- Email: [email protected]
Effects of Xiangsha Liujunzi decoction drug serum on gastric antrum smooth muscle cells from rats with functional dyspepsia by regulating gastrointestinal hormones
Journal of Traditional Chinese Medical Sciences xxx (xxxx) xxx
Contents lists available at ScienceDirect
Journal of Traditional Chinese Medical Sciences journal homepage: www.elsevier.com/locate/jtcms
Effects of Xiangsha Liujunzi decoction drug serum on gastric antrum smooth muscle cells from rats with functional dyspepsia by regulating gastrointestinal hormones Ning Dai a, Jinghong Hu a, Yan Liu a, Dongyu Ge a, Ruijuan Dong a, Fengzhi Wu b, Jiaojiao Yu a, Mindan Chen a, Deborah C. Ma c, Feng Li a, *, 1 a b c
School of Traditional Chinese Medicine, Beijing University of Chinese Medicine, Beijing, 100029, China Journal Center, Beijing University of Chinese Medicine, Beijing, 100029, China Roots & Needles Acupuncture Inc, San Diego, 92121, USA
a r t i c l e i n f o
a b s t r a c t
Article history: Received 26 November 2019 Received in revised form 11 January 2020 Accepted 12 January 2020 Available online xxx
Objective: To observe the effect and mechanism of Xiangsha Liujunzi decoction (XSLJZD) drug serum on gastric antrum smooth muscle cells (SMCs) in rats with functional dyspepsia (FD). Methods: Gastric antrum SMCs from rats with FD were isolated, cultured, and then divided into six groups as follows: control, model, domperidone, low-dose XSLJZD (LXSLJZD), medium-dose XSLJZD (MXSLJZD), and high-dose XSLJZD (HXSLJZD). Each group was administered the corresponding drug serum for intervention. Drug serum intervention conditions and proliferative activity of SMCs were tested by cholecystokinin octapeptide. Ghrelin, gastrin, somatostatin, and substance P (SP) levels were measured by ELISA. Somatostatin and SP mRNA expression was measured by real-time PCR. Results: A concentration of 10% drug serum for 24 h was decided to be the best intervention condition for later study. The mean optical density value in the model group was lower than that in the control group (P ¼ .001). Optical density values in the domperidone and HXSLJZD groups were higher than those in the model group (P ¼ .025, P ¼ .032, respectively). Gastrin, SP, and ghrelin levels in the model group were lower (P ¼ .007, P ¼ .037, P ¼ .005, respectively), but somatostatin levels were higher, compared with those in the control group (P ¼ .031). Gastrin, SP, and ghrelin levels in the domperidone, MXSLJZD, and HXSLJZD groups were higher than those in the model group (all P<.05). Somatostatin levels in the four drug-treated groups were lower than those in the model group (P ¼ .002, P ¼ .007, P ¼ .001, P ¼ .009, respectively). SP mRNA levels in the model group were lower than those in the control, domperidone, MXSLJZD, and HXSLJZD groups (P ¼ .037 P ¼ .016, P ¼ .025, P ¼ .002, respectively). Somatostatin mRNA levels in the model group were higher than those in the control and MXSLJZD groups (P ¼ .042, P ¼ .035). Conclusions: XSLJZD and domperidone drug serum effectively promote proliferative activity of gastric antrum SMCs in an FD model. The mechanism of this activity may be regulated by gastrointestinal hormones. © 2020 Beijing University of Chinese Medicine. Production and hosting by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Keywords: Functional dyspepsia Xiangsha Liujunzi decoction Gastrointestinal hormones Gastric antrum Smooth muscle cells
Introduction Functional dyspepsia (FD) is characterized by postprandial fullness, early satiation, epigastric pain, and epigastric burning that
* Corresponding author. E-mail address: [email protected] (F. Li). Peer review under responsibility of Beijing University of Chinese Medicine. 1 Present address: School of Traditional Chinese Medicine, Beijing University of Chinese Medicine, Beijing 100029, China
persist for at least 3 months according to the Rome IV diagnostic criteria.1 FD is becoming a severe health issue worldwide, with a prevalence varying between 10% and 30%.2,3 Although there is no changes in organs, these uncomfortable symptoms have a serious effect on patients with FD. Additionally, FD incurs a heavy economic burden. FD costs more than $18 billion in patients in the USA.4 Delayed gastric emptying or antral dysmotility is considered to be the main cause of these dyspepsia symptoms in patients with FD.5 Previous research has shown that gastrointestinal hormones, such as gastrin, ghrelin, somatostatin, and substance P (SP), are
https://doi.org/10.1016/j.jtcms.2020.01.007 2095-7548/© 2020 Beijing University of Chinese Medicine. Production and hosting by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http:// creativecommons.org/licenses/by-nc-nd/4.0/).
Please cite this article as: Dai N et al., Effects of Xiangsha Liujunzi decoction drug serum on gastric antrum smooth muscle cells from rats with functional dyspepsia by regulating gastrointestinal hormones, Journal of Traditional Chinese Medical Sciences, https://doi.org/10.1016/ j.jtcms.2020.01.007
2
N. Dai et al. / Journal of Traditional Chinese Medical Sciences xxx (xxxx) xxx
Table 1 Primer sequences of SP, somatostatin, and GAPDH.
Table 2 Gastric emptying and small intestinal propulsion rates.
Name
Primer Sequences(5’-3’)
Gene Bank Number
Length(bp)
Results
Control group
Model group
SP
F: ACTGGTCCGACAGTGACCAAATC R: CCCGTTTGCCCATTAATCCA F:GACCCCAGACTCCGTCAGTT R:GGCATCGTTCTCTGTCTGGTT F: GGCACAGTCAAGGCTGAGAATG R: ATGGTGGTGAAGACGCCAGTA
NM_012666.2
1049
Gastric emptying rate Small intestinal propulsion rate
0.5928 (0.1004)△△ 0.7197 (0.0623)△△
0.4552 (0.0698) 0.3740 (0.07748)
NM_012659
564
NM_017008.4
1306
SS GAPDH
Note: F: forward primer; R: reverse primer; NM: number.
associated with gastric motility.6e10 Currently, FD can be treated by conventional medications, including acid suppressive drugs, prokinetic agents, and antidepressants. Despite these treatments, treatment of FD is not satisfactory.11 Xiangsha Liujunzi decoction (XSLJZD), which originates from ancient and modern medical theory, can relieve symptoms of patients with FD.12e15 The occurrence of adverse events with XSLJZD is not significantly different from pharmacotherapy.16 A previous study showed that XSLJZD reduced gastric sensitivity and increased food intake in rats with FD.17 However, the mechanism of action is unclear. Modern research shows the trend of the overall level to the cellular level. Gastric peristalsis is derived from contraction of smooth muscle cells (SMCs) in the stomach wall. Activity of smooth muscle movement is affected by factors, such as neurotransmitters, gastrointestinal hormones, and drugs. In vitro culture of cells is useful for studying cellular function and the corresponding cellular signal transduction mechanism. Therefore, we studied the effect of XSLJZD on gastric antrum SMCs in rats with FD and its mechanism. This study aimed to provide a reference for drug targets for FD. Methods Ethics approval The experiments were performed in accordance with the Guide for the Care and Use of Laboratory Animals published by the National Institutes of Health (NIH Publications No.85-23, revised 1996) and followed the Beijing University of Chinese Medicine guidelines for the welfare of experimental animals, with the approval of the Animal Care Committee of Beijing Medical Center. The ethics committee protocol number was BUCM-4-2016102824-4024. Experimental animals We studied 20 male SpragueeDawley 7-day-old rat pups and their mothers and 75 male SpragueeDawley rats (200 ± 20 g), which were raised in the SPF level animal house, with a 12-h rhythm, 22 C, and 60%e70% humidity. Each mother provided breast milk for four rat pups in a cage. The female and male rats ate complete nutritional palletized feed and drank water freely (SPF Laboratory Animal Technology Co., Ltd., Beijing, China). Modeling We created a rat model of FD with iodoacetamide (IA) and the modified multiple platform method.18 Twenty 7-day-old rats were raised for 3 days. We randomly divided 10-day-old rats into the control group and IA group. The control group (n ¼ 8) received 0.2 mL of 2% sucrose and the IA group (model group, n ¼ 12) received 0.2 mL of 0.1% IA in 2% sucrose daily for 6 days. During this period, these rats consumed breast milk and the mothers ate food and drank water freely. After this time, the rats were raised normally. When the rats were 3 weeks old, they were separated from
Note: DDP<.01 compared with the model group. Data are shown as mean (SD).
their mothers and divided into different cages. When the rats were 6 weeks old, except for rats in the control group, those in the IA group were placed in a multiple platform box (18:00e8:00 h) for 14 days. The water in the box was changed every day and water temperature was maintained at 22 C. Drugs XSLJZD consists of ginseng, Largehead Atractylodes Rh (Atractylodes macrocephala), Indian Buead Tuckahoe (Poria cocos), liquorice root (Glycyrrhiza uralensis), Tangerine Peel (Pericarpium Citri Reticulatae Blanco), Pinellia ternate (Pinelliae Rhizoma), villous amomum fruit (Amomum villosum), and Aucklandia lappa (Aucklandiae Radix). These drugs, which were provided by the Pharmaceutical Department of China Academy of Chinese Medical Sciences Xiyuan Hospital, were dissolved in deionized water. Separating and cultivating gastric antrum SMCs of model rats After modeling, we randomly chose four model rats and prevented them from eating for 24 h. The rats were anesthetized, sacrificed by cervical dislocation, and soaked in 75% alcohol for 15 min. We separated and cultivated gastric antrum SMCs of FD rats according to Li.19 When cells grew to a dense single layer, they were passed on. The experiments started when cells were passed on to the third generation. Preparation of drug-containing serum Healthy male SD rats were randomly divided into five groups as follows: control (n ¼ 15, same volume of deionized water), domperidone (n ¼ 15, 0.3 g/kg), low-dose XSLJZD (LXSLJZD) (n ¼ 15, 1.25 g/kg), medium-dose XSLJZD (MXSLJZD) (n ¼ 15, 2.5 g/kg), and high-dose XSLJZD (HXSLJZD) (n ¼ 15, 5 g/kg). These rats received corresponding drugs continuously for 7 days. They were then anesthetized and blood from the abdominal aorta was sampled after last does 2 h. The blood was kept for 6 h at 4 C and then centrifuged (3000 r/minute for 20 min). We separated serum and mixed the serum of same group rats. The serum was inactivated in a 56 C water bath for 30 min and filtered with a 0.22-mm filter for sterilization. The serum was kept in a 80 C refrigerator after transferring to 1.5-mL tubes.20 Measurement of the gastric emptying rate Control and model group rats were not allowed to eat for 24 h after modeling. After this time, each of the rats received a black semisolid pasty mixture (3 mL). This mixture consisted of sodium carboxymethyl cellulose 10 g, milk powder 16 g, sugar 8 g, starch 8 g, activated carbon powder 2 g, and 250 mL of distilled water. Fifty minutes later, we anesthetized the rats and opened their abdominal cavity immediately. The rats’ cardia and pylorus were tightened, and the stomach was separated and weighed. We cut the stomach along the greater gastric curvature, cleaned it with normal saline, dried it with filter paper, and weighed its net weight. We calculated the gastric emptying rate according to the following formula21:
Please cite this article as: Dai N et al., Effects of Xiangsha Liujunzi decoction drug serum on gastric antrum smooth muscle cells from rats with functional dyspepsia by regulating gastrointestinal hormones, Journal of Traditional Chinese Medical Sciences, https://doi.org/10.1016/ j.jtcms.2020.01.007
N. Dai et al. / Journal of Traditional Chinese Medical Sciences xxx (xxxx) xxx
3
Fig. 1. HE staining results of gastric pathology in the control and model groups. Note: Tissue sections were viewed at 40 magnification.
gastric emptying rate (%) ¼ [1(gastric full weight-gastric net weight)/gavage amount] 100%
of advancement. The small intestine propulsion rate (%) was calculated as the carbon powder front distance/small intestine overall length 100%.
Measurement of the small intestine propulsion rate Hematoxylin and eosin staining We opened the rat abdominal cavity, separated the mesentery, and cut out the intestinal canal from the pylorus to the ileocecal valve and put it on a glass pane without tractive effort. We measured the distance from the pylorus to the leading edge of the charcoal and its full length, and recorded the ratio as the percentage
After sampling abdominal aorta blood, the stomach was separated, fixed with 10%formalin solution, and embedded in paraffin. Tissue was subsequently cut in 6-mm sections. The sections were dehydrated in gradient alcohol, counterstained with hematoxylin,
Please cite this article as: Dai N et al., Effects of Xiangsha Liujunzi decoction drug serum on gastric antrum smooth muscle cells from rats with functional dyspepsia by regulating gastrointestinal hormones, Journal of Traditional Chinese Medical Sciences, https://doi.org/10.1016/ j.jtcms.2020.01.007
4
N. Dai et al. / Journal of Traditional Chinese Medical Sciences xxx (xxxx) xxx
Fig. 2. Effect of XSLJZD drug serum intervention on rat gastric antrum SMCs. Note: (A) OD values at 24 h in cells that were treated with 2.5%, 5%, 10%, 15%, and 20% drug serum in the six groups (B) OD values at 48 h in cells that were treated with 2.5%, 5%, 10%, 15%, and 20% drug serum in the six groups (C) OD values at 72 h in cells that were treated with 2.5%, 5%, 10%, 15%, and 20% drug serum in the six groups
Please cite this article as: Dai N et al., Effects of Xiangsha Liujunzi decoction drug serum on gastric antrum smooth muscle cells from rats with functional dyspepsia by regulating gastrointestinal hormones, Journal of Traditional Chinese Medical Sciences, https://doi.org/10.1016/ j.jtcms.2020.01.007
N. Dai et al. / Journal of Traditional Chinese Medical Sciences xxx (xxxx) xxx
dewaxed, and sealed with neutral resin. The sections were then observed by a microscope and images were acquired with a camera.
Table 3 Effect of XSLJZD drug serum on proliferative activity of gastric antrum SMCs.
XSLJZD drug serum intervention in gastric antrum SMCs of model rats Gastric antrum SMCs of model rats were vaccinated in 96-well plates and divided into the following six groups: control, model, domperidone, LXSLJZD, MXSLJZD, and HXSLJZD groups. We separately added medium with different concentrations of drug serum to every group after the cells were attached. We separately tested optical density (OD) values after 24, 48, and 72 h by the cholecystokinin octapeptide (CCK-8) test (Dojindo, Shanghai, China) according to the manufacturer’s instructions twice.
Effect of XSLJZD drug serum on proliferative activity of gastric antrum SMCs in model rats Gastric antrum SMCs of model rats were vaccinated in 96-well plates and divided into the following six groups: control, model, domperidone, LXSLJZD, MXSLJZD, and HXSLJZD groups. We added medium with 10% corresponding drug serum to each group after the cells were attached. We measured OD values after 24 h by the CCK-8 test according to the manufacturer’s instructions. We calculated the relative viability of cells according to the following formula: relative viability of cells ¼ OD value of each drug-treated group/OD value of the control group.
ELISA
5
Groups
OD value
Control group Model group Domperidone group LXSLJZD group MXSLJZD group HXSLJZD group
1.34 1.14 1.32 1.25 1.22 1.26
(0.06)△△ (0.08) (0.13)△ (0.12) (0.12) (0.07)△
Note: △△P<.01, △P<.05 compared with the model group. Data are shown as mean (SD).
Statistical analysis Data were analyzed with SPSS 20.0 software. Data are expressed as mean and standard deviation (SD). If data from two groups were normally distributed, they were analyzed with the Student’s test. If data from three groups were normally distributed, they were analyzed with one-way ANOVA. If data did not fit a normal distribution, a non-parametric test was used. P.05 was considered as a significant difference. Results Gastric emptying and small intestinal propulsion rates The gastric emptying and small intestinal propulsion rates are shown in Table 2. The gastric emptying and small intestinal propulsion rates in the model group were significantly lower than those in the control group (P ¼ .001, P<.001, respectively).
Gastric antrum SMCs of model rats were vaccinated in 96-well plates and divided into the following six groups: control, model, domperidone, LXSLJZD, MXSLJZD, and HXSLJZD groups. We added medium with 10% corresponding drug serum to every group after the cells were attached. Twenty-four hours later, we aspirated cells and centrifuged them (1000 r/minute for 5 min). The supernatant was kept in a 80 C refrigerator after transferring it to 1.5-mL tubes. Gastrin, ghrelin, somatostatin, and substance P levels were measured according to the ELISA kit instructions (Yidacheng, China, Beijing).
Hematoxylin and eosin staining
Real-time PCR
First, we separately added medium with different concentrations (2.5%, 5%, 10%, 15%, and 20%) of drug serum to every group after cells were attached and then measured OD values at 24 h. Cells that were treated with 2.5%, 5%, and 10% drug serum showed an increasing trend in OD values, while 10%, 15%, and 20% drug serum had an unstable effect on OD values in cells. The model group showed a downward trend and the other five groups showed an upward trend (Fig.2A). At 48 h, cells that were treated with 2.5%, 5%, and 10% drug serum showed an increasing trend in OD values, while 10%, 15%, and 20% drug serum had an unstable effect on cells. The model group showed a downward trend in OD values. OD values in the drug group initially decreased and then increased, while the other four groups showed an upward trend (Fig.2B). At 72 h, the effect of 2.5%, 5%, 10%, 15%, and 20% drug serum concentrations on OD values in cells was unstable. The control, LXSLJZD, and HXSLJZD groups showed a "up-slight drop-up" trend in OD
Gastric antrum SMCs of model rats were vaccinated in 96-well plates and divided into the following six groups: control, model, domperidone, LXSLJZD, MXSLJZD, and HXSLJZD groups. We added medium with 10% corresponding drug serum to every group after the cells were attached. Twenty-four hours later, we aspirated cells and cleaned them with preheated phosphate-buffered saline. We used real-time PCR to measure SP and somatostatin mRNA levels. We extracted total RNA using the Trizol Reagent Kit (Ambion, USA) and performed reverse transcription using a reverse transcription kit (Reveraid First Strand cDNA Synthesis Kit, Thermo Scientific). Reaction conditions were as follows: annealing for 65 C for 5 min, extension at 42 C for 60 min, and inactivation at 70 C for 5 min. Amplification conditions were as follows: 95 C for 30 s, 95 C 1, and 60 C for 30 s, for 40 cycles. Table 1 shows the primer sequences.
Hematoxylin and eosin (HE) staining results of gastric pathology in the control and model groups are shown in Fig.1. There were no changes in histomorphology of the stomach between the control and model groups. This finding indicated that modeling did not lead to structural changes in the stomach, consistent with the characteristics of functional diseases. XSLJZD drug serum intervention in gastric antrum SMCs of model rats
(D) OD values at 24 h in cells that were treated with 5%, 10% and 15% drug serum (E) OD values at 48 h in cells that were treated with 5%, 10%, and 15% drug serum (F) OD values at 72 h in cells that were treated with 5%, 10%, and 15% drug serum.
Please cite this article as: Dai N et al., Effects of Xiangsha Liujunzi decoction drug serum on gastric antrum smooth muscle cells from rats with functional dyspepsia by regulating gastrointestinal hormones, Journal of Traditional Chinese Medical Sciences, https://doi.org/10.1016/ j.jtcms.2020.01.007
6
N. Dai et al. / Journal of Traditional Chinese Medical Sciences xxx (xxxx) xxx
Table 4 Gastrointestinal hormones in gastric antrum SMC supernatant. Groups
SP
Control group Model group Domperidone group LXSLJZD group MXSLJZD group HXSLJZD group
1.71 1.55 1.91 1.85 1.80 1.78
SS (0.04)△ (0.07) (0.04)△△ (0.03)△△ (0.10)△△ (0.14)△△
222.75 270.76 195.30 207.14 180.13 210.10
GAS (17.71)△ (34.98) (28.86)△△ (27.38)△△ (14.91)△△ (11.12)△△
208.05 112.39 189.58 162.72 268.50 229.88
Ghrelin (12.67)△△ (17.83) (23.08)△ (37.13) (39.12)△△ (61.07)△△
2199.42 1342.26 1929.92 2115.28 2184.96 1984.34
(503.04)△△ (555.77) (415.05)△ (141.19)△ (278.27)△△ (761.02)△
Note: DDP<.01, DP<.05 compared with the model group. Data are shown as mean (SD). SP and somatostatin mRNA levels in gastric antrum SMCs.
values. OD values in the model group increased followed by a decrease. The domperidone group showed a trend in OD values of a fall, rise, fall, and then a rise, and these changes were large. The MXSLJZD group showed a trend in OD values of a fall and then a rise (Fig.2C). Therefore, 5% and 10% drug serum concentrations in rat gastric antral SMCs for 24 h had a better effect than the other conditions. On the basis of the above-mentioned results, we separately added medium with different concentrations (5%, 10%, and 15%) of drug serum to every group again after cells were attached. At 24 h, cells that treated with 5% and 10% drug serum concentrations showed a declining trend in OD values. However, 10% and 15% drug serum concentrations showed an increasing trend in OD values and the growth trend in each group was similar (Fig.2D). At 48 h, cells that were treated with 5%, 10%, and 15% drug serum concentrations showed an increasing trend in OD values. This increasing trend in OD values with 10% and 15% drug serum concentrations in the LXSLJZD and HXSLJZD groups was greater than that in the other groups (Fig.2E). At 72 h, 5%, 10%, and 15% drug serum concentrations showed an increase in OD values in all groups. However, the model group showed a significantly higher increase in OD values compared with the other five groups (Fig.2F). We decided that 10% drug serum for 24 h was the best intervention condition for later studies. Effect of XSLJZD drug serum on proliferative activity of gastric antrum SMCs in model rats Table 3 shows the effect of XSLJZD drug serum on proliferative
activity of gastric antrum SMCs in rats with FD. The mean OD value in the model group was significantly lower than that in the control group (P ¼ .001). The mean OD values in the domperidone and HXSLJZD groups were significantly higher than that in the model group (P ¼ .025, P ¼ .032, respectively). Gastrointestinal hormones in gastric antrum SMC supernatant Table 4 shows mean gastrin, ghrelin, SP, and somatostatin levels in gastric antrum SMC supernatant. Gastrin levels in the model group were significantly lower than those in the control group (P ¼ .007). Gastrin levels in the domperidone, MXSLJZD, and HXSLJZD groups were significantly higher than those in the model group (P ¼ .021, P<.001, P ¼ .002, respectively). Ghrelin levels in the model group were significantly lower than those in the control group (P ¼ .005). Ghrelin levels in the other four drug-treated groups were significantly higher than those in the model group (P ¼ .044, P ¼ .010, P ¼ .005, P ¼ .029, respectively). Somatostatin levels in the model group were significantly higher than those in the control group (P ¼ .031), and significantly higher than those in the domperidone, LXSLJZD, MXSLJZD, and HXSLJZD groups (P ¼ .002, P ¼ .007, P ¼ .001, P ¼ .009, respectively). SP levels in the model group were significantly lower than those in the control group (P ¼ .037), and significantly lower than those in the domperidone, LXSLJZD, MXSLJZD, and HXSLJZD groups (P<.001, P ¼ .001, P ¼ .003, P ¼ .005, respectively). Fig.3 shows SP and somatostatin mRNA levels in gastric antrum SMCs. SP mRNA levels in the model group were significantly lower than those in the control, domperidone, MXSLJZD, and HXSLJZD
Fig. 3. SP and somatostatin mRNA levels in gastric antrum SMCs. Note: DDP<.01, DP<.05 compared with the model group. Abbreviations: XSLJZD: Xiangsha Liujunzi decoction; LXSLJZD: low-dose Xiangsha Liujunzi decoction; MXSLJZD: mediumdose Xiangsha Liujunzi decoctuon; HXSLJZD: high-dose Xiangsha Liujunzi decoction; SMCs: smooth muscle cells; SP: substance P; SS: somatostatin.
Please cite this article as: Dai N et al., Effects of Xiangsha Liujunzi decoction drug serum on gastric antrum smooth muscle cells from rats with functional dyspepsia by regulating gastrointestinal hormones, Journal of Traditional Chinese Medical Sciences, https://doi.org/10.1016/ j.jtcms.2020.01.007
N. Dai et al. / Journal of Traditional Chinese Medical Sciences xxx (xxxx) xxx
groups (P ¼ .037, P ¼ .016, P ¼ .025, P ¼ .002, respectively). Somatostatin mRNA levels in the model group were significantly higher than those in the control and MXSLJZD groups (P ¼ .042, P ¼ .035, respectively). Discussion FD is an important health issue worldwide. FD is associated with hypersensitivity to gastric distention and dysfunction of gastric motility. IA can injure the stomach and this injury can lead to dysfunction of gastric motility.22 Coordinated motor activity of the gastrointestine is related to the gastric emptying rate and small intestinal propulsion rate, which are regulated by neuropeptide.23 Delayed gastric emptying might cause gastric discomfort.24 The FD rat model in our study was created by IA administration.18,22 The FD rat model was successful because the gastric emptying and small intestinal propulsion rates in the model group were significantly lower than those in the control group. Additionally, HE staining showed no pathological changes in the stomach, which is consistent with the characteristics of functional gastrointestinal diseases.1 Isolation of cells in vitro can rule out the effects of different diffusion rates of drugs in tissues. XSLZJD might be more effective compared with prokinetic drugs in treating FD, and no side effects of XSLZJD have been identified in trials.25 Therefore, the current study attempted to further examine the mechanism of XSLZJD in treating FD from the perspective of the cellular level. Previous studies have shown that XSLJZD improves gastric motility of rats with FD.26 The involved mechanism may be achieved by regulating the contractile force and contraction cycle frequency of gastric SMCs. In our study, we first investigated the effect of drug serum on regulation of gastric antral SMCs. We found that a concentration of 10% drug serum for 24 h was the best intervention condition for later study. We then found that, in the model group that received XSLJZD drug serum, the mean OD value of cells was significantly increased, which indicated that serum containing XSLJZD effectively enhanced cellular activity. This finding suggests that XSLJZD drug serum has a protective effect on gastric antrum SMCs in FD. Gastric motility disorder is one of the causes of FD. Disorder of gastrointestinal hormones, such as ghrelin, gastrin, SP, and somatostatin, is recognized as an important contributor to FD. Ghrelin is a hormone that can stimulate food intake, and increase gastric movement and appetite.27,28 Suppression of ghrelin is related to slow gastric emptying.29 Therefore, ghrelin might be associated with FD. Gastrin is produced by the gastric antrum. Gastrin can improve digestive function of the gastrointestinal tract by stimulating gastrointestinal movement.30,31 A previous study showed that gastrin levels in patients with FD were significantly higher than those in healthy controls.32 Somatostatin has a negative effect on gastrointestinal peristalsis.33 A previous study showed that gentiopicroside improved gastrointestinal motility disorder by enhancing gastrin levels and reducing somatostatin levels.34 Patients with FD have higher levels of somatostatin compared with healthy individuals.35,36 SP has an excitatory effect on gastrointestinal movement.37,38 Animal experiments have shown that, in gastric antrum tissue of FD model rats, qualitative expression of SP is decreased. Domperidone is an antinauseant and gastrokinetic drug, which is effective for treating functional gastrointestinal disorders, such as dyspepsia, gastroesophageal reflux, nausea, and vomiting. The pharmacological effects of domperidone on gastrointestinal function are closely related to changes in motilin, gastrin, ghrelin, and somatostatin.39e41 Domperidone has similar effects to XSLJZD in regulating gastrointestinal hormones. In our study, gastrin, SP, and ghrelin levels in gastric antrum SMC supernatant in the model group were lower, and somatostatin levels were higher
7
compared with those in the control group. After drug serum intervention, ghrelin levels in the domperidone, LXSLJZD, MXLSJZD, and HXSLJZD groups were significantly higher than those in the model group. Gastrin levels in the domperidone, LXSLJZD, MXLSJZD, and HXSLJZD groups were significantly higher than those in the model group. SP levels in the domperidone, LXSLJZD, MXLSJZD, and HXSLJZD groups were significantly higher than those in the model group. Somatostatin levels in the domperidone, LXSLJZD, MXLSJZD, and HXSLJZD groups were significantly lower than those in the model group. Additionally, SP mRNA expression in the model group was lower than that in the control group. SP mRNA expression in the domperidone, MXSLJZD, and HXSLJZD groups was higher than that in the model group. Somatostatin mRNA expression in the model group was higher than that in the control group. Somatostatin mRNA expression in the MXSLJZD group was lower than that in the model group. Limitations This study has some limitations. In this study, gastric antrum SMCs, which were isolated from FD model rats, were primary cultured cells. Therefore, their ability to reproduce and grow was inferior to cell lines. Additionally, during screening of pre-medicine serum intervention conditions, we used a large number of SMC cells. As a result, there was an insufficient number of remaining cells to complete detection of gastrin and ghrelin mRNA levels. We will further improve the method of cell isolation and culture in future research. Conclusion This study shows that a rat model of FD can be prepared by IA. XLSJZD and domperidone drug serum effectively promote proliferative activity gastric antrum SMCs in the FD model. XLSJZD and domperidone drug serum can also increase ghrelin, gastrin, and SP levels in gastric antrum SMC supernatant and SP mRNA expression in gastric antrum SMCs. Moreover, XLSJZD and domperidone drug serum decrease somatostatin levels in gastric antrum supernatant and somatostatin mRNA expression in the gastric antrum. Our findings could help to reveal the mechanism of action of XLSJZD for treating FD at the cellular level. Funding This research was supported by the National Basic Research Program of China (973 Program, 2013CB531703) and 2019 Basic Research Business Expenses Project of Beijing University of Chinese Medicine (2019-JYB-XS-001). Declaration of competing interest None of the authors have any conflicts of financial interest. CRediT authorship contribution statement Ning Dai: Data curation, Funding acquisition, and Writing ‒ original draft. Jinghong Hu: Methodology and Data curation. Yan Liu: Methodology. Dongyu Ge: Methodology. Ruijuan Dong: Methodology. Fengzhi Wu: Writing ‒ review & editing. Jiaojiao Yu: Formal analysis and Methodology. Mindan Chen: Formal analysis and Methodology. Deborah C. Ma: Writing ‒ review & editing. Feng Li: Conceptualization, Supervision, Funding acquisition, and Writing ‒ review & editing.
Please cite this article as: Dai N et al., Effects of Xiangsha Liujunzi decoction drug serum on gastric antrum smooth muscle cells from rats with functional dyspepsia by regulating gastrointestinal hormones, Journal of Traditional Chinese Medical Sciences, https://doi.org/10.1016/ j.jtcms.2020.01.007
8
N. Dai et al. / Journal of Traditional Chinese Medical Sciences xxx (xxxx) xxx
Acknowledgments We are grateful for the technical support provided by Dr. Lin Lv and Dr. Fengyun Wang (Xiyuan Hospital, affiliated with the Chinese Academy of TCM, Beijing, China) and Xin Ma (Beijing University of Chinese Medicine, Beijing, China). References 1. Ke MY, Fang XC, Hou XH. Functional Gastrointestinal Disorders/disorders of GutBrain Interaction. Beijing: Science Press; 2016. 2. Mahadeva S, Goh KL. Epidemiology of functional dyspepsia: a global perspective. World J Gastroenterol. 2006;12(17):2661. 3. Shaib Y, El-Serag HB. The prevalence and risk factors of functional dyspepsia in a multiethnic population in the United States. Am J Gastroenterol. 2004;99(11): 2210e2216. 4. Lacy BE, Weiser KT, Kennedy AT, et al. Functional dyspepsia: the economic impact to patients. Aliment Pharmacol Ther. 2013;38:170e177. 5. Park JW, Ko SJ, Han Gj, et al. The effects of Banha-sasim-tang on dyspeptic symptoms and gastric motility in cases of functional dyspepsia: a randomized, dobule-blind, placebo-controlled, and two-center trial. Evid Based Complement Alternat Med. 2013;2013:265035. 6. Ozturk AS, Guzel M, Askar TK, et al. Evaluation of the hormones responsible for the gastrointestinal motility in cattle with displacement of the abomasum; ghrelin, motilin and gastrin. Vet Rec. 2013;172(24), 636‒636. 7. Michal ZL. Gastric ulcer induced changes in substance P and Nk1, Nk2, Nk3 receptors expression in different stomach localizations with regard to intrinsic neuronal system. Histochem Cell Biol. 2019;151:29e42. 8. Gonkowski SW, Rytel LN. Somatostatin as an active substance in the mammalian enteric nervous system. Int J Mol Sci. 2019;20:4461. 9. Zhang SY, Yang P, Li XX, et al. Comparative researches of semen arecae and charred semen arecae on gastrointestinal motility, motilin, substance P, and CCK in chronically stressed rats. Evid Based Complement Alternat Med. 2017;2017:1e8. 10. Li Y, Zhang WY, Ma J, et al. Study on the regulation of brain-gut peptide by Shenling Baizhu San in functional diarrhea rats. J Tradit Chin Med Sci. 2018;2018(5):283e290. 11. Ko SJ, Cho SH, Kim KJ, et al. Herbal medicine Banha-sasim-tang for the treatment of functional dyspepsia protocol for a systematic review of randomized controlled trials. Medicine (Baltim). 2019;98. e15760. 12. Lv L, Wang FY, Ma XX, et al. Efficacy and safety of Xiangsha Liujunzi granules for functional dyspepsia: a multi-center randomized double-blind placebocontrolled clinical study. World J Gastroenterol. 2017;23(30):5589e5601. 13. Zhang J, Xu BH. Modified Xiangsha Liujunzi Decoction for the treatment of 54 cases of functional dyspepsia (spleen deficiency syndrome). Global Tradit Chin Med. 2017;10(6):729e731 [Chinese]. 14. He GH, Zhong ZS, Hu XJ, et al. Meta-analysis of functional dyspepsia treated by Xiangsha Liujunzi decoction. Guiding J Tradit Chine Med Pharm. 2018;24(10): 105e109 [Chinese]. 15. Cai LJ, Fan YH, Lu B, et al. Effect observation of Xiangsha Six Mild-Drug Decoction in treatment of spleen and stomach deficiency type of functional dyspepsia. Chin Arch Tradit Chin Med. 2014;31(8):1974e1976 [Chinese]. 16. Chu MHK, Wu IXY, Ho RST, et al. Chinese herbal medicine for functional dyspepsia: systematic review of systematic reviews. Ther Adv Gastroen. 2018;11:1e24. 17. Liu J, Li F, Tang XD, et al. XiangshaLiujunzi decoction alleviates the symptoms of functional dyspepsia by regulating brainegut axis and production of neuropeptides. BMC Complement Altern Med. 2015;15:387. 18. Liu J, Li F, Tang XD, et al. Reconstruction and assessment of functional dyspepsia with spleen deficiency in TCM. Global Tradit Chin Med. 2015;8(6): 701e705 [Chinese]. 19. Li DX, Ling JH, Wang YJ, et al. Effect of drug-containing serum of immature bitter orange on cell contraction, intracellular Ca2þ concentration and calmodulin expression in rat antral smooth muscle cells. Shijie Huaren Xiaohua Zazhi. 2015;23(8):1224e1230 [Chinese].
20. Chen MD, Hu JH, Ma J, et al. In vitro effects of Pixu Sihao Fang dosed serum on colonic smooth muscle cells in rats with spleen-deficiency functional diarrhea. J Beijing Univ Tradit Chin Med. 2017;40(4):297e301 [Chinese]. 21. Francis J, Critchley D, Dourish CT, et al. Comparisons between the effects of 5HT and dl-fenfluramine on food intake and gastric emptying in the rat. Pharmacol, Biochem Behav. 1995;50(4):581e585. 22. Liu LS, Winston JH, Shenoy MM, et al. A rat model of chronic gastric sensorimotor dysfunction resulting from transient neonatal gastric irritation. Gastroenterology. 2008;134:2070e2079. 23. Lupoli R, Pisano F, Capaldo B. Postprandial glucose control in type 1 diabetes: importance of the gastric emptying rate. Nutrients. 2019;11:1559. 24. Kusano MY, Zai HK, Shimoyama Yk, et al. Rapid gastric emptying, rather than delayed gastric emptying, might provoke functional dyspepsia. J Gastroenterol Hepatol. 2011;26:75e78. 25. Xiao Y, Liu YY, Yu KQ, et al. Chinese herbal medicine liu jun zi tang and Xiang sha liu jun zi tang for functional dyspepsia: meta-analysis of randomized controlled trials. Evid Based Complement Alternat Med. 2012;2012:1e7. 26. Lv L, Wang FY, Tang XD, et al. Effect of PixuIrecipe on gastric smooth muscle contraction force of FD rats with Pi deficiency syndrome. Chin J Integr Tradit West Med. 2018;38(7):825e831 [Chinese]. 27. Krueger T, Melendez P. Effect of ghrelin on feed intake and metabolites in lambs. Appetite. 2012;58(2):758e759. 28. Hu XL, You L, Hu CH, et al. Effects of b-hydroxybutyric acid and ghrelin on the motility and inflammation of gastric antral smooth muscle cells involving the regulation of growth hormone secretagogue receptor. Mol Med Rep. 2019;20: 5050e5058. 29. Heruc GA, Little TJ, Kohn M, et al. Appetite perceptions, gastrointestinal symptoms, ghrelin, peptide YY and state anxiety are disturbed in adolescent females with anorexia nervosa and only partially restored with short-term refeeding. Nutrients. 2018;11:1. 30. Thomas A. Gut motility, sphincters and reflex control. Anaesth Intensive Care Med. 2006;7:57e58. 31. Xue ZZ, Wu CC, Wei JY, et al. An orally administered magnoloside A ameliorates functional dyspepsia by modulating brain-gut peptides and gut microbiota. Life Sci. 2019;233:116749. 32. Fang JL, Wang DH, Zhao Q, et al. Brain-gut axis modulation of acupuncture in functional dyspepsia: a preliminary resting-state fcMRI study. Evid Based Complement Alternat Med. 2015;2015:860463. 33. Van OBJ, Adriaensen D, Van NL, et al. The role(s) of somatostatin, structurally related peptides and somatostatin receptors in the gastrointestinal tract: a review. Regul Pept. 2009;156:1e8. 34. Ruan M, Yu B, Xu L, et al. Attenuation of stress-induced gastrointestinal motility disorder by gentiopicroside, from Gentiana macrophylla Pall. Fitoterapia. 2015;103:265e276. 35. Russo F, Chimienti G, Clemente C, et al. Gastric activity and gut peptides in patients with functional dyspepsia: postprandial distress syndrome versus epigastric pain syndrome. J Clin Gastroenterol. 2017;51:136e144. 36. Jonsson BH, Uvn€ as-Moberg K, Theorell T, et al. Gastrin, cholecystokinin, and somatostatin in a laboratory experiment of patients with functional dyspepsia. Psychosom Med. 1998;60(3):331e337. 37. Fu XY, Li Z, Zhang N, et al. Effects of gastrointestinal motility on obesity. Nutr Metab. 2014;11(1):3. 38. Yang SL, Liu SL. Effect of Shugan Hewei Tang on expression of iNOS and SP in rats with functional dyspepsia. In: Paper Presented at: Compilation of Papers of the 18th Academic Exchange Conference of the Chinese Society of Spleen and Stomach Diseases of the Chinese. Beijing, China: Traditional Medicine Society; 2006. 39. Hiroki I, Fumihiko K, Kazuro I, et al. Effects of domperidone on human plasma levels of motilin, somatostatin, gastrin, adrenocorticotropic hormone and cortisol. Biol Pharm Bull. 2005;28(9):1752e1756. 40. Ling JH, Wei LM, Zhang YQ, et al. Effect of method of soothing liver and regulating qi on expression of gastrin and somatostatin in hypothalamus, gastric antrum of functional dyspepsia rats. Zhongguo Zhongyao Zazhi. 2010;35: 3069e3073 [Chinese]. 41. Sagkan-Ozturk A, Demir EA, Ozturk A. Prokinetics stimulate the increase of ghrelin in mice. Bratisl Lek Listy. 2016;117:726e729.
Please cite this article as: Dai N et al., Effects of Xiangsha Liujunzi decoction drug serum on gastric antrum smooth muscle cells from rats with functional dyspepsia by regulating gastrointestinal hormones, Journal of Traditional Chinese Medical Sciences, https://doi.org/10.1016/ j.jtcms.2020.01.007
Contents lists available at ScienceDirect
Journal of Traditional Chinese Medical Sciences journal homepage: www.elsevier.com/locate/jtcms
Effects of Xiangsha Liujunzi decoction drug serum on gastric antrum smooth muscle cells from rats with functional dyspepsia by regulating gastrointestinal hormones Ning Dai a, Jinghong Hu a, Yan Liu a, Dongyu Ge a, Ruijuan Dong a, Fengzhi Wu b, Jiaojiao Yu a, Mindan Chen a, Deborah C. Ma c, Feng Li a, *, 1 a b c
School of Traditional Chinese Medicine, Beijing University of Chinese Medicine, Beijing, 100029, China Journal Center, Beijing University of Chinese Medicine, Beijing, 100029, China Roots & Needles Acupuncture Inc, San Diego, 92121, USA
a r t i c l e i n f o
a b s t r a c t
Article history: Received 26 November 2019 Received in revised form 11 January 2020 Accepted 12 January 2020 Available online xxx
Objective: To observe the effect and mechanism of Xiangsha Liujunzi decoction (XSLJZD) drug serum on gastric antrum smooth muscle cells (SMCs) in rats with functional dyspepsia (FD). Methods: Gastric antrum SMCs from rats with FD were isolated, cultured, and then divided into six groups as follows: control, model, domperidone, low-dose XSLJZD (LXSLJZD), medium-dose XSLJZD (MXSLJZD), and high-dose XSLJZD (HXSLJZD). Each group was administered the corresponding drug serum for intervention. Drug serum intervention conditions and proliferative activity of SMCs were tested by cholecystokinin octapeptide. Ghrelin, gastrin, somatostatin, and substance P (SP) levels were measured by ELISA. Somatostatin and SP mRNA expression was measured by real-time PCR. Results: A concentration of 10% drug serum for 24 h was decided to be the best intervention condition for later study. The mean optical density value in the model group was lower than that in the control group (P ¼ .001). Optical density values in the domperidone and HXSLJZD groups were higher than those in the model group (P ¼ .025, P ¼ .032, respectively). Gastrin, SP, and ghrelin levels in the model group were lower (P ¼ .007, P ¼ .037, P ¼ .005, respectively), but somatostatin levels were higher, compared with those in the control group (P ¼ .031). Gastrin, SP, and ghrelin levels in the domperidone, MXSLJZD, and HXSLJZD groups were higher than those in the model group (all P<.05). Somatostatin levels in the four drug-treated groups were lower than those in the model group (P ¼ .002, P ¼ .007, P ¼ .001, P ¼ .009, respectively). SP mRNA levels in the model group were lower than those in the control, domperidone, MXSLJZD, and HXSLJZD groups (P ¼ .037 P ¼ .016, P ¼ .025, P ¼ .002, respectively). Somatostatin mRNA levels in the model group were higher than those in the control and MXSLJZD groups (P ¼ .042, P ¼ .035). Conclusions: XSLJZD and domperidone drug serum effectively promote proliferative activity of gastric antrum SMCs in an FD model. The mechanism of this activity may be regulated by gastrointestinal hormones. © 2020 Beijing University of Chinese Medicine. Production and hosting by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Keywords: Functional dyspepsia Xiangsha Liujunzi decoction Gastrointestinal hormones Gastric antrum Smooth muscle cells
Introduction Functional dyspepsia (FD) is characterized by postprandial fullness, early satiation, epigastric pain, and epigastric burning that
* Corresponding author. E-mail address: [email protected] (F. Li). Peer review under responsibility of Beijing University of Chinese Medicine. 1 Present address: School of Traditional Chinese Medicine, Beijing University of Chinese Medicine, Beijing 100029, China
persist for at least 3 months according to the Rome IV diagnostic criteria.1 FD is becoming a severe health issue worldwide, with a prevalence varying between 10% and 30%.2,3 Although there is no changes in organs, these uncomfortable symptoms have a serious effect on patients with FD. Additionally, FD incurs a heavy economic burden. FD costs more than $18 billion in patients in the USA.4 Delayed gastric emptying or antral dysmotility is considered to be the main cause of these dyspepsia symptoms in patients with FD.5 Previous research has shown that gastrointestinal hormones, such as gastrin, ghrelin, somatostatin, and substance P (SP), are
https://doi.org/10.1016/j.jtcms.2020.01.007 2095-7548/© 2020 Beijing University of Chinese Medicine. Production and hosting by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http:// creativecommons.org/licenses/by-nc-nd/4.0/).
Please cite this article as: Dai N et al., Effects of Xiangsha Liujunzi decoction drug serum on gastric antrum smooth muscle cells from rats with functional dyspepsia by regulating gastrointestinal hormones, Journal of Traditional Chinese Medical Sciences, https://doi.org/10.1016/ j.jtcms.2020.01.007
2
N. Dai et al. / Journal of Traditional Chinese Medical Sciences xxx (xxxx) xxx
Table 1 Primer sequences of SP, somatostatin, and GAPDH.
Table 2 Gastric emptying and small intestinal propulsion rates.
Name
Primer Sequences(5’-3’)
Gene Bank Number
Length(bp)
Results
Control group
Model group
SP
F: ACTGGTCCGACAGTGACCAAATC R: CCCGTTTGCCCATTAATCCA F:GACCCCAGACTCCGTCAGTT R:GGCATCGTTCTCTGTCTGGTT F: GGCACAGTCAAGGCTGAGAATG R: ATGGTGGTGAAGACGCCAGTA
NM_012666.2
1049
Gastric emptying rate Small intestinal propulsion rate
0.5928 (0.1004)△△ 0.7197 (0.0623)△△
0.4552 (0.0698) 0.3740 (0.07748)
NM_012659
564
NM_017008.4
1306
SS GAPDH
Note: F: forward primer; R: reverse primer; NM: number.
associated with gastric motility.6e10 Currently, FD can be treated by conventional medications, including acid suppressive drugs, prokinetic agents, and antidepressants. Despite these treatments, treatment of FD is not satisfactory.11 Xiangsha Liujunzi decoction (XSLJZD), which originates from ancient and modern medical theory, can relieve symptoms of patients with FD.12e15 The occurrence of adverse events with XSLJZD is not significantly different from pharmacotherapy.16 A previous study showed that XSLJZD reduced gastric sensitivity and increased food intake in rats with FD.17 However, the mechanism of action is unclear. Modern research shows the trend of the overall level to the cellular level. Gastric peristalsis is derived from contraction of smooth muscle cells (SMCs) in the stomach wall. Activity of smooth muscle movement is affected by factors, such as neurotransmitters, gastrointestinal hormones, and drugs. In vitro culture of cells is useful for studying cellular function and the corresponding cellular signal transduction mechanism. Therefore, we studied the effect of XSLJZD on gastric antrum SMCs in rats with FD and its mechanism. This study aimed to provide a reference for drug targets for FD. Methods Ethics approval The experiments were performed in accordance with the Guide for the Care and Use of Laboratory Animals published by the National Institutes of Health (NIH Publications No.85-23, revised 1996) and followed the Beijing University of Chinese Medicine guidelines for the welfare of experimental animals, with the approval of the Animal Care Committee of Beijing Medical Center. The ethics committee protocol number was BUCM-4-2016102824-4024. Experimental animals We studied 20 male SpragueeDawley 7-day-old rat pups and their mothers and 75 male SpragueeDawley rats (200 ± 20 g), which were raised in the SPF level animal house, with a 12-h rhythm, 22 C, and 60%e70% humidity. Each mother provided breast milk for four rat pups in a cage. The female and male rats ate complete nutritional palletized feed and drank water freely (SPF Laboratory Animal Technology Co., Ltd., Beijing, China). Modeling We created a rat model of FD with iodoacetamide (IA) and the modified multiple platform method.18 Twenty 7-day-old rats were raised for 3 days. We randomly divided 10-day-old rats into the control group and IA group. The control group (n ¼ 8) received 0.2 mL of 2% sucrose and the IA group (model group, n ¼ 12) received 0.2 mL of 0.1% IA in 2% sucrose daily for 6 days. During this period, these rats consumed breast milk and the mothers ate food and drank water freely. After this time, the rats were raised normally. When the rats were 3 weeks old, they were separated from
Note: DDP<.01 compared with the model group. Data are shown as mean (SD).
their mothers and divided into different cages. When the rats were 6 weeks old, except for rats in the control group, those in the IA group were placed in a multiple platform box (18:00e8:00 h) for 14 days. The water in the box was changed every day and water temperature was maintained at 22 C. Drugs XSLJZD consists of ginseng, Largehead Atractylodes Rh (Atractylodes macrocephala), Indian Buead Tuckahoe (Poria cocos), liquorice root (Glycyrrhiza uralensis), Tangerine Peel (Pericarpium Citri Reticulatae Blanco), Pinellia ternate (Pinelliae Rhizoma), villous amomum fruit (Amomum villosum), and Aucklandia lappa (Aucklandiae Radix). These drugs, which were provided by the Pharmaceutical Department of China Academy of Chinese Medical Sciences Xiyuan Hospital, were dissolved in deionized water. Separating and cultivating gastric antrum SMCs of model rats After modeling, we randomly chose four model rats and prevented them from eating for 24 h. The rats were anesthetized, sacrificed by cervical dislocation, and soaked in 75% alcohol for 15 min. We separated and cultivated gastric antrum SMCs of FD rats according to Li.19 When cells grew to a dense single layer, they were passed on. The experiments started when cells were passed on to the third generation. Preparation of drug-containing serum Healthy male SD rats were randomly divided into five groups as follows: control (n ¼ 15, same volume of deionized water), domperidone (n ¼ 15, 0.3 g/kg), low-dose XSLJZD (LXSLJZD) (n ¼ 15, 1.25 g/kg), medium-dose XSLJZD (MXSLJZD) (n ¼ 15, 2.5 g/kg), and high-dose XSLJZD (HXSLJZD) (n ¼ 15, 5 g/kg). These rats received corresponding drugs continuously for 7 days. They were then anesthetized and blood from the abdominal aorta was sampled after last does 2 h. The blood was kept for 6 h at 4 C and then centrifuged (3000 r/minute for 20 min). We separated serum and mixed the serum of same group rats. The serum was inactivated in a 56 C water bath for 30 min and filtered with a 0.22-mm filter for sterilization. The serum was kept in a 80 C refrigerator after transferring to 1.5-mL tubes.20 Measurement of the gastric emptying rate Control and model group rats were not allowed to eat for 24 h after modeling. After this time, each of the rats received a black semisolid pasty mixture (3 mL). This mixture consisted of sodium carboxymethyl cellulose 10 g, milk powder 16 g, sugar 8 g, starch 8 g, activated carbon powder 2 g, and 250 mL of distilled water. Fifty minutes later, we anesthetized the rats and opened their abdominal cavity immediately. The rats’ cardia and pylorus were tightened, and the stomach was separated and weighed. We cut the stomach along the greater gastric curvature, cleaned it with normal saline, dried it with filter paper, and weighed its net weight. We calculated the gastric emptying rate according to the following formula21:
Please cite this article as: Dai N et al., Effects of Xiangsha Liujunzi decoction drug serum on gastric antrum smooth muscle cells from rats with functional dyspepsia by regulating gastrointestinal hormones, Journal of Traditional Chinese Medical Sciences, https://doi.org/10.1016/ j.jtcms.2020.01.007
N. Dai et al. / Journal of Traditional Chinese Medical Sciences xxx (xxxx) xxx
3
Fig. 1. HE staining results of gastric pathology in the control and model groups. Note: Tissue sections were viewed at 40 magnification.
gastric emptying rate (%) ¼ [1(gastric full weight-gastric net weight)/gavage amount] 100%
of advancement. The small intestine propulsion rate (%) was calculated as the carbon powder front distance/small intestine overall length 100%.
Measurement of the small intestine propulsion rate Hematoxylin and eosin staining We opened the rat abdominal cavity, separated the mesentery, and cut out the intestinal canal from the pylorus to the ileocecal valve and put it on a glass pane without tractive effort. We measured the distance from the pylorus to the leading edge of the charcoal and its full length, and recorded the ratio as the percentage
After sampling abdominal aorta blood, the stomach was separated, fixed with 10%formalin solution, and embedded in paraffin. Tissue was subsequently cut in 6-mm sections. The sections were dehydrated in gradient alcohol, counterstained with hematoxylin,
Please cite this article as: Dai N et al., Effects of Xiangsha Liujunzi decoction drug serum on gastric antrum smooth muscle cells from rats with functional dyspepsia by regulating gastrointestinal hormones, Journal of Traditional Chinese Medical Sciences, https://doi.org/10.1016/ j.jtcms.2020.01.007
4
N. Dai et al. / Journal of Traditional Chinese Medical Sciences xxx (xxxx) xxx
Fig. 2. Effect of XSLJZD drug serum intervention on rat gastric antrum SMCs. Note: (A) OD values at 24 h in cells that were treated with 2.5%, 5%, 10%, 15%, and 20% drug serum in the six groups (B) OD values at 48 h in cells that were treated with 2.5%, 5%, 10%, 15%, and 20% drug serum in the six groups (C) OD values at 72 h in cells that were treated with 2.5%, 5%, 10%, 15%, and 20% drug serum in the six groups
Please cite this article as: Dai N et al., Effects of Xiangsha Liujunzi decoction drug serum on gastric antrum smooth muscle cells from rats with functional dyspepsia by regulating gastrointestinal hormones, Journal of Traditional Chinese Medical Sciences, https://doi.org/10.1016/ j.jtcms.2020.01.007
N. Dai et al. / Journal of Traditional Chinese Medical Sciences xxx (xxxx) xxx
dewaxed, and sealed with neutral resin. The sections were then observed by a microscope and images were acquired with a camera.
Table 3 Effect of XSLJZD drug serum on proliferative activity of gastric antrum SMCs.
XSLJZD drug serum intervention in gastric antrum SMCs of model rats Gastric antrum SMCs of model rats were vaccinated in 96-well plates and divided into the following six groups: control, model, domperidone, LXSLJZD, MXSLJZD, and HXSLJZD groups. We separately added medium with different concentrations of drug serum to every group after the cells were attached. We separately tested optical density (OD) values after 24, 48, and 72 h by the cholecystokinin octapeptide (CCK-8) test (Dojindo, Shanghai, China) according to the manufacturer’s instructions twice.
Effect of XSLJZD drug serum on proliferative activity of gastric antrum SMCs in model rats Gastric antrum SMCs of model rats were vaccinated in 96-well plates and divided into the following six groups: control, model, domperidone, LXSLJZD, MXSLJZD, and HXSLJZD groups. We added medium with 10% corresponding drug serum to each group after the cells were attached. We measured OD values after 24 h by the CCK-8 test according to the manufacturer’s instructions. We calculated the relative viability of cells according to the following formula: relative viability of cells ¼ OD value of each drug-treated group/OD value of the control group.
ELISA
5
Groups
OD value
Control group Model group Domperidone group LXSLJZD group MXSLJZD group HXSLJZD group
1.34 1.14 1.32 1.25 1.22 1.26
(0.06)△△ (0.08) (0.13)△ (0.12) (0.12) (0.07)△
Note: △△P<.01, △P<.05 compared with the model group. Data are shown as mean (SD).
Statistical analysis Data were analyzed with SPSS 20.0 software. Data are expressed as mean and standard deviation (SD). If data from two groups were normally distributed, they were analyzed with the Student’s test. If data from three groups were normally distributed, they were analyzed with one-way ANOVA. If data did not fit a normal distribution, a non-parametric test was used. P.05 was considered as a significant difference. Results Gastric emptying and small intestinal propulsion rates The gastric emptying and small intestinal propulsion rates are shown in Table 2. The gastric emptying and small intestinal propulsion rates in the model group were significantly lower than those in the control group (P ¼ .001, P<.001, respectively).
Gastric antrum SMCs of model rats were vaccinated in 96-well plates and divided into the following six groups: control, model, domperidone, LXSLJZD, MXSLJZD, and HXSLJZD groups. We added medium with 10% corresponding drug serum to every group after the cells were attached. Twenty-four hours later, we aspirated cells and centrifuged them (1000 r/minute for 5 min). The supernatant was kept in a 80 C refrigerator after transferring it to 1.5-mL tubes. Gastrin, ghrelin, somatostatin, and substance P levels were measured according to the ELISA kit instructions (Yidacheng, China, Beijing).
Hematoxylin and eosin staining
Real-time PCR
First, we separately added medium with different concentrations (2.5%, 5%, 10%, 15%, and 20%) of drug serum to every group after cells were attached and then measured OD values at 24 h. Cells that were treated with 2.5%, 5%, and 10% drug serum showed an increasing trend in OD values, while 10%, 15%, and 20% drug serum had an unstable effect on OD values in cells. The model group showed a downward trend and the other five groups showed an upward trend (Fig.2A). At 48 h, cells that were treated with 2.5%, 5%, and 10% drug serum showed an increasing trend in OD values, while 10%, 15%, and 20% drug serum had an unstable effect on cells. The model group showed a downward trend in OD values. OD values in the drug group initially decreased and then increased, while the other four groups showed an upward trend (Fig.2B). At 72 h, the effect of 2.5%, 5%, 10%, 15%, and 20% drug serum concentrations on OD values in cells was unstable. The control, LXSLJZD, and HXSLJZD groups showed a "up-slight drop-up" trend in OD
Gastric antrum SMCs of model rats were vaccinated in 96-well plates and divided into the following six groups: control, model, domperidone, LXSLJZD, MXSLJZD, and HXSLJZD groups. We added medium with 10% corresponding drug serum to every group after the cells were attached. Twenty-four hours later, we aspirated cells and cleaned them with preheated phosphate-buffered saline. We used real-time PCR to measure SP and somatostatin mRNA levels. We extracted total RNA using the Trizol Reagent Kit (Ambion, USA) and performed reverse transcription using a reverse transcription kit (Reveraid First Strand cDNA Synthesis Kit, Thermo Scientific). Reaction conditions were as follows: annealing for 65 C for 5 min, extension at 42 C for 60 min, and inactivation at 70 C for 5 min. Amplification conditions were as follows: 95 C for 30 s, 95 C 1, and 60 C for 30 s, for 40 cycles. Table 1 shows the primer sequences.
Hematoxylin and eosin (HE) staining results of gastric pathology in the control and model groups are shown in Fig.1. There were no changes in histomorphology of the stomach between the control and model groups. This finding indicated that modeling did not lead to structural changes in the stomach, consistent with the characteristics of functional diseases. XSLJZD drug serum intervention in gastric antrum SMCs of model rats
(D) OD values at 24 h in cells that were treated with 5%, 10% and 15% drug serum (E) OD values at 48 h in cells that were treated with 5%, 10%, and 15% drug serum (F) OD values at 72 h in cells that were treated with 5%, 10%, and 15% drug serum.
Please cite this article as: Dai N et al., Effects of Xiangsha Liujunzi decoction drug serum on gastric antrum smooth muscle cells from rats with functional dyspepsia by regulating gastrointestinal hormones, Journal of Traditional Chinese Medical Sciences, https://doi.org/10.1016/ j.jtcms.2020.01.007
6
N. Dai et al. / Journal of Traditional Chinese Medical Sciences xxx (xxxx) xxx
Table 4 Gastrointestinal hormones in gastric antrum SMC supernatant. Groups
SP
Control group Model group Domperidone group LXSLJZD group MXSLJZD group HXSLJZD group
1.71 1.55 1.91 1.85 1.80 1.78
SS (0.04)△ (0.07) (0.04)△△ (0.03)△△ (0.10)△△ (0.14)△△
222.75 270.76 195.30 207.14 180.13 210.10
GAS (17.71)△ (34.98) (28.86)△△ (27.38)△△ (14.91)△△ (11.12)△△
208.05 112.39 189.58 162.72 268.50 229.88
Ghrelin (12.67)△△ (17.83) (23.08)△ (37.13) (39.12)△△ (61.07)△△
2199.42 1342.26 1929.92 2115.28 2184.96 1984.34
(503.04)△△ (555.77) (415.05)△ (141.19)△ (278.27)△△ (761.02)△
Note: DDP<.01, DP<.05 compared with the model group. Data are shown as mean (SD). SP and somatostatin mRNA levels in gastric antrum SMCs.
values. OD values in the model group increased followed by a decrease. The domperidone group showed a trend in OD values of a fall, rise, fall, and then a rise, and these changes were large. The MXSLJZD group showed a trend in OD values of a fall and then a rise (Fig.2C). Therefore, 5% and 10% drug serum concentrations in rat gastric antral SMCs for 24 h had a better effect than the other conditions. On the basis of the above-mentioned results, we separately added medium with different concentrations (5%, 10%, and 15%) of drug serum to every group again after cells were attached. At 24 h, cells that treated with 5% and 10% drug serum concentrations showed a declining trend in OD values. However, 10% and 15% drug serum concentrations showed an increasing trend in OD values and the growth trend in each group was similar (Fig.2D). At 48 h, cells that were treated with 5%, 10%, and 15% drug serum concentrations showed an increasing trend in OD values. This increasing trend in OD values with 10% and 15% drug serum concentrations in the LXSLJZD and HXSLJZD groups was greater than that in the other groups (Fig.2E). At 72 h, 5%, 10%, and 15% drug serum concentrations showed an increase in OD values in all groups. However, the model group showed a significantly higher increase in OD values compared with the other five groups (Fig.2F). We decided that 10% drug serum for 24 h was the best intervention condition for later studies. Effect of XSLJZD drug serum on proliferative activity of gastric antrum SMCs in model rats Table 3 shows the effect of XSLJZD drug serum on proliferative
activity of gastric antrum SMCs in rats with FD. The mean OD value in the model group was significantly lower than that in the control group (P ¼ .001). The mean OD values in the domperidone and HXSLJZD groups were significantly higher than that in the model group (P ¼ .025, P ¼ .032, respectively). Gastrointestinal hormones in gastric antrum SMC supernatant Table 4 shows mean gastrin, ghrelin, SP, and somatostatin levels in gastric antrum SMC supernatant. Gastrin levels in the model group were significantly lower than those in the control group (P ¼ .007). Gastrin levels in the domperidone, MXSLJZD, and HXSLJZD groups were significantly higher than those in the model group (P ¼ .021, P<.001, P ¼ .002, respectively). Ghrelin levels in the model group were significantly lower than those in the control group (P ¼ .005). Ghrelin levels in the other four drug-treated groups were significantly higher than those in the model group (P ¼ .044, P ¼ .010, P ¼ .005, P ¼ .029, respectively). Somatostatin levels in the model group were significantly higher than those in the control group (P ¼ .031), and significantly higher than those in the domperidone, LXSLJZD, MXSLJZD, and HXSLJZD groups (P ¼ .002, P ¼ .007, P ¼ .001, P ¼ .009, respectively). SP levels in the model group were significantly lower than those in the control group (P ¼ .037), and significantly lower than those in the domperidone, LXSLJZD, MXSLJZD, and HXSLJZD groups (P<.001, P ¼ .001, P ¼ .003, P ¼ .005, respectively). Fig.3 shows SP and somatostatin mRNA levels in gastric antrum SMCs. SP mRNA levels in the model group were significantly lower than those in the control, domperidone, MXSLJZD, and HXSLJZD
Fig. 3. SP and somatostatin mRNA levels in gastric antrum SMCs. Note: DDP<.01, DP<.05 compared with the model group. Abbreviations: XSLJZD: Xiangsha Liujunzi decoction; LXSLJZD: low-dose Xiangsha Liujunzi decoction; MXSLJZD: mediumdose Xiangsha Liujunzi decoctuon; HXSLJZD: high-dose Xiangsha Liujunzi decoction; SMCs: smooth muscle cells; SP: substance P; SS: somatostatin.
Please cite this article as: Dai N et al., Effects of Xiangsha Liujunzi decoction drug serum on gastric antrum smooth muscle cells from rats with functional dyspepsia by regulating gastrointestinal hormones, Journal of Traditional Chinese Medical Sciences, https://doi.org/10.1016/ j.jtcms.2020.01.007
N. Dai et al. / Journal of Traditional Chinese Medical Sciences xxx (xxxx) xxx
groups (P ¼ .037, P ¼ .016, P ¼ .025, P ¼ .002, respectively). Somatostatin mRNA levels in the model group were significantly higher than those in the control and MXSLJZD groups (P ¼ .042, P ¼ .035, respectively). Discussion FD is an important health issue worldwide. FD is associated with hypersensitivity to gastric distention and dysfunction of gastric motility. IA can injure the stomach and this injury can lead to dysfunction of gastric motility.22 Coordinated motor activity of the gastrointestine is related to the gastric emptying rate and small intestinal propulsion rate, which are regulated by neuropeptide.23 Delayed gastric emptying might cause gastric discomfort.24 The FD rat model in our study was created by IA administration.18,22 The FD rat model was successful because the gastric emptying and small intestinal propulsion rates in the model group were significantly lower than those in the control group. Additionally, HE staining showed no pathological changes in the stomach, which is consistent with the characteristics of functional gastrointestinal diseases.1 Isolation of cells in vitro can rule out the effects of different diffusion rates of drugs in tissues. XSLZJD might be more effective compared with prokinetic drugs in treating FD, and no side effects of XSLZJD have been identified in trials.25 Therefore, the current study attempted to further examine the mechanism of XSLZJD in treating FD from the perspective of the cellular level. Previous studies have shown that XSLJZD improves gastric motility of rats with FD.26 The involved mechanism may be achieved by regulating the contractile force and contraction cycle frequency of gastric SMCs. In our study, we first investigated the effect of drug serum on regulation of gastric antral SMCs. We found that a concentration of 10% drug serum for 24 h was the best intervention condition for later study. We then found that, in the model group that received XSLJZD drug serum, the mean OD value of cells was significantly increased, which indicated that serum containing XSLJZD effectively enhanced cellular activity. This finding suggests that XSLJZD drug serum has a protective effect on gastric antrum SMCs in FD. Gastric motility disorder is one of the causes of FD. Disorder of gastrointestinal hormones, such as ghrelin, gastrin, SP, and somatostatin, is recognized as an important contributor to FD. Ghrelin is a hormone that can stimulate food intake, and increase gastric movement and appetite.27,28 Suppression of ghrelin is related to slow gastric emptying.29 Therefore, ghrelin might be associated with FD. Gastrin is produced by the gastric antrum. Gastrin can improve digestive function of the gastrointestinal tract by stimulating gastrointestinal movement.30,31 A previous study showed that gastrin levels in patients with FD were significantly higher than those in healthy controls.32 Somatostatin has a negative effect on gastrointestinal peristalsis.33 A previous study showed that gentiopicroside improved gastrointestinal motility disorder by enhancing gastrin levels and reducing somatostatin levels.34 Patients with FD have higher levels of somatostatin compared with healthy individuals.35,36 SP has an excitatory effect on gastrointestinal movement.37,38 Animal experiments have shown that, in gastric antrum tissue of FD model rats, qualitative expression of SP is decreased. Domperidone is an antinauseant and gastrokinetic drug, which is effective for treating functional gastrointestinal disorders, such as dyspepsia, gastroesophageal reflux, nausea, and vomiting. The pharmacological effects of domperidone on gastrointestinal function are closely related to changes in motilin, gastrin, ghrelin, and somatostatin.39e41 Domperidone has similar effects to XSLJZD in regulating gastrointestinal hormones. In our study, gastrin, SP, and ghrelin levels in gastric antrum SMC supernatant in the model group were lower, and somatostatin levels were higher
7
compared with those in the control group. After drug serum intervention, ghrelin levels in the domperidone, LXSLJZD, MXLSJZD, and HXSLJZD groups were significantly higher than those in the model group. Gastrin levels in the domperidone, LXSLJZD, MXLSJZD, and HXSLJZD groups were significantly higher than those in the model group. SP levels in the domperidone, LXSLJZD, MXLSJZD, and HXSLJZD groups were significantly higher than those in the model group. Somatostatin levels in the domperidone, LXSLJZD, MXLSJZD, and HXSLJZD groups were significantly lower than those in the model group. Additionally, SP mRNA expression in the model group was lower than that in the control group. SP mRNA expression in the domperidone, MXSLJZD, and HXSLJZD groups was higher than that in the model group. Somatostatin mRNA expression in the model group was higher than that in the control group. Somatostatin mRNA expression in the MXSLJZD group was lower than that in the model group. Limitations This study has some limitations. In this study, gastric antrum SMCs, which were isolated from FD model rats, were primary cultured cells. Therefore, their ability to reproduce and grow was inferior to cell lines. Additionally, during screening of pre-medicine serum intervention conditions, we used a large number of SMC cells. As a result, there was an insufficient number of remaining cells to complete detection of gastrin and ghrelin mRNA levels. We will further improve the method of cell isolation and culture in future research. Conclusion This study shows that a rat model of FD can be prepared by IA. XLSJZD and domperidone drug serum effectively promote proliferative activity gastric antrum SMCs in the FD model. XLSJZD and domperidone drug serum can also increase ghrelin, gastrin, and SP levels in gastric antrum SMC supernatant and SP mRNA expression in gastric antrum SMCs. Moreover, XLSJZD and domperidone drug serum decrease somatostatin levels in gastric antrum supernatant and somatostatin mRNA expression in the gastric antrum. Our findings could help to reveal the mechanism of action of XLSJZD for treating FD at the cellular level. Funding This research was supported by the National Basic Research Program of China (973 Program, 2013CB531703) and 2019 Basic Research Business Expenses Project of Beijing University of Chinese Medicine (2019-JYB-XS-001). Declaration of competing interest None of the authors have any conflicts of financial interest. CRediT authorship contribution statement Ning Dai: Data curation, Funding acquisition, and Writing ‒ original draft. Jinghong Hu: Methodology and Data curation. Yan Liu: Methodology. Dongyu Ge: Methodology. Ruijuan Dong: Methodology. Fengzhi Wu: Writing ‒ review & editing. Jiaojiao Yu: Formal analysis and Methodology. Mindan Chen: Formal analysis and Methodology. Deborah C. Ma: Writing ‒ review & editing. Feng Li: Conceptualization, Supervision, Funding acquisition, and Writing ‒ review & editing.
Please cite this article as: Dai N et al., Effects of Xiangsha Liujunzi decoction drug serum on gastric antrum smooth muscle cells from rats with functional dyspepsia by regulating gastrointestinal hormones, Journal of Traditional Chinese Medical Sciences, https://doi.org/10.1016/ j.jtcms.2020.01.007
8
N. Dai et al. / Journal of Traditional Chinese Medical Sciences xxx (xxxx) xxx
Acknowledgments We are grateful for the technical support provided by Dr. Lin Lv and Dr. Fengyun Wang (Xiyuan Hospital, affiliated with the Chinese Academy of TCM, Beijing, China) and Xin Ma (Beijing University of Chinese Medicine, Beijing, China). References 1. Ke MY, Fang XC, Hou XH. Functional Gastrointestinal Disorders/disorders of GutBrain Interaction. Beijing: Science Press; 2016. 2. Mahadeva S, Goh KL. Epidemiology of functional dyspepsia: a global perspective. World J Gastroenterol. 2006;12(17):2661. 3. Shaib Y, El-Serag HB. The prevalence and risk factors of functional dyspepsia in a multiethnic population in the United States. Am J Gastroenterol. 2004;99(11): 2210e2216. 4. Lacy BE, Weiser KT, Kennedy AT, et al. Functional dyspepsia: the economic impact to patients. Aliment Pharmacol Ther. 2013;38:170e177. 5. Park JW, Ko SJ, Han Gj, et al. The effects of Banha-sasim-tang on dyspeptic symptoms and gastric motility in cases of functional dyspepsia: a randomized, dobule-blind, placebo-controlled, and two-center trial. Evid Based Complement Alternat Med. 2013;2013:265035. 6. Ozturk AS, Guzel M, Askar TK, et al. Evaluation of the hormones responsible for the gastrointestinal motility in cattle with displacement of the abomasum; ghrelin, motilin and gastrin. Vet Rec. 2013;172(24), 636‒636. 7. Michal ZL. Gastric ulcer induced changes in substance P and Nk1, Nk2, Nk3 receptors expression in different stomach localizations with regard to intrinsic neuronal system. Histochem Cell Biol. 2019;151:29e42. 8. Gonkowski SW, Rytel LN. Somatostatin as an active substance in the mammalian enteric nervous system. Int J Mol Sci. 2019;20:4461. 9. Zhang SY, Yang P, Li XX, et al. Comparative researches of semen arecae and charred semen arecae on gastrointestinal motility, motilin, substance P, and CCK in chronically stressed rats. Evid Based Complement Alternat Med. 2017;2017:1e8. 10. Li Y, Zhang WY, Ma J, et al. Study on the regulation of brain-gut peptide by Shenling Baizhu San in functional diarrhea rats. J Tradit Chin Med Sci. 2018;2018(5):283e290. 11. Ko SJ, Cho SH, Kim KJ, et al. Herbal medicine Banha-sasim-tang for the treatment of functional dyspepsia protocol for a systematic review of randomized controlled trials. Medicine (Baltim). 2019;98. e15760. 12. Lv L, Wang FY, Ma XX, et al. Efficacy and safety of Xiangsha Liujunzi granules for functional dyspepsia: a multi-center randomized double-blind placebocontrolled clinical study. World J Gastroenterol. 2017;23(30):5589e5601. 13. Zhang J, Xu BH. Modified Xiangsha Liujunzi Decoction for the treatment of 54 cases of functional dyspepsia (spleen deficiency syndrome). Global Tradit Chin Med. 2017;10(6):729e731 [Chinese]. 14. He GH, Zhong ZS, Hu XJ, et al. Meta-analysis of functional dyspepsia treated by Xiangsha Liujunzi decoction. Guiding J Tradit Chine Med Pharm. 2018;24(10): 105e109 [Chinese]. 15. Cai LJ, Fan YH, Lu B, et al. Effect observation of Xiangsha Six Mild-Drug Decoction in treatment of spleen and stomach deficiency type of functional dyspepsia. Chin Arch Tradit Chin Med. 2014;31(8):1974e1976 [Chinese]. 16. Chu MHK, Wu IXY, Ho RST, et al. Chinese herbal medicine for functional dyspepsia: systematic review of systematic reviews. Ther Adv Gastroen. 2018;11:1e24. 17. Liu J, Li F, Tang XD, et al. XiangshaLiujunzi decoction alleviates the symptoms of functional dyspepsia by regulating brainegut axis and production of neuropeptides. BMC Complement Altern Med. 2015;15:387. 18. Liu J, Li F, Tang XD, et al. Reconstruction and assessment of functional dyspepsia with spleen deficiency in TCM. Global Tradit Chin Med. 2015;8(6): 701e705 [Chinese]. 19. Li DX, Ling JH, Wang YJ, et al. Effect of drug-containing serum of immature bitter orange on cell contraction, intracellular Ca2þ concentration and calmodulin expression in rat antral smooth muscle cells. Shijie Huaren Xiaohua Zazhi. 2015;23(8):1224e1230 [Chinese].
20. Chen MD, Hu JH, Ma J, et al. In vitro effects of Pixu Sihao Fang dosed serum on colonic smooth muscle cells in rats with spleen-deficiency functional diarrhea. J Beijing Univ Tradit Chin Med. 2017;40(4):297e301 [Chinese]. 21. Francis J, Critchley D, Dourish CT, et al. Comparisons between the effects of 5HT and dl-fenfluramine on food intake and gastric emptying in the rat. Pharmacol, Biochem Behav. 1995;50(4):581e585. 22. Liu LS, Winston JH, Shenoy MM, et al. A rat model of chronic gastric sensorimotor dysfunction resulting from transient neonatal gastric irritation. Gastroenterology. 2008;134:2070e2079. 23. Lupoli R, Pisano F, Capaldo B. Postprandial glucose control in type 1 diabetes: importance of the gastric emptying rate. Nutrients. 2019;11:1559. 24. Kusano MY, Zai HK, Shimoyama Yk, et al. Rapid gastric emptying, rather than delayed gastric emptying, might provoke functional dyspepsia. J Gastroenterol Hepatol. 2011;26:75e78. 25. Xiao Y, Liu YY, Yu KQ, et al. Chinese herbal medicine liu jun zi tang and Xiang sha liu jun zi tang for functional dyspepsia: meta-analysis of randomized controlled trials. Evid Based Complement Alternat Med. 2012;2012:1e7. 26. Lv L, Wang FY, Tang XD, et al. Effect of PixuIrecipe on gastric smooth muscle contraction force of FD rats with Pi deficiency syndrome. Chin J Integr Tradit West Med. 2018;38(7):825e831 [Chinese]. 27. Krueger T, Melendez P. Effect of ghrelin on feed intake and metabolites in lambs. Appetite. 2012;58(2):758e759. 28. Hu XL, You L, Hu CH, et al. Effects of b-hydroxybutyric acid and ghrelin on the motility and inflammation of gastric antral smooth muscle cells involving the regulation of growth hormone secretagogue receptor. Mol Med Rep. 2019;20: 5050e5058. 29. Heruc GA, Little TJ, Kohn M, et al. Appetite perceptions, gastrointestinal symptoms, ghrelin, peptide YY and state anxiety are disturbed in adolescent females with anorexia nervosa and only partially restored with short-term refeeding. Nutrients. 2018;11:1. 30. Thomas A. Gut motility, sphincters and reflex control. Anaesth Intensive Care Med. 2006;7:57e58. 31. Xue ZZ, Wu CC, Wei JY, et al. An orally administered magnoloside A ameliorates functional dyspepsia by modulating brain-gut peptides and gut microbiota. Life Sci. 2019;233:116749. 32. Fang JL, Wang DH, Zhao Q, et al. Brain-gut axis modulation of acupuncture in functional dyspepsia: a preliminary resting-state fcMRI study. Evid Based Complement Alternat Med. 2015;2015:860463. 33. Van OBJ, Adriaensen D, Van NL, et al. The role(s) of somatostatin, structurally related peptides and somatostatin receptors in the gastrointestinal tract: a review. Regul Pept. 2009;156:1e8. 34. Ruan M, Yu B, Xu L, et al. Attenuation of stress-induced gastrointestinal motility disorder by gentiopicroside, from Gentiana macrophylla Pall. Fitoterapia. 2015;103:265e276. 35. Russo F, Chimienti G, Clemente C, et al. Gastric activity and gut peptides in patients with functional dyspepsia: postprandial distress syndrome versus epigastric pain syndrome. J Clin Gastroenterol. 2017;51:136e144. 36. Jonsson BH, Uvn€ as-Moberg K, Theorell T, et al. Gastrin, cholecystokinin, and somatostatin in a laboratory experiment of patients with functional dyspepsia. Psychosom Med. 1998;60(3):331e337. 37. Fu XY, Li Z, Zhang N, et al. Effects of gastrointestinal motility on obesity. Nutr Metab. 2014;11(1):3. 38. Yang SL, Liu SL. Effect of Shugan Hewei Tang on expression of iNOS and SP in rats with functional dyspepsia. In: Paper Presented at: Compilation of Papers of the 18th Academic Exchange Conference of the Chinese Society of Spleen and Stomach Diseases of the Chinese. Beijing, China: Traditional Medicine Society; 2006. 39. Hiroki I, Fumihiko K, Kazuro I, et al. Effects of domperidone on human plasma levels of motilin, somatostatin, gastrin, adrenocorticotropic hormone and cortisol. Biol Pharm Bull. 2005;28(9):1752e1756. 40. Ling JH, Wei LM, Zhang YQ, et al. Effect of method of soothing liver and regulating qi on expression of gastrin and somatostatin in hypothalamus, gastric antrum of functional dyspepsia rats. Zhongguo Zhongyao Zazhi. 2010;35: 3069e3073 [Chinese]. 41. Sagkan-Ozturk A, Demir EA, Ozturk A. Prokinetics stimulate the increase of ghrelin in mice. Bratisl Lek Listy. 2016;117:726e729.
Please cite this article as: Dai N et al., Effects of Xiangsha Liujunzi decoction drug serum on gastric antrum smooth muscle cells from rats with functional dyspepsia by regulating gastrointestinal hormones, Journal of Traditional Chinese Medical Sciences, https://doi.org/10.1016/ j.jtcms.2020.01.007