- Email: [email protected]
Effects of sulfur application on cadmium bioaccumulation in tobacco and its possible mechanisms of rhizospheric microorganisms
Journal of Hazardous Materials 368 (2019) 308–315
Contents lists available at ScienceDirect
Journal of Hazardous Materials journal homepage: www.elsevier.com/locate/jhazmat
Effects of sulfur application on cadmium bioaccumulation in tobacco and its possible mechanisms of rhizospheric microorganisms
T
Xuanzhen Lia, Hao Yua, Xiaowei Sunb, Jiantao Yanga, Daichang Wangc, Lianfeng Shena, ⁎ Yanshuo Pand, Yucheng Wue, Qiang Wangc, Yong Zhaoa, a
College of Forestry, Henan Agricultural University, Zhengzhou, 450002, China Henan Academy of Forestry, Zhengzhou, 450008, China c College of Resources and Environment, Henan Agricultural University, Zhengzhou, 450002, China d College of Life Science, Henan Agricultural University, Zhengzhou, 450002, China e Key Laboratory of Soil Environment and Pollution Remediation, Institute of Soil Science, Chinese Academy of Sciences, Nanjing, 210008, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Tobacco Sulfur application Bioremediation Cadmium Rhizospheric microorganisms
A potting experiment was conducted to investigate the effect of sulfur application on the bioaccumulation by tobacco and its mechanisms of rhizospheric microorganisms. Cadmium content in tobacco was analyzed using atomic absorption spectrometer, while bacterial community and related gene in soil were analyzed via highthroughput sequencing and quantitative PCR techniques, respectively. The obtained results indicated that tobacco had the ability to accumulate cadmium under no sulfur application conditions, with cadmium contents of 35.4, 23.6, and 26.3 mg kg−1 in leaves, stems, and roots, respectively. Under high-sulfur treatment, these values increased to 66.4, 46.1, and 42.6 mg kg-1, respectively, probably due to the increase of the available cadmium content (from 1.1 to 3.3 mg kg−1) in the soil through a decrease of the soil pH value, which was contributed by the sulfur oxidation reaction. dsrA and soxB genes might play an important role in sulfur oxidation, and Thiobacillus sp. was the dominant bacterial genus during the sulfur oxidation process. In addition, sulfur application exerted little effect on the diversity and structure of the soil bacterial community. The combined results indicate that sulfur application is an effective and safe method for Cd phytoextraction by tobacco.
1. Introduction Cadmium (Cd) is a harmful element that has been classified as a carcinogen (Category 1) by the International Agency for Research on Cancer (IARC). According to a recent survey, the Cd content in the soil of China has exceeded the standard by 7.0%. Consequently, food that exceeds the standard as a result of soil pollution occurs frequently, which is potentially dangerous to the health of consumers [1]. Therefore, the remediation of the contaminated soil has always been of high concern. Phytoextraction with hyperaccumulating plants has long been described as a promising method for the remediation of soils contaminated with heavy metals, including Cd [2]. The importance of this method lies in the substantial uptake of Cd from soil via roots of hyperaccumulator. Currently, a number of Cd hyperaccumulator plants, such as Sedum alfredii, Thlaspi caerulescens, Arabidopsis halleri, and Brassica juncea, are found [3]. The mechanisms of uptake, transport and detoxification of Cd by plants have been reported [3,4]. Among various bioaccumulation mechanisms, the unique rhizosphere environment was
⁎
considered as one of the most important characteristics in the phytoextraction of Cd, including the reduced soil pH, higher metal bioavailability, and increased rhizomicrobial activity [5]. Recently, fieldscale remediation of cadmium contaminated soil has also been attempted [3,6]. However, most of the hyperaccumulators typically only achieve low biomass, have a slow growth rate, and show poor environmental adaptability [2,7], which limits the application of phytoextraction technology. Tobacco belongs to the family of Solanaceae and is also an important economic crop, which is widely planted throughout the world. This plant has a specific enrichment capacity for Cd [7]. For example, an experiment including 59 tobacco varieties indicated that the Cd content in leaves reached 30.45–116.28 mg kg−1 when they were planted in soil with a Cd content of 8.0 mg kg-1 [8]. In addition, the Cd translocation to the shoot appears to be rapid, probably within hours [9]. As a result, the leaves could accumulate about 50% of the total Cd taken up by the tobacco plant [10]. Genetic modification of tobacco to improve Cd accumulation has also been attempted [11]. Although the
Corresponding author. E-mail address: [email protected] (Y. Zhao).
https://doi.org/10.1016/j.jhazmat.2018.12.099 Received 28 August 2018; Received in revised form 15 November 2018; Accepted 26 December 2018 Available online 27 December 2018 0304-3894/ © 2019 Elsevier B.V. All rights reserved.
Journal of Hazardous Materials 368 (2019) 308–315
X. Li et al.
and 1.02 g kg−1 (high-sulfur treatment, S2). Plastic pots were used in the experiments and 1 kg of soil was loaded into each pot. After tobacco seedlings had been transplanted to the pots, the pots were transferred to a light culture room under a culture conditions of a 14 h: 10 h photoperiod at 400 mmol m-2 s-1, day: night temperatures of 25: 20 °C and day: night humidity of 60–70%. Soil that had neither sulfur addition nor plant cultivation was used as control and each treatment was repeated at least three times. Deionized water was added to maintained the moisture content to about 80% of the moisture-holding capacity. After 60 d of growth, plants were harvested and gently washed with distilled water. All plants were then separated into roots, stems, and leaves using stainless steel scissors. The dry weight of the tissue was determined via the moisture content of the corresponding part of wet weight.
enrichment factor of tobacco is lower than that of other hyperaccumulator plants, tobacco has a large biomass. As a result, the total amount of Cd uptake by tobacco far exceeds that of other hyperaccumulators [12]. In addition, tobacco has specific advantages of rapid growth and strong adaptability to the environment for phytoextraction [7,13]. Therefore, tobacco posed the important potential in Cd contaminated soil remediation. Although several conditions are required, the bioavailability of Cd is considered to be a critical factor for plant-uptake efficiency. Chelateassisted phytoextraction has been proposed to improve the efficiency of conventional phytoextraction of heavy metals [13]. Ethylene diamine disuccinate (EDDS) and ethylene diamine tetraacetate (EDTA) are two traditional chelating agents; however, no desirable results were obtained when these two compounds were used in phytoextraction of Cd by tobacco [13]. Sulfur is one of the essential elements in plants and has important physiological functions, which include the tolerance to abiotic stress, secondary metabolism, photosynthetic oxygen production, and electron transport [14]. In addition to these functions, studies have shown that sulfur also increases the uptake and accumulation of Cd in plants and the two following reasons are plausible: First, the utilization of sulfur can reduce the pH value of soil and thus improve the bioavailability of Cd, which is beneficial for the uptake by plants [15,16]. Secondly, sulfur application can provide the raw materials for the plant synthesis of glutathione (GSH), phytochelatins (PCs), and other non-protein thiols (NPTs), which can chelate intracellularly with Cd, thus promoting the uptake and transport as well as detoxification of Cd [14,17,18]. In addition, sulfur offers advantages of low cost, nontoxicity, and supplementation of sulfur nutrition. Therefore, it has been considered that sulfur application is an ideal enhanced method for phytoextraction. In this study, tobacco was used as model plant, and potting experiments were conducted to evaluate the effects of different amounts of sulfur application on tobacco growth and Cd uptake, by adding both high and low doses of sulfur to Cd contaminated soil. The changes of total sulfur and NPTs content in tobacco, soil pH, available Cd content, sulfate radical content, sulfur oxidation gene copy numbers, and rhizospheric microbial community were analyzed to investigate the possible mechanisms with which sulfur promotes the Cd uptake by tobacco. The obtained results provide the foundation for future Cd phytoextraction by tobacco.
2.3. Cd concentration analysis Dried and homogenized tobacco tissue powders were thoroughly digested with nitric acid and sulphuric acid (3:1 ratio); then, the samples were analyzed via atomic absorption spectrometer (AAS, Agilent 3510, USA) [19]. The methodical detection limit was 0.05, and R2 of the standard curves was 0.9996. The Cd analysis conditions were: width of spectral band of 0.4 nm, wavelength of 228.8 nm, and flow combustible gas of 1000 mL min−1. 2.4. Analysis of total sulfur and total non-protein thiol concentration in plants Determination of total sulfur content in tobacco: 0.500 g sample was weighed and placed in a microwave digestion tank, followed by digestion with 7 mL HClO4 and 2 mL H2O2 (180 °C, 15 min). Then, it was transferred to a fixed volume of 25 mL to remove acid, placed in a 25 mL colorimetric dish, and the total sulfur content of the tobacco was determined via inductively coupled plasma emission spectrometry (ICPAES). Total NPTs were extracted by homogenizing 0.5 g frozen plant tissue with 2 ml 5% 5-sulphosalicylic acid (SSA) with 6.3 mM diethylenetriaminepenta acetic acid (DETAPAC) using a prechilled mortar, pestle, and quartz sand. After the homogenate was centrifuged, the supernatant was collected and immediately used for the assay of NPTs: 300 μL supernatant were mixed with 630 μL K2HPO4 (0.5 M, pH 7.5). The absorbance at 412 nm was read 2 min before and after the addition of 25 μL 6 mM DTNB solution (DTNBε = 13,600 M−1 cm-1) [20].
2. Materials and methods 2.1. Tobacco seedlings and soil
2.5. Analysis of total pH, available Cd, and SO42− in soil
Seedlings of Nicotiana tabacum “Changbohuang” (age 60 d) were supplied by the College of Tobacco Science, Henan Agricultural University. Cd contaminated soil was collected from the experimental field (0–20 cm), located in Jiyuan city, Henan province, China, which was formerly polluted by a smeltery through atmospheric precipitation. After air drying, the soil was mixed and sieved (2 mm). The principal soil properties are listed in Table 1.
For the analysis of the sulfate content in soil, 5 g of the rhizosphere soil sample was added to a 50 mL centrifuge bottle and 20 mL deionized water was added; the mixture was shaken well at 25 °C. After centrifugation for 4 min, the supernatant was poured out into a 10 mL polyethylene test tube to obtain the water-soluble extract. After passing a water filtration membrane of 0.45 μm, the extract was determined via ion chromatography (Thermo ICS-600). The AS23 column was used as anion column and an AG9−HC column was used as protective column; the conductivity detector was used to detect it, and the suppressor was ASRS 4 mm. The chromatographic conditions were as follows: column temperature 30 °C, detection cell temperature 35 °C, Na2CO3 solution 9.0 × 10−3 mol L-1 as eluent [21].
2.2. Potting experiments Sulfur powder was thoroughly mixed with soil samples at the beginning of the experiment to ensure an initial sulfur concentration of 0 g kg−1 (no-sulfur treatment, S0), 0.51 g kg−1 (low-sulfur treatment, S1), Table 1 Physical and chemical properties of soil in the experiment. pH
Organic matter (%)
Total N (%)
Total P (%)
Total K (%)
Available N (mg kg−1)
Available P (mg kg−1)
Available K (mg kg−1)
Available Cd (mg kg−1)
Cd (mg kg−1)
8.1
1.815
0.113
0.102
2.38
70.65
20.4
157.89
1.1
9.4
309
Journal of Hazardous Materials 368 (2019) 308–315
X. Li et al.
construct the PE2C300 library according to the standard operating procedure of Illumina MiSeq platform (Illumina, San Diego, USA) by Majorbio Bio-Pharm Technology Co. Ltd. (Shanghai, China). The raw reads were deposited into the NCBI Sequence Read Archive (SRA) database (Accession Number: PRJNA505125). Raw fastq files were demultiplexed, quality-filtered by Trimmomatic, and merged by FLASH with the following criteria: (i) The reads were truncated at any site receiving an average quality score < 20 over a 50 bp sliding window. (ii) Primers were exactly matched allowing two nucleotide mismatchings, and reads containing ambiguous bases were removed. (iii) Sequences with overlap longer than 10 bp were merged according to their overlap sequence. UPARSE software (version 7.1 http://drive5.com/uparse/) was used to cluster the sequence using OTUs according to 97% similarity, and chimera was eliminated via UCHIME software. Each sequence was annotated via RDP classifier (http://rdp.cme.msu.edu/) and compared to the Silva database (silva128/16 s_bacteria). The threshold of alignment was set to 70%. Nonmetric multidimensional scaling (NMDS) analysis was performed with an OTU table using the vegan package of R.
For pH measurement of the soil, the rhizosphere soil samples were extracted via CaCl2 solution, and 5 g of the rhizosphere soil was added to 25 mL 0.01 mol L−1 CaCl2 solution. The pH was measured via microcomputer acidometer after oscillation. The analytical method of soil available Cd used 5.0 g rhizosphere soil samples that were accurately weighted and placed in a 50 mL triangular flask. 10.0 mL 0.005 mol L−1 DTPA extract was added. Extraction was done for 1 h from the oscillating machine at 25 °C followed by filtration. The Cd content in the filtrate was determined via AAS [22]. 2.6. Quantitative analysis of the sulfur oxidation gene in rhizospheric soil Rhizospheric soil samples were collected at the 60 d. The MoBio PowerSoilTM DNA (MO BIO laboratories, CA, USA) kit was used to extract DNA from rhizospheric soil. The extraction methods were conducted in accordance with the operating guidelines of the kit. FastPrep was used to break the cells, the fragmentation velocity was 5.0, the time was 45 s. The final DNA concentration and purification were determined via NanoDrop 2000 UV–vis spectrophotometer (Thermo Scientific, Wilmington, USA), and DNA quality was checked by 1% agarose gel electrophoresis. The cells were stored at −20 °C following DNA extraction. The quantitative PCR of dsrA, soxB, and sqr gene was conducted via ABI7500 fluorescence quantitative PCR (Applied Biosystems, USA). The PCR reaction system consisted of 16.5 μL 2 × ChamQ SYBR Color qPCR Master Mix (TaKaRa, Japan), 5 μmol L−1 forward and reverse primers, 0.8 μL each, and DNA template 2 μL, the rest was supplemented with ddH2O to 25 μL. sqr-473 F/982R, soxB-704 F/1199R, and dsrA-625 F/ 877R (Table 2) were used as amplification primers for quantitative PCR. The cycling protocol was as follows: initial denaturation for 30 s at 95 °C, followed by 40 cycles of denaturation for 5 s at 95 °C, annealing for 30 s at 50 °C for sqr, 55 °C for soxB, 60 °C for dsrA, and elongation for 40 s at 72 °C. The correlation coefficients ( r2) of the standard curves were > 0.999. The amplification efficiencies (E) of sqr, soxB, and dsrA were 75.5, 79.9, and 97.4%, respectively.
2.8. Statistical analysis A one-way ANOVA with Duncan's post hoc tests were performed to evaluate the differences within datasets, with significance defined as a value of 0.05 (SPSS 13.0 package, SPSS, Chicago, IL, USA).
3. Results and discussion 3.1. Effects of different sulfur concentrations on tobacco growth The addition of a chelating agent is an important strategy to improve the effects of phytoextraction. Traditional chelating agents, such as EDTA, EDDS, and NTA, have been applied for the phytoextraction by tobacco. However, these compounds are not ideal activators because they can inhibit the growth of tobacco, or the enhancement of Cd uptake by tobacco is limited [12,13]. To evaluate the effects of sulfur application on the growth of tobacco, the biomass of roots, stems, and leaves, as well as the number of leaves were analyzed. The results showed that neither high-sulfur nor low-sulfur treatments had a significant effect on the growth of tobacco (Fig. 1), suggesting that the application of sulfur as activator was safe and would not affect tobacco growth.
2.7. 16S rDNA sequencing Regarding 338 F/806R (Table 2) as primer tagged with barcode, the variable V3-V4 region was amplified via PCR. The amplification program was as follows: pre-denaturation at 95 °C for 3 min, 27 cycles (denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 45 s), and final 72 °C extension 10 min (PCR instrument: ABI GeneAmp®9700). The amplification system was 20 μL, including 4 μL 5×FastPfu buffer solution, 2 μL 2.5 mM dNTPs, 0.8 μL positive and negative primer (5 μM), 0.4 μL FastPfu polymerase, 0.2 μL BSA and 10 ng DNA template, proper level of ddH2O. PCR products were recovered by 2% agarose gel and purified by AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA, USA). Tris−HCl elution was detected via 2% agarose gel electrophoresis. Quantitative analysis was performed via QuantiFluor™-ST (Promega, USA). The purified amplification fragment was used to Table 2 Amplification primer sequence used in the experiment. Gene name
Primer name
primer sequence (5’-3’)
sqr
473F 982R 704F 1199R 625F 877R 338 F 806R
CATCCTGCTTCGGCCCNGCNTAYGART CCATGGATTCGATRTANCCNGTYT ATCGGYCAGGCYTTYCCSTA MAVGTGCCGTTGAARTTGC TTCAAGTTCTCCGGCTGCSCNAAYGACTG CGTTSANRCAGTGCATGCAGCG ACTCCTACGGGAGGCAGCAG GGACTACHVGGGTWTCTAAT
soxB dsrA 16S
Fig. 1. Effects of sulfur application for tobacco growth (A: Leaf; B: Stem; C: Root; D: Number of leaves). S0, S1, and S2 represent no-sulfur treatment, lowsulfur treatment and high sulfur-treatment, respectively. Values with the same letter indicate that there are no differences (P > 0.05). 310
Journal of Hazardous Materials 368 (2019) 308–315
X. Li et al.
Fig. 2. Effects of different sulfur levels on both accumulation and transport of Cd in tobacco (A: Cd content; B: translocation factor). S0, S1, and S2 represent no-sulfur treatment, low-sulfur treatment and high sulfur-treatment, respectively. Values with the same color and letter indicate that there are no differences (P > 0.05).
part is easier to harvest than the underground part, which is beneficial for the Cd removal from soil. Further analysis showed that although the distribution of Cd in tobacco was not changed in response to sulfur application, high-sulfur treatment increased the root-to-shoot translocation factor (Fig. 2B), indicating that the high sulfur content in tobacco was beneficial for the translocation from the root to the aboveground parts. Liu et al. considered that the transport of Cd from the soil to tobacco roots was a form of active transport, while the transport from the root system to aboveground part followed a passive process [7]. It has also been suggested that the efficiency of passive transport correlates positively with the number of carriers, which indicates that sulfur application may increase the number of carriers of Cd to some extent.
3.2. Effects of different sulfur concentrations on Cd accumulation in Tobacco Analyzing the distribution of Cd in tobacco leaves, stems, and roots showed that the Cd contents in tobacco without sulfur application were 35.4, 23.6, and 26.3 mg kg−1, respectively, which was higher than the background value of Cd in soil (9.4 mg kg−1) (Table 1 and Fig. 2A). However, our determination of tobacco enrichment was lower than reported previously. For example, in the study of Liu et al. (2016), Cd in soil was 9.21 mg kg−1 (comparable to the level in this study) while the Cd content in tobacco leaves reached 92.0 mg kg−1 [7], which was much higher than the results obtained in this study. On the one hand, this difference is likely related to the varieties [8]. The variety “K326” in the study of Liu et al. (2016) may have a higher Cd bioaccumulation capability than “Changbohuang” in the current work. On the other hand, chemical forms and partitioning of Cd in the soil also affect its phytoavailability [23]. In the soil solution, Cd is mainly present as Cd2+, which is the main form for plant uptake. In the solid phase, Cd may be reversibly bound to soil particulates, which can be readily released into the soil solution. The chemical forms and partitioning of Cd in soil are strongly affected by various conditions, such as redox potential, cation exchange capacity, soil pH, microbial communities, competing cations, and temperature [23]. This suggests that the choice of high accumulation variety of tobacco and appropriate improvement of soil physicochemical properties were important to enhance the phytoavailability in the phytoextraction practice. Furthermore, different amounts of sulfur application had different effects on Cd accumulation in tobacco. Low-sulfur treatment did not significantly affect the Cd contents in tobacco; however, the high-sulfur treatment significantly increased the Cd content, and the measured Cd contents in leaves, stems, and roots were 66.4, 46.1, and 42.6 mg kg−1, respectively. These values were 1.88, 1.95, and 1.62 times higher than the corresponding values under non-sulfur treatment (Fig. 2A), indicating that appropriate sulfur application can promote the uptake and accumulation of Cd in tobacco. In addition, according to the observations of previous studies [24,25], sulfur not only promoted Cd absorption, but also increased the uptake of several heavy metals (copper, zinc, nickel, and chromium) by other plants, such as Zea mays L., Brassica juncea, Brassica oleraceae, and Cercis canadensis. Therefore, it is of universal significance to promote the absorption and accumulation of heavy metals via sulfur application, which is a measure worth to further develop to enhance the phytoextraction efficiency. It has been suggested that hyperaccumulator plants have a strong capacity to transport heavy metals upward, and Cd content in the aboveground part is typically higher than that in the underground part [25], while Cd content in non-hyper accumulator plants follows the opposite trend [25,26]. Tobacco also has this characteristic, i.e., the accumulation of Cd in leaves happens prior to other parts (Fig. 2A). This is more advantageous for phytoextraction, because the aboveground
3.3. Effects of different sulfur concentrations on the total sulfur and nonprotein thiol compounds in Tobacco Sulfur is an essential element for tobacco and a raw material for the synthesis of NPTs. NPTs, including PCs, GSH, and cysteine, can be induced and synthesized by Cd and other heavy metals [27]. A large number of studies have shown that the chelation of NPTs with Cd may not only achieve detoxification, but also participate in the long-distance transport of Cd [28,29]. Another study suggested that NPTs may play an important role in the Cd uptake by plants, as the uptake rate of Cd by Suaeda salsa was significantly reduced in response to N-ethylmaleimide (a thiol blocker) pretreatment [17]. Analyzing the content of sulfur related compounds in different organs of tobacco showed that sulfur application increased the total sulfur content in the roots, stems, and leaves of tobacco (Fig. 3A). However, the content of NPTs was not significantly affected, except the value of stems in high-sulfur application (Fig. 3B), which indicated that sulfur application could promote the absorption of sulfur in tobacco but failed to biosynthesize NPTs. 3.4. Effects of different sulfur concentrations on pH value and available Cd content in soil To further elucidate the mechanism of sulfur application promoting Cd accumulation in tobacco, both the soil pH and available Cd content were analyzed. The results showed that the background value of the soil pH was 8.1, and at the end of the experiment, the soil pH of control and no-sulfur treatment changed little, with values of 8.0 and 7.9, respectively. The pH value of soil decreased by sulfur application treatment. In particular, the pH value of high-sulfur and low-sulfur treatment decreased to 7.1 and 7.5, respectively (Fig. 4A). At the end of the experiment, the available Cd content changed slightly under the control, no-sulfur treatment, and low-sulfur treatment, reaching 1.2, 1.3, and 1.4 mg kg−1 from 1.1 mg kg-1 (background value), respectively. However, the content of available Cd under the high-sulfur treatment increased to the highest level (3.3 mg kg−1) (Fig. 4B), indicating that sulfur can decrease the pH value of soil and increase the bioavailability 311
Journal of Hazardous Materials 368 (2019) 308–315
X. Li et al.
Fig. 3. Effects of different sulfur level on total sulfur and NPTs in tobacco (A: total sulfur content: B: NPTs). S0, S1, and S2 represent no-sulfur treatment, low-sulfur treatment and high sulfur-treatment, respectively. Values with the same color and letter indicate that there are no differences (P > 0.05).
of Cd. This phenomenon has also been described in other studies [15,16]. Hoefer et al. (2015) suggested that sulfur is oxidized by sulfur oxidizing bacteria in the soil, accompanied by producing sulfate radicals and releasing protons, thus improving the bioavailability and phytoextraction of Cd. This effect is related to the amount of sulfur application, i.e., the greater the sulfur application, the higher the Cd bioavailability will be [15]. In this study, although the pH value of lowsulfur treatment decreased, it did not effectively improve the Cd availability, compared to the control. This is likely due to the strong buffering capacity and cation exchange capacity of the soil; therefore, it failed to significantly increase the Cd bioaccumulation in tobacco.
3.5. Microbial transformation of sulfur in the rhizosphere In this study, the sulfate content of soil was analyzed. The results showed that the sulfate content of the no-sulfur treatment was 44.6 mg kg−1 at the end of the experiment, while that of the high-sulfur treatment and the low-sulfur treatment increased to 788.1 and 349.5 mg kg-1, respectively (Fig. 5). This may account for the increased total sulfur concentration in tobacco under both treatments (Fig. 3A). Meanwhile, the results also confirmed the previous supposition that exogenous sulfur was transformed into sulfate radicals by sulfur oxidizing bacteria in soil. Sulfur-oxidization by prokaryotes is widespread in the soil and mechanism for the oxidation of reduced sulfur are diverse. In the periplasm of prokaryotes, sulfur oxidation occurred via the Sox pathway, in which the thiosulfate-oxidizing Sox enzyme complex convert thiosulfate to sulfate. The Sox enzyme complex was encoded by soxB gene, which was widespread among the various phylogenetic groups of sulfur-oxidizing bacteria [30]. In the cytoplasm, the Dsr pathway can be utilized, in which the accumulation of zero-valent sulfur can be oxidized to thiosulfate or polysulfides via the reverse dissimilatory sulfite reductase system, encoded by the
Fig. 5. Effects of different sulfur concentrations on sulfate content in soil. Control represents without tobacco planting and S addition. S0, S1, and S2 represent no-sulfur treatment, low-sulfur treatment and high sulfur-treatment, respectively. Values with the same letter indicate that there are no differences (P > 0.05).
dsrABEFHCMKLJOPNRS gene cluster [31]. In addition, Sulfide:quinone oxidoreductase, encoded by sqr, catalyzes sulfide oxidation during sulfide-dependent chemo- and phototrophic growth in bacteria [32]. Many studies used one or more of these functional sulfur oxidation genes, such as dsrA, soxB, and sqr, as molecular biomarkers to examine communities of sulfur-oxidizing bacteria and their roles in various environments [30,33]. In this work, to further understand the microbial transformation process of sulfur in the rhizosphere of soil, the copy number of sulfur oxidation-related genes was investigated via quantitative PCR. The results showed that both high-sulfur and low-sulfur treatments increased their copy numbers for dsrA and soxB. With regard to sqr, the copy numbers of high-sulfur and low-sulfur treatments were
Fig. 4. Effects of different sulfur levels on soil pH and available Cd concentration (A: pH value; B: available Cd concentration). Control represents without tobacco planting and S addition. S0, S1, and S2 represent no-sulfur treatment, low-sulfur treatment and high sulfur-treatment, respectively. 312
Journal of Hazardous Materials 368 (2019) 308–315
X. Li et al.
Fig. 6. Effects of different sulfur concentrations on the copy numbers of dsrA, soxB, and sqr genes in soil (A: dsrA; B: soxB; and C: sqr). Control represents without tobacco planting and S addition. S0, S1, and S2 represent no-sulfur treatment, low-sulfur treatment and high sulfur-treatment, respectively. Values with the same letter indicate that there are no differences (P > 0.05).
Fig. 7. Abundance of two OTUs responsible for sulfur oxidation (A) and their dendrogram (B). Control represents without tobacco planting and S addition. S0, S1, and S2 represent no-sulfur treatment, low-sulfur treatment and high sulfur-treatment, respectively. Values with the same color and letter indicate that there are no differences (P > 0.05). Neighbor-joining tree based on 16S rRNA gene sequences showing the phylogenetic position of the bacteria corresponding OTU 1718, OTU 1216 and their representatives of other related taxa. Bootstrap values (expressed as percentages of 1000 replications) > 50% are shown at the branch points. Bar 0.005 substitutions per nucleotide position.
significantly lower than those of no-sulfur treatments (Fig. 6). This suggests that both soxB and dsrA may play key roles in the sulfur oxidation; however, the copy number of sqr is low probably due to the lack of sulfide oxidation in soil. High-throughput sequencing analysis of the 16 s rDNA gene of soil bacteria showed that the abundance of OTU1718 and OTU1216 in nosulfur treatment was only 0.01% at the end of the experiment. With increasing sulfur application level, the abundance of both OTUs gradually increased. In the high-sulfur treatment, they became the two most abundant OTUs, with abundances reaching 6.28% and 5.26%, respectively (Fig. 7A). The construction of a dendrogram showed that both OTU1718 and OTU1216 belong to Thiobacillus sp. They were closely related to Thiobacillus thioparus and uncultured Thiobacillus sp. clone X-41, respectively (Fig. 7B). Thiobacillus thioparus is a type of autotrophic bacterium that can oxidize sulfur to sulfuric acid [34], which might be responsible for the increase of sulfate content in soil (Fig. 5). It can furthermore obtain energy during this oxidation process by using CO2 as carbon source to promote growth [35]. Unlike many types of sulfur oxidizing bacteria (Acidithiobacillus thiooxidans and Acidithiobacillus ferrooxidans) which prefer to grow in an acidic environment, the optimum pH for the growth of Thiobacillus thioparus is 7.5, which is close to the pH value of soil with high-sulfur treatment; therefore, this might be the main reason why T. thioparus can become a dominant bacterium in the soil in response to sulfur treatment [36]. It has also been reported that the soxB and dsrA gene are present in the Thiobacillus sp. strains [30,33], suggesting that the increased copy number of the soxB and dsrA genes after sulfur application may be a result of the proliferation of Thiobacillus sp. strains. The combined results also indicated that Thiobacillus sp. plays an important role in the sulfur oxidation, soil acidification and enhancement of Cd phytoavailability in this work.
Table 3 Effects of sulfur application on the diversity of soil bacteria. Control represents without tobacco planting and S addition. S0, S1, and S2 represent no-sulfur treatment, low-sulfur treatment and high sulfur-treatment, respectively. The same column with the same letter indicates no significant difference (P > 0.05). Treatments
Shannon index
Coverage
Control S0 S1 S2
6.57a 6.45 a 6.20 a 5.99 a
0.99 0.99 0.99 0.99
Fig. 8. NMDS analysis of soil bacterial community. Control represents without tobacco planting and S addition. S0, S1, and S2 represent no-sulfur treatment, low-sulfur treatment and high sulfur-treatment, respectively.
313
Journal of Hazardous Materials 368 (2019) 308–315
X. Li et al.
Fig. 9. Effect of sulfur application on soil bacterial community structure (A: portal level; B: generic level). Control represents without tobacco planting and S addition. S0, S1, and S2 represent no-sulfur treatment, low-sulfur treatment and high sulfur-treatment, respectively.
large biomass, thus offers the potential for the remediation of Cd contaminated soil. In this study, the effect of sulfur application on the uptake of Cd, as well as its possible mechanisms of rhizospheric microorganisms were investigated. The results showed that tobacco has a good ability to accumulate and transport of Cd, and the leaves had the strongest enrichment ability for Cd accumulation, followed by the roots and stems. Sulfur supplication can affect the uptake and accumulation of Cd in tobacco; however, it is related to the amount of sulfur application. Only a high amount of sulfur application can effectively promote the bioaccumulation of Cd in leaves, stems, and roots of tobacco. The mechanism may be mediated by the enhancement of Cd bioavailability in soil, caused by the acidification of soil through a sulfur oxidation reaction. Both dsrA and soxB genes may play important roles in sulfur oxidation to release proton and sulfate radical, and Thiobacillus was the dominant bacterial genus for sulfur oxidation. Sulfur application had little effect on the growth of tobacco or the diversity of rhizosphere bacteria, implying its safety in practical utility. The combined results highlighted the importance of the sulfur application in phytoextraction. In future studies, sulfur oxidizing bacteria, such as Thiobacillus sp., should be isolated and applied in elemental sulfur-aided phytoextraction of Cd to improve the remediation efficiency by tobacco.
3.6. Effects of sulfur application on the diversity and structure of rhizosphere bacteria The results of high throughput sequencing showed that the sequence coverage rate was 99%, which indicates that the depth of sequence is reasonable and can basically represent the true sample situation (Table 3). A comparison of the diversity indices showed that there was no significant difference in the Shannon index among different treatments (Table 3); therefore, it can be concluded that the effect of sulfur application on the diversity of soil microbial community is small. NMDS analysis showed that the difference of no-sulfur, low-sulfur, and high-sulfur treatments was smaller than the comparison to control (Fig. 8). Tobacco tends to secrete large amounts of compounds during its growth stages, such as organic acids and sugars, which can be used as nutrients for rhizospheric microorganisms and affect their community structure [37]. This might be the main reason why tobacco plants had a greater effect on microbial community than sulfur application. These results also suggest that sulfur application had less effect on the microbial community structure. At the phylum level, a total of 27 bacteria were detected in each treatment, nine of which were dominant (abundance > 1%). The four more abundant bacteria were Proteobacteria (26.78%), Actinobacteria (25.12%), Chloroflexi (17.57%), and Acidobacteria (11.29%) in the control. After tobacco cultivation, Actinobacteria abundance increased to 31.62%, becoming the most abundant phylum, while the abundance of other phyla decreased. Compared to no sulfur treatment, the abundance of most phyla decreased, while the abundance of Proteobacteria increased after sulfur application. Proteobacteria abundances in lowsulfur and high-sulfur treatment reached 26.05% and 33.92%, respectively (Fig. 9A). At the genus level, the top abundant genera in the control and no-sulfur treatment were norank_f__Anaerolineaceae (3.4%) and norank_f__Gemmatimonadaceae (2.5%), respectively. However, Thiobacillus, which are typical sulfur oxidizing bacteria, became the most abundant genus in both the low-sulfur and high-sulfur treatments, and its abundance reached 6.3% and 11.54%, respectively (Fig. 9B), indicating that sulfur oxidation was the most important biochemical process in soil. However, the top 20 bacteria with the highest abundance were basically identical among all treatments, implying that the effect of sulfur application on the rhizosphere microbial structure was limited, unlike the effect of EDTA or EDDS addition, which had strong effects on soil bacterial diversity and community structure [38,39]. The combined results suggest that sulfur application is safe and effective for the phytoextraction of Cd by tobacco.
Acknowledgments The study was financially supported by the National Key Research and Development Program of China (2018YFD0800304), the Key Project Science and Technology Education Department of Henan (17A610001), and the National Natural Science Foundation of China (41401350). References [1] F.J. Zhao, Y.B. Ma, Y.G. Zhu, Z. Tang, S.P. Mcgrath, Soil contamination in China: current status and mitigation strategies, Environ. Sci. Technol. 49 (2015) 750–759. [2] A. Wiszniewska, E. Hanus-Fajerska, E. Muszynska, K. Ciarkowska, Natural organic amendments for improved phytoremediation of polluted soils: a review of recent progress, Pedosphere 26 (2016) 1–12. [3] S.Y. He, X.E. Yang, Z. He, V.C. Baligar, Morphological and physiological responses of plants to cadmium toxicity: a review, Pedosphere 27 (2017) 421–438. [4] N. Verbruggen, C. Hermans, H. Schat, Molecular mechanisms of metal hyperaccumulation in plants, New Phytol. 181 (2009) 759–776. [5] D.D. Hou, K. Wang, T. Liu, H.X. Wang, Z. Lin, J. Qian, L.L. Lu, S.K. Tian, Unique rhizosphere micro-characteristics facilitate phytoextraction of multiple metals in soil by the hyperaccumulating plant Sedum alfredii, Environ. Sci. Technol. 51 (2017) 5675–5684. [6] L. Deng, Z. Li, J. Wang, H.Y. Liu, N. Li, L.H. Wu, P.J. Hu, Y.M. Luo, P. Christie, Longterm field phytoextraction of zinc/cadmium contaminated soil by Sedum plumbizincicola under different agronomic strategies, Int. J. Phytorem. 18 (2016) 134–140. [7] H.W. Liu, H.Y. Wang, Y.B. Ma, H.H. Wang, Y. Shi, Role of transpiration and metabolism in translocation and accumulation of cadmium in tobacco plants, Chemosphere 144 (2015) 1960–1965. [8] T. Doroszewska, A. Berbec, Variation for cadmium uptake among Nicotiana species,
4. Conclusions Tobacco is a plant with high Cd bioaccumulation capability and 314
Journal of Hazardous Materials 368 (2019) 308–315
X. Li et al.
soil heavy metals and their uptake by maize, Environ. Int. 30 (2004) 323–328. [25] G. Dede, S. Ozdemir, Effects of elemental sulphur on heavy metal uptake by plants growing on municipal sewage sludge, J. Environ. Manage. 166 (2016) 103–108. [26] J.L. Fan, Z.Y. Hu, N. Ziadi, X. Xia, C.Y.H. Wu, Excessive sulfur supply reduces cadmium accumulation in brown rice (Oryza sativa L.), Environ. Pollut. 158 (2010) 409–415. [27] F.F. Nocito, C. Lancilli, B. Dendena, G. Lucchini, G.A. Sacchi, Cd retention in rice roots is influenced by Cd availability, chelation and translocation, Plant Cell. Environ. 34 (2011) 994–1008. [28] H. Bashir, M.M. Ibrahim, R. Bagheri, J. Ahmad, I.A. Arif, M.A. Baig, M.I. Qureshi, Influence of sulfur and cadmium on antioxidants, phytochelatins and growth in Indian mustard, AoB Plants 7 (2015) 1–9. [29] J.W. Wu, A. Sagervanshi, K.H. Muehling, Sulfate facilitates cadmium accumulation in leaves of Vicia faba L. at flowering stage, Ecotoxicol. Environ. Saf. 156 (2018) 375–382. [30] B. Meyer, J.F. Imhoff, J. Kuever, Molecular analysis of the distribution and phylogeny of the soxB gene among sulfur-oxidizing bacteria-evolution of the Sox sulfur oxidation enzyme system, Environ. Microbiol. 9 (2007) 2957–2977. [31] C. Dahl, S. Engels, A.S. Pott-Sperling, A. Schulte, J. Sander, Y. Lubbe, O. Deuster, D.C. Brune, Novel genes of the dsr gene cluster and evidence for close interaction of Dsr proteins during sulfur oxidation in the phototrophic sulfur bacterium Allochromatium vinosum, J. Bacteriol. 187 (2005) 1392–1404. [32] L.K. Chan, R.M. Morgan-Kiss, T.E. Hanson, Functional analysis of three sulfide: Quinone oxidoreductase homologs in Chlorobaculum tepidum, J. Bacteriol. 191 (2009) 1026–1034. [33] J.F. Luo, X. Tan, K.X. Liu, W.T. Lin, Survey of sulfur‑oxidizing bacterial community in the Pearl River water using soxB, sqr, and dsrA as molecular biomarkers, 3 Biotech 8 (2018) 73–82. [34] W.J. Gu, W. Sun, Y.S. Lu, X. Li, P.Z. Xu, K.Z. Xie, L.L. Sun, H.T. Wu, Effect of Thiobacillus thioparus 1904 and sulphur addition on odour emission during aerobic composting, Bioresour. Technol. 249 (2018) 254–260. [35] E.J. Johnson, J.H.D. Peck, Coupling of phosphorylation and carbon dioxide fixation in extracts of Thiobacillus thioparus, J. Bacteriol. 89 (1965) 1041–1050. [36] S.Y. Chen, J.G. Lin, Enhancement of metal bioleaching from contaminated sediment using silver ion, J. Hazard. Mater. 161 (2009) 893–899. [37] P.N. Chiang, M.K. Wang, C.Y. Chiu, S.Y. Chou, Effects of Cd amendments on lowmolecular-weight organic acid exudates in rhizosphere soils of tobacco and sunflower, Environ. Toxicol. 21 (2006) 479–488. [38] L. Yang, G.P. Wang, Z.N. Cheng, Y. Liu, Z.G. Shen, C.L. Luo, Influence of the application of chelant EDDS on soil enzymatic activity and microbial community structure, J. Hazard. Mater. 262 (2013) 561–570. [39] G. Vigliotta, S. Matrella, A. Cicatelli, F. Guarino, S. Castiglione, Effects of heavy metals and chelants on phytoremediation capacity and on rhizobacterial communities of maize, J. Environ. Manage. 179 (2016) 93–102.
Genet. Resour. Crop. EV. 51 (2004) 323–333. [9] R. Vögeli-Lange, G.J. Wagner, Relationship between cadmium, glutathione and cadmium-binding peptides (phytochelatins) in leaves of intact tobacco seedlings, Plant Sci. 114 (1996) 11–18. [10] K. Rosén, J. Eriksson, M. Vinichuk, Uptake and translocation of 109Cd and stable Cd within tobacco plants (Nicotiana sylvestris), J. Environ. Radioact. 113 (2012) 16–20. [11] H. Khoudi, Y. Maatar, S. Gouiaa, K. Masmoudi, Transgenic tobacco plants expressing ectopically wheat H+-pyrophosphatase (H+-PPase) gene TaVP1 show enhanced accumulation and tolerance to cadmium, J. Plant Physiol. 169 (2012) 98–103. [12] A. Kayser, K. Wenger, A. Keller, W. Attinger, H.R. Felix, S.K. Gupta, R. Schulin, Enhancement of phytoextraction of Zn, Cd, and Cu from calcareous soil: The use of NTA and sulfur amendments, Environ. Sci. Technol. 34 (2000) 1778–1788. [13] M.W.H. Evangelou, U. Bauer, M. Ebel, A. Schaeffer, The influence of EDDS and EDTA on the uptake of heavy metals of Cd and Cu from soil with tobacco Nicotiana tabacum, Chemosphere 68 (2007) 345–353. [14] F.R. Capaldi, P.L. Gratao, A.R. Reis, L.W. Lima, R.A. Azevedo, Sulfur metabolism and stress defense responses in plants, Trop. Plant Biol. 8 (2015) 60–73. [15] C. Hoefer, J. Santner, M. Puschenreiter, W.W. Wenzel, Localized metal solubilization in the rhizosphere of salix smithiana upon sulfur application, Environ. Sci. Technol. 49 (2015) 4522–4529. [16] Y.P. Wang, Q.B. Li, W. Hui, J.Y. Shi, Q. Lin, X.C. Chen, Y.X. Chen, Effect of sulphur on soil Cu/Zn availability and microbial community composition, J. Hazard. Mater. 159 (2018) 385–389. [17] L.Z. Li, X.L. Liu, W.J.G.M. Peijnenburg, J.M. Zhao, X.B. Chen, J.B. Yu, H.F. Wu, Pathways of cadmium fluxes in the root of the halophyte Suaeda salsa, Ecotoxicol. Environ. Saf. 75 (2012) 1–7. [18] S. Clemens, Toxic metal accumulation, responses to exposure and mechanisms of tolerance in plants, Biochimie 88 (2006) 1707–1719. [19] X.Z. Li, Y.J. Wang, Y.S. Pan, H. Yu, X.L. Zhang, Y.P. Shen, S. Jiao, K. Wu, G.X. La, Y. Yuan, S.M. Zhang, Mechanisms of Cd and Cr removal and tolerance by macrofungus Pleurotus ostreatus HAU-2, J. Hazard. Mater. 330 (2017) 1–8. [20] M.F. Lopez-Climent, V. Arbona, R.M. Perez-Clemente, S.I. Zandalinas, A. GomezCadenas, Effect of cadmium and calcium treatments on phytochelatin and glutathione levels in citrus plants, Plant Biol. 16 (2012) 79–87. [21] P. Věra, Š. Karel, Capillary electrophoresis of inorganic anions and its comparison with ion chromatography, J. Chromatogr. A 789 (1997) 169–180. [22] R. Gruter, B. Costerousse, A. Bertoni, J. Mayer, C. Thonar, E. Frossard, R. Schulin, S. Tandy, Green manure and long-term fertilization effects on soil zinc and cadmium availability and uptake by wheat (Triticum aestivum L.) at different growth stages, Sci. Total Environ. 599 (2017) 1330–1343. [23] M. Shahid, S. Shamshad, M. Rafiq, S. Khalid, I. Bibi, N.K. Niazi, C. Dumat, M.I. Rashid, Cadmium bioavailability, uptake, toxicity and detoxification in soilplant system, Chemosphere 178 (2017) 513–533. [24] Y.S. Cui, Y.T. Dong, H.F. Li, Q.R. Wang, Effect of elemental sulphur on solubility of
315
Contents lists available at ScienceDirect
Journal of Hazardous Materials journal homepage: www.elsevier.com/locate/jhazmat
Effects of sulfur application on cadmium bioaccumulation in tobacco and its possible mechanisms of rhizospheric microorganisms
T
Xuanzhen Lia, Hao Yua, Xiaowei Sunb, Jiantao Yanga, Daichang Wangc, Lianfeng Shena, ⁎ Yanshuo Pand, Yucheng Wue, Qiang Wangc, Yong Zhaoa, a
College of Forestry, Henan Agricultural University, Zhengzhou, 450002, China Henan Academy of Forestry, Zhengzhou, 450008, China c College of Resources and Environment, Henan Agricultural University, Zhengzhou, 450002, China d College of Life Science, Henan Agricultural University, Zhengzhou, 450002, China e Key Laboratory of Soil Environment and Pollution Remediation, Institute of Soil Science, Chinese Academy of Sciences, Nanjing, 210008, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Tobacco Sulfur application Bioremediation Cadmium Rhizospheric microorganisms
A potting experiment was conducted to investigate the effect of sulfur application on the bioaccumulation by tobacco and its mechanisms of rhizospheric microorganisms. Cadmium content in tobacco was analyzed using atomic absorption spectrometer, while bacterial community and related gene in soil were analyzed via highthroughput sequencing and quantitative PCR techniques, respectively. The obtained results indicated that tobacco had the ability to accumulate cadmium under no sulfur application conditions, with cadmium contents of 35.4, 23.6, and 26.3 mg kg−1 in leaves, stems, and roots, respectively. Under high-sulfur treatment, these values increased to 66.4, 46.1, and 42.6 mg kg-1, respectively, probably due to the increase of the available cadmium content (from 1.1 to 3.3 mg kg−1) in the soil through a decrease of the soil pH value, which was contributed by the sulfur oxidation reaction. dsrA and soxB genes might play an important role in sulfur oxidation, and Thiobacillus sp. was the dominant bacterial genus during the sulfur oxidation process. In addition, sulfur application exerted little effect on the diversity and structure of the soil bacterial community. The combined results indicate that sulfur application is an effective and safe method for Cd phytoextraction by tobacco.
1. Introduction Cadmium (Cd) is a harmful element that has been classified as a carcinogen (Category 1) by the International Agency for Research on Cancer (IARC). According to a recent survey, the Cd content in the soil of China has exceeded the standard by 7.0%. Consequently, food that exceeds the standard as a result of soil pollution occurs frequently, which is potentially dangerous to the health of consumers [1]. Therefore, the remediation of the contaminated soil has always been of high concern. Phytoextraction with hyperaccumulating plants has long been described as a promising method for the remediation of soils contaminated with heavy metals, including Cd [2]. The importance of this method lies in the substantial uptake of Cd from soil via roots of hyperaccumulator. Currently, a number of Cd hyperaccumulator plants, such as Sedum alfredii, Thlaspi caerulescens, Arabidopsis halleri, and Brassica juncea, are found [3]. The mechanisms of uptake, transport and detoxification of Cd by plants have been reported [3,4]. Among various bioaccumulation mechanisms, the unique rhizosphere environment was
⁎
considered as one of the most important characteristics in the phytoextraction of Cd, including the reduced soil pH, higher metal bioavailability, and increased rhizomicrobial activity [5]. Recently, fieldscale remediation of cadmium contaminated soil has also been attempted [3,6]. However, most of the hyperaccumulators typically only achieve low biomass, have a slow growth rate, and show poor environmental adaptability [2,7], which limits the application of phytoextraction technology. Tobacco belongs to the family of Solanaceae and is also an important economic crop, which is widely planted throughout the world. This plant has a specific enrichment capacity for Cd [7]. For example, an experiment including 59 tobacco varieties indicated that the Cd content in leaves reached 30.45–116.28 mg kg−1 when they were planted in soil with a Cd content of 8.0 mg kg-1 [8]. In addition, the Cd translocation to the shoot appears to be rapid, probably within hours [9]. As a result, the leaves could accumulate about 50% of the total Cd taken up by the tobacco plant [10]. Genetic modification of tobacco to improve Cd accumulation has also been attempted [11]. Although the
Corresponding author. E-mail address: [email protected] (Y. Zhao).
https://doi.org/10.1016/j.jhazmat.2018.12.099 Received 28 August 2018; Received in revised form 15 November 2018; Accepted 26 December 2018 Available online 27 December 2018 0304-3894/ © 2019 Elsevier B.V. All rights reserved.
Journal of Hazardous Materials 368 (2019) 308–315
X. Li et al.
and 1.02 g kg−1 (high-sulfur treatment, S2). Plastic pots were used in the experiments and 1 kg of soil was loaded into each pot. After tobacco seedlings had been transplanted to the pots, the pots were transferred to a light culture room under a culture conditions of a 14 h: 10 h photoperiod at 400 mmol m-2 s-1, day: night temperatures of 25: 20 °C and day: night humidity of 60–70%. Soil that had neither sulfur addition nor plant cultivation was used as control and each treatment was repeated at least three times. Deionized water was added to maintained the moisture content to about 80% of the moisture-holding capacity. After 60 d of growth, plants were harvested and gently washed with distilled water. All plants were then separated into roots, stems, and leaves using stainless steel scissors. The dry weight of the tissue was determined via the moisture content of the corresponding part of wet weight.
enrichment factor of tobacco is lower than that of other hyperaccumulator plants, tobacco has a large biomass. As a result, the total amount of Cd uptake by tobacco far exceeds that of other hyperaccumulators [12]. In addition, tobacco has specific advantages of rapid growth and strong adaptability to the environment for phytoextraction [7,13]. Therefore, tobacco posed the important potential in Cd contaminated soil remediation. Although several conditions are required, the bioavailability of Cd is considered to be a critical factor for plant-uptake efficiency. Chelateassisted phytoextraction has been proposed to improve the efficiency of conventional phytoextraction of heavy metals [13]. Ethylene diamine disuccinate (EDDS) and ethylene diamine tetraacetate (EDTA) are two traditional chelating agents; however, no desirable results were obtained when these two compounds were used in phytoextraction of Cd by tobacco [13]. Sulfur is one of the essential elements in plants and has important physiological functions, which include the tolerance to abiotic stress, secondary metabolism, photosynthetic oxygen production, and electron transport [14]. In addition to these functions, studies have shown that sulfur also increases the uptake and accumulation of Cd in plants and the two following reasons are plausible: First, the utilization of sulfur can reduce the pH value of soil and thus improve the bioavailability of Cd, which is beneficial for the uptake by plants [15,16]. Secondly, sulfur application can provide the raw materials for the plant synthesis of glutathione (GSH), phytochelatins (PCs), and other non-protein thiols (NPTs), which can chelate intracellularly with Cd, thus promoting the uptake and transport as well as detoxification of Cd [14,17,18]. In addition, sulfur offers advantages of low cost, nontoxicity, and supplementation of sulfur nutrition. Therefore, it has been considered that sulfur application is an ideal enhanced method for phytoextraction. In this study, tobacco was used as model plant, and potting experiments were conducted to evaluate the effects of different amounts of sulfur application on tobacco growth and Cd uptake, by adding both high and low doses of sulfur to Cd contaminated soil. The changes of total sulfur and NPTs content in tobacco, soil pH, available Cd content, sulfate radical content, sulfur oxidation gene copy numbers, and rhizospheric microbial community were analyzed to investigate the possible mechanisms with which sulfur promotes the Cd uptake by tobacco. The obtained results provide the foundation for future Cd phytoextraction by tobacco.
2.3. Cd concentration analysis Dried and homogenized tobacco tissue powders were thoroughly digested with nitric acid and sulphuric acid (3:1 ratio); then, the samples were analyzed via atomic absorption spectrometer (AAS, Agilent 3510, USA) [19]. The methodical detection limit was 0.05, and R2 of the standard curves was 0.9996. The Cd analysis conditions were: width of spectral band of 0.4 nm, wavelength of 228.8 nm, and flow combustible gas of 1000 mL min−1. 2.4. Analysis of total sulfur and total non-protein thiol concentration in plants Determination of total sulfur content in tobacco: 0.500 g sample was weighed and placed in a microwave digestion tank, followed by digestion with 7 mL HClO4 and 2 mL H2O2 (180 °C, 15 min). Then, it was transferred to a fixed volume of 25 mL to remove acid, placed in a 25 mL colorimetric dish, and the total sulfur content of the tobacco was determined via inductively coupled plasma emission spectrometry (ICPAES). Total NPTs were extracted by homogenizing 0.5 g frozen plant tissue with 2 ml 5% 5-sulphosalicylic acid (SSA) with 6.3 mM diethylenetriaminepenta acetic acid (DETAPAC) using a prechilled mortar, pestle, and quartz sand. After the homogenate was centrifuged, the supernatant was collected and immediately used for the assay of NPTs: 300 μL supernatant were mixed with 630 μL K2HPO4 (0.5 M, pH 7.5). The absorbance at 412 nm was read 2 min before and after the addition of 25 μL 6 mM DTNB solution (DTNBε = 13,600 M−1 cm-1) [20].
2. Materials and methods 2.1. Tobacco seedlings and soil
2.5. Analysis of total pH, available Cd, and SO42− in soil
Seedlings of Nicotiana tabacum “Changbohuang” (age 60 d) were supplied by the College of Tobacco Science, Henan Agricultural University. Cd contaminated soil was collected from the experimental field (0–20 cm), located in Jiyuan city, Henan province, China, which was formerly polluted by a smeltery through atmospheric precipitation. After air drying, the soil was mixed and sieved (2 mm). The principal soil properties are listed in Table 1.
For the analysis of the sulfate content in soil, 5 g of the rhizosphere soil sample was added to a 50 mL centrifuge bottle and 20 mL deionized water was added; the mixture was shaken well at 25 °C. After centrifugation for 4 min, the supernatant was poured out into a 10 mL polyethylene test tube to obtain the water-soluble extract. After passing a water filtration membrane of 0.45 μm, the extract was determined via ion chromatography (Thermo ICS-600). The AS23 column was used as anion column and an AG9−HC column was used as protective column; the conductivity detector was used to detect it, and the suppressor was ASRS 4 mm. The chromatographic conditions were as follows: column temperature 30 °C, detection cell temperature 35 °C, Na2CO3 solution 9.0 × 10−3 mol L-1 as eluent [21].
2.2. Potting experiments Sulfur powder was thoroughly mixed with soil samples at the beginning of the experiment to ensure an initial sulfur concentration of 0 g kg−1 (no-sulfur treatment, S0), 0.51 g kg−1 (low-sulfur treatment, S1), Table 1 Physical and chemical properties of soil in the experiment. pH
Organic matter (%)
Total N (%)
Total P (%)
Total K (%)
Available N (mg kg−1)
Available P (mg kg−1)
Available K (mg kg−1)
Available Cd (mg kg−1)
Cd (mg kg−1)
8.1
1.815
0.113
0.102
2.38
70.65
20.4
157.89
1.1
9.4
309
Journal of Hazardous Materials 368 (2019) 308–315
X. Li et al.
construct the PE2C300 library according to the standard operating procedure of Illumina MiSeq platform (Illumina, San Diego, USA) by Majorbio Bio-Pharm Technology Co. Ltd. (Shanghai, China). The raw reads were deposited into the NCBI Sequence Read Archive (SRA) database (Accession Number: PRJNA505125). Raw fastq files were demultiplexed, quality-filtered by Trimmomatic, and merged by FLASH with the following criteria: (i) The reads were truncated at any site receiving an average quality score < 20 over a 50 bp sliding window. (ii) Primers were exactly matched allowing two nucleotide mismatchings, and reads containing ambiguous bases were removed. (iii) Sequences with overlap longer than 10 bp were merged according to their overlap sequence. UPARSE software (version 7.1 http://drive5.com/uparse/) was used to cluster the sequence using OTUs according to 97% similarity, and chimera was eliminated via UCHIME software. Each sequence was annotated via RDP classifier (http://rdp.cme.msu.edu/) and compared to the Silva database (silva128/16 s_bacteria). The threshold of alignment was set to 70%. Nonmetric multidimensional scaling (NMDS) analysis was performed with an OTU table using the vegan package of R.
For pH measurement of the soil, the rhizosphere soil samples were extracted via CaCl2 solution, and 5 g of the rhizosphere soil was added to 25 mL 0.01 mol L−1 CaCl2 solution. The pH was measured via microcomputer acidometer after oscillation. The analytical method of soil available Cd used 5.0 g rhizosphere soil samples that were accurately weighted and placed in a 50 mL triangular flask. 10.0 mL 0.005 mol L−1 DTPA extract was added. Extraction was done for 1 h from the oscillating machine at 25 °C followed by filtration. The Cd content in the filtrate was determined via AAS [22]. 2.6. Quantitative analysis of the sulfur oxidation gene in rhizospheric soil Rhizospheric soil samples were collected at the 60 d. The MoBio PowerSoilTM DNA (MO BIO laboratories, CA, USA) kit was used to extract DNA from rhizospheric soil. The extraction methods were conducted in accordance with the operating guidelines of the kit. FastPrep was used to break the cells, the fragmentation velocity was 5.0, the time was 45 s. The final DNA concentration and purification were determined via NanoDrop 2000 UV–vis spectrophotometer (Thermo Scientific, Wilmington, USA), and DNA quality was checked by 1% agarose gel electrophoresis. The cells were stored at −20 °C following DNA extraction. The quantitative PCR of dsrA, soxB, and sqr gene was conducted via ABI7500 fluorescence quantitative PCR (Applied Biosystems, USA). The PCR reaction system consisted of 16.5 μL 2 × ChamQ SYBR Color qPCR Master Mix (TaKaRa, Japan), 5 μmol L−1 forward and reverse primers, 0.8 μL each, and DNA template 2 μL, the rest was supplemented with ddH2O to 25 μL. sqr-473 F/982R, soxB-704 F/1199R, and dsrA-625 F/ 877R (Table 2) were used as amplification primers for quantitative PCR. The cycling protocol was as follows: initial denaturation for 30 s at 95 °C, followed by 40 cycles of denaturation for 5 s at 95 °C, annealing for 30 s at 50 °C for sqr, 55 °C for soxB, 60 °C for dsrA, and elongation for 40 s at 72 °C. The correlation coefficients ( r2) of the standard curves were > 0.999. The amplification efficiencies (E) of sqr, soxB, and dsrA were 75.5, 79.9, and 97.4%, respectively.
2.8. Statistical analysis A one-way ANOVA with Duncan's post hoc tests were performed to evaluate the differences within datasets, with significance defined as a value of 0.05 (SPSS 13.0 package, SPSS, Chicago, IL, USA).
3. Results and discussion 3.1. Effects of different sulfur concentrations on tobacco growth The addition of a chelating agent is an important strategy to improve the effects of phytoextraction. Traditional chelating agents, such as EDTA, EDDS, and NTA, have been applied for the phytoextraction by tobacco. However, these compounds are not ideal activators because they can inhibit the growth of tobacco, or the enhancement of Cd uptake by tobacco is limited [12,13]. To evaluate the effects of sulfur application on the growth of tobacco, the biomass of roots, stems, and leaves, as well as the number of leaves were analyzed. The results showed that neither high-sulfur nor low-sulfur treatments had a significant effect on the growth of tobacco (Fig. 1), suggesting that the application of sulfur as activator was safe and would not affect tobacco growth.
2.7. 16S rDNA sequencing Regarding 338 F/806R (Table 2) as primer tagged with barcode, the variable V3-V4 region was amplified via PCR. The amplification program was as follows: pre-denaturation at 95 °C for 3 min, 27 cycles (denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 45 s), and final 72 °C extension 10 min (PCR instrument: ABI GeneAmp®9700). The amplification system was 20 μL, including 4 μL 5×FastPfu buffer solution, 2 μL 2.5 mM dNTPs, 0.8 μL positive and negative primer (5 μM), 0.4 μL FastPfu polymerase, 0.2 μL BSA and 10 ng DNA template, proper level of ddH2O. PCR products were recovered by 2% agarose gel and purified by AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA, USA). Tris−HCl elution was detected via 2% agarose gel electrophoresis. Quantitative analysis was performed via QuantiFluor™-ST (Promega, USA). The purified amplification fragment was used to Table 2 Amplification primer sequence used in the experiment. Gene name
Primer name
primer sequence (5’-3’)
sqr
473F 982R 704F 1199R 625F 877R 338 F 806R
CATCCTGCTTCGGCCCNGCNTAYGART CCATGGATTCGATRTANCCNGTYT ATCGGYCAGGCYTTYCCSTA MAVGTGCCGTTGAARTTGC TTCAAGTTCTCCGGCTGCSCNAAYGACTG CGTTSANRCAGTGCATGCAGCG ACTCCTACGGGAGGCAGCAG GGACTACHVGGGTWTCTAAT
soxB dsrA 16S
Fig. 1. Effects of sulfur application for tobacco growth (A: Leaf; B: Stem; C: Root; D: Number of leaves). S0, S1, and S2 represent no-sulfur treatment, lowsulfur treatment and high sulfur-treatment, respectively. Values with the same letter indicate that there are no differences (P > 0.05). 310
Journal of Hazardous Materials 368 (2019) 308–315
X. Li et al.
Fig. 2. Effects of different sulfur levels on both accumulation and transport of Cd in tobacco (A: Cd content; B: translocation factor). S0, S1, and S2 represent no-sulfur treatment, low-sulfur treatment and high sulfur-treatment, respectively. Values with the same color and letter indicate that there are no differences (P > 0.05).
part is easier to harvest than the underground part, which is beneficial for the Cd removal from soil. Further analysis showed that although the distribution of Cd in tobacco was not changed in response to sulfur application, high-sulfur treatment increased the root-to-shoot translocation factor (Fig. 2B), indicating that the high sulfur content in tobacco was beneficial for the translocation from the root to the aboveground parts. Liu et al. considered that the transport of Cd from the soil to tobacco roots was a form of active transport, while the transport from the root system to aboveground part followed a passive process [7]. It has also been suggested that the efficiency of passive transport correlates positively with the number of carriers, which indicates that sulfur application may increase the number of carriers of Cd to some extent.
3.2. Effects of different sulfur concentrations on Cd accumulation in Tobacco Analyzing the distribution of Cd in tobacco leaves, stems, and roots showed that the Cd contents in tobacco without sulfur application were 35.4, 23.6, and 26.3 mg kg−1, respectively, which was higher than the background value of Cd in soil (9.4 mg kg−1) (Table 1 and Fig. 2A). However, our determination of tobacco enrichment was lower than reported previously. For example, in the study of Liu et al. (2016), Cd in soil was 9.21 mg kg−1 (comparable to the level in this study) while the Cd content in tobacco leaves reached 92.0 mg kg−1 [7], which was much higher than the results obtained in this study. On the one hand, this difference is likely related to the varieties [8]. The variety “K326” in the study of Liu et al. (2016) may have a higher Cd bioaccumulation capability than “Changbohuang” in the current work. On the other hand, chemical forms and partitioning of Cd in the soil also affect its phytoavailability [23]. In the soil solution, Cd is mainly present as Cd2+, which is the main form for plant uptake. In the solid phase, Cd may be reversibly bound to soil particulates, which can be readily released into the soil solution. The chemical forms and partitioning of Cd in soil are strongly affected by various conditions, such as redox potential, cation exchange capacity, soil pH, microbial communities, competing cations, and temperature [23]. This suggests that the choice of high accumulation variety of tobacco and appropriate improvement of soil physicochemical properties were important to enhance the phytoavailability in the phytoextraction practice. Furthermore, different amounts of sulfur application had different effects on Cd accumulation in tobacco. Low-sulfur treatment did not significantly affect the Cd contents in tobacco; however, the high-sulfur treatment significantly increased the Cd content, and the measured Cd contents in leaves, stems, and roots were 66.4, 46.1, and 42.6 mg kg−1, respectively. These values were 1.88, 1.95, and 1.62 times higher than the corresponding values under non-sulfur treatment (Fig. 2A), indicating that appropriate sulfur application can promote the uptake and accumulation of Cd in tobacco. In addition, according to the observations of previous studies [24,25], sulfur not only promoted Cd absorption, but also increased the uptake of several heavy metals (copper, zinc, nickel, and chromium) by other plants, such as Zea mays L., Brassica juncea, Brassica oleraceae, and Cercis canadensis. Therefore, it is of universal significance to promote the absorption and accumulation of heavy metals via sulfur application, which is a measure worth to further develop to enhance the phytoextraction efficiency. It has been suggested that hyperaccumulator plants have a strong capacity to transport heavy metals upward, and Cd content in the aboveground part is typically higher than that in the underground part [25], while Cd content in non-hyper accumulator plants follows the opposite trend [25,26]. Tobacco also has this characteristic, i.e., the accumulation of Cd in leaves happens prior to other parts (Fig. 2A). This is more advantageous for phytoextraction, because the aboveground
3.3. Effects of different sulfur concentrations on the total sulfur and nonprotein thiol compounds in Tobacco Sulfur is an essential element for tobacco and a raw material for the synthesis of NPTs. NPTs, including PCs, GSH, and cysteine, can be induced and synthesized by Cd and other heavy metals [27]. A large number of studies have shown that the chelation of NPTs with Cd may not only achieve detoxification, but also participate in the long-distance transport of Cd [28,29]. Another study suggested that NPTs may play an important role in the Cd uptake by plants, as the uptake rate of Cd by Suaeda salsa was significantly reduced in response to N-ethylmaleimide (a thiol blocker) pretreatment [17]. Analyzing the content of sulfur related compounds in different organs of tobacco showed that sulfur application increased the total sulfur content in the roots, stems, and leaves of tobacco (Fig. 3A). However, the content of NPTs was not significantly affected, except the value of stems in high-sulfur application (Fig. 3B), which indicated that sulfur application could promote the absorption of sulfur in tobacco but failed to biosynthesize NPTs. 3.4. Effects of different sulfur concentrations on pH value and available Cd content in soil To further elucidate the mechanism of sulfur application promoting Cd accumulation in tobacco, both the soil pH and available Cd content were analyzed. The results showed that the background value of the soil pH was 8.1, and at the end of the experiment, the soil pH of control and no-sulfur treatment changed little, with values of 8.0 and 7.9, respectively. The pH value of soil decreased by sulfur application treatment. In particular, the pH value of high-sulfur and low-sulfur treatment decreased to 7.1 and 7.5, respectively (Fig. 4A). At the end of the experiment, the available Cd content changed slightly under the control, no-sulfur treatment, and low-sulfur treatment, reaching 1.2, 1.3, and 1.4 mg kg−1 from 1.1 mg kg-1 (background value), respectively. However, the content of available Cd under the high-sulfur treatment increased to the highest level (3.3 mg kg−1) (Fig. 4B), indicating that sulfur can decrease the pH value of soil and increase the bioavailability 311
Journal of Hazardous Materials 368 (2019) 308–315
X. Li et al.
Fig. 3. Effects of different sulfur level on total sulfur and NPTs in tobacco (A: total sulfur content: B: NPTs). S0, S1, and S2 represent no-sulfur treatment, low-sulfur treatment and high sulfur-treatment, respectively. Values with the same color and letter indicate that there are no differences (P > 0.05).
of Cd. This phenomenon has also been described in other studies [15,16]. Hoefer et al. (2015) suggested that sulfur is oxidized by sulfur oxidizing bacteria in the soil, accompanied by producing sulfate radicals and releasing protons, thus improving the bioavailability and phytoextraction of Cd. This effect is related to the amount of sulfur application, i.e., the greater the sulfur application, the higher the Cd bioavailability will be [15]. In this study, although the pH value of lowsulfur treatment decreased, it did not effectively improve the Cd availability, compared to the control. This is likely due to the strong buffering capacity and cation exchange capacity of the soil; therefore, it failed to significantly increase the Cd bioaccumulation in tobacco.
3.5. Microbial transformation of sulfur in the rhizosphere In this study, the sulfate content of soil was analyzed. The results showed that the sulfate content of the no-sulfur treatment was 44.6 mg kg−1 at the end of the experiment, while that of the high-sulfur treatment and the low-sulfur treatment increased to 788.1 and 349.5 mg kg-1, respectively (Fig. 5). This may account for the increased total sulfur concentration in tobacco under both treatments (Fig. 3A). Meanwhile, the results also confirmed the previous supposition that exogenous sulfur was transformed into sulfate radicals by sulfur oxidizing bacteria in soil. Sulfur-oxidization by prokaryotes is widespread in the soil and mechanism for the oxidation of reduced sulfur are diverse. In the periplasm of prokaryotes, sulfur oxidation occurred via the Sox pathway, in which the thiosulfate-oxidizing Sox enzyme complex convert thiosulfate to sulfate. The Sox enzyme complex was encoded by soxB gene, which was widespread among the various phylogenetic groups of sulfur-oxidizing bacteria [30]. In the cytoplasm, the Dsr pathway can be utilized, in which the accumulation of zero-valent sulfur can be oxidized to thiosulfate or polysulfides via the reverse dissimilatory sulfite reductase system, encoded by the
Fig. 5. Effects of different sulfur concentrations on sulfate content in soil. Control represents without tobacco planting and S addition. S0, S1, and S2 represent no-sulfur treatment, low-sulfur treatment and high sulfur-treatment, respectively. Values with the same letter indicate that there are no differences (P > 0.05).
dsrABEFHCMKLJOPNRS gene cluster [31]. In addition, Sulfide:quinone oxidoreductase, encoded by sqr, catalyzes sulfide oxidation during sulfide-dependent chemo- and phototrophic growth in bacteria [32]. Many studies used one or more of these functional sulfur oxidation genes, such as dsrA, soxB, and sqr, as molecular biomarkers to examine communities of sulfur-oxidizing bacteria and their roles in various environments [30,33]. In this work, to further understand the microbial transformation process of sulfur in the rhizosphere of soil, the copy number of sulfur oxidation-related genes was investigated via quantitative PCR. The results showed that both high-sulfur and low-sulfur treatments increased their copy numbers for dsrA and soxB. With regard to sqr, the copy numbers of high-sulfur and low-sulfur treatments were
Fig. 4. Effects of different sulfur levels on soil pH and available Cd concentration (A: pH value; B: available Cd concentration). Control represents without tobacco planting and S addition. S0, S1, and S2 represent no-sulfur treatment, low-sulfur treatment and high sulfur-treatment, respectively. 312
Journal of Hazardous Materials 368 (2019) 308–315
X. Li et al.
Fig. 6. Effects of different sulfur concentrations on the copy numbers of dsrA, soxB, and sqr genes in soil (A: dsrA; B: soxB; and C: sqr). Control represents without tobacco planting and S addition. S0, S1, and S2 represent no-sulfur treatment, low-sulfur treatment and high sulfur-treatment, respectively. Values with the same letter indicate that there are no differences (P > 0.05).
Fig. 7. Abundance of two OTUs responsible for sulfur oxidation (A) and their dendrogram (B). Control represents without tobacco planting and S addition. S0, S1, and S2 represent no-sulfur treatment, low-sulfur treatment and high sulfur-treatment, respectively. Values with the same color and letter indicate that there are no differences (P > 0.05). Neighbor-joining tree based on 16S rRNA gene sequences showing the phylogenetic position of the bacteria corresponding OTU 1718, OTU 1216 and their representatives of other related taxa. Bootstrap values (expressed as percentages of 1000 replications) > 50% are shown at the branch points. Bar 0.005 substitutions per nucleotide position.
significantly lower than those of no-sulfur treatments (Fig. 6). This suggests that both soxB and dsrA may play key roles in the sulfur oxidation; however, the copy number of sqr is low probably due to the lack of sulfide oxidation in soil. High-throughput sequencing analysis of the 16 s rDNA gene of soil bacteria showed that the abundance of OTU1718 and OTU1216 in nosulfur treatment was only 0.01% at the end of the experiment. With increasing sulfur application level, the abundance of both OTUs gradually increased. In the high-sulfur treatment, they became the two most abundant OTUs, with abundances reaching 6.28% and 5.26%, respectively (Fig. 7A). The construction of a dendrogram showed that both OTU1718 and OTU1216 belong to Thiobacillus sp. They were closely related to Thiobacillus thioparus and uncultured Thiobacillus sp. clone X-41, respectively (Fig. 7B). Thiobacillus thioparus is a type of autotrophic bacterium that can oxidize sulfur to sulfuric acid [34], which might be responsible for the increase of sulfate content in soil (Fig. 5). It can furthermore obtain energy during this oxidation process by using CO2 as carbon source to promote growth [35]. Unlike many types of sulfur oxidizing bacteria (Acidithiobacillus thiooxidans and Acidithiobacillus ferrooxidans) which prefer to grow in an acidic environment, the optimum pH for the growth of Thiobacillus thioparus is 7.5, which is close to the pH value of soil with high-sulfur treatment; therefore, this might be the main reason why T. thioparus can become a dominant bacterium in the soil in response to sulfur treatment [36]. It has also been reported that the soxB and dsrA gene are present in the Thiobacillus sp. strains [30,33], suggesting that the increased copy number of the soxB and dsrA genes after sulfur application may be a result of the proliferation of Thiobacillus sp. strains. The combined results also indicated that Thiobacillus sp. plays an important role in the sulfur oxidation, soil acidification and enhancement of Cd phytoavailability in this work.
Table 3 Effects of sulfur application on the diversity of soil bacteria. Control represents without tobacco planting and S addition. S0, S1, and S2 represent no-sulfur treatment, low-sulfur treatment and high sulfur-treatment, respectively. The same column with the same letter indicates no significant difference (P > 0.05). Treatments
Shannon index
Coverage
Control S0 S1 S2
6.57a 6.45 a 6.20 a 5.99 a
0.99 0.99 0.99 0.99
Fig. 8. NMDS analysis of soil bacterial community. Control represents without tobacco planting and S addition. S0, S1, and S2 represent no-sulfur treatment, low-sulfur treatment and high sulfur-treatment, respectively.
313
Journal of Hazardous Materials 368 (2019) 308–315
X. Li et al.
Fig. 9. Effect of sulfur application on soil bacterial community structure (A: portal level; B: generic level). Control represents without tobacco planting and S addition. S0, S1, and S2 represent no-sulfur treatment, low-sulfur treatment and high sulfur-treatment, respectively.
large biomass, thus offers the potential for the remediation of Cd contaminated soil. In this study, the effect of sulfur application on the uptake of Cd, as well as its possible mechanisms of rhizospheric microorganisms were investigated. The results showed that tobacco has a good ability to accumulate and transport of Cd, and the leaves had the strongest enrichment ability for Cd accumulation, followed by the roots and stems. Sulfur supplication can affect the uptake and accumulation of Cd in tobacco; however, it is related to the amount of sulfur application. Only a high amount of sulfur application can effectively promote the bioaccumulation of Cd in leaves, stems, and roots of tobacco. The mechanism may be mediated by the enhancement of Cd bioavailability in soil, caused by the acidification of soil through a sulfur oxidation reaction. Both dsrA and soxB genes may play important roles in sulfur oxidation to release proton and sulfate radical, and Thiobacillus was the dominant bacterial genus for sulfur oxidation. Sulfur application had little effect on the growth of tobacco or the diversity of rhizosphere bacteria, implying its safety in practical utility. The combined results highlighted the importance of the sulfur application in phytoextraction. In future studies, sulfur oxidizing bacteria, such as Thiobacillus sp., should be isolated and applied in elemental sulfur-aided phytoextraction of Cd to improve the remediation efficiency by tobacco.
3.6. Effects of sulfur application on the diversity and structure of rhizosphere bacteria The results of high throughput sequencing showed that the sequence coverage rate was 99%, which indicates that the depth of sequence is reasonable and can basically represent the true sample situation (Table 3). A comparison of the diversity indices showed that there was no significant difference in the Shannon index among different treatments (Table 3); therefore, it can be concluded that the effect of sulfur application on the diversity of soil microbial community is small. NMDS analysis showed that the difference of no-sulfur, low-sulfur, and high-sulfur treatments was smaller than the comparison to control (Fig. 8). Tobacco tends to secrete large amounts of compounds during its growth stages, such as organic acids and sugars, which can be used as nutrients for rhizospheric microorganisms and affect their community structure [37]. This might be the main reason why tobacco plants had a greater effect on microbial community than sulfur application. These results also suggest that sulfur application had less effect on the microbial community structure. At the phylum level, a total of 27 bacteria were detected in each treatment, nine of which were dominant (abundance > 1%). The four more abundant bacteria were Proteobacteria (26.78%), Actinobacteria (25.12%), Chloroflexi (17.57%), and Acidobacteria (11.29%) in the control. After tobacco cultivation, Actinobacteria abundance increased to 31.62%, becoming the most abundant phylum, while the abundance of other phyla decreased. Compared to no sulfur treatment, the abundance of most phyla decreased, while the abundance of Proteobacteria increased after sulfur application. Proteobacteria abundances in lowsulfur and high-sulfur treatment reached 26.05% and 33.92%, respectively (Fig. 9A). At the genus level, the top abundant genera in the control and no-sulfur treatment were norank_f__Anaerolineaceae (3.4%) and norank_f__Gemmatimonadaceae (2.5%), respectively. However, Thiobacillus, which are typical sulfur oxidizing bacteria, became the most abundant genus in both the low-sulfur and high-sulfur treatments, and its abundance reached 6.3% and 11.54%, respectively (Fig. 9B), indicating that sulfur oxidation was the most important biochemical process in soil. However, the top 20 bacteria with the highest abundance were basically identical among all treatments, implying that the effect of sulfur application on the rhizosphere microbial structure was limited, unlike the effect of EDTA or EDDS addition, which had strong effects on soil bacterial diversity and community structure [38,39]. The combined results suggest that sulfur application is safe and effective for the phytoextraction of Cd by tobacco.
Acknowledgments The study was financially supported by the National Key Research and Development Program of China (2018YFD0800304), the Key Project Science and Technology Education Department of Henan (17A610001), and the National Natural Science Foundation of China (41401350). References [1] F.J. Zhao, Y.B. Ma, Y.G. Zhu, Z. Tang, S.P. Mcgrath, Soil contamination in China: current status and mitigation strategies, Environ. Sci. Technol. 49 (2015) 750–759. [2] A. Wiszniewska, E. Hanus-Fajerska, E. Muszynska, K. Ciarkowska, Natural organic amendments for improved phytoremediation of polluted soils: a review of recent progress, Pedosphere 26 (2016) 1–12. [3] S.Y. He, X.E. Yang, Z. He, V.C. Baligar, Morphological and physiological responses of plants to cadmium toxicity: a review, Pedosphere 27 (2017) 421–438. [4] N. Verbruggen, C. Hermans, H. Schat, Molecular mechanisms of metal hyperaccumulation in plants, New Phytol. 181 (2009) 759–776. [5] D.D. Hou, K. Wang, T. Liu, H.X. Wang, Z. Lin, J. Qian, L.L. Lu, S.K. Tian, Unique rhizosphere micro-characteristics facilitate phytoextraction of multiple metals in soil by the hyperaccumulating plant Sedum alfredii, Environ. Sci. Technol. 51 (2017) 5675–5684. [6] L. Deng, Z. Li, J. Wang, H.Y. Liu, N. Li, L.H. Wu, P.J. Hu, Y.M. Luo, P. Christie, Longterm field phytoextraction of zinc/cadmium contaminated soil by Sedum plumbizincicola under different agronomic strategies, Int. J. Phytorem. 18 (2016) 134–140. [7] H.W. Liu, H.Y. Wang, Y.B. Ma, H.H. Wang, Y. Shi, Role of transpiration and metabolism in translocation and accumulation of cadmium in tobacco plants, Chemosphere 144 (2015) 1960–1965. [8] T. Doroszewska, A. Berbec, Variation for cadmium uptake among Nicotiana species,
4. Conclusions Tobacco is a plant with high Cd bioaccumulation capability and 314
Journal of Hazardous Materials 368 (2019) 308–315
X. Li et al.
soil heavy metals and their uptake by maize, Environ. Int. 30 (2004) 323–328. [25] G. Dede, S. Ozdemir, Effects of elemental sulphur on heavy metal uptake by plants growing on municipal sewage sludge, J. Environ. Manage. 166 (2016) 103–108. [26] J.L. Fan, Z.Y. Hu, N. Ziadi, X. Xia, C.Y.H. Wu, Excessive sulfur supply reduces cadmium accumulation in brown rice (Oryza sativa L.), Environ. Pollut. 158 (2010) 409–415. [27] F.F. Nocito, C. Lancilli, B. Dendena, G. Lucchini, G.A. Sacchi, Cd retention in rice roots is influenced by Cd availability, chelation and translocation, Plant Cell. Environ. 34 (2011) 994–1008. [28] H. Bashir, M.M. Ibrahim, R. Bagheri, J. Ahmad, I.A. Arif, M.A. Baig, M.I. Qureshi, Influence of sulfur and cadmium on antioxidants, phytochelatins and growth in Indian mustard, AoB Plants 7 (2015) 1–9. [29] J.W. Wu, A. Sagervanshi, K.H. Muehling, Sulfate facilitates cadmium accumulation in leaves of Vicia faba L. at flowering stage, Ecotoxicol. Environ. Saf. 156 (2018) 375–382. [30] B. Meyer, J.F. Imhoff, J. Kuever, Molecular analysis of the distribution and phylogeny of the soxB gene among sulfur-oxidizing bacteria-evolution of the Sox sulfur oxidation enzyme system, Environ. Microbiol. 9 (2007) 2957–2977. [31] C. Dahl, S. Engels, A.S. Pott-Sperling, A. Schulte, J. Sander, Y. Lubbe, O. Deuster, D.C. Brune, Novel genes of the dsr gene cluster and evidence for close interaction of Dsr proteins during sulfur oxidation in the phototrophic sulfur bacterium Allochromatium vinosum, J. Bacteriol. 187 (2005) 1392–1404. [32] L.K. Chan, R.M. Morgan-Kiss, T.E. Hanson, Functional analysis of three sulfide: Quinone oxidoreductase homologs in Chlorobaculum tepidum, J. Bacteriol. 191 (2009) 1026–1034. [33] J.F. Luo, X. Tan, K.X. Liu, W.T. Lin, Survey of sulfur‑oxidizing bacterial community in the Pearl River water using soxB, sqr, and dsrA as molecular biomarkers, 3 Biotech 8 (2018) 73–82. [34] W.J. Gu, W. Sun, Y.S. Lu, X. Li, P.Z. Xu, K.Z. Xie, L.L. Sun, H.T. Wu, Effect of Thiobacillus thioparus 1904 and sulphur addition on odour emission during aerobic composting, Bioresour. Technol. 249 (2018) 254–260. [35] E.J. Johnson, J.H.D. Peck, Coupling of phosphorylation and carbon dioxide fixation in extracts of Thiobacillus thioparus, J. Bacteriol. 89 (1965) 1041–1050. [36] S.Y. Chen, J.G. Lin, Enhancement of metal bioleaching from contaminated sediment using silver ion, J. Hazard. Mater. 161 (2009) 893–899. [37] P.N. Chiang, M.K. Wang, C.Y. Chiu, S.Y. Chou, Effects of Cd amendments on lowmolecular-weight organic acid exudates in rhizosphere soils of tobacco and sunflower, Environ. Toxicol. 21 (2006) 479–488. [38] L. Yang, G.P. Wang, Z.N. Cheng, Y. Liu, Z.G. Shen, C.L. Luo, Influence of the application of chelant EDDS on soil enzymatic activity and microbial community structure, J. Hazard. Mater. 262 (2013) 561–570. [39] G. Vigliotta, S. Matrella, A. Cicatelli, F. Guarino, S. Castiglione, Effects of heavy metals and chelants on phytoremediation capacity and on rhizobacterial communities of maize, J. Environ. Manage. 179 (2016) 93–102.
Genet. Resour. Crop. EV. 51 (2004) 323–333. [9] R. Vögeli-Lange, G.J. Wagner, Relationship between cadmium, glutathione and cadmium-binding peptides (phytochelatins) in leaves of intact tobacco seedlings, Plant Sci. 114 (1996) 11–18. [10] K. Rosén, J. Eriksson, M. Vinichuk, Uptake and translocation of 109Cd and stable Cd within tobacco plants (Nicotiana sylvestris), J. Environ. Radioact. 113 (2012) 16–20. [11] H. Khoudi, Y. Maatar, S. Gouiaa, K. Masmoudi, Transgenic tobacco plants expressing ectopically wheat H+-pyrophosphatase (H+-PPase) gene TaVP1 show enhanced accumulation and tolerance to cadmium, J. Plant Physiol. 169 (2012) 98–103. [12] A. Kayser, K. Wenger, A. Keller, W. Attinger, H.R. Felix, S.K. Gupta, R. Schulin, Enhancement of phytoextraction of Zn, Cd, and Cu from calcareous soil: The use of NTA and sulfur amendments, Environ. Sci. Technol. 34 (2000) 1778–1788. [13] M.W.H. Evangelou, U. Bauer, M. Ebel, A. Schaeffer, The influence of EDDS and EDTA on the uptake of heavy metals of Cd and Cu from soil with tobacco Nicotiana tabacum, Chemosphere 68 (2007) 345–353. [14] F.R. Capaldi, P.L. Gratao, A.R. Reis, L.W. Lima, R.A. Azevedo, Sulfur metabolism and stress defense responses in plants, Trop. Plant Biol. 8 (2015) 60–73. [15] C. Hoefer, J. Santner, M. Puschenreiter, W.W. Wenzel, Localized metal solubilization in the rhizosphere of salix smithiana upon sulfur application, Environ. Sci. Technol. 49 (2015) 4522–4529. [16] Y.P. Wang, Q.B. Li, W. Hui, J.Y. Shi, Q. Lin, X.C. Chen, Y.X. Chen, Effect of sulphur on soil Cu/Zn availability and microbial community composition, J. Hazard. Mater. 159 (2018) 385–389. [17] L.Z. Li, X.L. Liu, W.J.G.M. Peijnenburg, J.M. Zhao, X.B. Chen, J.B. Yu, H.F. Wu, Pathways of cadmium fluxes in the root of the halophyte Suaeda salsa, Ecotoxicol. Environ. Saf. 75 (2012) 1–7. [18] S. Clemens, Toxic metal accumulation, responses to exposure and mechanisms of tolerance in plants, Biochimie 88 (2006) 1707–1719. [19] X.Z. Li, Y.J. Wang, Y.S. Pan, H. Yu, X.L. Zhang, Y.P. Shen, S. Jiao, K. Wu, G.X. La, Y. Yuan, S.M. Zhang, Mechanisms of Cd and Cr removal and tolerance by macrofungus Pleurotus ostreatus HAU-2, J. Hazard. Mater. 330 (2017) 1–8. [20] M.F. Lopez-Climent, V. Arbona, R.M. Perez-Clemente, S.I. Zandalinas, A. GomezCadenas, Effect of cadmium and calcium treatments on phytochelatin and glutathione levels in citrus plants, Plant Biol. 16 (2012) 79–87. [21] P. Věra, Š. Karel, Capillary electrophoresis of inorganic anions and its comparison with ion chromatography, J. Chromatogr. A 789 (1997) 169–180. [22] R. Gruter, B. Costerousse, A. Bertoni, J. Mayer, C. Thonar, E. Frossard, R. Schulin, S. Tandy, Green manure and long-term fertilization effects on soil zinc and cadmium availability and uptake by wheat (Triticum aestivum L.) at different growth stages, Sci. Total Environ. 599 (2017) 1330–1343. [23] M. Shahid, S. Shamshad, M. Rafiq, S. Khalid, I. Bibi, N.K. Niazi, C. Dumat, M.I. Rashid, Cadmium bioavailability, uptake, toxicity and detoxification in soilplant system, Chemosphere 178 (2017) 513–533. [24] Y.S. Cui, Y.T. Dong, H.F. Li, Q.R. Wang, Effect of elemental sulphur on solubility of
315