity ten-fold over that noted in the hypothyroid rat (Dozin et al., 1986). Sood et al. (1996) noted that ME mRNA levels in liver followed a pattern of expression similar to that of the ME activity levels. They did show the existence of isoforms of ME mRNA (27S and 21S) with the 27S in much greater quantity. Dozin et al. (1986) indicate that both isoforms coded for ME protein. This finding seemed to support previous work by Strait et al. (1989) that also showed the existence of these two mRNA species. The latter work did indicate that the level of ME activity was related to both species. Strait et al. (1989) previously sequenced the 27S species and determined that polyadenylation was responsible for this species size and its sensitivity to T3 administration. They also proposed that a delayed response time in the expression of the 21S fragment was due to a defective polyadenylation site. Thus, message processing may be a further point of regulation of both message stability and translation efficiency. Goodridge's group (Thurmond and Goodridge, 1998) described T3 response units in the 5′-flanking region of the ME gene. Although this region contained only one major response unit, several minor units were also noted. These minor units, however, were necessary for full gene expression. It is unclear from our data if

Fig. 2. Malic enzyme activity and gene expression in chickens fed methimazole to deplete thyroid hormones. Chickens were initially offered diets containing 18% crude protein and 0 or 1 g/kg methimazole from 14 to 28 days. Chickens given methimazole were then offered diets containing the same level of crude protein with or without 1 mg T3/kg. Birds were selected and killed at intervals from 0 to 4 days (Experiment 1) and from 0 to 48 h (Experiment 2) following initiation of the latter treatments. The first part of each legend denotes the treatment for the 14 to 28-day period and the second part denotes whether or not the birds were given supplemental T3 for the stated intervals. Values for malic enzyme (ME, EC 1.1.1.40), activity are expressed as μmol of reduced NADP formed per minute under standard assay conditions. Gene expression is noted as the Ct relative to that of the control gene, beta actin. Data are means four chickens at each time point. Bars represent SEM. a,b Common superscripts at a time point are not different (P N 0.05). c, Superscript indicates an effect of treatment used to relieve MMI effect (P b 0.05).

76

R.W. Rosebrough et al. / Comparative Biochemistry and Physiology, Part C 150 (2009) 72–78

Fig. 3. NADP-linked isocitrate dehydrogenase enzyme activity and gene expression methimazole to deplete thyroid hormones. The experimental protocol is described in Fig. 2. Values for NADP-linked isocitrate dehydrogenase (ICD, EC 1.1.1.42) activity are expressed as μmol of reduced NADP formed per minute under standard assay conditions. Gene expression is noted as the Ct relative to that of the control gene, beta actin. Data are means four chickens at each time point. Bars represent SEM. a,b Common superscripts at a time point are not different (P N 0.05). c, Superscript indicates an effect of treatment used to relieve MMI effect (P b 0.05).

Fig. 4. Aspartate aminotransferase enzyme activity and gene expression in chickens fed methimazole to deplete thyroid hormones. The experimental protocol is described in Fig. 2. Values for aspartate aminotransferase (AAT, EC 2.6.1.1) activity are expressed as μmol of oxidized NAD formed per minute under standard assay conditions. Gene expression is noted as the Ct relative to that of the control gene, beta actin. Data are means four chickens at each time point. Bars represent SEM. a,b Common superscripts at a time point are not different (P N 0.05). c, Superscript indicates an effect of treatment used to relieve MMI effect (P b 0.05).

R.W. Rosebrough et al. / Comparative Biochemistry and Physiology, Part C 150 (2009) 72–78

occupancy of these response units could play a role in ME gene expression after the initial repletion interval in the present study. The data in Figs. 3 and 4 should be examined together as we have repeatedly shown that conditions inhibiting fat synthesis stimulate the activities of both ICD and AST (Rosebrough and Steele, 1985; Rosebrough et al., 1988). Furthermore, the above conditions that stimulate lipogenesis also decrease enzyme activities. Fig. 3 shows somewhat inconsistent effects of repletion of ICD activity following the removal of the MMI diet. For example, the control diet appeared to increase activity at 24 h in the second experiment but not in the first experiment. The enzyme activities in the present study indicate that ICD may function in both lipid and protein metabolism by providing a residual capacity for NADPH and a coreactant for transamination (α ketoglutarate) and subsequent citrate availability. Providing supplemental T3 to restore thyroid function slightly inhibited gene expression if data were summarized over a 1 to 4 day period. In contrast, both diets had profound effects (Pb 0.05) on shortterm gene expression, especially 6 h post initiation of the treatment. This effect was not sustained any longer that 6 h. In both experiments, MMI increased (P b 0.05) AST activity at 28 days. Providing supplemental T3 increased activity compared to the control diet 1 day following initiation of the treatments. A further examination of effects of feeding either the control or T3 diet revealed highly inconsistent results over shorter sampling intervals. In contrast to its effect on AST activity, MMI decreased (P b 0.05) AST expression at 28 days although its effect in the second experiment did not reach significance (Fig. 4). Feeding the T3 diet increased AST gene expression compared to that noted with the MMI diet at 28 days and with that noted by feeding the control diet at 1 and 2 days. An examination of short-term effects showed an effect of T3 supplementation 24 h post initiation of the diet, agreeing with that noted in the first experiment. Refeeding the diet without supplemental T3 resulted in a slight increase (P b 0.05) in expression after 1 day and a slight, though insignificant, decrease 2 days posts diet initiation of that diet. Both dietary treatments decreased (P b 0.05) expression 4 days post initiation when compared to 28 day values. Short-term sampling

77

(6 h post initiation) revealed a highly significant (P b 0.01) decrease in gene expression occurring prior to the previously noted changes in longer-term expression (9–48 h). Both ICD and AST may function together to affect lipogenesis as competition exists between acetyl-CoA carboxylase and the aconitaseisocitrate dehydrogenase pathway for limited cytoplasmic citrate. Thus, the requirement for α ketoglutarate as a co-reactant for transamination of excess amino acids depresses citrate levels and the subsequent activation of acetyl CoA carboxylase. Citrate levels appear to control the avian enzyme more than the rat enzyme (Clark et al., 1979; Hillard et al., 1980). Comparisons of dietary effects in Fig. 5 indicates no statistically significant difference in ACC expression rates in 28-day old birds. In contrast, treating the hypothyroid chickens (dietary MMI) with T3 decreased ACC gene expression at both 1 and 2 days following initiation of the treatment compared to hypothyroid birds given a diet without supplemental T3. An analysis of short-term effects of T3 supplementation showed that gene expression was first stimulated at 6 to 9 h after initiation of supplementation followed by the previously mentioned period inhibition of expression (24–48 h). At 4 days, expression rates were nearly identical for both dietary treatments. Previous work by Hillgartner et al. (1997) showed that T3 enhanced ACC gene expression nearly four fold in the absence of glucose and this effect was magnified by media glucose. The stimulation of ACC activity was a result of an increase in mRNA resulting from changes in transcription rates. The above group also reported a lag time following T3 addition before ACC transcription reached its greatest rate. They inferred that some intermediate was required for the effect of T3 on ACC transcription. Although our previous findings demonstrate unequivocally that exogenous T3 depresses de novo lipogenesis (Rosebrough and McMurtry, 2000), it can also be shown that normal levels of endogenous T3 are required for this effect. Zhang et al. (2001) reported that T3 stimulates a 7-fold increase in transcription of the acetyl-CoA carboxylase-alpha (ACC-alpha) gene in chick embryo hepatocytes suggesting that T3 regulates ACC-alpha transcription by changing the composition of nuclear receptor complexes bound to a ACC-alpha-T3

Fig. 5. Acetyl CoA Carboxylase and fatty acid synthase gene expression in chickens fed methimazole to deplete thyroid hormones. The experimental protocol is described in Fig. 2. Gene expression is noted as the Ct relative to that of the control gene, beta actin. Data are means four chickens at each time point. Bars represent SEM. a,b Common superscripts at a time point are not different (P N 0.05). c, superscript indicates an effect of treatment used to relieve MMI effect (P N 0.05).

78

R.W. Rosebrough et al. / Comparative Biochemistry and Physiology, Part C 150 (2009) 72–78

response element. At this time, it is important to note that ACC catalyzes a proposed rate-limiting step in de novo lipid synthesis and that T3 may be necessary for transcription of its gene. Fig. 5 also summarizes the effects of dietary MMI and T3 supplementation on FAS gene expression. An examination of both short and longer-term supplementation confirms somewhat paradoxical effects of supplying T3 to hypothyroid birds. For example, 1 and 2 day values for expression indicate a significant decrease (P b 0.05) in expression accompanying T3 supplementation. In contrast, there was a significant increase (P b 0.05) in expression 9 h after initiation of the T3 treatment that occurred prior to the first decrease in expression 24 h post initiation of T3. In contrast, repleting with the control diet resulted in an apparent increase in expression at 1 and 2 days when compared to that noted in birds fed supplemental T3. Swierczynski et al. (1991) found that the addition of triiodothyronine (T3) to chick-embryo hepatocytes in culture increased accumulations of ME, FAS, ACC and their mRNAs. They proposed that phosphorylation regulated the expression of the above genes whose expression was controlled by T3. If this is the case, it can be construed that gene expression is controlled by both transcription and posttranslational events. Thus is possible that rapid changed in expression rates as well as certain lag times in the present set of experiments could well be affected by both transcriptional and posttranslational events. In summary, these data present an interesting contrast to a previous study of ours (Richards et al., 2003) that demonstrated a close correlation between lipogenic gene expression and concomitant enzyme activities. In contrast, the data in this report substantiates some of our previous findings (Rosebrough et al., 2007). In fairness, the previously mentioned study (Richards et al., 2003) was conducted with normal, euthyroid birds undergoing light stimulation to induce egg production. It seems evident that changes in gene expression may control enzyme activity during challenges that radically alter metabolism (fasting–refeeding, high–low protein diets, initial stages of hormone depletion–replenishment) but message stability and enzyme protein turnover may control activity as homeostasis is reached. References Bustin, S.A., 2000. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J. Mol. Endocrin. 25, 169–193. Chiasson, R.B., Sharp, P.J., Klandorf, H., Scanes, C.G., Harvey, S., 1979. The effect of rapeseed meal and methimazole on levels of plasma hormones in growing broiler cockerels. Poultry Sci. 58, 1575–1583. Clark, S.D., Watkins, P.A., Lane, M.D., 1979. Acute control of fatty acid synthesis by cyclic AMP in the chick liver cell: possible site of inhibition of citrate formation. J. Lipid Res. 20, 974–985. Cleland, W.W., Thompson, V.M., Barden, R.E., 1969. Isocitrate dehydrogenase (TPN specific) from pig heart. In: Lowenstein, J.M. (Ed.), Methods in Enzymology, vol. 13. Academic Press, New York, pp. 30–33. Decuypere, E., Buyse, J., Scanes, C.G., Huybrechts, L., Kuhn, E.R., 1987. Effects of hyperor hypothyroid status on growth, adiposity and levels of growth hormone, somatomedin C and thyroid metabolism in broiler chickens. Reprod. Nutr. Dev. 27 B, 555–565.

Dozin, B., Magnuson, M.A., Nikodem, V.M., 1986. Thyroid hormone regulation of malic enzyme synthesis. Dual tissue-specific control. J. Biol. Chem. 261, 10290–10292. Folch, J., Lees, M., Sloane-Stanley, G.H., 1957. A simple method for the isolation and purification of total lipids from animal tissues. J. Biol. Chem. 226, 497–509. Harvey, S., 1983. Thyroid hormones inhibit growth hormone secretion in domestic fowl Gallus domesticus. J. Endocrinol. 98, 129–135. Hillard, B.L., Lundin, P., Clarke, S.D., 1980. Essentiality of dietary carbohydrate for maintenance of liver lipogenesis in the chick. J. Nutr. 110, 1533–1542. Hillgartner, F.B., Charron, T., Chesnut, K.A., 1997. Triiodothyronine stimulates and glucagon inhibits transcription of the acetyl-CoA carboxylase gene in chick embryo hepatocytes: glucose and insulin amplify the effect of triiodothyronine. Arch. Biochem. Biophys. 337, 159–168. Hsu, R.Y., Lardy, H.A., 1969. Malic enzyme. Methods Enzymol. 113, 230–235. Leung, F.C., Taylor, J.E., Vanderstine, A., 1984a. Thyrotropin-releasing hormone stimulates body weight gain and increases thyroid hormones and growth hormone in plasma of cockerels. Endocrinology 115, 736–740. Leung, F.C., Taylor, J.E., Vanderstine, A., 1984b. Effects of dietary thyroid hormones on growth, serum T3, T4 and growth hormone in sex-linked dwarf chickens. Proc. Soc. Exp. Biol. Med. 177, 77–81. Leung, F.C., Taylor, J.E., Vanderstine, A., 1985. Effects of dietary thyroid hormones on growth, plasma T3, T4 and growth hormone in normal and hypothyroid chickens. Gen. Comp. Endocrinol. 59, 91–99. Martin, R.J., Herbein, J.H., 1976. A comparison of the enzyme levels and in vitro utilization of various substrates for lipogenesis in pair-fed lean and obese pigs. Proc. Soc. Exp. Biol. Med. 151, 231–235. Remington, R.D., Schork, M.A., 1970. Statistics with Applications to the Biological and Health Sciences. Prentice-Hall, Englewood Cliffs, New Jersey. Richards, M.P., Poch, S.M., Coon, C.N., Rosebrough, R.W., Ashwell, C.M., McMurtry, J.P., 2003. Feed restriction significantly alters lipogenic gene expression in broiler breeder chickens. J. Nutr. 133, 707–715. Rosebrough, R.W., McMurtry, J.P., 2000. Supplemental triiodothyronine, feeding regimens and metabolic responses by the broiler chicken. Domest. Anim. Endocrinol. 19, 15–24. Rosebrough, R.W., Steele, N.C., 1985. Energy and protein relations in the broiler. 1. Effect of protein levels and feeding regimes on growth, body composition and in vitro lipogenesis in broiler chickens. Poultry Sci. 64, 119–126. Rosebrough, R.W., Steele, N.C., 1987. Methods to assess glucose and lipid metabolism in avian liver explants. Comp. Biochem. Physiol. A 88, 1041–1049. Rosebrough, R.W., McMurtry, J.P., Mitchell, A.D., Steele, N.C., 1988. Protein and energy restrictions in the broiler chicken. 6. Effect of dietary protein and energy restrictions on carbohydrate and lipid metabolism and metabolic hormone profiles. Comp. Biochem. Physiol. A 90, 311–316. Rosebrough, R.W., Russell, B.A., Richards, M.P., 2007. Responses of chickens subjected to thyroid hormone depletion–repletion. Comp. Biochem. Physiol. A 147, 543–549. Sood, A., Schwartz, H.L., Oppenheimer, J.H., 1996. Tissue-specific regulation of malic enzyme by thyroid hormone in the neonatal rat. Biochem. Biophys. Res. Commun. 222, 287–291. Strait, K.A., Kinlaw, W.B., Mariash, C.N., Oppenheimer, J.H., 1989. Kinetics of induction by thyroid hormone of the two hepatic mRNAs coding for cytosolic malic enzyme in the hypothyroid and euthyroid states. Evidence against an obligatory role of S14 protein in malic enzyme gene expression. J. Biol. Chem. 264, 19784–19789. Swierczynski, J., Mitchell, D.A., Reinhold, D.S., Salati, L.M., Stapleton, S.R., Klautky, S.A., Struve, A.E., Goodridge, A.G., 1991. Triiodothyronine-induced accumulations of malic enzyme, fatty acid synthase, acetyl-coenzyme A carboxylase, and their mRNAs are blocked by protein kinase inhibitors. Transcription is the affected step. J. Biol. Chem. 266, 17459–17466. Thurmond, D.C., Goodridge, A.G., 1998. Characterization of thyroid hormone response elements in the gene for chicken malic enzyme. Factors that influence triiodothyronine responsiveness. J. Biol. Chem. 273, 1613–1622. Zhang, Y., Yin, L., Hillgartner, F.B., 2001. Thyroid hormone stimulates acetyl-coA carboxylase-alpha transcription in hepatocytes by modulating the composition of nuclear receptor complexes bound to a thyroid hormone response element. J. Biol. Chem. 276, 974–983.