- Email: [email protected]
Effects of tacrolimus and dexamethasone on tubulointerstitial fibrosis in mercuric chloride treated Brown Norway rats
Exp Toxic Pathol 2003; 55: 197–207 URBAN & FISCHER http://www.urbanfischer.de/journals/exptoxpath 1
Department of Veterinary Pathology, Graduate School of Agricultural and Life Sciences, The University of Tokyo, Tokyo, Japan 2 Biopathology Institute Co., Ltd., Ohita, Japan
Effects of tacrolimus and dexamethasone on tubulointerstitial fibrosis in mercuric chloride treated Brown Norway rats KAZUHIKO SUZUKI1, TOMOMICHI KANABAYASHI2, HIROYUKI NAKAYAMA1, and KUNIO DOI1 With 8 figures and 1 table Received: November 26, 2002; Received: May 19, 2003; Accepted: June 11, 2003 Address for correspondence: KUNIO DOI, Department of Veterinary Pathology, Graduate School of Agricultural and Life Sciences, The University of Tokyo, Yayoi 1-1-1, Bunkyo-ku, Tokyo 113-8657, Japan; Tel.: ++81-3-5841-5401, Fax: ++81-3-5841-8185, e-mail: [email protected] Key words: Brown Norway rat; tubulointerstitial fibrosis; tacrolimus; dexamethasone; macrophage; mercuric chloride.
Summary We investigated the effects of daily injection of tacrolimus (FK), an immunosuppressor, or dexamethasone (Dx), an antiinflammatory agent, on renal tubulointerstitial fibrosis in mercuric chloride-treated Brown Norway rats. The tubular lesions observed after one time injection of mercuric chloride were reduced in FK-treatment group, but not in Dx-treatment group. Moreover, FK reduced infiltration of mononuclear cells, especially macrophages, and proliferation of myofibroblasts in renal intestitium and also inhibited renal interstitial fibrosis through the reduction of the expressions of fibrosis-related factors, i.e. plasminogen activator inhibitor-1 and transforming growth factor-β1. On the other hand, Dx reduced lymphocyte infiltraton, but did not inhibit macrophage infiltration. In addition, Dx did not suppress myofibroblast profiferation, upregulation of fibrosis-related factors, and interstitial fibrosis. From these findings, it is suggested that FK may inhibit renal interstitial fibrosis through inhibition of macrophage infiltration, and that macrophages and myofibroblasts are very important fibrogenic factors in the development of mercuric chloride-induced renal tubulointerstitial fibrosis in BN rats.
Introduction Renal tubulointerstitial lesions, especially fibrosis, have been attracting great attention, since it was recognized that renal tubulointerstitial lesions following renal tubular and glomerular injury are closely related with
renal dysfunction (RISDON et al. 1968; BOHLE et al. 1977a; BOHLE et al. 1977b; FISCHBACH et al. 1977; WEHMANN et al. 1989; D’AMICO 1992). Recently, it has been speculated that macrophages and α-smooth muscle actin (SMA)-positive myofibroblasts might play an important role in renal interstitial fibrosis (YAMATE et al. 1996), but the relationship between these cells and renal fibrosis has not fully been clarified. Moreover, there are only a few reports on the role of lymphocytes in the development of renal fibrosis, although lymphocytes are also involved in renal tubulointerstitial lesions. In our previous studies on mercuric chloride-treated Brown Norway (BN) rats, we reported that macrophages, myofibroblasts and TGF-β1 originated from tubular epithelial cells and some populations of macrophages might be closely related with the development of renal interstitial fibrosis (SUZUKI et al. 1998; SUZUKI et al. 1999). It is well known that a genetically restricted autoimmune syndrome can be induced in BN rats by repeated injection of low doses of mercuric chloride that involves polyclonal B lymphocyte activation (SAPIN et al. 1977) and synthesis of anti-nuclear and anti-glomerular basement membrane antibodies (HIRSCH et al. 1982). So, it seems reasonable to consider that immunological mechanisms also take part in the pathogenesis of renal tubulointerstitial fibrosis. In this study, we investigated whether immunological mechanisms participate in the pathogenesis of mercuric chloride-induced tubulointerstitial fibrosis in BN rats using immunosuppressive 0940-2993/03/55/02-03-197 $ 15.00/0
197
agent, tacrolimus, or anti-inflammatory agent, dexamethasone. The protocol of this study was approved by the Animal Care and Use Committe of Graduate School of Agricultural and Life Sciences, the University of Tokyo.
Material and methods Animals: One hundred and twenty-six 9-week-old male Brown Norway (BN) rats (220 ± 20 g) (Charles River Japan Co., Kanagawa, Japan) were used. The animals were housed 2–3 per cage using an isolator caging system (Niki Shoji Co., Tokyo, Japan) in an animal room controled at 23 ± 20 °C and 55 ± 5% r.h. with 14 hs-light and 10 hs-dark cycle. They were fed commercial pellets (MF, Oriental Yeast Co. Ltd. Tokyo, Japan) and water ad libitum. Treatments: Mercuric chloride (HgCl2, WAKO Pure Chemicals Co., Ltd., Tokyo) was dissolved in distilled water and the concentration was adjusted to 1 mg/ml. Ninety rats were injected 1 ml/kg b.w. of the above-mentioned HgCl2 solution injected subcutaneously one time (T1-group) or three times every other day (T2-group). Tacrolimus (FK, Fijisawa Pharmaceutical Co., Ltd., Osaka, Japan) and dexamethasone (Dx, Nacalai Tesque, Inc., Kyoto, Japan) were dissolved in physiological saline to get the final concentration of 1 mg/ml, respectively, and 1 ml/kg b.w. of each solution was daily injected subcutaneously from one day before day 0 to the day of necropsy, respectively. Depending on the treatment, rats were divided into three subgroups, HgCl2 only-group, HgCl2+FK-group, and HgCl2+Dx-group. Five rats in each group were sacrificed under ether anesthesia at 4, 8 and 16 days after final HgCl2 injection in T1- and T2-groups, respectively. Moreover, the remaining 18 rats, which were injected with 1 ml/kg b.w. of distilled water one or three times as T1- or T2-group, were sacrificed at 4, 8 and 16 days after final injection and served as Control-group. Histopathology: The left kidney of each animal was fixed by PLP(periodate-lysine-paraformaldehyde)-AMeX (acetone, methyl benzoate, and xylene) method. Two-µm paraffin sections were stained with hematoxylin and eosin (HE) or Masson’s trichrome (MT) stain for histopathological examination. Immunohistochemistry: Two-µm PLP-AMeX fixed paraffin sections were stained by labelled streptavidin bi-
otin (LSAB) method using LSAB 2 kit (DAKO Japan, Kyoto, Japan). The primary antibodies used were anti-rat ED1 (BMA Biochemical Ltd., Switzerland), anti-rat W3/25 (CD4 equivalent) (Harlan Sera-Lab. Ltd., Sussex, England), OX-8 (CD8 equivalent) (Pharmigen, San Diego, U.S.A.) and anti-human α-smooth muscle actin (α-SMA) (DAKO Japan, Kyoto) mouse monoclonal antibodies. The number of positive cells for each antibody was counted in randomly selected 50 fields (0.5 mm2 each) in the corticomedullary junction per section per rat under light microscopy with ×400 magnification, and an average number per field was calculated for each rat. Reverse transcription-polymerase chain reaction (RT-PCR): The expressions of mRNA of tissue inhibitors of metalloproteinases (TIMP)-1, TIMP-2, TIMP-3, urokinase-type plasminogen activator (uPA), plasminogen activator inhibitor-1 (PAI-1) and transforming growth factorβ1 (TGF-β1) (table1) were examined. The total RNA was extracted from the renal cortical tissue of the right kidney of each rat killed as scheduled using ISOGEN (Nippon Gene Co. Ltd., Toyama, Japan). Next, 5 µg of total RNA was reverse transcribed to single-strand cDNA by incubation with reverse transcription mixture (1 µl oligo (dT)12–18 primer (Gibco/BRL Life Technologies Ltd., Paisley, UK), 4 µl 1st strand buffer (Gibco/BRL Life Technologies Ltd.), 1 µl dNTP (10 mM, Gibco/BRL Life Technologies Ltd.), 2 µl DTT (0.1 M, Gibco/BRL Life Technologies Ltd.) and 1 µl Super script Ureverse transcriptase (Gibco/BRL Life Technologies Ltd.)). Direct PCR was performed with pairs of oligonucleotide primers corresponding to the cDNA sequences of some fibrosis related factors. The PCR was performed in a total volume of 50 µl (1 µl cDNA, 37.75 µl UPDW, 5 µl 10 × PCR buffer which contains 100 mM Tris-HCl buffer, 500 mM KCl and 15 mM MgCl2 (Takara Shuzo Co., Ltd., Shiga, Japan), 5 µl dNTP (Takara Shuzo co. Ltd.), 0.5 µl of 50 pmol/ml sense primer, 0.5 µl of 50 pmol/ml antisense primer and 0.25 µl Taq polymerase (5 U/ml, Takara Taq, Takara Shuzo co. Ltd.)). Takara PCR thermal cycler was used as follows: denaturing (94.0 °C, 1 min), annealing (1 min) and extension (72.0 °C, 1 min). For quantification, the PCR products were electrophoresed on a 2% agarose gel in Tris-borate EDTA buffer, stained with ethidium bromide (Sigma Chemical Co., St. Louis, MO) and analyzed using Quantity One v3.0.2 (pdi, New York, USA). The results were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression.
Table 1. Primer sequences and cycle numbers
TIMP-1 TIMP-2 TIMP-3 u-PA PAI-1 TGF-β1 GAPDH
198
Sense Primer
Antisense Primer
Cycle No.
Tm
GCTAAATTCATGGGTTCCCCAG GCAATGCAGACGTAGTGATCAG ATGCCTTCTGCAACTCCGACAT TGGGGGAGAATTCACTGTCGTT AGTGTTTCAGCATGTGGTCCAG GCCCTGGATACCAACTACTGCTTC GAGTATGTCGTGGAGTCTACTG
TTGCTGAGCAGGGCTCAGATTA CCTGTGGTTTAGGCTCTTCTTC TTGCAATTGCAACCCAGGTGGT TAGTCAGTGGCACTCTCTTGTC ATACCTTTGGTGTGCCTCTCCA TCAGCTGCACTTGCAGGAGCGCACGATCAT GCTTCACCACCTTCTTGATGTC
33 29 28 25 31 27 22
58.6 58.6 58.6 58.6 58.6 63.0 58.6
Exp Toxic Pathol 55 (2003) 2–3
Statistical analysis: All values are presented as mean ± standard error (SE). Statistical analysis was done using the Student’s t -test.
Results Histopathological findings of T1-group In HgCl2 only-group, regenerative tubular epithelium and luminal dilatation were predominated in the straight
portions of the proximal tubules in the cortex, especially at the cortico-medullary junction at day 4 (fig. 1a). These tubular cells were gradually replaced by eosinophilic epithelial cells at day 16. In HgCl2+FK-group, regenerative changes were predominant at day 4 (fig. 1b). The regenerated tubular epithelia resembled essentially normal tubular epithelia in the Control-group at and after day 8. In HgCl2+Dx-group, luminal dilatation of effected tubules were not found at day 4 (fig. 1c); they were first observed at day 16.
Fig. 1. Tubular lesions at the cortico-medullary junction in HgCl2-group (a, d), HgCl2+FK-group (b, e) and HgCl2+Dxgroup (c, f) at 4 days after final HgCl2 injectin in T1- (a, b, c) and T2-group (d, e, f), respectively. In T1-group, tubular regeneration and luminal expansion are observed in HgCl2 only- (a) and HgCl2+FK-groups (b), but, in HgCl2+Dx-group, luminal expansion are not observed (c). On the other hand, in T2-group, tubular lesions are observed in HgCl2 only- (d) and HgCl2+Dx-groups (f), but not in HgCl2+FK-group (e). HE, ×100.
Fig. 2. Peritubular fibrosis were observed in HgCl2 only-group (a) and HgCl2+Dx-group (c), but not in HgCl2+FK-group (b) at day 16 in T2-group. MT, ×120. Exp Toxic Pathol 55 (2003) 2–3
199
Histopathological findings of T2-group In HgCl2 only-group and HgCl2+Dx-group, regeneration of tubular epithelium and luminal dilatation were predominant until day 16 (figs. 1d and 1f), and peritubular fibrosis became gradually prominent (figs. 2a and 2c). In contrast to these two groups, in HgCl2+FK-group, renal tubules were relatively similar to those in Controlgroup (fig. 1e), and luminal dilatation of renal tubules
and peritubular fibrosis were not observed throughout the experimental period (fig. 2b).
Kinetics of infiltrating cells in renal interstitium Among the infiltrating cells in the renal interstitium, ED1-positive cells (monocyte/macrophage) were most predominant. In HgCl2 only-group, the number of ED1positive cells mildly increased mainly in tubulointersti-
Fig. 3. Kinctics of ED1-positive cells (a), α-SMA-positive cells (b), W3/25-positive cells (c), and OX-8-positive cells (d) : HgCl2+FK group, : HgCl2+Dx group, : Control group. *p < 0.05: in renal interstitium. : HgCl2 only-group, Significantly different from HgCl2-group, +: p < 0.05 Significantly different from Control-group. 200
Exp Toxic Pathol 55 (2003) 2–3
tium in the T1-group (fig. 4a), and it increased apparently both in tubulointerstitium and around arterioles in T2-group (fig. 4d). In T1-group, the number of ED1-positive cells in HgCl2+FK-group was significantly smaller than that in HgCl2 only-group, but it was larger than that in Control-group (figs. 3a and 4b). The number of ED1positive cells was also significantly smaller in HgCl2+Dx-group than HgCl2 only-group, and it was almost the same as that in Control-group (figs. 3a and 4c).
However, in T2-group, although the number of ED1-positive cells in HgCl2+FK-group was continuously smaller than that in HgCl2 only-group, the number of ED1-positive cells in HgCl2+DX-group was transiently larger than that in HgCl2 only-group and continuously larger than that in HgCl2+FK-group (figs. 3a, 4e and 4f). W3/25-positive cells (CD4 positive T lymphocyte) were also found mainly in tubulointerstitium in T1-group, and both in tubulointerstitium and around arterioles in T2-
Fig. 4. Immunohistochemical staining for ED1 in HgCl2 only-group (a, d), HgCl2+FK-group (b, e) and HgCl2+Dx-group (c, f) at day 8 in T1-group (a, b, c) and at day 4 in T2-group (d, e, f), respectively. In T1-group, the number of ED-1 positive cells found in tubulointerstitium is small in HgCl2+FK- (b) and HgCl2+Dx (c) groups compared with HgCl2 only-group (a). On the other hand, in T2-group, many ED-1 positive cells are observed in HgCl2 only- (d) and HgCl2+Dx (f) groups, but not in HgCl2+FK-group (e). ×200.
Fig. 5. Immunohistochemical staining for W3/25 in HgCl2 only-group (a), HgCl2+FK-group (b) and HgCl2+Dx-group (c) at day 16 in T2-group. The number of W3/25-positive cells in HgCl2 only-group (a) is larger than that in HgCl2+FK- (b) and HgCl2+Dx-groups (c). ×200. Exp Toxic Pathol 55 (2003) 2–3
201
group, respectively (fig. 5). The number of W3/25-positive cells in HgCl2-group increased at day 8 in T1-group. It continuously increased in T2-group, and kept higher value than that in Control-group throughout the experimental period (fig. 3c). In HgCl2+FK-and HgCl2+Dxgroups, interstitial infiltration of W3/25-positive cells was
inhibited, and the number of W3/25-positive cells in these two groups was almost the same as that in Control-group. Although the absolute number was slightly different, kinetics of OX-8-positive cells (CD8 positive T lymphocyte) in three groups were almost similar to that of W3/25-positive cells in these three groups (figs. 3d and 6).
Fig. 6. Immunohistochemical staining for OX-8 in HgCl2 only-group (a), HgCl2+FK-group (b) and HgCl2+Dx-group (c) at day 16 in T2-group. The number of W3/25-positive cells in HgCl2 only-group (a) is larger than that in HgCl2+FK- (b) and HgCl2+Dx-groups (c). ×200.
Fig. 7. Immunohistochemical staining for α-SMA in HgCl2 only-group (a, d), HgCl2+FK-group (b, e) and HgCl2+Dxgroup (c, f) at day 8 in T1-group (a, b, c) and at day 4 in T2-group (d, e, f), respectively. In T1-group, the number of αSMA positive cells found in tubulointerstitium is small in HgCl2+FK- (b) and HgCl2+Dx (c) groups compared with HgCl2 only-group (a). On the other hand, in T2-group, many α-SMA positive cells are observed in HgCl2 only- (d) and HgCl2 +Dx (f) groups, but not in HgCl2 +FK-group (e). ×125. 202
Exp Toxic Pathol 55 (2003) 2–3
Fig. 8. mRNA levels of fibrosis-related factors. TIMP-1 (a), TIMP-2 (b), TIMP-3 (c), uPA (d), PAI-1 (e) and TGF-β1 (f). : HgCl2+FK group, : HgCl2+Dx group, : Control group. *: p < 0.05 Significantly differ: HgCl2 only-group, ent from HgCl2-group, +: p < 0.05 Significantly different from Control-group. Exp Toxic Pathol 55 (2003) 2–3
203
Kinetics of α-SMA-positive cells in renal interstitium Spindle-shaped α-SMA-positive cells were found around the tubules which showed degenerative or regenerative epithelial changes in the cortico-medullary junction (fig. 7). In HgCl2 only-group, the number of αSMA-positive cells significantly increased at day 4 and 8 in T1-group and decreased thereafter (fig. 3b). In HgCl2+FK-group, the number of α-SMA-positive cells transiently increased at day 4 and decreased thereafter (fig. 3b). The level was significantly lower than that in HgCl2-group. In contrast to the HgCl2+FK-group, the number of α-SMA-positive cells in HgCl2+Dx-group was significantly higher than that in HgCl2-group in T2group, especially at day 4 (fig. 3b).
Kinetics of fibrosis-related factors TIMPs: In T1-group, the expression of TIMP-1 mRNA increased at day 4 and gradually decreased thereafter in HgCl2 only-, HgCl2+FK-, and HgCl2+Dx-groups, and its degree was almost the same among these three groups at each timepoint (Fig. 8a). In T2-group, the expression of TIMP-1 mRNA was kept higher level, and there was no difference among three groups. On the other hand, the expressions of TIMP-2 and TIMP-3 mRNAs did not change throughout the experimental period, and there was no difference among the three groups (figs. 8b and 8C). Plasmin-dependent pathway: uPA mRNA expression was not changed throughout the experimental period, and there was no significant difference among all groups (fig. 8d). On the other hand, the level of PAI-1 mRNA expression in HgCl2 only-group in T1-group peaked at day 8 and decreased thereafter (Fig. 8e). However, it was significantly high throughout the experimental period. In HgCl2+FK-group, the expression of PAI-1 mRNA was also upregulated, but its degree was less than that in HgCl2 only-group. In HgCl2+Dx group, although the level of PAI-1 mRNA expression in T1-group was almost the same as that in Control-group at day 4, it increased gradually at and after day 8 and became higher than that in HgCl2 only-group in T2-group. Transforming growth factor (TGF)-β1: The level of TGF-β1 mRNA expression in HgCl2-group was highest at day 8 in T1-group and it maintained higher value than that in Control-group (fig. 8f). In HgCl2+FK and HgCl2+Dx groups, the level of TGF-β1 mRNA expression was also higher than that in Control-group, but it was lower than that in HgCl2-group. Moreover, the level of TGF-β1 mRNA expression in HgCl2+Dx-group was slightly higher than that in HgCl2+Dx-group throughout the experimental period.
Discussion In this study, we investigated the effects of FK and Dx on the development of tubulointerstitial fibrosis in mer204
Exp Toxic Pathol 55 (2003) 2–3
curic chloride-treated BN rats. The histological changes in HgCl2 only-group were same as those reported in our previous paper (SUZUKI et al. 1998). In the HgCl2+FKgroup, regenerative tubular epithelia were prominent at day 4 in T1-group. Effected renal tubules immediately recovered to normal-appearing ones at day 8 and peritubular fibrosis was not observed in T2 group. FK is an immunosuppressant and known to be 100-times potent in inhibiting T cell activation, cytotoxic T cell generation, and cytokine production than cyclosporin A (BIERER et al. 1990). FK is also reported to be nephrotoxic (STILLMAN et al. 1995). On the other hand, some recent studies reported its protective effects against toxin- or ischemiamediated injuries and glomerulosclerosis (SAKR et al. 1990; FARGHALI et al. 1991a; FARGHALI et al. 1991b; VAN THIEL et al. 1992; HAMAR et al. 2001). Based on these reports, it can be speculated that FK may hasten recovery and protect the kidney from nephrotoxicity induced by repeated mercuric chloride injection and following peritubular fibrosis in this model. On the other hand, in HgCl2+Dx-group, although early tubular lesions were delayed, peritubular fibrosis was prominent in T2-group and fibrosis was somewhat more severe than in the HgCl2 only-group. Dx is a glucocorticoid steroid and has multiple and complex effects on immune responses and inflammation. Large doses of glucocorticoids cause nephrotoxity (JEVNIKAR et al. 1992; CHEN et al. 1998), and Dx is also said to accelerate fibrogenesis in liver fibrosis model induced by common bile duct ligation induced (MELGERT et al. 2001). Dx at the dose level of 1 mg/kg b.w. in the present study seems to produce nephrotoxicity especially after repeated mercuric chloride injection and accelerate peritubular fibrosis. The number of W3/25-positive lymphocytes in HgCl2 only-group increased at day 8 in T1-group. In T2-group, it increased continuously and kept higher levels than that in Control-group throughout the experimental period. In HgCl2+FK-and HgCl2+Dx-groups, interstitial infiltration of W3/25-positive lymphocytes was inhibited and the number of W3/25-positive lymphocytes was almost the same as that in Control-group. Although the absolute number was slightly different, kinetics of OX-8-positive lymphocytes in three groups were almost similar to that of W3/25-positive lymphocytes. The suppression of lymphocyte infiltration in HgCl2+FK-and HgCl2+Dx-groups seems to be due to their inhibitory effect on immunity as previous reported (WENNBERG et al. 2001; HAMAR et al. 2001). However, HgCl2+FK- and HgCl2+Dx-groups showed opposite results as to renal fibrosis. Therefore, it is reasonable to consider that lymphocytes infiltrated in interstitium may not essentially contribute to the development of renal fibrosis in this model. The number of ED1-positive macrophages in HgCl2 only-group peaked at day 8 in T1-group, and it showed more prominent increase in T2-group. In HgCl2 +FK-and HgCl2+Dx-groups in T1-group, it showed slight increase, but it was significantly fewer than that in HgCl2-
group. In T2-group, the number of ED1-positive macrophages in HgCl2+FK-group was significantly fewer than HgCl2-group, but the number in HgCl2+Dx-group showed transient and remarkable increase at day 4 and decreased thereafter. Essentially, FK and Dx are said to be able to reduce infiltration of macrophages as well as lymphocytes (WENNBERG et al. 2001; HAMAR et al. 2001). Indeed, as mentioned above, FK could reduce macrophage infiltration in all timepoints. Dx also reduced macrophage infiltration in T1-group, but it enhanced macrophage infiltration in T2-group, probably because of nephrotoxicity induced by high dose Dx. Therefore, its insufficient inhibition of macrophage infiltration may enhance renal fibrosis, because macrophages are one of the most inportant factors of renal interstitial fibrosis (DIAMOND et al. 1995; EDDY and GIACHELLI 1995; YAMATE et al. 1995; YAMATE et al. 1996; EDDY 1996; NAKATSUJI et al.1998). Kinetics of α-SMA-positive cells in three treated groups were almost the same as that of ED1-positive macrophages, except that at day 4 in T1-group. Thus, daily Dx injection increased the number of myofibloblast, and daily FK injection inhibited the increase in number of myofibroblast. However, it is still obscure whether these effects are direct or indirect to target cells. In this regard, it was suggested that fibroblasts were activated into α-SMA-positive myofibroblasts by TGF-β1 secreted from macrophages infiltrated into interstitium (DIAMOND et al. 1995; TAMAKI et al. 1994). From these findings, the effect of these drugs on the number of αSMA-positive cells may be indirect through macrophage infiltration. The plasmin-dependent pathway is one of the important matrix metalloproteinases (MMPs) regulatory pathway. In this process, an activation of latent MMPs is regulated by the balance of PAs and PAIs expressions (KRUITHOF et al. 1988; DUYMELINCK et al. 1997). In HgCl2+FK-group, uPA mRNA expression was not changed, and the expression of PAI-1 mRNA was significantly upregulated but its degree was less than that in HgCl2-group. Taking into consideration that PAI-1 mRNA was localized in regenerative tubular epithelial cells in our previous study (SUZUKI et al. 2001) and tubular injury was moderate in HgCl2+FK group, FK may have an inhibitory effect on the expression of PAI-1 mRNA. In contrast to HgCl2+FK-group, the expression of PAI-1 mRNA in HgCl2+Dx-group was upregulated at and after day 8 in T1-group. In addition, in T2-group, it was higher than that in HgCl2-group. Some in vitro studies showed that Dx induced the PAI-1 mRNA in rat hepatocytes and osteoblasts (FUKUMOTO et al. 1992; UNO et al. 1998). So, the above-mentioned upregulation of PAI1 mRNA may be resulted from synergistic effect of mercuric chloride and Dx. As mentioned above, in comparison with the expression of uPA mRNA, the expression of PAI-1 mRNA was predominant in all treated groups, especially in HgCl2 only- and HgCl2+Dx-groups showing peritubular fibrosis. In our previous study, we specu-
lated that PAI-1 may be one of the important fibrogenetic factors as a regulator of MMPs activity (SUZUKI et al. 2001). So, the present report may support our previous speculation. TIMPs, a well-known MMP inhibitor, also have an important effect on the regulation of MMPs activity. In this study, the expression of TIMP-1 mRNA was increased, but the expressions of TIMP-2 and TIMP-3 mRNA were not significantly changed in HgCl2-group. This result was in accordance with the results of previous studies (EDDY 1996; SUZUKI et al. 2001). In HgCl2+FKand HgCl2+Dx-groups, the expression of TIMP-1 mRNA was increased, but the expressions of TIMP-2 and TIMP-3 mRNA showed no changes. The levels of TIMP-1 mRNA showed no significant differences among three groups. Therefore, it was considered that FK and Dx might not have any effects on the expressions of TIMPs mRNAs. In contrast, MELGERT et al. (2001) suggested that Dx accerated fibrogenesis with an induction of TIMP-1 mRNA. TGF-β1 is considered as the most important fibrosis promoting cytokine, and has multiple roles in fibrosis. Namely, it increases synthesis of extracellular matrix, decreases production of MMPs and increases production of TIMPs (KUNCIO et al. 1991; MULLER et al. 1991; ROBERTS et al. 1992; SHARMA et al. 1995). In this study, it seems that FK and Dx did not have any effects on mercuric chloride-induced upregulation of TGF-β1 mRNA expression. In previous reports, FK was said to reduce the expression of TGF-β1 mRNA and decrease the rate of interstitial fibrosis and glomerulosclerosis (JAIN et al. 2000; BICKNELL et al. 2000; HAMAR et al. 2001). On the other hand, it was reported that Dx enhanced the expression of TGF-β1 mRNA in in vivo study (KARIM et al. 1997), but it inhibit in in vitro study (MELGERT et al. 2001), while Dx enhanced the expressions of other fibrosis-related factors in both studies. From these findings, it is suggested that FK and Dx might have an effect on TGF-β1-independent fibrogenetic mechanism. In conclusion, it was suggested that FK reduced mononuclear cell infiltration in renal interstitium, and also inhibited renal fibrosis through the reduction in the expression and/or number of almost all fibrosis-related factors, especially macrophage infiltration. On the other hand, Dx reduced lymphocyte infiltraton, but did not inhibit macrophage infiltration and fibrosis. These findings indicated the importance of macrophages in the development of mercuric chloride-induced renal interstitial fibrosis in BN rats.
References BICKNELL GR, WILLIAMS ST, SHAW JA, et al.: Differential effect of cyclosporin and tacrolimus on the expression of fibrosis-associated genes in isolated glomeruli from renal transplants. Br J Surg 2000; 87: 1569–1575. Exp Toxic Pathol 55 (2003) 2–3
205
BIERER BE, SCHREIBER SL, BURAKOFF SJ: Mechanism of immunosuppression by FK 506. Transplantation 1990; 49: 1168–1202. BOHLE A, BADER R, GRUND KE, et al.: Serum creatinine concentration and interstitial volume. Analysis of concentrations in endocapillary (acute) glomerulonephritis. Virchow Arch A 1977a; 375: 87-96. BOHLE A, GLOMB D, GRUND KE, et al.: Correlations between relative interstitial volume of the renal cortex and the serum creatinine concentration in minimal change with nephrotic syndrome and in focal sclerosing glomerulonephritis. Virchow Arch A 1977b; 376: 221–232. CHEN A, SHEU LF, HO YS, et al.: Administration of dexamethasone induces proteinuria of glomerular origin inmice. Am J Kidney Dis 1998; 31: 443–452. D’AMICO G: Influence of clinical and histological features on actuarial renal survival in adult patients with iopathic IgA nephropathy, membranous nephropathy, and membrano-proliferative glomerulonephritis. Survey of recent literature. Am J Kidney Dis 1992; 20: 315–323. DIAMOND JR, VAN GOOR H, DING G, et al.: Myofibroblasts in experimental hydronephrosis. Am J Pathol 1995; 146: 121–129. DUYMELYNC C, DEBG JT, DAUWE SHE, et al.: Inhibition of the matrix metalloproteinase system in a rat model of chronic cyclosporine nephropathy. Kidney Int 1998; 54: 804–818. EDDY AA, GIACHELLI CM: Interstitial inflammation and fibrosis in rats with diet-induced hypercholesterolemia. Kidney Int 1995; 47: 1546–1557. EDDY AA: Molecular insights into renal interstitial fibrosis. J Am Soc Nephrol 1996; 7: 2495–2508. FARGHALI H, SAKR ME, GASBARRINI A, et al.: A biochemical and 31p-NMR investigation of the effect of FK506 and cyclosporin pretreatment of immobilized hepatocytes perfused with ethanol. Transplant Proc 1991a; 23: 2805–2808. FARGHALI H, GASBARRINI A, BORLE AB, et al.: FK506 modulates D-galactosamine-induced hepatitis in rats. Transplant Proc 1991b; 23: 2809–2811. FARGHALI H, GASBARRINI A, NALESNIK MA, et al.: FK506 is a hepatoprotective agent in animals with experimental chemically induced hepatitis. Hepatology 1991c; 14: 162A. FISCHBACH H, MACKENSEN S, GRUND KE, et al.: Relationship between glomerular lesions, serum creatinine concentration and interstitial volume in membrano-proliferative glomerulonephritis. Klin Wochenschr 1977; 55: 603–608. FUKUMOTO S, ALLAN EH, ZEHEB R, et al.:Glucocorticoid regulation of plasminogen activator inhibitor-1 messenger ribonucleic acid and protein in normal and malignant rat osteoblasts. Endocrinology 1992; 130: 797–804. HAMAR P, PETI-PETERDI J, SZABO A, et al.: Interleukin-2dependent mechanisms are involved in the development of glomerulosclerosis after partial renal ablation in rats. Exp Nephrol 2001; 9: 133–141. HIRSCH F, COUDERC J, SAPIN C, et al.: Polyclonal effect of HgCl2 in the rat, its possible role in an experimental autoimmune disease. Eur J Immunol 1982, 12: 620–625. 206
Exp Toxic Pathol 55 (2003) 2–3
JAIN S, BICKNELL GR, NICHOLSON ML: Tacrolimus has less fibrogenic potential than cyclosporin A in a model of renal ischaemia-reperfusion injury. Br J Surg 2000; 87: 1563–1568. JEVNIKAR AM, SINGER GG, BRENNAN DC, et al.: Dexamethasone prevents autoimmune nephritis and reduces renal expression of Ia but not costimulatory signals. Am J Pathol 1992; 141: 743–751. KARIM MA, FRIZZELL S, INMAN L, et al.: In vivo role of glucocorticoids in barotrauma vascular repair and fibrosis. J Mol Cell Cardiol 1997; 29: 1111–1122. KRUITHOF EKO: Plasminogen activator inhibitors: A review. Enzyme 1988; 40: 113–121. KUNCIO GS, NEILSON EG, HAVERTY T: Mechanisms of tubulointerstitial fibrosis. Kidney Int 1991; 39: 550–556. MELGERT BN, OLINGA P, VAN DER LAAN JMS, et al.: Targeting dexamethasone to kupffer cells: Effects on liver inflammation and fibrosis in rats. Hepatology 2001; 34: 719–728. MULLER GA, MARKOVIC-LIPKOVSKI J, RODEMANN HP: The progression of renal diseases: On the pathogenesis of renal interstitial fibrosis. Klin Wochenschr 1991; 69: 576–586. NAKATSUJI S, YAMATE J, SAKUMA S: Macrophages, myofibroblast, and extracellular matrix accumulation in interstitial fibrosis of choronic progressive nephropathy in aged rats. Vet Pathol 1998; 35: 352–360. RISDON RA, SLOPER JC, WARDENER HE: Relationship between renal funtion and histologic changes found in renal biopsy specimens from patients with persistent glomerular nephritis. Lancet 1968; 2: 363–366. ROBERTS AB, MCCUNE BK, SPORNN MB: TGF-β: Regulation of extracellular matrix. Kidney Int 1992; 41: 557–559. SAKR ME, HASSANEIN TI, ZETTI GM, et al.: FK506 ameliorates the hepatic injury associated with ischemia. Life Sci 1990; 47: 687–691. SAPIN C, DRUET E, DRUET P: Induction of anti-glomerular basement membrane antibodies in the Brown Norway rat by mercuric chloride. Clin Exp Immunol 1977; 28: 173–179. SHARMA AK, MAUER SM, KIM Y, et al.: Altered expression of matrix metalloproteinase-2, TIMP, TIMP-2 in obstructive nephropathy. J Lab Clin Med 1995; 125: 754–761 SUZUKI K, UETSUKA K, NAKAYAMA H, et al.: Renal tubulointerstitial lesions in mercuric chloride-treated Brown Norway rats. J Toxicol Pathol 1998; 11: 241–247. SUZUKI K, UETSUKA K, NAKAYAMA H, et al.: Kinetics of transforming growth factor-β1 and extracellular matrix in renal tubulointerstitial lesions in mercuric chloridetreated Brown Norway rats. Int J Exp Path 1999; 80: 125–132. SUZUKI K, NAKAYAMA H, DOI K: Kinetics of matrix metalloproteinases and their regulatory factors in mercuric chloride-induced tubulointerstitial fibrosis in Brown Norway rats. Exp Toxic Pathol 2001; 53: 337–343. STILLMAN IE, ANDOH TF, BURDMANN EA, et al.: FK506 nephrotoxicity: morphologic and physiologic characterization of rat model. Lab Inv 1995; 73: 794–803. TAMAKI K, OKUDA S, ANDO T, et al.: TGF-β in glomerulosclerosis and interstitial fibrosis of adriamycin nephropathy. Kidney Int 1994; 45: 525–536.
UNO S, NAKAMURA M, OHOMAGARI Y, et al.: Regulation of tissue-type plasminogen activator (tPA) and type-1 plasminogen activator inhibitor (PAI-1) gene expression in rat hepatocytes in primary culture. J Biochem 1998; 123: 806–812. VAN THIEL DH, SAKR M, ZETTI G, et al.: FK 506 reduces the injury experienced following renal ischemia and reperfusion. Ren Fail 1992; 14: 285–288. WEHMANN M, BOHLE A, BOGENSCHUTZ O, et al.: Longterm prognosis of chronic idiopathic membranous glomerulonephritis. An analysis of 334 cases with particular regard to tubulo-interstitial changes. Clin Nephrol 1989; 31: 67–76.
WENNBERG L, CZECH KA, LARSSON LC, et al.: Effects of immunosuppressive treatment on host responses against intracerebral porcine neural tissue xenografts in rats. Transplantation 2001; 71: 1797–1806. YAMATE J, TATSUMI M, NAKATSUJI S, et al.: Immunohistochemical observations on the kinetics of macrophages and myofibroblasts in rat renal interstitial fibrosis induced by cis-diamminedichloroplatinum. J Comp Pathol 1995; 112: 27–39. YAMATE J, ISHIDA A, TSUJINO K, et al.: Immunohistochemical study of rat renal interstitial fibrosis induced by repeated injection of cisplatin, with special reference to the kinetics of macrophages and myofibroblasts. Toxicol Pathol 1996; 24: 199–206.
Exp Toxic Pathol 55 (2003) 2–3
207
Department of Veterinary Pathology, Graduate School of Agricultural and Life Sciences, The University of Tokyo, Tokyo, Japan 2 Biopathology Institute Co., Ltd., Ohita, Japan
Effects of tacrolimus and dexamethasone on tubulointerstitial fibrosis in mercuric chloride treated Brown Norway rats KAZUHIKO SUZUKI1, TOMOMICHI KANABAYASHI2, HIROYUKI NAKAYAMA1, and KUNIO DOI1 With 8 figures and 1 table Received: November 26, 2002; Received: May 19, 2003; Accepted: June 11, 2003 Address for correspondence: KUNIO DOI, Department of Veterinary Pathology, Graduate School of Agricultural and Life Sciences, The University of Tokyo, Yayoi 1-1-1, Bunkyo-ku, Tokyo 113-8657, Japan; Tel.: ++81-3-5841-5401, Fax: ++81-3-5841-8185, e-mail: [email protected] Key words: Brown Norway rat; tubulointerstitial fibrosis; tacrolimus; dexamethasone; macrophage; mercuric chloride.
Summary We investigated the effects of daily injection of tacrolimus (FK), an immunosuppressor, or dexamethasone (Dx), an antiinflammatory agent, on renal tubulointerstitial fibrosis in mercuric chloride-treated Brown Norway rats. The tubular lesions observed after one time injection of mercuric chloride were reduced in FK-treatment group, but not in Dx-treatment group. Moreover, FK reduced infiltration of mononuclear cells, especially macrophages, and proliferation of myofibroblasts in renal intestitium and also inhibited renal interstitial fibrosis through the reduction of the expressions of fibrosis-related factors, i.e. plasminogen activator inhibitor-1 and transforming growth factor-β1. On the other hand, Dx reduced lymphocyte infiltraton, but did not inhibit macrophage infiltration. In addition, Dx did not suppress myofibroblast profiferation, upregulation of fibrosis-related factors, and interstitial fibrosis. From these findings, it is suggested that FK may inhibit renal interstitial fibrosis through inhibition of macrophage infiltration, and that macrophages and myofibroblasts are very important fibrogenic factors in the development of mercuric chloride-induced renal tubulointerstitial fibrosis in BN rats.
Introduction Renal tubulointerstitial lesions, especially fibrosis, have been attracting great attention, since it was recognized that renal tubulointerstitial lesions following renal tubular and glomerular injury are closely related with
renal dysfunction (RISDON et al. 1968; BOHLE et al. 1977a; BOHLE et al. 1977b; FISCHBACH et al. 1977; WEHMANN et al. 1989; D’AMICO 1992). Recently, it has been speculated that macrophages and α-smooth muscle actin (SMA)-positive myofibroblasts might play an important role in renal interstitial fibrosis (YAMATE et al. 1996), but the relationship between these cells and renal fibrosis has not fully been clarified. Moreover, there are only a few reports on the role of lymphocytes in the development of renal fibrosis, although lymphocytes are also involved in renal tubulointerstitial lesions. In our previous studies on mercuric chloride-treated Brown Norway (BN) rats, we reported that macrophages, myofibroblasts and TGF-β1 originated from tubular epithelial cells and some populations of macrophages might be closely related with the development of renal interstitial fibrosis (SUZUKI et al. 1998; SUZUKI et al. 1999). It is well known that a genetically restricted autoimmune syndrome can be induced in BN rats by repeated injection of low doses of mercuric chloride that involves polyclonal B lymphocyte activation (SAPIN et al. 1977) and synthesis of anti-nuclear and anti-glomerular basement membrane antibodies (HIRSCH et al. 1982). So, it seems reasonable to consider that immunological mechanisms also take part in the pathogenesis of renal tubulointerstitial fibrosis. In this study, we investigated whether immunological mechanisms participate in the pathogenesis of mercuric chloride-induced tubulointerstitial fibrosis in BN rats using immunosuppressive 0940-2993/03/55/02-03-197 $ 15.00/0
197
agent, tacrolimus, or anti-inflammatory agent, dexamethasone. The protocol of this study was approved by the Animal Care and Use Committe of Graduate School of Agricultural and Life Sciences, the University of Tokyo.
Material and methods Animals: One hundred and twenty-six 9-week-old male Brown Norway (BN) rats (220 ± 20 g) (Charles River Japan Co., Kanagawa, Japan) were used. The animals were housed 2–3 per cage using an isolator caging system (Niki Shoji Co., Tokyo, Japan) in an animal room controled at 23 ± 20 °C and 55 ± 5% r.h. with 14 hs-light and 10 hs-dark cycle. They were fed commercial pellets (MF, Oriental Yeast Co. Ltd. Tokyo, Japan) and water ad libitum. Treatments: Mercuric chloride (HgCl2, WAKO Pure Chemicals Co., Ltd., Tokyo) was dissolved in distilled water and the concentration was adjusted to 1 mg/ml. Ninety rats were injected 1 ml/kg b.w. of the above-mentioned HgCl2 solution injected subcutaneously one time (T1-group) or three times every other day (T2-group). Tacrolimus (FK, Fijisawa Pharmaceutical Co., Ltd., Osaka, Japan) and dexamethasone (Dx, Nacalai Tesque, Inc., Kyoto, Japan) were dissolved in physiological saline to get the final concentration of 1 mg/ml, respectively, and 1 ml/kg b.w. of each solution was daily injected subcutaneously from one day before day 0 to the day of necropsy, respectively. Depending on the treatment, rats were divided into three subgroups, HgCl2 only-group, HgCl2+FK-group, and HgCl2+Dx-group. Five rats in each group were sacrificed under ether anesthesia at 4, 8 and 16 days after final HgCl2 injection in T1- and T2-groups, respectively. Moreover, the remaining 18 rats, which were injected with 1 ml/kg b.w. of distilled water one or three times as T1- or T2-group, were sacrificed at 4, 8 and 16 days after final injection and served as Control-group. Histopathology: The left kidney of each animal was fixed by PLP(periodate-lysine-paraformaldehyde)-AMeX (acetone, methyl benzoate, and xylene) method. Two-µm paraffin sections were stained with hematoxylin and eosin (HE) or Masson’s trichrome (MT) stain for histopathological examination. Immunohistochemistry: Two-µm PLP-AMeX fixed paraffin sections were stained by labelled streptavidin bi-
otin (LSAB) method using LSAB 2 kit (DAKO Japan, Kyoto, Japan). The primary antibodies used were anti-rat ED1 (BMA Biochemical Ltd., Switzerland), anti-rat W3/25 (CD4 equivalent) (Harlan Sera-Lab. Ltd., Sussex, England), OX-8 (CD8 equivalent) (Pharmigen, San Diego, U.S.A.) and anti-human α-smooth muscle actin (α-SMA) (DAKO Japan, Kyoto) mouse monoclonal antibodies. The number of positive cells for each antibody was counted in randomly selected 50 fields (0.5 mm2 each) in the corticomedullary junction per section per rat under light microscopy with ×400 magnification, and an average number per field was calculated for each rat. Reverse transcription-polymerase chain reaction (RT-PCR): The expressions of mRNA of tissue inhibitors of metalloproteinases (TIMP)-1, TIMP-2, TIMP-3, urokinase-type plasminogen activator (uPA), plasminogen activator inhibitor-1 (PAI-1) and transforming growth factorβ1 (TGF-β1) (table1) were examined. The total RNA was extracted from the renal cortical tissue of the right kidney of each rat killed as scheduled using ISOGEN (Nippon Gene Co. Ltd., Toyama, Japan). Next, 5 µg of total RNA was reverse transcribed to single-strand cDNA by incubation with reverse transcription mixture (1 µl oligo (dT)12–18 primer (Gibco/BRL Life Technologies Ltd., Paisley, UK), 4 µl 1st strand buffer (Gibco/BRL Life Technologies Ltd.), 1 µl dNTP (10 mM, Gibco/BRL Life Technologies Ltd.), 2 µl DTT (0.1 M, Gibco/BRL Life Technologies Ltd.) and 1 µl Super script Ureverse transcriptase (Gibco/BRL Life Technologies Ltd.)). Direct PCR was performed with pairs of oligonucleotide primers corresponding to the cDNA sequences of some fibrosis related factors. The PCR was performed in a total volume of 50 µl (1 µl cDNA, 37.75 µl UPDW, 5 µl 10 × PCR buffer which contains 100 mM Tris-HCl buffer, 500 mM KCl and 15 mM MgCl2 (Takara Shuzo Co., Ltd., Shiga, Japan), 5 µl dNTP (Takara Shuzo co. Ltd.), 0.5 µl of 50 pmol/ml sense primer, 0.5 µl of 50 pmol/ml antisense primer and 0.25 µl Taq polymerase (5 U/ml, Takara Taq, Takara Shuzo co. Ltd.)). Takara PCR thermal cycler was used as follows: denaturing (94.0 °C, 1 min), annealing (1 min) and extension (72.0 °C, 1 min). For quantification, the PCR products were electrophoresed on a 2% agarose gel in Tris-borate EDTA buffer, stained with ethidium bromide (Sigma Chemical Co., St. Louis, MO) and analyzed using Quantity One v3.0.2 (pdi, New York, USA). The results were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression.
Table 1. Primer sequences and cycle numbers
TIMP-1 TIMP-2 TIMP-3 u-PA PAI-1 TGF-β1 GAPDH
198
Sense Primer
Antisense Primer
Cycle No.
Tm
GCTAAATTCATGGGTTCCCCAG GCAATGCAGACGTAGTGATCAG ATGCCTTCTGCAACTCCGACAT TGGGGGAGAATTCACTGTCGTT AGTGTTTCAGCATGTGGTCCAG GCCCTGGATACCAACTACTGCTTC GAGTATGTCGTGGAGTCTACTG
TTGCTGAGCAGGGCTCAGATTA CCTGTGGTTTAGGCTCTTCTTC TTGCAATTGCAACCCAGGTGGT TAGTCAGTGGCACTCTCTTGTC ATACCTTTGGTGTGCCTCTCCA TCAGCTGCACTTGCAGGAGCGCACGATCAT GCTTCACCACCTTCTTGATGTC
33 29 28 25 31 27 22
58.6 58.6 58.6 58.6 58.6 63.0 58.6
Exp Toxic Pathol 55 (2003) 2–3
Statistical analysis: All values are presented as mean ± standard error (SE). Statistical analysis was done using the Student’s t -test.
Results Histopathological findings of T1-group In HgCl2 only-group, regenerative tubular epithelium and luminal dilatation were predominated in the straight
portions of the proximal tubules in the cortex, especially at the cortico-medullary junction at day 4 (fig. 1a). These tubular cells were gradually replaced by eosinophilic epithelial cells at day 16. In HgCl2+FK-group, regenerative changes were predominant at day 4 (fig. 1b). The regenerated tubular epithelia resembled essentially normal tubular epithelia in the Control-group at and after day 8. In HgCl2+Dx-group, luminal dilatation of effected tubules were not found at day 4 (fig. 1c); they were first observed at day 16.
Fig. 1. Tubular lesions at the cortico-medullary junction in HgCl2-group (a, d), HgCl2+FK-group (b, e) and HgCl2+Dxgroup (c, f) at 4 days after final HgCl2 injectin in T1- (a, b, c) and T2-group (d, e, f), respectively. In T1-group, tubular regeneration and luminal expansion are observed in HgCl2 only- (a) and HgCl2+FK-groups (b), but, in HgCl2+Dx-group, luminal expansion are not observed (c). On the other hand, in T2-group, tubular lesions are observed in HgCl2 only- (d) and HgCl2+Dx-groups (f), but not in HgCl2+FK-group (e). HE, ×100.
Fig. 2. Peritubular fibrosis were observed in HgCl2 only-group (a) and HgCl2+Dx-group (c), but not in HgCl2+FK-group (b) at day 16 in T2-group. MT, ×120. Exp Toxic Pathol 55 (2003) 2–3
199
Histopathological findings of T2-group In HgCl2 only-group and HgCl2+Dx-group, regeneration of tubular epithelium and luminal dilatation were predominant until day 16 (figs. 1d and 1f), and peritubular fibrosis became gradually prominent (figs. 2a and 2c). In contrast to these two groups, in HgCl2+FK-group, renal tubules were relatively similar to those in Controlgroup (fig. 1e), and luminal dilatation of renal tubules
and peritubular fibrosis were not observed throughout the experimental period (fig. 2b).
Kinetics of infiltrating cells in renal interstitium Among the infiltrating cells in the renal interstitium, ED1-positive cells (monocyte/macrophage) were most predominant. In HgCl2 only-group, the number of ED1positive cells mildly increased mainly in tubulointersti-
Fig. 3. Kinctics of ED1-positive cells (a), α-SMA-positive cells (b), W3/25-positive cells (c), and OX-8-positive cells (d) : HgCl2+FK group, : HgCl2+Dx group, : Control group. *p < 0.05: in renal interstitium. : HgCl2 only-group, Significantly different from HgCl2-group, +: p < 0.05 Significantly different from Control-group. 200
Exp Toxic Pathol 55 (2003) 2–3
tium in the T1-group (fig. 4a), and it increased apparently both in tubulointerstitium and around arterioles in T2-group (fig. 4d). In T1-group, the number of ED1-positive cells in HgCl2+FK-group was significantly smaller than that in HgCl2 only-group, but it was larger than that in Control-group (figs. 3a and 4b). The number of ED1positive cells was also significantly smaller in HgCl2+Dx-group than HgCl2 only-group, and it was almost the same as that in Control-group (figs. 3a and 4c).
However, in T2-group, although the number of ED1-positive cells in HgCl2+FK-group was continuously smaller than that in HgCl2 only-group, the number of ED1-positive cells in HgCl2+DX-group was transiently larger than that in HgCl2 only-group and continuously larger than that in HgCl2+FK-group (figs. 3a, 4e and 4f). W3/25-positive cells (CD4 positive T lymphocyte) were also found mainly in tubulointerstitium in T1-group, and both in tubulointerstitium and around arterioles in T2-
Fig. 4. Immunohistochemical staining for ED1 in HgCl2 only-group (a, d), HgCl2+FK-group (b, e) and HgCl2+Dx-group (c, f) at day 8 in T1-group (a, b, c) and at day 4 in T2-group (d, e, f), respectively. In T1-group, the number of ED-1 positive cells found in tubulointerstitium is small in HgCl2+FK- (b) and HgCl2+Dx (c) groups compared with HgCl2 only-group (a). On the other hand, in T2-group, many ED-1 positive cells are observed in HgCl2 only- (d) and HgCl2+Dx (f) groups, but not in HgCl2+FK-group (e). ×200.
Fig. 5. Immunohistochemical staining for W3/25 in HgCl2 only-group (a), HgCl2+FK-group (b) and HgCl2+Dx-group (c) at day 16 in T2-group. The number of W3/25-positive cells in HgCl2 only-group (a) is larger than that in HgCl2+FK- (b) and HgCl2+Dx-groups (c). ×200. Exp Toxic Pathol 55 (2003) 2–3
201
group, respectively (fig. 5). The number of W3/25-positive cells in HgCl2-group increased at day 8 in T1-group. It continuously increased in T2-group, and kept higher value than that in Control-group throughout the experimental period (fig. 3c). In HgCl2+FK-and HgCl2+Dxgroups, interstitial infiltration of W3/25-positive cells was
inhibited, and the number of W3/25-positive cells in these two groups was almost the same as that in Control-group. Although the absolute number was slightly different, kinetics of OX-8-positive cells (CD8 positive T lymphocyte) in three groups were almost similar to that of W3/25-positive cells in these three groups (figs. 3d and 6).
Fig. 6. Immunohistochemical staining for OX-8 in HgCl2 only-group (a), HgCl2+FK-group (b) and HgCl2+Dx-group (c) at day 16 in T2-group. The number of W3/25-positive cells in HgCl2 only-group (a) is larger than that in HgCl2+FK- (b) and HgCl2+Dx-groups (c). ×200.
Fig. 7. Immunohistochemical staining for α-SMA in HgCl2 only-group (a, d), HgCl2+FK-group (b, e) and HgCl2+Dxgroup (c, f) at day 8 in T1-group (a, b, c) and at day 4 in T2-group (d, e, f), respectively. In T1-group, the number of αSMA positive cells found in tubulointerstitium is small in HgCl2+FK- (b) and HgCl2+Dx (c) groups compared with HgCl2 only-group (a). On the other hand, in T2-group, many α-SMA positive cells are observed in HgCl2 only- (d) and HgCl2 +Dx (f) groups, but not in HgCl2 +FK-group (e). ×125. 202
Exp Toxic Pathol 55 (2003) 2–3
Fig. 8. mRNA levels of fibrosis-related factors. TIMP-1 (a), TIMP-2 (b), TIMP-3 (c), uPA (d), PAI-1 (e) and TGF-β1 (f). : HgCl2+FK group, : HgCl2+Dx group, : Control group. *: p < 0.05 Significantly differ: HgCl2 only-group, ent from HgCl2-group, +: p < 0.05 Significantly different from Control-group. Exp Toxic Pathol 55 (2003) 2–3
203
Kinetics of α-SMA-positive cells in renal interstitium Spindle-shaped α-SMA-positive cells were found around the tubules which showed degenerative or regenerative epithelial changes in the cortico-medullary junction (fig. 7). In HgCl2 only-group, the number of αSMA-positive cells significantly increased at day 4 and 8 in T1-group and decreased thereafter (fig. 3b). In HgCl2+FK-group, the number of α-SMA-positive cells transiently increased at day 4 and decreased thereafter (fig. 3b). The level was significantly lower than that in HgCl2-group. In contrast to the HgCl2+FK-group, the number of α-SMA-positive cells in HgCl2+Dx-group was significantly higher than that in HgCl2-group in T2group, especially at day 4 (fig. 3b).
Kinetics of fibrosis-related factors TIMPs: In T1-group, the expression of TIMP-1 mRNA increased at day 4 and gradually decreased thereafter in HgCl2 only-, HgCl2+FK-, and HgCl2+Dx-groups, and its degree was almost the same among these three groups at each timepoint (Fig. 8a). In T2-group, the expression of TIMP-1 mRNA was kept higher level, and there was no difference among three groups. On the other hand, the expressions of TIMP-2 and TIMP-3 mRNAs did not change throughout the experimental period, and there was no difference among the three groups (figs. 8b and 8C). Plasmin-dependent pathway: uPA mRNA expression was not changed throughout the experimental period, and there was no significant difference among all groups (fig. 8d). On the other hand, the level of PAI-1 mRNA expression in HgCl2 only-group in T1-group peaked at day 8 and decreased thereafter (Fig. 8e). However, it was significantly high throughout the experimental period. In HgCl2+FK-group, the expression of PAI-1 mRNA was also upregulated, but its degree was less than that in HgCl2 only-group. In HgCl2+Dx group, although the level of PAI-1 mRNA expression in T1-group was almost the same as that in Control-group at day 4, it increased gradually at and after day 8 and became higher than that in HgCl2 only-group in T2-group. Transforming growth factor (TGF)-β1: The level of TGF-β1 mRNA expression in HgCl2-group was highest at day 8 in T1-group and it maintained higher value than that in Control-group (fig. 8f). In HgCl2+FK and HgCl2+Dx groups, the level of TGF-β1 mRNA expression was also higher than that in Control-group, but it was lower than that in HgCl2-group. Moreover, the level of TGF-β1 mRNA expression in HgCl2+Dx-group was slightly higher than that in HgCl2+Dx-group throughout the experimental period.
Discussion In this study, we investigated the effects of FK and Dx on the development of tubulointerstitial fibrosis in mer204
Exp Toxic Pathol 55 (2003) 2–3
curic chloride-treated BN rats. The histological changes in HgCl2 only-group were same as those reported in our previous paper (SUZUKI et al. 1998). In the HgCl2+FKgroup, regenerative tubular epithelia were prominent at day 4 in T1-group. Effected renal tubules immediately recovered to normal-appearing ones at day 8 and peritubular fibrosis was not observed in T2 group. FK is an immunosuppressant and known to be 100-times potent in inhibiting T cell activation, cytotoxic T cell generation, and cytokine production than cyclosporin A (BIERER et al. 1990). FK is also reported to be nephrotoxic (STILLMAN et al. 1995). On the other hand, some recent studies reported its protective effects against toxin- or ischemiamediated injuries and glomerulosclerosis (SAKR et al. 1990; FARGHALI et al. 1991a; FARGHALI et al. 1991b; VAN THIEL et al. 1992; HAMAR et al. 2001). Based on these reports, it can be speculated that FK may hasten recovery and protect the kidney from nephrotoxicity induced by repeated mercuric chloride injection and following peritubular fibrosis in this model. On the other hand, in HgCl2+Dx-group, although early tubular lesions were delayed, peritubular fibrosis was prominent in T2-group and fibrosis was somewhat more severe than in the HgCl2 only-group. Dx is a glucocorticoid steroid and has multiple and complex effects on immune responses and inflammation. Large doses of glucocorticoids cause nephrotoxity (JEVNIKAR et al. 1992; CHEN et al. 1998), and Dx is also said to accelerate fibrogenesis in liver fibrosis model induced by common bile duct ligation induced (MELGERT et al. 2001). Dx at the dose level of 1 mg/kg b.w. in the present study seems to produce nephrotoxicity especially after repeated mercuric chloride injection and accelerate peritubular fibrosis. The number of W3/25-positive lymphocytes in HgCl2 only-group increased at day 8 in T1-group. In T2-group, it increased continuously and kept higher levels than that in Control-group throughout the experimental period. In HgCl2+FK-and HgCl2+Dx-groups, interstitial infiltration of W3/25-positive lymphocytes was inhibited and the number of W3/25-positive lymphocytes was almost the same as that in Control-group. Although the absolute number was slightly different, kinetics of OX-8-positive lymphocytes in three groups were almost similar to that of W3/25-positive lymphocytes. The suppression of lymphocyte infiltration in HgCl2+FK-and HgCl2+Dx-groups seems to be due to their inhibitory effect on immunity as previous reported (WENNBERG et al. 2001; HAMAR et al. 2001). However, HgCl2+FK- and HgCl2+Dx-groups showed opposite results as to renal fibrosis. Therefore, it is reasonable to consider that lymphocytes infiltrated in interstitium may not essentially contribute to the development of renal fibrosis in this model. The number of ED1-positive macrophages in HgCl2 only-group peaked at day 8 in T1-group, and it showed more prominent increase in T2-group. In HgCl2 +FK-and HgCl2+Dx-groups in T1-group, it showed slight increase, but it was significantly fewer than that in HgCl2-
group. In T2-group, the number of ED1-positive macrophages in HgCl2+FK-group was significantly fewer than HgCl2-group, but the number in HgCl2+Dx-group showed transient and remarkable increase at day 4 and decreased thereafter. Essentially, FK and Dx are said to be able to reduce infiltration of macrophages as well as lymphocytes (WENNBERG et al. 2001; HAMAR et al. 2001). Indeed, as mentioned above, FK could reduce macrophage infiltration in all timepoints. Dx also reduced macrophage infiltration in T1-group, but it enhanced macrophage infiltration in T2-group, probably because of nephrotoxicity induced by high dose Dx. Therefore, its insufficient inhibition of macrophage infiltration may enhance renal fibrosis, because macrophages are one of the most inportant factors of renal interstitial fibrosis (DIAMOND et al. 1995; EDDY and GIACHELLI 1995; YAMATE et al. 1995; YAMATE et al. 1996; EDDY 1996; NAKATSUJI et al.1998). Kinetics of α-SMA-positive cells in three treated groups were almost the same as that of ED1-positive macrophages, except that at day 4 in T1-group. Thus, daily Dx injection increased the number of myofibloblast, and daily FK injection inhibited the increase in number of myofibroblast. However, it is still obscure whether these effects are direct or indirect to target cells. In this regard, it was suggested that fibroblasts were activated into α-SMA-positive myofibroblasts by TGF-β1 secreted from macrophages infiltrated into interstitium (DIAMOND et al. 1995; TAMAKI et al. 1994). From these findings, the effect of these drugs on the number of αSMA-positive cells may be indirect through macrophage infiltration. The plasmin-dependent pathway is one of the important matrix metalloproteinases (MMPs) regulatory pathway. In this process, an activation of latent MMPs is regulated by the balance of PAs and PAIs expressions (KRUITHOF et al. 1988; DUYMELINCK et al. 1997). In HgCl2+FK-group, uPA mRNA expression was not changed, and the expression of PAI-1 mRNA was significantly upregulated but its degree was less than that in HgCl2-group. Taking into consideration that PAI-1 mRNA was localized in regenerative tubular epithelial cells in our previous study (SUZUKI et al. 2001) and tubular injury was moderate in HgCl2+FK group, FK may have an inhibitory effect on the expression of PAI-1 mRNA. In contrast to HgCl2+FK-group, the expression of PAI-1 mRNA in HgCl2+Dx-group was upregulated at and after day 8 in T1-group. In addition, in T2-group, it was higher than that in HgCl2-group. Some in vitro studies showed that Dx induced the PAI-1 mRNA in rat hepatocytes and osteoblasts (FUKUMOTO et al. 1992; UNO et al. 1998). So, the above-mentioned upregulation of PAI1 mRNA may be resulted from synergistic effect of mercuric chloride and Dx. As mentioned above, in comparison with the expression of uPA mRNA, the expression of PAI-1 mRNA was predominant in all treated groups, especially in HgCl2 only- and HgCl2+Dx-groups showing peritubular fibrosis. In our previous study, we specu-
lated that PAI-1 may be one of the important fibrogenetic factors as a regulator of MMPs activity (SUZUKI et al. 2001). So, the present report may support our previous speculation. TIMPs, a well-known MMP inhibitor, also have an important effect on the regulation of MMPs activity. In this study, the expression of TIMP-1 mRNA was increased, but the expressions of TIMP-2 and TIMP-3 mRNA were not significantly changed in HgCl2-group. This result was in accordance with the results of previous studies (EDDY 1996; SUZUKI et al. 2001). In HgCl2+FKand HgCl2+Dx-groups, the expression of TIMP-1 mRNA was increased, but the expressions of TIMP-2 and TIMP-3 mRNA showed no changes. The levels of TIMP-1 mRNA showed no significant differences among three groups. Therefore, it was considered that FK and Dx might not have any effects on the expressions of TIMPs mRNAs. In contrast, MELGERT et al. (2001) suggested that Dx accerated fibrogenesis with an induction of TIMP-1 mRNA. TGF-β1 is considered as the most important fibrosis promoting cytokine, and has multiple roles in fibrosis. Namely, it increases synthesis of extracellular matrix, decreases production of MMPs and increases production of TIMPs (KUNCIO et al. 1991; MULLER et al. 1991; ROBERTS et al. 1992; SHARMA et al. 1995). In this study, it seems that FK and Dx did not have any effects on mercuric chloride-induced upregulation of TGF-β1 mRNA expression. In previous reports, FK was said to reduce the expression of TGF-β1 mRNA and decrease the rate of interstitial fibrosis and glomerulosclerosis (JAIN et al. 2000; BICKNELL et al. 2000; HAMAR et al. 2001). On the other hand, it was reported that Dx enhanced the expression of TGF-β1 mRNA in in vivo study (KARIM et al. 1997), but it inhibit in in vitro study (MELGERT et al. 2001), while Dx enhanced the expressions of other fibrosis-related factors in both studies. From these findings, it is suggested that FK and Dx might have an effect on TGF-β1-independent fibrogenetic mechanism. In conclusion, it was suggested that FK reduced mononuclear cell infiltration in renal interstitium, and also inhibited renal fibrosis through the reduction in the expression and/or number of almost all fibrosis-related factors, especially macrophage infiltration. On the other hand, Dx reduced lymphocyte infiltraton, but did not inhibit macrophage infiltration and fibrosis. These findings indicated the importance of macrophages in the development of mercuric chloride-induced renal interstitial fibrosis in BN rats.
References BICKNELL GR, WILLIAMS ST, SHAW JA, et al.: Differential effect of cyclosporin and tacrolimus on the expression of fibrosis-associated genes in isolated glomeruli from renal transplants. Br J Surg 2000; 87: 1569–1575. Exp Toxic Pathol 55 (2003) 2–3
205
BIERER BE, SCHREIBER SL, BURAKOFF SJ: Mechanism of immunosuppression by FK 506. Transplantation 1990; 49: 1168–1202. BOHLE A, BADER R, GRUND KE, et al.: Serum creatinine concentration and interstitial volume. Analysis of concentrations in endocapillary (acute) glomerulonephritis. Virchow Arch A 1977a; 375: 87-96. BOHLE A, GLOMB D, GRUND KE, et al.: Correlations between relative interstitial volume of the renal cortex and the serum creatinine concentration in minimal change with nephrotic syndrome and in focal sclerosing glomerulonephritis. Virchow Arch A 1977b; 376: 221–232. CHEN A, SHEU LF, HO YS, et al.: Administration of dexamethasone induces proteinuria of glomerular origin inmice. Am J Kidney Dis 1998; 31: 443–452. D’AMICO G: Influence of clinical and histological features on actuarial renal survival in adult patients with iopathic IgA nephropathy, membranous nephropathy, and membrano-proliferative glomerulonephritis. Survey of recent literature. Am J Kidney Dis 1992; 20: 315–323. DIAMOND JR, VAN GOOR H, DING G, et al.: Myofibroblasts in experimental hydronephrosis. Am J Pathol 1995; 146: 121–129. DUYMELYNC C, DEBG JT, DAUWE SHE, et al.: Inhibition of the matrix metalloproteinase system in a rat model of chronic cyclosporine nephropathy. Kidney Int 1998; 54: 804–818. EDDY AA, GIACHELLI CM: Interstitial inflammation and fibrosis in rats with diet-induced hypercholesterolemia. Kidney Int 1995; 47: 1546–1557. EDDY AA: Molecular insights into renal interstitial fibrosis. J Am Soc Nephrol 1996; 7: 2495–2508. FARGHALI H, SAKR ME, GASBARRINI A, et al.: A biochemical and 31p-NMR investigation of the effect of FK506 and cyclosporin pretreatment of immobilized hepatocytes perfused with ethanol. Transplant Proc 1991a; 23: 2805–2808. FARGHALI H, GASBARRINI A, BORLE AB, et al.: FK506 modulates D-galactosamine-induced hepatitis in rats. Transplant Proc 1991b; 23: 2809–2811. FARGHALI H, GASBARRINI A, NALESNIK MA, et al.: FK506 is a hepatoprotective agent in animals with experimental chemically induced hepatitis. Hepatology 1991c; 14: 162A. FISCHBACH H, MACKENSEN S, GRUND KE, et al.: Relationship between glomerular lesions, serum creatinine concentration and interstitial volume in membrano-proliferative glomerulonephritis. Klin Wochenschr 1977; 55: 603–608. FUKUMOTO S, ALLAN EH, ZEHEB R, et al.:Glucocorticoid regulation of plasminogen activator inhibitor-1 messenger ribonucleic acid and protein in normal and malignant rat osteoblasts. Endocrinology 1992; 130: 797–804. HAMAR P, PETI-PETERDI J, SZABO A, et al.: Interleukin-2dependent mechanisms are involved in the development of glomerulosclerosis after partial renal ablation in rats. Exp Nephrol 2001; 9: 133–141. HIRSCH F, COUDERC J, SAPIN C, et al.: Polyclonal effect of HgCl2 in the rat, its possible role in an experimental autoimmune disease. Eur J Immunol 1982, 12: 620–625. 206
Exp Toxic Pathol 55 (2003) 2–3
JAIN S, BICKNELL GR, NICHOLSON ML: Tacrolimus has less fibrogenic potential than cyclosporin A in a model of renal ischaemia-reperfusion injury. Br J Surg 2000; 87: 1563–1568. JEVNIKAR AM, SINGER GG, BRENNAN DC, et al.: Dexamethasone prevents autoimmune nephritis and reduces renal expression of Ia but not costimulatory signals. Am J Pathol 1992; 141: 743–751. KARIM MA, FRIZZELL S, INMAN L, et al.: In vivo role of glucocorticoids in barotrauma vascular repair and fibrosis. J Mol Cell Cardiol 1997; 29: 1111–1122. KRUITHOF EKO: Plasminogen activator inhibitors: A review. Enzyme 1988; 40: 113–121. KUNCIO GS, NEILSON EG, HAVERTY T: Mechanisms of tubulointerstitial fibrosis. Kidney Int 1991; 39: 550–556. MELGERT BN, OLINGA P, VAN DER LAAN JMS, et al.: Targeting dexamethasone to kupffer cells: Effects on liver inflammation and fibrosis in rats. Hepatology 2001; 34: 719–728. MULLER GA, MARKOVIC-LIPKOVSKI J, RODEMANN HP: The progression of renal diseases: On the pathogenesis of renal interstitial fibrosis. Klin Wochenschr 1991; 69: 576–586. NAKATSUJI S, YAMATE J, SAKUMA S: Macrophages, myofibroblast, and extracellular matrix accumulation in interstitial fibrosis of choronic progressive nephropathy in aged rats. Vet Pathol 1998; 35: 352–360. RISDON RA, SLOPER JC, WARDENER HE: Relationship between renal funtion and histologic changes found in renal biopsy specimens from patients with persistent glomerular nephritis. Lancet 1968; 2: 363–366. ROBERTS AB, MCCUNE BK, SPORNN MB: TGF-β: Regulation of extracellular matrix. Kidney Int 1992; 41: 557–559. SAKR ME, HASSANEIN TI, ZETTI GM, et al.: FK506 ameliorates the hepatic injury associated with ischemia. Life Sci 1990; 47: 687–691. SAPIN C, DRUET E, DRUET P: Induction of anti-glomerular basement membrane antibodies in the Brown Norway rat by mercuric chloride. Clin Exp Immunol 1977; 28: 173–179. SHARMA AK, MAUER SM, KIM Y, et al.: Altered expression of matrix metalloproteinase-2, TIMP, TIMP-2 in obstructive nephropathy. J Lab Clin Med 1995; 125: 754–761 SUZUKI K, UETSUKA K, NAKAYAMA H, et al.: Renal tubulointerstitial lesions in mercuric chloride-treated Brown Norway rats. J Toxicol Pathol 1998; 11: 241–247. SUZUKI K, UETSUKA K, NAKAYAMA H, et al.: Kinetics of transforming growth factor-β1 and extracellular matrix in renal tubulointerstitial lesions in mercuric chloridetreated Brown Norway rats. Int J Exp Path 1999; 80: 125–132. SUZUKI K, NAKAYAMA H, DOI K: Kinetics of matrix metalloproteinases and their regulatory factors in mercuric chloride-induced tubulointerstitial fibrosis in Brown Norway rats. Exp Toxic Pathol 2001; 53: 337–343. STILLMAN IE, ANDOH TF, BURDMANN EA, et al.: FK506 nephrotoxicity: morphologic and physiologic characterization of rat model. Lab Inv 1995; 73: 794–803. TAMAKI K, OKUDA S, ANDO T, et al.: TGF-β in glomerulosclerosis and interstitial fibrosis of adriamycin nephropathy. Kidney Int 1994; 45: 525–536.
UNO S, NAKAMURA M, OHOMAGARI Y, et al.: Regulation of tissue-type plasminogen activator (tPA) and type-1 plasminogen activator inhibitor (PAI-1) gene expression in rat hepatocytes in primary culture. J Biochem 1998; 123: 806–812. VAN THIEL DH, SAKR M, ZETTI G, et al.: FK 506 reduces the injury experienced following renal ischemia and reperfusion. Ren Fail 1992; 14: 285–288. WEHMANN M, BOHLE A, BOGENSCHUTZ O, et al.: Longterm prognosis of chronic idiopathic membranous glomerulonephritis. An analysis of 334 cases with particular regard to tubulo-interstitial changes. Clin Nephrol 1989; 31: 67–76.
WENNBERG L, CZECH KA, LARSSON LC, et al.: Effects of immunosuppressive treatment on host responses against intracerebral porcine neural tissue xenografts in rats. Transplantation 2001; 71: 1797–1806. YAMATE J, TATSUMI M, NAKATSUJI S, et al.: Immunohistochemical observations on the kinetics of macrophages and myofibroblasts in rat renal interstitial fibrosis induced by cis-diamminedichloroplatinum. J Comp Pathol 1995; 112: 27–39. YAMATE J, ISHIDA A, TSUJINO K, et al.: Immunohistochemical study of rat renal interstitial fibrosis induced by repeated injection of cisplatin, with special reference to the kinetics of macrophages and myofibroblasts. Toxicol Pathol 1996; 24: 199–206.
Exp Toxic Pathol 55 (2003) 2–3
207