Effects of the bisphosphonate ibandronate on hyperalgesia, substance P, and cytokine levels in a rat model of persistent inflammatory pain

Available online at www.sciencedirect.com

European Journal of Pain 12 (2008) 284–292 www.EuropeanJournalPain.com

Effects of the bisphosphonate ibandronate on hyperalgesia, substance P, and cytokine levels in a rat model of persistent inflammatory pain Mauro Bianchi a,*, Silvia Franchi a, Paolo Ferrario a, Maria Luisa Sotgiu b, Paola Sacerdote a b

a Department of Pharmacology, University of Milano, Via Vanvitelli 32, 20129 Milano, Italy Institute of Bioimages and Molecular Physiology, CNR, Via Fratelli Cervi 93, 20090 Segrate, Italy

Received 27 March 2007; received in revised form 29 May 2007; accepted 14 June 2007 Available online 30 July 2007

Abstract The anti-inflammatory and analgesic properties of different bisphosphonates have been demonstrated in both animal and human studies. Ibandronate is a third-generation bisphosphonate effective in managing different types of bone pain. In this study we investigated its effects in a standard pre-clinical model of inflammatory pain. We evaluated the effects of a single injection of different doses (0.5, 1.0, and 2.0 mg/kg i.p.) of ibandronate on inflammatory oedema and cutaneous hyperalgesia produced by the intraplantar injection of complete Freund’s adjuvant (CFA) in the rat hind-paw. In addition, we measured the effects of this drug (1.0 mg/ kg i.p.) on hind-paw levels of different pro-inflammatory mediators (PGE-2, SP, TNF-a, and IL-1b). We also measured the levels of SP protein and of its mRNA in the ipsilateral dorsal root ganglia (DRG). Ibandronate proved able to reduce the inflammatory oedema, the hyperalgesia to mechanical stimulation, and the levels of SP in the inflamed tissue as measured 3 and 7 days following CFA-injection. This drug significantly reduced the levels of TNF-a and IL-1b only on day 7. On the other hand, the levels of PGE-2 in the inflamed hind-paw were unaffected by the administration of this bisphosphonate. Finally, ibandronate blocked the overexpression of SP mRNA in DRG induced by CFA-injection in the hind-paw. These data help to complete the pharmacodynamic profile of ibandronate, while also suggesting an involvement of several inflammatory mediators, with special reference to substance P, in the analgesic action of this bisphosphonate. Ó 2007 European Federation of Chapters of the International Association for the Study of Pain. Published by Elsevier Ltd. All rights reserved. Keywords: Hyperalgesia; Ibandronate; Interleukin-1; Prostaglandin E2; Substance P; Tumor necrosis factor-a

1. Introduction In the last few years bisphosphonates have become important in the management of pain in patients with metastatic cancer or affected by postmenopausal osteoporosis (Emkey et al., 2005; Body, 2006). Ibandronate * Corresponding author. Tel.: +39 02 50316930; fax: +39 02 50316949. E-mail address: [email protected] (M. Bianchi).

is a third-generation, nitrogen-containing, bisphosphonate which has been shown to inhibit osteoclast-mediated bone resorption in women with postmenopausal osteoporosis, and to prevent skeletal-related events, improve quality of life, and reduce pain in patients with metastatic bone disease (Body et al., 2004; Heidenreich and Ohlmann, 2004; Cameron et al., 2006; Croom and Scott, 2006). Several studies have shown that bisphosphonates of the first and the second-generation such as alendronate, clodronate and pamidronate, can exert

1090-3801/$32 Ó 2007 European Federation of Chapters of the International Association for the Study of Pain. Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.ejpain.2007.06.005

M. Bianchi et al. / European Journal of Pain 12 (2008) 284–292

analgesic effects in experimental animals (Goicoechea et al., 1999; Bonabello et al., 2001; Bonabello et al., 2003). Some data are available on the anti-nociceptive effects of the third-generation bisphosphonate zoledronic acid in rodents (Walker et al., 2002). The effects of ibandronate in animal models of persistent pain, however, have yet to be investigated in detail. The mechanism by which bisphosphonates may decrease pain is largely unknown. In fact, the main effect of all the drugs belonging to this pharmacological family, including ibandronate, is to reduce bone resorption by inhibiting osteoclast function (Fleisch, 1991; Russell and Rogers, 1999; McCormack and Plosker, 2006). This biological action, however, does not fully explain their analgesic efficacy. In particular, the rapid appearance of pain relief after the administration of ibandronate in patients with bone disease from breast cancer (Heidenreich et al., 2004) suggests a possible dissociation between the analgesic and the metabolic effects of this compound. Some anti-inflammatory effects of different bisphosphonates, including ibandronate, have been investigated in a few number of studies (Santini et al., 2004; Bauss and Body, 2005; Toussirot and Wendling, 2005; Yamamoto et al., 2006). Nevertheless, the possible anti-inflammatory action of ibandronate is still controversial (Zysk et al., 2003). For all these reasons, we thought it would be of interest to explore in the present study the effects of ibandronate using an animal model of prolonged noxious stimulation in which a single injection of complete Freund’s adjuvant (CFA) in the hind-paw caused inflammatory hyperalgesia (Stein et al., 1988 ). In addition to investigating the effects of this drug on inflammatory oedema and mechanical hyperalgesia, we measured the changes in the hind-paw levels of prostaglandin E-2 (PGE-2), substance P (SP), tumor necrosis factor-a (TNF) and interleukin-1b (IL-1). Finally, we evaluated the changes in SP production in primary afferent sensory neurons following the administration of ibandronate in normal and inflamed animals.

2. Methods 2.1. Animals Male Sprague Dawley albino rats (Charles River, Calco, Italy) weighing between 200 and 250 g were used. The animals were housed 4 to a cage, at 22 ± 2 °C with a light-dark cycle of 12/12-h and free access to water and food. The rats were allowed to habituate to the housing facilities for 1 week before the experiments began. Behavioural studies were carried out in a quiet room between 10.00 and 12.00. Eight rats were used in each experimental group.

285

All procedures were approved by the Department of Pharmacology of the University of Milan Animal Care and Use Committee and followed the ethical guidelines for the treatment of animals of the International Association for the Study of Pain (Zimmermann, 1983). All efforts were made to minimize the number of animals and their suffering. 2.2. Induction of inflammation and drug treatments Peripheral inflammation was induced by the injection of a suspension of 0.1 mg/0.1 ml complete Freund’s adjuvant (CFA) containing heat-killed and dried mycobacterium tuberculosis (H37Ra, ATCC 25177) in 85% paraffin oil and 15% mannide monooleate into the plantar surface of the left hind-paw. Control animals were injected with 0.1 ml of saline in the left hind-paw. Ibandronate ([1-hydroxy-3-(methylpentylamino)propylidene]bis-phosphonic acid) was supplied by Roche Diagnostics GmbH, Mannheim, Germany. The drug was dissolved in saline and administered by intraperitoneal route (i.p.) in a volume of 0.2 ml/100 g bw. The drug injection was performed 1 h after the paw injection of CFA. Control animals were treated i.p. with the same volume of saline. In the first set of experiments (evaluation of the effects on inflammatory oedema and hyperalgesia), ibandronate was administered at the doses of 0.5, 1.0 and 2.0 mg/kg. For the further studies (evaluation of the effects on tissue levels of different inflammatory mediators), the dose of 1.0 mg/kg of ibandronate was chosen. 2.3. Evaluation of inflammatory oedema and hyperalgesia The intensity of inflammatory oedema and hyperalgesia was measured on day 1, 2, 3 and 7 after the intraplantar injection of CFA or saline. The paw swelling (oedema) was assessed by measuring the volume of both hind-paws by a plethysmometer (7150 Plethysmometer, Basile, Comerio, Italy). The results are expressed as the algebraic difference between the volume (ml) of inflamed (CFA-injected) and normal (saline-injected) hind-paw. The Randall-Selitto paw-withdrawal test, which uses mechanical force as nociceptive stimulus, was used to measure inflammatory hyperalgesia. The stimulus was applied with an analgesymeter (Basile, Comerio, Italy) which generates a linearly increasing mechanical force, applied by a conical piece of plastic with a dome-shaped tip on the dorsal surface of the rat’s hind-paw. The animals were gently held and incremental pressure (maximum 250 g) was applied onto the dorsal surface of the hind-paw. The thresholds represent the pressure (expressed in grams) at which the animal withdrew its hind-paw. The results are expressed as the algebraic difference between the thresholds measured on the right and left (inflamed) hind-paw.

286

M. Bianchi et al. / European Journal of Pain 12 (2008) 284–292

The observer was blind to treatment allocation of the animals. 2.4. Measurement of PGE -2, SP, TNF-a and IL-1b in paw skin On days 3 and 7 following the intraplantar injection of CFA or saline the animals were killed by decapitation and the entire hind-paw skin was removed. The tissue samples were weighed, frozen on dry ice and stored at 70 °C until further processing for PGE-2, SP, TNF, and IL-1 measurements (Bianchi et al., 2004). Alter homogenization of skin tissue in phosphate buffered saline (PBS), PGE-2 extraction and purification was performed using a solid phase method utilizing 100 mg Amprep C18 minicolumns (GE Healthcare, Cologno Monzese, Italy). The samples were eluted in ethyl acetate, and evaporated to dryness in a Savant Vacuum Centrifuge apparatus. Quantitative determination of PGE-2 was performed by the enzyme immunoassay using a commercially available EIA kit (GE Healthcare, Cologno Monzese, Italy). The sensitivity of the PGE-2 EIA kit was 50 pg/ml. For the measurements of SP skin samples were homogenized in 2 ml of 0.1 N acetic acid, centrifuged at 10 000g and stored at 70 °C. SP was measured by radioimmunoassay (RIA) using antiserum and methods previously described and validated (Bianchi et al., 2004). The antibody was raised in rabbit against synthetic SP, and it is directed towards the C terminal of the peptide. I125–SP was purchased from GE Healthcare (Cologno Monzese, Italy). Sensitivity of the RIA was 10 pg/tube and intra-assay and inter-assay variation coefficient were 8% and 11%, respectively. For TNF and IL-1 evaluation skin samples were homogenized in 2 ml of phosphate buffered saline pH 7.4 (PBS) containing 10 mM EDTA and 20 KIU/ml aprotinin (Sigma, Milano, Italy). After centrifugation at 10 000g the supernatants were frozen at 70 °C . TNF and IL-1 were measured by mean of ELISA kit specific for rat TNF (Bender Medsystem, Prodotti Gianni, Italy) and for the mature form of rat IL-1b (eBioscience, Societa` Italiana Chimici, Italy). All the ELISA procedures were performed according to the manufacturer’s instructions. The standards were recombinant cytokine curves generated in doubling dilutions from 2500 to 39 pg/ml. 2.5. Removal of dorsal root ganglia (DRG) Three and 7 days after CFA-injection animals were anaesthetized with sodium pentobarbital (60 mg/kg, i.p., 0.2 ml/100 g bw). L4, L5 and L6 DRG ipsilateral to the CFA-injected hind-paw were removed under dissecting microscope, immediately frozen in liquid nitro-

gen and stored at 80°C until the SP protein content and preprotachykinin gene expression measurement. For the evaluation of SP levels, DRG were homogenized in 0.25 ml 0.1 N acetic acid, and the peptide measured as described above for paw skin. 2.6. RNA isolation and real-time RT-PCR Total RNA from DRG was purified using TRIzol reagent (Invitrogen, Life Technologies, San Giuliano Milanese, Italy) according to the manufacturer’s instructions and resuspended in 6 ll of formamide. After purification, total RNA concentrations were determined from the sample absorbance value at 260 nm. 3000 ng of total RNA were treated with DNase (DNA-freeAmbion) to avoid false-positive results due to amplification of contaminating genomic DNA. First strand cDNA was synthesized from 1000 ng of total RNA in a final volume of 20 ll using M-MLV RT (Moloney Murine Leukemia Virus Reverse Transcriptase; Invitrogen, San Giuliano Milanese, Italy). cDNA (2 ll) was subjected to real-time quantitative PCR using ABI PRISM 7000 (Applied Biosystems, Forster City, CA). TaqMan PCR was performed in 25 ll volumes using Real Master Mix Probe ROX (Eppendorf, Hamburg, Germany). Custom probes were prepared by Applied Biosystem. The probes were designed to span an intron in order to avoid potential amplification of contaminated DNA in the analyzed samples (Lu et al., 2005) The probes were labelled at the 5 0 end with 6-carboxy fluorescicein (FAM) and at the 3 0 end with 6-carboxy-tetramethyl rhodamine (TAMRA). Table 1 shows the primers and probe sequence for preprotachykinin (PPT, Genbank accession number M15191) and GAPDH (Genbank accession number AF106860). All PCR assays were performed in triplicate. Before using the DDCT method for relative quantification, we performed a validation experiment to demonstrate that the efficiencies of target and reference are equal. The reaction conditions were as follows: 95°C for 2 min, followed by 40 cycles at 95 °C for 15 s (denaturation) and 60 °C for 1 min (annealing and elongation). As controls, we used the reaction mixture without the cDNA. Threshold cycle numbers (CT) were determined with an ABI PRISM 7000 Sequence Detection System (version 1.1 software) and transformed using the DC T ð2DDCT Þ comparative method. Gene-specific expression values were normalized to expression values of GAPDH (endogenous control) within each sample. The levels of preprotachykinin were expressed relative to the calibrator value control group. Relative quantification was performed using the comparative method. The amount of target, normalized to an endogenous reference and relative to a calibrator, is given by 2DDCT . Briefly, the DCT value is determined by subtracting the average GAPDH CT value from the

M. Bianchi et al. / European Journal of Pain 12 (2008) 284–292

287

Table 1 Primers/probe sequence used in the real-time quantitative RT-PCR to analyse transcription levels of SP mRNA

Probes (5 0 FAM-3 0 TAMRA)

Primers 0

0

Substance P

Sense 5 -AAGTTTGCCAGCGATGCAA-3 Antisense 5 0 -AACCAAGGGAAGCGAAAGA-3 0

ACAGGAGTTTCTCTGCCTCCAGCAGCA

GAPDH

Sense 5 0 -AATGTATCCGTTGTGGATCTGACA-3 0 Antisense 5-AGCCCAGGATGCCCTTTAGT-3 0

TCGGCCGCCTGCTTCACCA

average cytokines CT in the same sample. The calculation of DDCT involves subtraction of the DCT calibrator value. 2.7. Statistical analysis Data were analyzed by one way analysis of variance (ANOVA), followed by Bonferroni’s t-test for multiple comparison. An effect was determined to be significant if the P-value was less than 0.05.

3. Results 3.1. Effects of ibandronate on inflammatory oedema and mechanical hyperalgesia The injection of CFA into hind-paw caused a marked increase in paw volume (oedema), associated with a decrease in the paw-withdrawal latency to noxious mechanical stimulation Both the inflammatory oedema and hyperalgesia were evident at 1, 2, 3 and 7 days after CFA-injection. Fig. 1, left panel, shows that the oedema formation was significantly reduced by ibandronate 1.0

and 2.0 mg/kg, while the dose of 0.5 mg/kg was not effective. This drug effect was evident starting from the third day after treatment and was similarly maintained at the 7th day after ibandronate administration. The effect of ibandronate on inflammatory hyperalgesia is shown in the right panel of Fig. 1. The CFA-induced mechanical hyperalgesia was significantly reduced by ibandronate 1.0 and 2.0 mg/kg, while no significant difference was identified between the values measured in animals treated with ibandronate 0.5 mg/kg and those measured in rats treated with saline. The anti-hyperalgesic effect of ibandronate was evident starting from the third day after treatment and was already present 7 days after treatment. It is important to note that we previously established that, at these doses (0.5, 1.0, and 2.0 mg/kg), ibandronate did not affect nociceptive thresholds to mechanical stimulation in the normal (uninflamed) hind-paws (data not shown). 3.2. Effects of ibandronate on inflammatory mediators in the paw In the first set of experiments we demonstrated that the doses of 1.0 and 2.0 mg/kg were similarly effective

Fig. 1. Left panel: Effect of ibandronate (0.5, 1.0, and 2.0 mg/kg i.p.) on the inflammatory oedema induced by the hind-paw injection of CFA. Ibandronate (IBN) or saline were administered 1 h after CFA-injection. Data are expressed in ml, as mean ± SEM of the algebraic difference between the volume of inflamed (CFA-injected) and uninflamed (saline-injected) hind-paw. Right panel: Effect of ibandronate (0.5, 1.0, and 2.0 mg/kg i.p.) on the inflammatory hyperalgesia induced by the hind-paw injection of CFA. Ibandronate (IBN) or saline were administered 1 h after CFA-injection. The evaluation was performed by Randall-Selitto Test. Data are expressed in grams, as mean ± SEM of the algebraic difference between thresholds measured in saline-injected and CFA-injected (inflamed) hind-paw. * = P < 0.05 vs CFA + saline.

288

M. Bianchi et al. / European Journal of Pain 12 (2008) 284–292

in reducing inflammatory oedema and hyperalgesia. In the light of this observation and of the information that clinically relevant renal damage in rat was not noted after the i.v. administration of ibandronate at a dose of 1.0 mg/kg (Pfister et al., 2003), we decided to perform the following studies on inflammatory mediators with the lowest effective dose, i.e. 1.0 mg/kg. At this dose, ibandronate did not affect the PGE-2 levels in the skin of saline-injected hind-paws. As expected, CFA-injection caused a significant increase in PGE-2tissue concentrations. The administration of ibandronate to animals with inflamed paw did not modify PGE-2 levels increased by CFA-injection (Fig. 2). The injection of CFA caused a clear increase in SP levels in the paw both at 3 and 7 days after the induction of the inflammation (Fig. 3). This change in SP levels was completely prevented at both time points by the treatment with ibandronate. No significant effect of this drug on SP was observed in the paw of non-inflamed animals. Fig. 4 shows the results regarding the paw concentrations of TNF and IL-1. When administered to animals intraplantarly injected with saline, ibandronate had no effect either on the TNF or IL-1 levels. The injection of CFA produced a significant increase in the skin content of both cytokines in the ipsilateral paw. This effect of CFA was evident at 3 and 7 days post-injection. The administration of ibandronate to CFA-treated animals did not to modify cytokine concentrations as measured 3 days after CFA-injection. On the other hand, at 7 days after the induction of the inflammation in animals treated with ibandronate the paw skin levels of TNF and IL1 resulted significantly lower than those measured in the inflamed paw of rats treated with saline.

Fig. 3. Effect of ibandronate (1.0 mg/kg i.p.) on the increase of SP tissue levels produced by CFA-injection into the hind-paw of rats. Control animals were treated intraplantarly and i.p. with saline. Ibandronate or saline were administered 1 h after intraplantar injection of CFA or saline. The measurements were performed 3 and 7 days after CFA-injection. Values are means ± SEM of eight rats. * = P < 0.05 vs controls; # = P < 0.05 vs CFA + saline.

3.3. Ibandronate effect on SP and preprotachykinin mRNA levels in DRG To assess the possible effect of ibandronate on SP production in primary afferent sensory neurons, ipsilateral L3-5 DRG were collected 3 and 7 days after CFAinjection in the hind-paw. Both SP protein and its mRNA were evaluated. No significant differences were present in SP protein content in DRG obtained from rats intraplantarly treated with saline or CFA, and the administration of ibandronate did not modify SP either in control or in inflamed animals (Table 2). Fig. 5 shows the fold increase in preprotachykinin gene expression in DRG compared with control animals (i.e. not inflamed animals treated with saline). A slight but significant increase in preprotachykinin expression was observed in DRG obtained from CFA-treated animal; this effect was present both at 3 and 7 days after the induction of the inflammation. The administration of ibandronate completely prevented the overexpression of SP mRNA induced by CFA, while did not affect SP mRNA levels in animals injected intraplantarly with saline.

4. Discussion

Fig. 2. Effect of ibandronate (1.0 mg/kg i.p.) on the increase of PGE-2 tissue levels produced by CFA-injection into the hind-paw of rats. Control animals were treated intraplantarly and i.p. with saline. Ibandronate or saline were administered 1 h after intraplantar injection of CFA or saline. The measurements were performed 3 and 7 days after CFA-injection. Values are means ± SEM of eight rats.

Ibandronate is a potent and long acting bisphoshonate, highly effective in the treatment of osteoporosis and pain associated with metastatic bone disease (Body et al., 2004; Heidenreich and Ohlmann, 2004; Cameron et al., 2006; Croom and Scott, 2006). In the present study we have shown that this drug is able to reduce inflammatory oedema and hyperalgesia in a rat model

M. Bianchi et al. / European Journal of Pain 12 (2008) 284–292

289

Fig. 4. Effect of ibandronate (1.0 mg/kg i.p.) on the increase of TNF (left panel) and IL-1 (right panel) tissue levels produced by CFA-injection into the hind-paw of rats. Control animals were treated intraplantarly and i.p. with saline. Ibandronate or saline were administered 1 h after intraplantar injection of CFA or saline. The measurements were performed 3 and 7 days after CFA-injection. Values are means ± SEM of eight rats. * = P < 0.05 vs controls; # = P < 0.05 vs CFA + saline.

Table 2 SP protein content in DRG SP (pg/lg protein) Controls Ibandronate CFA + saline CFA + ibandronate

3 days 0.152± 0.04 0.162 ± 0.06 0.210± 0.05 0.200 ± 0.05

7 days 0.161 ± 0.02 0.154 ± 0.05 0.220 ± 0.06 0.190 ± 0.013

Control animals were treated intraplantarly and i.p. with saline. Ibandronate or saline were administered 1 h after the intraplantar injection of CFA or saline. Three and 7 days after hind-paw CFA administration, L4, L5 and L6 DRG ipsilateral to the CFA-injected hind-paw were removed, and pooled. Values are mean ± SEM of eight rats.

Fig. 5. Effect of ibandronate (1.0 mg/kg i.p.) on the increase of preprotachykinin mRNA expression in ipsilateral DRG produced by CFA-injection into the hind-paw of rats. Control animals were treated intraplantarly and i.p. with saline. Ibandronate or saline were administered 1 h after intraplantar injection of CFA or saline. The measurements were performed 3 and 7 days after CFA-injection. Results are expressed as preprotachykinin mRNA expression in relation to GADPH, and are presented as a fold increase relative to control animals. Values are means ± SEM of four rats. * = P < 0.05 vs controls; # = P < 0.05 vs CFA + Ibandronate.

of persistent pain. These effects became evident on the third day after the administration of a single dose of ibandronate on the same day as the induction of inflam-

mation, and proved long lasting; in fact, they were still evident one week after drug administration. It is well known that a major problem associated with the clinical use of bisphosphonates is related to their renal toxicity (Adami and Zamperlan, 1996). The renal safety of these drugs depends on the dose and the dosing interval. It is therefore important to point out that we have demonstrated significant anti-inflammatory effects after the treatment with a dose of ibandronate (1.0 mg/kg) which has been reported to not induce clinically relevant nephrotoxicity after i.v. administration in the rat (Pfister et al., 2003). As previously noted, this fact also determined our choice to perform all the biochemical studies with this dose of ibandronate. Although there is no clear relation of this dose to the doses used in humans, it is important to stress that ibandronate accumulates in bone after repeated dosing (Bauss et al., 2004). Thus, in the clinical setting, repeated doses cause high concentrations in bone. Part of the bone-bound drug is released during bone turnover, and in consequence results in a high concentration in the bone environment. In order to simulate such high concentrations in our short-term animal model, we administered a single high dose. Bone concentration of ibandronate is more relevant for the actions of this drug since serum levels decrease fast due to the short half-life of ibandronate in both rats and humans (Barrett et al., 2004). Peripheral inflammatory pain is associated with a complex pattern of local changes. Following tissue injury many pro-nociceptive and pro-inflammatory mediators are activated; they lower nociceptive thresholds and increase neuronal membrane excitability, leading to hypernociception (Woolf, 1991; Cunha et al., 2005). Among these, the neuropeptide SP is present in C-fibres, is synthesized in DRG, and is transported to both central and peripheral endings of primary afferent neurons (Maggi, 1995). In the spinal cord, it has excitatory effects on dorsal horn neurons producing an

290

M. Bianchi et al. / European Journal of Pain 12 (2008) 284–292

increase in nociception. Moreover, SP is released antidromically in the inflamed tissue, where it sustains the so-called neurogenic inflammation (Maggi, 1995; White, 1997). In periphery, SP is able to sensitise afferent fibres and increase the sensitivity to nociceptive stimuli. In addition, SP can directly activate immune cells inducing the chemotaxis of monocytes/macrophages, and the production of different pro-inflammatory cytokines (Bianchi et al., 2003; Delgado et al., 2003; Bianchi et al., 2004). It has been reported that more than 80% of SP synthesized by DRG neurons is being exported towards the terminal endings in periphery rather than to the central nervous system (Maggi, 1995; White, 1997). In this study, we observed a clear increase in SP release in the CFA-inflamed paw, associated with a significant increase of the expression of PPT I gene, that encodes for SP mRNA (Krause et al., 1984; Lu et al., 2005), in the L4-6 DRG corresponding to the afferents from the inflamed hind-paw. Rather surprisingly, we did not find any increase in SP peptide levels in DRG of rats injected with CFA in the hind-paw. This may reflect a dynamic interplay between the production of the peptide and its transport from the soma; one possible explanation is that following an intense nerve stimulation, as happens during persistent inflammation, the newly synthesized peptide is rapidly transported along the axon and rapidly released in periphery. Our present data suggest an important involvement of SP in the anti-hyperalgesic effect of ibandronate. In fact, this bisphosphonate completely abolished the increase in SP synthesis and release induced by CFAinjection in the hind-paw. It this context, it is important to stress that antidromically released SP is able to recruit neutrophils and monocytes into inflamed tissue, and to stimulate lymphocytes, mast cells, and macrophages to produce various cytokines, including IL-1 and TNF (Delgado et al., 2003; Hernanz et al., 2003). These cytokines can either directly sensitise nociceptors, or induce the release of other pro-inflammatory and pro-nociceptive mediators (Safieh-Garabedian et al., 1995; Marchand et al., 2005). Interestingly, IL-1 has been reported to regulate SP production in DRG (Morioka et al., 2002); therefore a positive loop between SP and cytokines is active in the maintenance and perpetration of inflammatory hyperalgesia. After CFA-injection we observed a significant increase in paw IL-1 and TNF levels that was prevented by the administration of ibandronate. However, the cytokine increase was already evident 3 days after CFA, whereas ibandronate was able to reduce it only on day 7. Therefore, an overall analysis of our findings appears to suggest that the ibandronateinduced decrease in SP may have an impact on the production of IL-1 and TNF in the hind-paw. It has been suggested that some bisphosphonates may directly modulate the production of cytokines from monocyte/macrophages, either increasing (Pioli et al.,

1990; Takagi et al., 2005) or decreasing them (Dehghani et al., 2004; Selander et al., 1996). Although we cannot rule out a direct effect of ibandronate on cytokine production, it is important to note that we did not observe any effect of ibandronate on cytokine production in the absence of an inflammatory state. In this study, the increase in PGE-2 hind-paw levels induced by CFA-injection was not affected by the treatment with ibandronate. This observation suggests that this drug does not interact with the cyclooxygenase (COX) enzymes, and is in accordance with findings recently published showing that several bisphosphonates do not interfere either with COX-1 or COX-2 activity (Tuominen et al., 2006). With regard to the effects of ibandronate on SP, the mechanisms by which this bisphosphonate may produce a decrease in SP production remains to be clarified. It has recently been suggested that the activation of osteoclasts in CFA-induced paw inflammation plays a role in nociceptor sensitisation (Nagae et al., 2006). Osteoclasts localized in the inflamed paw, indeed, may secrete protons and make the microenvironment acidic. It is well known that two classes of acid-sensing nociceptors are present in sensory neurons: the acid-sensing ion channels (ASICS) and the transient receptor potential channel vanilloid member (TRPV1) (Rhee and Kress, 2001). TRPV-1 can be activated directly by hydrogen ions. TRPV-1 activation promotes inflammation mediated by SP in several animal models (Tognetto et al., 2001; Dinh et al., 2004; Hutter et al., 2005; Kanai et al., 2005). It can therefore be hypothesised that ibandronate, by inhibiting osteoclastic activity, might prevent proton production by these cells, and reduce the activation of specific ion channels and the consequent production of SP by primary afferents. The role of the nervous system in regulating bone biology is now emerging, and a number of anatomical and physiological evidences demonstrate the presence of sensory SP containing nerve in the bone (Bjurholm et al., 1988; Hukkanen et al., 1992; Fras et al., 2003; Goto and Tanaka, 2002). The rich innervation of periosteum by SP positive fibres further supports the notion of a role for this peptide in bone pain. A body of data exists showing that bone malignancies induce peripheral and central sensitisation of the nervous system. A critical link between inflammation and cancer has been described, and several pro-inflammatory mediators, including TNF and IL-1, have been identified to exert a crucial role in the development of hyperalgesia (Clohisy and Mantyh, 2003; Aggarwal et al., 2006). Moreover, it has been demonstrated that osteoclastic bone resorption is associated with an inflammatory state adjacent to bone (Nagae et al., 2006). In view of all these findings, the ability of ibandronate to reduce inflammatory hyperalgesia, and to inhibit the mechanisms activated by tachykinins and cytokines in inflammatory

M. Bianchi et al. / European Journal of Pain 12 (2008) 284–292

conditions may contribute to explain the reduction of pain observed after treatment with this bisphosphonate in patients with osteoporosis and cancer pain associated with metastatic bone disease.

References Adami S, Zamperlan S. Adverse effects of bisphosphonates. Drug Saf 1996;14:158–70. Aggarwal BB, Shishodia S, Sandur SK, Pandey MK, Sethi G. Inflammation and cancer: How hot is the link? Biochem Pharmacol 2006;72:1605–21. Barrett J, Worth E, Bauss F, Epstein S. Ibandronate: a clinical pharmacological and pharmacokinetic update. J Clin Pharmacol 2004;44:951–65. Bauss F, Body J. Ibandronate in metastatic bone disease: a review of preclinical data. Anti-cancer Drugs 2005;16:107–18. Bauss F, Graham R, Russell G. Ibandronate in osteoporosis: preclinical data and rationale for intermittent dosing. Osteoporos Int 2004;15:423–33. Bianchi M, Broggini M, Balzarini P, Baratelli P, Ferrario P, Panerai AE, et al. Effects of tramadol on synovial fluid concentrations of substance P and interleukin-6 in patients with knee osteoarthritis: comparison with paracetamol. Int Immunopharmacol 2003;3:1901–8. Bianchi M, Martucci C, Biella G, Ferrario P, Sacerdote P. Increased substance P and tumor necrosis factor alpha in the paws following formalin injection in rat tail. Brain Res 2004;1019:255–8. Bjurholm A, Kreicbergs A, Brodin E, Schultzberg M. Substance Pand CGRP-immunoreactive nerves in bone. Peptides 1988;9:165–71. Body JJ. Breast cancer: bisphosphonates therapy for metastatic bone disease. Clin Cancer Res 2006;12:6258s–63s. Body JJ, Diel IJ, Lichinitzer M, Lazarev A, Pecherstorfer M, Bell R, et al. Oral ibandronate reduces the risk of sletal complications in breast cancer patients with metastatic bone disease: results from two randomizes, placebo-controlled phase III studies. Br J Cancer 2004;90:1133–7. Bonabello A, Galmozzi MR, Bruzzese T, Zara GP. Analgesic effect of bisphosphonates in mice. Pain 2001;91:269–75. Bonabello A, Galmozzi MR, Canaparo R, Serpe L, Zara GP. Longterm analgesic effect of clodronate in rodents. Bone 2003: 567–574. Cameron D, Fallon, Diel I. Ibandronate: its role in metastatic breast cancer. Oncologist 2006;11(Suppl. 1):27–33. Clohisy DR, Mantyh PW. Bone cancer pain. Cancer 2003;97:866–73. Croom KF, Scott LJ. Intravenous ibandronate in the treatment od osteoporosis. Drugs 2006;66:1593–601. Cunha TM, Verri WA, Silva JS, Poole S, Cunha FQ, Ferreira SH. A cascade of cytokines mediates mechanical inflammatory hypernociception in mice. Proc Natl Acad Sci 2005;102:1755–60. Dehghani F, Conrad A, Kohl A, Korf HW, Hailer NP. Clodronate inhibits the secretion of proinflammatory cytokines and NO by isolated microglial cells and reduces the number of proliferating glial cells in excitotoxically injured hippocampal slice cultures. Exp Neurol 2004;186:241–51. Delgado AV, Mc Manus AT, Chambers JP. Production of tumor necrosis factor – alpha, interleukin-1b, interleukin-2 and interleukin-6 by rat leukocytes subpopulation after exposure to substance P. Neuropeptides 2003;37:355–61. Dinh QT, Groneberg DA, Peiser C, Mingomataj E, Joachim RA, Witt C, et al. Substance P expression in TRPV-1 and trkA-positive dorsal root ganglion neurons innervating the mouse lung. Respir Physiol Neurobiol 2004;144:15–24.

291

Emkey R, Koltun W, Beusterien K, Seidman L, Kivitz A, Devas V, et al. Patient preference for once-monthly ibandronate versus once-weekly alendronate in a randomized, open-label, cross-over trial: the Boniva Alendronate Trial in Osteoporosis (BALTO). Curr Med Res Opin 2005;21:1895–903. Fleisch H. Bisphosphonates: pharmacology and use in the treatment of tumor induced hypercalcaemic and metastatic bone disease. Drugs 1991;42:919–44. Fras C, Kravetz P, Mody DR, Heggeness MH. Substance P containing nerve within the human vertebral body: an immunohistochemical study of the basivertebral nerve. Spine 2003;3:63–7. Goicoechea C, Porras E, Alfaro MJ, Martin MI. Alendronate induces antinociception in mice, not related with its effects in bone. Jpn J Pharmacol 1999;79:433–7. Goto T, Tanaka TM. Tachykinin and tachykinin receptors in bone. Microsc Res Tech 2002;58:91–7. Heidenreich A, Ohlmann CH. Ibandronate: its pharmacology and clinical efficacy in the management of tumor-induced hypercalcemia and metastatic bone disease. Expert Rev Anticancer Ther 2004;4:991–1005. Heidenreich A, Ohlmann C, Body JJ. Ibandronate in metastatic bone pain. Semin Oncol 2004;31(Suppl. 10):67–72. Hernanz A, Medina S, de Miguel E, Martin-Mola E. Effect of CGRP, neuropeptide Y, substance P and vasoactive intestinal peptide on Interleukin-1 beta, interleukin-6 and tumor necrosis factor-alpha production by peripheral whole blood cells from rheumatoid arthritis and osteoarthritis patients. Regul Pept 2003;115:19–24. Hukkanen M, Konttinen YT, Rees RG, Santavirta S, Terenghi G, Polak JM. Distribution of nerve ending and sensory neuropeptides in rat synovium, meniscus and bone. Int J Tissue React 1992;14:1–10. Hutter MM, Wick EC, Day AL, Maa J, Zerega EC, Richmond AC, et al. Transient receptor potential vanilloid (TRPV-1) promotes neurogenic inflammation in the pancreas via activation of the neurokinin-1 receptor. Pancreas 2005;30:260–5. Kanai Y, Nakazato E, Fujiuchi A, Hara T, Imai A. Invovement of an increased spinal TRPV-1 sensitization throughout its upregulation in mechanical allodynia of CCI rats. Neuropharmacology 2005;49:977–84. Krause JE, Chirgwin JM, Carter MS, Xu ZS, Hershey AD. Three rat preprotachikinin mRNAs encoded the neuropeptide SP and neurokinin A. Proc Natl Acad Sci USA 1984;84:881–5. Lu CL, Pasricha PJ, Hsieh JC, Lu RH, Lai CR, Wu LL, et al. Changes of the neuropeptides content and gene expression in spinal cord and dorsal root ganglion after noxious colorectal distension. Reg Pept 2005;131:66–73. Maggi CA. Tachykinins and calcitonin gene related peptide (CGRP) as co-trasmitters released from peripheral endings of sensory nerves. Prog Neurobiol 1995;45:1–98. Marchand F, Perretti M, Mc Mahon SB. Role of the immune system in chronic pain. Nat Rev Neurosci 2005;6:521–31. McCormack PL, Plosker GL. Ibandronic acid: a review of its use in the treatment of bone metastases of breast cancer. Drugs 2006;66:711–28. Morioka N, Takeda K, Kumagai K, Hanada T, Ikoma K, Hide I, et al. Interleukin-1b-induced substance P release from rat cultured primary afferents neurons driven by two phospholipase A2 enzymes: secretory type IIA and cytosolic type IV. J Neurochem 2002;80:989–97. Nagae M, Hiraga T, Wakabayashi H, Wang L, Iwara K, Yoneda T. Osteoclasts play a part in pain due to inflammation adjacent to bone. Bone 2006;39:1107–15. Pfister T, Atzpodien E, Bauss F. The renal effects of minimally nephrotoxic doses of ibandronate and zoledronate following single and intermittent intravenous administration in rats. Toxicology 2003;191:159–67.

292

M. Bianchi et al. / European Journal of Pain 12 (2008) 284–292

Pioli G, Hughes DE, Milan A, Aarden L, Meager A, Chapman K. Bisphosphonates stimulate the production of cytokines by human peripheral blood mononuclear cells in vitro. Calcif Tissue Int 1990;46:A54. Rhee PW, Kress M. Molecular physiology of proton transduction in nociceptors. Curr Opin Pharmacol 2001;1:45–51. Russell RG, Rogers MJ. Bisphosphonates: from the laboratory to the clinic and back again. Bone 1999;25:97–106. Safieh-Garabedian B, Poole S, Allchorn A, Winter J, Woolf C. Contribution of IL-1 beta to the inflammation-induced increase in nerve growth factor levels and inflammatory hyperalgesia. Br J Pharmacol 1995;115:1265–75. Santini D, Fratto ME, Vincenzi B, La Cesa A, Dianzani C, Tonini G. Bisphosphonate effects in cancer and inflammatory diseases. In vitro and in vivo modulation of cytokine activities. Biodrugs 2004;18:269–78. Selander KS, Monkkonnen J, Karhukorpi EK, Harkonen P, Hannuniemi R, Vaananen HK. Characteristics of clodronate-induced apoptosis in osteoclasts and macrophages. Mol Pharmacol 1996;50:1127–38. Stein C, Millan MJ, Herz A. Unilateral inflammation of the hindpaw in rats as a model of prolonged noxious stimulation: alterations in behavior and nociceptive thresholds. Pharmacol Biochem Behav 1988;31:445–51. Takagi K, Takagi M, Kanangat S, Warrington KC, Shigemitsu H, Postlewaite A. Modulation of TNF-alpha gene expression by IFNgamma and pamidronate in murine macrophages: regulation by STAT1 dependent pathways. J Immunol 2005;174:1801–10.

Tognetto M, Amadesi S, Harrison S, Creminon C, Trevisani M, Carreras M, et al. Anandamide excites central terminals of dorsal root ganglion neurons via vanilloid receptor-1 activation. J Neurosci 2001;21:1104–9. Toussirot E´, Wendling D. Bisphosphonates as anti-inflammatory agents in ankylosing spondylitis and spondylarthropathies. Expert Opin Pharmacother 2005;6:35–43. Tuominen OM, Ylitalo-heikkala R, Vehmas TI, Mucha I, Ylitalo P, Riutta A. Effect of bisphosphonates on prostaglandin E2 and tromboxane B2 production in human whole blood and monocytes stimulated by lipopolysaccaride and A23187. Methods Find Exp Clin Pharmacol 2006;28:361–7. Walker K, Medhurst SJ, Kidd BL, Glatt M, Bowes M, Patel S, et al. Disease modifying and anti-nociceptive effects of the bisphosphonate, zoledronic acid in a model of bone cancer pain. Pain 2002;100:219–29. White DM. Release of substance P from peripheral sensory nerve terminals. J Peripher Nerv Syst 1997;2:191–201. Woolf CJ. Generation of acute pain. Br Med Bull 1991;47:523–33. Yamamoto K, Yoshino S, Shue G, Nagashima M. Inhibitory effect of bone resorption and inflammation with etidronate therapy in patients with rheumatoid arthritis for 3 years and in vitro assay in arthritis models. Rheumatol Int 2006;26:627–32. Zimmermann M. Ethical guidelines for investigation of experimental pain in conscious animals. Pain 1983;16:109–10. Zysk SP, Du¨rr HR, Gebhard HH, Schmitt-Sody M, Refior HJ, Messmer K, et al. Effects of ibandronate on inflammation in mouse antigen-induced arthritis. Inflamm Res 2003;52:221–6.