Effects of signal peptide exchange on HIV-1 glycoprotein expression and viral infectivity in mammalian cells

FEBS Letters 580 (2006) 3775–3778

Effects of signal peptide exchange on HIV-1 glycoprotein expression and viral infectivity in mammalian cells Tanya Pfeiffer, Thorsten Pisch, Gerard Devitt, Denise Holtkotte, Valerie Bosch* Forschungsschwerpunkt Infektion und Krebs, F020, Deutsches Krebsforschungszentrum, Im Neuenheimer Feld 242, 69120 Heidelberg, Germany Received 29 March 2006; accepted 30 May 2006 Available online 9 June 2006 Edited by Hans-Dieter Klenk

Abstract In certain cell systems, exchange of the human immunodeficiency virus (HIV) Env signal peptide (SP) sequence with that of heterologous SPs has been shown to increase gp120 transport and secretion. Here we demonstrate that exchange of the HIV-Env-SP with those from erythropoietin or tissue plasminogen activator in the proviral context does not increase wild-type membrane-bound Env expression or incorporation into released virions. In fact, virion infectivities were decreased. These infectivity decreases were largely due to effects on Env transport and/or function and only to a minor extent to cis effects as a result of the sequence exchanges themselves. Thus, in fact, it is not advantageous to employ heterologous SPs to achieve highlevel expression of functional cell surface membrane- or virionassociated HIV-Env.  2006 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. Keywords: HIV glycoprotein incorporation; HIV signal peptide; HIV glycoprotein transport

1. Introduction In common with many other integral membrane or secreted proteins, the HIV-1-Env glycoprotein contains an N-terminal signal peptide (SP) sequence which directs the nascent polypeptide to the endoplasmatic reticulum (ER). The 30 amino acid (aa) HIV-Env-SP is rather long and consists of a polar N-terminal region followed by a hydrophobic core [1]. In contrast to the cleavage of the SPs of many other glycoproteins, cleavage of the HIV-Env-SP in several cell lines is post-translational and very slow [2–4]. The HIV-SP associates with calnexin in the ER and this association has been implicated to down-modulate glycoprotein folding [3,4]. In fact, there appears to be a mutual relationship between SP removal and gp160 folding. Thus lack of SP removal delays or disturbs HIV-Env folding while, on the other hand, Env folding is required for SP removal [3–5]. Generally, expression and intracellular transport of mature gp120 and gp41 in mammalian cells is inefficient and only a small fraction (5–15%) of gp160 synthesised within the cell is processed to gp120 and gp41 and incorporated into released virions [6]. In early studies aimed at achieving efficient HIVEnv expression and secretion, chimeric env genes with heterol-

* Corresponding author. Fax: +49 6221 424932. E-mail address: [email protected] (V. Bosch).

ogous SPs were employed in mammalian cells [7,8] or in insect cells [2,9]. In S. frugiperda (SF9) insect cells, expression of secreted gp120 from recombinant baculovirus was significantly increased by replacement of the Env-SP with the SPs from melittin or from murine interleukin 3 or by elimination of positively charged aa within the Env-SP itself [2]. Also in mammalian cells, replacement of the HIV-Env-SP with heterologous SPs (from erythropoietin (Epo) and from tissue plasminogen activator (tPA)) has been reported to increase gp120 secretion, albeit not to such a pronounced extent as in insect cells [10]. In fact, the use of heterologous SPs to potentially increase HIV-Env secretion is a strategy which is still wide-spread [11]. In vaccine strategies based on inactivated virions, virus-like particles or liposomes, high-level expression of membraneanchored Env, generally in a functional form, has to be achieved. In this report, we have analysed if heterologous SPs would potentially be beneficial in these situations. We have generated proviral constructs encoding Env protein chimeras with SPs from either erythropoietin (this SP carries includes only a single charged aa) or tPA (this SP carries several charged aa) and compared the properties of these glycoproteins and of the respective mutant virions to those of their wild-type counterparts.

2. Materials and methods 2.1. Constructs Proviral plasmids were based on pNL4-3BH10 env (referred to here as pNL-Wt) [12]. Vpu expression was abolished by mutating the vpu initiation codon to ATT (exchanging G at nucleotide position 6063 (all numbering from pNL4-3 [13]) to T). The heterologous SPs employed to replace the HIV-Env-SP (Env aa 1–30 encoded by ATGAGAGTGAAGGAGAAATATCAGCACTTGTGGAGATGGGGGTGGAGATGGGGCACCATGCTCCTTGGGATGTTGATGATCTGTAGTGCT, nucleotides 6221–6310) were either from erythropoietin (Epo-SP) (aa 1–26, numbering starting at the initiation methionine, encoded by the sequence ATGGGGGTGCACGAATGTCCTGCCTGGCTGTGGCTTCTCCTGTCCCTGCTGTCGCTCCCTCTGGGCCTCCCAGTCCTG) or from tissue plasminogen activator (tPA-SP) (aa 1–35, numbering starting at the initiation methionine, encoded by the sequence ATGGATGCAATGAAGAGAGGGCTCTGCTGTGTGCTGCTGCTGTGTGGAGCAGTCTTCGTTTCGCCCAGCCAGGAAATCCATGCCCGATTCAGAAGAGGAGCCAGA). For identification purposes, in these latter cases, a SacI site was introduced 15 nucleotides upstream of the env gene, i.e. in the non-expressed vpu gene, by exchanging AG (nucleotides 6207, 6208) with TC. SalI–KpnI fragments (nucleotides 5785–6343), containing the exchanges in the Vpu-ATG and Env-SP, were generated using standard PCR technologies and employed to replace the same fragment in pNL-Wt. Sequencing of the entire

0014-5793/$32.00  2006 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.febslet.2006.05.070

3776

2.3. Infectivity assays Equalised amounts (determined by CA-ELISA) of virions released from transfected 293T cells were titrated in triplicate on Tzm-bl indicator cells [17–19] in the presence of 1.5 lM Saquinivir (to prevent spread of infection). In the case of VSV-G pseudotyped virions Tzmbl cells were preincubated with, and titrations carried out in the presence of culture supernatants (1:1) from SIM2 and SIM4 hybridoma cells which produce antibodies against CD4 [20]. We demonstrated in a control experiment that this incubation inhibits HIV-Env mediated infectivity by more that 99%. At 36 h p.i., infected cells were stained for b-galactosidase activity, counted and titer of infectious units (IU) per millilitre calculated. Spreading infections in H9 T-cells (106 cells in 3 ml) were initiated with equalised amounts (equivalent to 100 ng CA ) of the respective virions, generated in transfected 293T cells. Input virus was removed at 5 h p.i. and the cells washed twice. Aliquots of media were collected at different time-points postinfections and the amounts of newly synthesised released virus quantitated by CA-ELISA.

3. Results and discussion 3.1. Expression of proviral constructs encoding Env proteins with heterologous SPs The proviral constructs encoding Env proteins with either Wt-Env-SP, Epo-SP or tPA-SP are illustrated in Fig. 1A. The SP replacements in Env lead to premature termination of the Vpu protein. Thus, in order to carry out comparative analyses, initiation of Vpu translation was completely abol-

pNL-Wt (vpu-)

pNL-Epo-SP

P

-SP tPA

o-S Ep

Wt

Wt

(vp

-SP

P o-S

(vp

Ep

tPA

u-)

B

u-)

pNL-tPA-SP

Wt

2.2. Expression of modified proviruses, cell–cell fusion levels mediated by mutant Env proteins Proviral constructs pNL-Wt, pNL-Wt (vpu-), pNL-Epo-SP and pNL-tPA-SP were transfected into 293T cells employing standard calcium phosphate procedures. In some experiments, virions were pseudotyped with the glycoprotein of vesicular stomatitis virus (VSV-G) by cotransfection of the respective proviral plasmids with pMD.G [14]. Two days post-transfection (p.t.), the culture supernatants were filtered (0.45 lm filter) and, for Western blot analysis, released virions were concentrated by centrifugation at 200 000 · g for 3 h through a cushion of 20% sucrose. Virions in culture supernatants or after concentration were quantitated by ELISA for HIV-CA (Innogenetics, Belgium). Lysates of transfected cells were prepared in 1% Triton X-100 in phosphate buffered saline (PBS). Western blot analyses of cell lysates (equalised by CA-ELISA of the respective culture supernatants) and of viral lysates (equivalent to 100 ng CA) were performed employing rabbit anti-gp120 antibodies and anti-p24 Mab 183-H12-5C [15]. A semi-quantitative assay to assess cell–cell fusion activities was performed essentially as previously described [16]. Briefly, 293T cells growing in 6-well dishes were transfected with the respective proviral constructs and cultivated from 5 to 48 h p.t. in the presence of 1.5 lM HIV protease inhibitor, Saquinivir (Hofmann-La Roche, Basel, Switzerland), to prevent release of infectious virions. At 48 h p.t., the cells were overlayed with 3 ml confluent 1G5 cells, which are Jurkat cells containing a stably integrated HIV-LTR fire-fly luciferase construct. Cocultivation was continued for 4 h during which time syncytium formation between the two cell types results in activation of LTR-driven luciferase expression by Tat protein from the transfected 293T cells. The cocultured cells were then lysed and luciferase activities measured using standard procedures. In order to normalise for possible differences in transfection efficiencies, parallel transfections were cultivated in the absence of Saquinivir, the amounts of released virions reflecting the infection efficiencies determined by CA-ELISA (these were generally in the same range) and the measured luciferase values adjusted accordingly.

A pNL-Wt

Wt

SalI–KpnI fragments confirmed the presence of the planned exchanges and revealed an inadvertent nucleotide deletion (A at nucleotide position 6164) in all cases. This deletion is in the non-expressed vpu gene, upstream of env, and was not corrected. The resulting plasmids are designated pNL-Wt (vpu-), pNL-Epo-SP and pNL-tPA-SP.

T. Pfeiffer et al. / FEBS Letters 580 (2006) 3775–3778

anti gp120

anti p24 cell

virus

Fig. 1. (A) Schematic representation of the proviral constructs with Env-SP exchanges. The sequences and charges of the amino acids of the HIV-Env-SP, the Epo-SP and tPA-SP are given. Expression of Vpu has been abrogated by mutation of the initiation ATG to ATT. (B) Western blot analysis of equalised amounts (by ELISA for CA) of cell lysates (left) and of lysates of released virions (right) from 293T cells transfected with the respective proviral constructs as indicated. The top parts of the filters have been probed with anti-gp120 and the bottom parts with anti-p24.

ished in a control plasmid (pNL-Wt (vpu-)) as well as in both pNL-Epo-SP and pNL-tPA-SP plasmids by mutating the Vpu initiation ATG to ATT. Although in many cell lines, abrogation of Vpu expression results in less efficient release of virus particles into the extracellular medium [21,22], this was not the case in 293T cells. Thus, levels of virus particle release (as quantitated by CA ELISA) were equivalent after transfection with pNL-Wt (intact vpu gene) or with the any of the vpudeficient proviruses (data not shown). Fig. 1B shows Western blot analysis of the respective cell and viral lysates. The total amounts of expressed viral glycoproteins in the transfected cells were equivalent (left panel) and incorporation into virions occurred in all cases (right panel). However, there was no increase in the extent of glycoprotein incorporation in the case of the proviruses expressing Env proteins with heterologous SPs. In fact, we reproducibly observed that incorporation was slightly impaired in the case of pNL-tPA-SP. This means that in the context of full-length HIV-Env, the tested heterologous SPs, which include an SP which, in contrast to the HIV-SP, is only very weakly charged (Epo-SP), do not lead to an increase in Env expression or particle incorporation levels. Since the extent of incorporation into particles is at least partially determined by the level of surface expression of retroviral glycoproteins [23], these analyses make it unlikely that the heterologous SPs increase HIV-Env transport to the cell surface. On the contrary, the decreased incorporation of Env from into pNL-tPA-SP particles would rather point to a deleterious effect, perhaps as a result of incomplete SP removal or to incorrect folding as a result of premature SP removal.

T. Pfeiffer et al. / FEBS Letters 580 (2006) 3775–3778

3777

3.2. Infectivities of released virions encoding Env proteins with heterologous SPs Virions released from 293T cells transfected with pNL-Wt, pNL-Wt (vpu-), pNL-Epo-SP and pNL-tPA-SP were first analysed in single-round infectivity assays in Tzm-bl reporter cells. As shown in Fig. 2A, there was no significant difference in the titers of virions expressed from pNL-Wt or pNL-Wt (vpu-), i.e. with or without vpu expression. On the other hand, the infectivities of virions expressed from pNL-Epo-SP or pNLtPA-SP proviral plasmids were reduced to levels of about 30% of that of wild-type. We then analysed the effects of the SP exchanges on the kinetics of viral replication and spread in T-cells. Fig. 2B shows analysis of the kinetics of infection in H9 T-cells which had been infected with equal amounts of the respective virions produced in 293T cells. The kinetics of spread of pNL-Wt and pNL-Wt (vpu-) virions were approximately the same indicating that, in this culture system, Vpu expression did not markedly influence viral spread. However, pNL-Epo-SP and, more markedly pNL-tPA-SP virions, both exhibited a delay in viral spread. The cultures did become com-

A

120

% infectivity

100 80 60 40 20

3.3. Fusion activities of Env proteins with heterologous SPs We next analysed the effects of the SP exchanges on cell–cell fusion activities mediated by the respective Env proteins. 293T cells transfected with pNL-Wt, pNL-Wt (vpu-), pNL-Epo-SP or pNL-tPA-SP were cocultivated with 1G5 cells, which are Jurkat T-cells containing a stably integrated HIV-LTR luciferase construct. On fusion between these two cell types, HIV-Tat protein expressed in the 293T cells activates luciferase expression from the LTR. The levels of luciferase activities measured reflect the extents of cell–cell fusion induced by the respective Envs. As a control for possible transactivation induced by secreted Tat or by possible spontaneous fusion, control incubations between transfected 293T cells and 1G5 cells were carried out in the presence of CD4 antibodies which inhibit Env-mediated fusion. These luciferase values, which were however low, were subtracted from the values obtained in the absence of CD4 antibodies. As can be seen in Fig. 3, the levels of fusion induced by expression of the Env proteins with Epo-SP or tPA-SP were reduced to about 40% of that induced by expression of Wt-Env. This indicates that the SP exchanges have resulted in impaired Env transport to the cell surface and/or to impaired Env-function, phenomena which cannot be distinguished in this assay. 3.4. Infectivities mediated by VSV-G pseudotyped virions We finally analysed if, in addition to possible effects on Env transport or functionality, the SP sequence exchanges within the pNL-Epo-SP and pNL-tPA-SP genomes were themselves contributing to the diminished infectivities of the respective virions, we analysed the infectivities of the respective virions

0

Wt

pletely infected, as confirmed by immunofluorescence with anti-HIV antibodies (not shown), but with a delay of about 2–3 days. These detrimental effects of the SP exchanges on virus infectivity may be the result of reduced Env incorporation into particles, as has been shown to be the case with pNL-tPA-SP (Fig. 1B), of impaired Env functionality and/or, alternatively, to cis effects resulting from the nucleotide exchanges within the proviral genome sequence.

Wt (vpu-) Epo-SP tPA-SP

B 10000

160 140

100

10

1 0

2

4

6

8

10

12

days post infection Fig. 2. Infectivities of virions released from 293T cells transfected with the respective proviral constructs. (A) Analysis of ‘‘single-round’’ infectivities by titration on Tzm-bl indicator cells. The titers for pNLWt (which were in the range of 3 · 106 IU/ml) were taken as 100% and the relative infectivities of the mutant viruses calculated. The average of 2 experiments is shown. (B) Kinetics of infection and spread in H9 T-cells. The amounts of newly generated virions released in the culture media at the days p.i. given (x-axis) were quantitated by ELISA for CA (y-axis). m = pNL-Wt; d = pNL-Wt (vpu-); r = pNL-Epo-SP; j = pNL-tPA-SP.

% luciferase activity

ng p24/ml

1000

120 100 80 60 40 20 0

Wt

Wt (vpu-) Epo-SP tPA-SP

Fig. 3. Cell–cell fusion activities. Luciferase activities in lysates of cocultures of transfected 293T cells plus Jurkat 1G5 cells, reflecting the extents of the respective Env-mediated cell–cell fusion activities, were measured. The relative light units (RLU) measured for pNL-Wt (in the range of 1–4 · 105 RLU per coculture) were set at 100% and the relative values for the mutants calculated. The average of two experiments is given.

3778

T. Pfeiffer et al. / FEBS Letters 580 (2006) 3775–3778

120

% infectivity

100 80 60 40 20 0

Wt

Wt (vpu-) Epo-SP tPA-SP

Fig. 4. Infectivities of VSV-G pseudotyped virions. ‘‘Single-round’’ infectivities were measured on Tzm-bl indicator cells in the presence of antibodies to CD4. The titers for VSV-G pseudotyped pNL-Wt (which were in the range of 1 · 106 IU/ml) were taken as 100% and the relative infectivities of the mutant viruses calculated. The average of two experiments is shown.

pseudotyped with VSV-G. The titrations of the respective virions on Tzm-bl cells were carried out in the presence of antibodies against CD4 which we demonstrated to inhibit HIV-Env-mediated infectivity to over 99% (data not shown). As can be seen in Fig. 4, when infection was mediated by the pseudotyping VSV-G protein, the infectivities of both pNLEpo-SP and pNL-tPA-SP virions were only very slightly reduced in comparison to pNL-Wt (vpu-). This would mean that the more prominent reduction in infectivity seen with the unpseudotyped virions (Fig. 2A) is largely mediated by Env-related phenomena and is influenced only to a minor extent, if at all, in cis by the genome sequence exchanges themselves. In summary, these results do not lend support for the use of heterologous SPs in HIV-Env plasmids expressing wild-type membrane-bound Env. Acknowledgements: The following reagents were obtained through the AIDS Research and Reference Reagent Program, AIDS Program, NIAID, NIH: HIV-1 p24 hybridoma cells (183-H12-5C) were from B. Chesebro and H. Chen, 1G5 cells were from Dr. Estuardo Aguilar-Cordova and Dr. John Belmont, Tzm-bl cells from Dr. John Kappes, Dr. Xiaoyun Wu and Tranzyme Inc. and SIM-2 and SIM-4 cells from Dr. James Hildreth. Thorsten Pisch was supported by the Wilhelm-Sander Foundation, Gerard Devitt by the H.W. & J. Hector Foundation, and Denise Holtkotte by the Deutsche Forschungsgemeinschaft.

References [1] Wain-Hobson, S., Sonigo, P., Danos, O., Cole, S. and Alizon, M. (1985) Nucleotide sequence of the AIDS virus, LAV. Cell 40, 9– 17. [2] Li, Y., Luo, L., Thomas, D.Y. and Kang, C.Y. (1994) Control of expression, glycosylation, and secretion of HIV-1 gp120 by homologous and heterologous signal sequences. Virology 204, 266–278. [3] Li, Y., Luo, L., Thomas, D.Y. and Kang, C.Y. (2000) The HIV-1 Env protein signal sequence retards its cleavage and downregulates the glycoprotein folding. Virology 272, 417–428. [4] Li, Y., Bergeron, J.J., Luo, L., Ou, W.J., Thomas, D.Y. and Kang, C.Y. (1996) Effects of inefficient cleavage of the signal sequence of HIV-1 gp 120 on its association with calnexin, folding, and intracellular transport. Proc. Natl. Acad. Sci. USA 93, 9606–9611.

[5] Land, A., Zonneveld, D. and Braakman, I. (2003) Folding of HIV-1 envelope glycoprotein involves extensive isomerization of disulfide bonds and conformation-dependent leader peptide cleavage. FASEB J. 17, 1058–1067. [6] Willey, R.L., Bonifacino, J.S., Potts, B.J., Martin, M.A. and Klausner, R.D. (1988) Biosynthesis, cleavage, and degradation of the human immunodeficiency virus 1 envelope glycoprotein gp160. Proc. Natl. Acad. Sci. USA 85, 9580–9584. [7] Berman, P.W., Nunes, W.M. and Haffar, O.K. (1988) Expression of membrane-associated and secreted variants of gp160 of human immunodeficiency virus type 1 in vitro and in continuous cell lines. J. Virol. 62, 3135–3142. [8] Lasky, L.A. et al. (1986) Neutralization of the AIDS retrovirus by antibodies to a recombinant envelope glycoprotein. Science 233, 209–212. [9] Culp, J.S., Johansen, H., Hellmig, B., Beck, J., Matthews, T.J., Delers, A. and Rosenberg, M. (1991) Regulated expression allows high level production and secretion of HIV-1 gp120 envelope glycoprotein in Drosophila Schneider cells. Biotechnology (NY) 9, 173–177. [10] Herrera, A.M., Musacchio, A., Fernandez, J.R. and Duarte, C.A. (2000) Efficiency of erythropoietin’s signal peptide for HIV(MN)-1 gp 120 expression. Biochem. Biophys. Res. Commun. 273, 557–559. [11] Binley, J.M. et al. (2000) A recombinant human immunodeficiency virus type 1 envelope glycoprotein complex stabilized by an intermolecular disulfide bond between the gp120 and gp41 subunits is an antigenic mimic of the trimeric virion-associated structure. J. Virol. 74, 627–643. [12] Bosch, V. and Pawlita, M. (1990) Mutational analysis of the human immunodeficiency virus type 1 env gene product proteolytic cleavage site. J. Virol. 64, 2337–2344. [13] Adachi, A., Gendelman, H.E., Koenig, S., Folks, T., Willey, R., Rabson, A. and Martin, M.A. (1986) Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone. J. Virol. 59, 284–291. [14] Naldini, L., Blomer, U., Gallay, P., Ory, D., Mulligan, R., Gage, F.H., Verma, I.M. and Trono, D. (1996) In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science 272, 263–267. [15] Chesebro, B., Wehrly, K., Nishio, J. and Perryman, S. (1992) Macrophage-tropic human immunodeficiency virus isolates from different patients exhibit unusual V3 envelope sequence homogeneity in comparison with T-cell-tropic isolates: definition of critical amino acids involved in cell tropism. J. Virol. 66, 6547–6554. [16] Holtkotte, D., Pfeiffer, T., Pisch, T. and Bosch, V. (2006) Selection and characterization of a replication-competent human immunodeficiency virus type 1 variant encoding C-terminally truncated env. AIDS Res. Hum. Retroviruses 22, 57–65. [17] Derdeyn, C.A. et al. (2000) Sensitivity of human immunodeficiency virus type 1 to the fusion inhibitor T-20 is modulated by coreceptor specificity defined by the V3 loop of gp120. J. Virol. 74, 8358–8367. [18] Platt, E.J., Wehrly, K., Kuhmann, S.E., Chesebro, B. and Kabat, D. (1998) Effects of CCR5 and CD4 cell surface concentrations on infections by macrophagetropic isolates of human immunodeficiency virus type 1. J. Virol. 72, 2855–2864. [19] Wei, X. et al. (2002) Emergence of resistant human immunodeficiency virus type 1 in patients receiving fusion inhibitor (T-20) monotherapy. Antimicrob. Agents Chemother. 46, 1896–1905. [20] McCallus, D.E., Ugen, K.E., Sato, A.I., Williams, W.V. and Weiner, D.B. (1992) Construction of a recombinant bacterial human CD4 expression system producing a bioactive CD4 molecule. Viral Immunol. 5, 163–172. [21] Klimkait, T., Strebel, K., Hoggan, M.D., Martin, M.A. and Orenstein, J.M. (1990) The human immunodeficiency virus type 1specific protein vpu is required for efficient virus maturation and release. J. Virol. 64, 621–629. [22] Terwilliger, E.F., Cohen, E.A., Lu, Y.C., Sodroski, J.G. and Haseltine, W.A. (1989) Functional role of human immunodeficiency virus type 1 vpu. Proc. Natl. Acad. Sci. USA 86, 5163–5167. [23] Yuste, E., Reeves, J.D., Doms, R.W. and Desrosiers, R.C. (2004) Modulation of Env content in virions of simian immunodeficiency virus: correlation with cell surface expression and virion infectivity. J. Virol. 78, 6775–6785.