Effects of yolkin on the immune response of mice and its plausible mechanism of action

Journal Pre-proof Effects of yolkin on the immune response of mice and its plausible mechanism of action ´ Bo˙zena Obminska-Mrukowicz, Marianna Szczypka, Magdalena Lis, Aleksandra Pawlak, Agnieszka Suszko-Pawłowska, Angelika Sysak, ˛ Aleksandra Zambrowicz, Timo Burster, Maja Kocieba, Jolanta ´ Artym, Ewa Zaczynska, Iwona Kochanowska, Michał Zimecki

PII:

S0165-2478(19)30207-X

DOI:

https://doi.org/10.1016/j.imlet.2020.01.003

Reference:

IMLET 6416

To appear in:

Immunology Letters

Received Date:

17 April 2019

Revised Date:

2 September 2019

Accepted Date:

13 January 2020

´ Please cite this article as: Obminska-Mrukowicz B, Szczypka M, Lis M, Pawlak A, ˛ ´ Suszko-Pawłowska A, Sysak A, Zambrowicz A, Burster T, Kocieba M, Artym J, Zaczynska E, Kochanowska I, Zimecki M, Effects of yolkin on the immune response of mice and its plausible mechanism of action, Immunology Letters (2020), doi: https://doi.org/10.1016/j.imlet.2020.01.003

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2020 Published by Elsevier.

Runnig title: Immunotropic properties of yolkin

Effects of yolkin on the immune response of mice and its plausible mechanism of action

Bożena

Obmińska-Mrukowicza,

Aleksandra

Pawlaka,

Agnieszka

Marianna

Szczypkaa,

Suszko-Pawłowskaa,

Magdalena

Lisa,

Angelika Sysaka,

Zaczyńskad, Iwona Kochanowskad, Michał Zimeckid,*

a

ro of

Aleksandra Zambrowiczb, Timo Bursterc, Maja Kociębad, Jolanta Artymd, Ewa

-p

Department of Pharmacology and Toxicology, Faculty of Veterinary Medicine, University of Environmental

and Life Sciences, Wrocław, Poland b

Department of Animal Products Technology and Quality Management, Faculty of Biotechnology and Food

c

re

Sciences, Wrocław University of Environmental and Life Sciences, Wrocław, Poland d

Biology Department, School of Science and Technology, Nazarbayev University, Kazakhstan Republic

Jo

ur

na

Sciences, Wrocław, Poland

lP

Laboratory of Immunobiology, Institute of Immunology and Experimental Therapy, Polish Academy of

*

Corresponding author at: Laboratory of Immunobiology, Institute of Immunology and

Experimental Therapy, Polish Academy of Sciences, Weigla str. 12, 53-114 Wrocław, Poland

E-mail address: [email protected] (M. Zimecki)

1

Highlights  yolkin is a protein from egg’s yolk  yolkin stimulates the humoral immune response in mice  yolkin inhibits contact sensitivity in mice  yolkin provides differentiation signals for Jurkat and WEHI 231 cells  yolkin significantly increases B cell content in lymphoid organs

ro of

 yolkin may promote immune system maturation in birds

ABSTRACT

-p

Yolkin is a product of proteolytic degradation of vitellogenin, a protein contained in eggs’ yolk, with already described procognitive properties. Here, we investigated effects of yolkin

re

on the humoral and cellular immune response in mice, phenotype of cells from lymphoid organs and function of innate immunity cells. In vitro studies included effects of yolkin on

lP

mitogen-induced thymocyte proliferation, percentage of CD19 cells in bone marrow cells culture, expression of signaling molecules in Jurkat cells, interleukin 2 receptor (IL-2R) subunits in WEHI 231 cells and susceptibility of these cells to anti-Ig-induced cell death. The

na

results showed that repeatable i.p. injections of yolkin stimulated the humoral immune response to sheep red blood cells (SRBC) irrespective of the time of the treatment. On the other hand, yolkin inhibited contact sensitivity to oxazolone. Treatment of mice with yolkin

ur

diminished the percentage of double positive cells and increasing the content of single positive CD4+ and CD8+ cells in the thymus. At the same time an increase of percentage of

Jo

CD19+ B cells in the spleen and mesenteric lymph nodes was observed. In addition, the protein, given i.p., diminished ex vivo ability to synthesize nitric oxide by resident, peritoneal macrophages, stimulated with lipopolisaccharide (LPS). In vitro studies showed that yolkin increased CD19+ cell content in bone marrow cell population. The protein also enhanced proliferation of thymocytes to concanavalin A and stimulated expression of MAP kinases in Jurkat cells. In WEHI 231 B cell line yolkin caused a loss of IL-2R gamma chain expression, correlated with an increased resistance of these cells to proapoptotic action of anti-Ig antibodies. In conclusion, this is a first demonstration of immunotropic properties of yolkin in 2

in vitro and in vivo tests. The results provide evidence for induction of maturation and stimulatory signals in immature T and B cells by the protein, suggesting its potential role in the development of an embryo’s immune system. Keywords: Yolkin Egg proteins Humoral immune response Contact sensitivity T and B cells

ro of

MAP kinases

-p

1. Introduction

Development of vital organs and acquisition of immune functions by a fetus, and

re

subsequently by a newborn, is accomplished in mammals by transfer of nutrients and maternal immunoglobulins [1], and after birth by means of colostrum and milk, containing

lP

peptides and proteins such as colostrinin [2] and lactoferrin [3, 4]. In contrast, there is no such close mother-offspring association in birds, so the egg must contain all constituents necessary for embryo development. In fact, the egg is a rich source of bioactive proteins exhibiting an

na

array of activities [5] including a bird-specific immunoglobulin class IgY [6]. Interestingly, 48 proteins are common to both chicken and human amniotic fluids indicating a close evolutionary link between mammals and birds [7]. Among bioactive egg proteins, a crucial

ur

role is played by phosphorus rich phosvitin, an enzymatic product of vitellogenin [8]. The protein contributes to embryo bone formation [9], neutralizes bacterial products [10], inhibits

Jo

hydroxyl radical formation by binding iron [11] and exhibits antiapoptotic properties [12] thus enhancing innate immunity in the developing embryo. Another bioactive protein, although not so well defined and investigated, is yolkin, which has been identified as a set of low molecular weight peptides and proteins [13]. The fractions of molecular weight (MW), ranging from 16 to 35 kDa, contained glycan moieties and their amino acid sequence corresponded to the sequence of vitellogenin. The authors concluded that this preparation, termed “yolkin”, represented vitellogenin-derived peptides.

3

Yolkin exhibited a character of endogenous regulators of several immune and biochemical processes. In the hitherto conducted studies, yolkin was shown to induce several cytokines (IL-1β, IL-6, IL-8, IL-10 and TNF-α) in human whole blood cultures [13-17]. In addition, a modulating effect of yolkin on nitric oxide secretion by monocytic J774 cell line and an inhibition of cellular lipid oxidation were described [15]. Yolkin, beside its ability to modulate the immune system, may also affect the nervous system. The protein was shown to regulate intracellular processes responsible for production and release of the brain derived neurotrophic factor (BDNF). Yolkin stimulated rat pheochromocytoma PC12 Tet On cell line for secretion of a mature form of BDNF [18] as well as induced production of this mediator in

ro of

a human whole blood cell culture [16]. The protein was subsequently found to improve cognitive parameters in old rats, such as spatial and episodic memory and motor functions, when studied in comparison with colostral peptides [19]. However, no investigations were undertaken to establish its potential effect on the maturation and function of the immune system in vivo. Based on analogy, we hypothesized that, similarly to colostrinin, being a

-p

composition of peptides promoting T-cell maturation [2] and accompanying colostral IgG2 [20], the proteins associated with IgY may also exhibit such properties.

re

Therefore, the aim of this investigation was to evaluate immunotropic actions of yolkin with regard to humoral and cellular immune responses, the effect on T and B cell phenotype in

lP

primary and secondary lymphoid organs and the function of macrophages, representing the innate immunity cells. In addition, in vitro experiments were designed to explain a plausible

na

mechanism of action of the protein. 2. Material and methods

ur

2.1. Mice

The studies were carried out with male and female Balb/c mice, 8-10 weeks old, weighing 1820 g. The experimental animals were obtained from the Breeding Centre of Laboratory

Jo

Animals at the Institute of Occupational Medicine, Łódź, Poland and from the Animal Facility of Mossakowski Medical Research Centre, Polish Academy of Sciences, Warszawa, Poland. The mice were housed in a cage at 21-22 °C with a 12/12-h light/dark cycle and were fed a commercial, pellet food and water ad libitum. Principles of laboratory animal care (NIH publication No 86-23, revised 1985), as well as specific national laws on the protection of animals were followed. The Local Ethics Committee at the Institute of Immunology and

4

Experimental Therapy, Polish Academy of Sciences, Wrocław, Poland, approved the study (permission # 12/2009 and 56/2018).

2.2. Reagents The investigated yolkin was isolated and kindly provided by the research team of the Department of Animal Products Technology and Quality Management, Faculty of Biotechnology and Food Sciences, Wrocław University of Environmental and Life Sciences, Wrocław, Poland. Bovine serum albumin (BSA), fetal calf serum (FCS), ammonium chloride, Ficoll 400, trypan blue, complement-containing sera from guinea pig, 2-mercaptoethanol, 1% sulfanilamide,

0.1%

N-(1-naphthyl)-ethylenediamine

dihydrochloride,

L-glutamine,

ro of

penicillin-streptomycin solution stabilized, HEPES, Alsever’s solution, oxazolone, acetone, lipopolysaccharide (LPS) from Escherichia coli serotype O55:B5, concanavalin A (Con A) were purchased from Sigma-Aldrich (Munich, Germany). Sodium nitrite and 2% phosphoric acid (H3PO4) were purchased from Chempur (Piekary Śląskie, Poland). Prestained Protein

-p

Standard (10-250 kDa) was from BioRad. Hank’s culture medium, phosphate buffered saline (PBS) and RPMI1640 culture medium were obtained from Biowest (Nuaillé, France).

re

Isoflurane (Iso-Vet) was obtained from Piramal Healthcare Limited (UK) and the diatrizoate sodium and meglumine diatrizoate solution (Urografin 76%) from Bayer Schering Pharma

lP

(Poland). Rat Anti-Mouse CD4:FITC/CD8:RPE dual color reagent and Rat Anti-Mouse CD19:FITC/CD3:RPE dual color reagent were obtained from Serotec (Kidlington, UK). Antibody cat. no. 1010-01 directed against mouse IgM, IgG and IgA classes was from

na

SouthernBiotech (Birmingham, AL, USA). Sheep red blood cells (SRBC) were kindly delivered by the Department of Animal Physiology and Biostructure, Wrocław University of Environmental and Life Sciences and stored in Alsever’s solution until use. The sheep blood

ur

was collected into Alsever’s solution in a sterile manner and kept at 4 °C for at least three

Jo

days. The SRBC suspension was prepared ex tempore in PBS.

2.3. Yolkin preparation Hen eggs were bought from a local market. The IgY containing yolkin was isolated from the egg yolks according to a procedure [21] modified later [13]. Next, yolk plasma was salted/fractionated using ammonium sulphate (40% saturation) dialyzed against water (24h) and then against 100 mM potassium phosphate buffer, pH 7.2 (24h) and clarified by centrifugation. This was the starting material for yolkin isolation. Then, IgY containing yolkin was subjected to chromatography in an LC system (BioRad) on a Sephacryl S-100 HR resin. 5

The column was calibrated using bovine serum albumin (66.0 kDa), ovalbumin (45.0 kDa) and lysozyme from hen egg white (11.4 kDa). The samples were loaded onto the chromatographic column (5×80 cm) and equilibrated with 100 mM potassium phosphate buffer, pH 7.2. The 4.4-ml fractions were collected at a flow rate of 1.1 ml/min. and pooled. Eventually, yolkin preparation was dialyzed against water for 24h and lyophilized. The electrophoretic visualization of the yolkin preparation is presented in Fig. 1. The preparation contains two predominant proteins of 40 and 35 kDa with traces of proteins with 30 kDa MW. A preparation of a similar protein composition exhibited neuroprotective and antioxidative

2.4. SDS-PAGE analysis

ro of

actions in our previous study [18].

SDS/polyacrylamide slab gels (15%) were prepared by using TXG Fast Cast Acrylamide solutions (Bio-Rad, California, USA). The yolkin sample (10 μg) was diluted with the buffer containing dithiothreitol as a reducing reagent and loaded on to the gel slab. At the end of

re

2.5. Treatment of mice with yolkin

-p

analysis, the gel slab was stained with Coomassie G-250.

Yolkin (as a lyophilized substance) was dissolved in PBS. The non-immunized mice (for

lP

phenotypic determination, cytokine and nitric oxide induction) were administered with yolkin intraperitoneally (i.p) once or five times at 24h intervals at three different doses of 1.0, 0.1 or 0.01 mg/kg body weight (b.w). The SRBC-immunized mice were administered with yolkin i.p

na

at the same dose (1.0, 0.1 or 0.01 mg/kg b.w.) four times at 24h intervals either prior to or after priming (Scheme 1A). Yolkin was also administered at the same dose four times at 24h intervals before sensitization with oxazolone (Scheme 1B). The trials on the control mice

ur

were conducted in parallel. The mice in the control group received PBS instead of yolkin. The volume of each dose of yolkin or PBS was 0.2 ml per animal. Each control and experimental

Jo

group consisted of 5-7 mice.

2.6. Experimental design for determination of the primary humoral immune response Determination of the humoral immune response to SRBC was performed by measurement of antibody forming cells (AFC) in the spleen and serum hemagglutinin IgM and IgG titers. The mice were immunized i.p. with 0.2 ml of 10% SRBC suspension (4×108 cells per mouse). In a first protocol mice were treated with yolkin on days: -4, -3, -2 and -1 before immunization with SRBC, a version aimed at determination of yolkin’s effect on the immune system cells of 6

mice prior to immunization. In a second protocol, yolkin was administered in four i.p. inoculations 1h after immunization and on days 1, 2 and 3 following immunization. The number of AFC was determined on day four after SRBC injection but anti-SRBC hemagglutinin titre was measured on days four and seven after immunization (for the experimental design, see Scheme 1A). For determination of the number of AFC the mice were anaesthetized with isoflurane and killed by cervical dislocation. The splenocytes producing anti-SRBC antibodies (AFC) were detected by the local hemolysis technique in agar gel, as originally described [22]. The results are presented as mean values of AFC from 7 animals per 106 viable splenocytes  standard error (SE). For determination of the serum hemagglutinin

ro of

IgM and IgG titers the blood samples were taken by retro-orbital bleeding from isofluraneanaesthetized mice. The total (IgM + IgG) and 2-mercaptoethanol resistant (IgG) serum agglutination titers were defined by an active hemagglutination test carried out on microplates [23]. The results were expressed as a log2 hemagglutinin serum titer  SE. The serum of non-

-p

immunized mice did not contain natural anti-SRBC antibodies.

2.7. Cellular immune response – contact sensitivity to oxazolone

re

The test was performed according to a method [24] with our modifications. Mice were given four daily i.p. injections of yolkin (0.01, 0.1 and 1 mg/kg body weight) on days -4, -3, -2 and -

lP

1 before immunization, except control mice, which received PBS i.p. only. 2h after administration of the last yolkin dose the mice were shaved on the abdomen (2×2 cm area) and after 24h 100 μl of 0.5% oxazolone in acetone was applied to all mice except those in the

na

background (BG) group. The contact sensitivity reaction was elicited 5 days later by application of 50 μl of 1% oxazolone in acetone on both sides of the ears. The ear edema was measured 24h later using a spring caliper (for the experimental design see Scheme 1B). The

ur

BG group of mice developed only a nonspecific irritation reaction to oxazolone, dissolved in acetone. The results showing the ear edema are presented as an antigen specific increase of

Jo

ear thickness, i.e., BG ear thickness of mice, given only the eliciting dose of the antigen (nonspecific irritation response), is subtracted from the responses measured in sensitized mice. The results are presented as a mean value of ear thickness measured in 5 mice (10 determinations, as both ears were measured) and expressed in mm ±SE.

2.8. Phenotypic determinations of cell subsets in lymphoid organs Mice were given an i.p. injection of yolkin in a single dose on five consecutive days and were sacrificed by isoflurane anesthesia, followed by cervical dislocation, on days 24h or 72h after

7

the last dose of yolkin. Thymuses, spleens and mesenteric lymph nodes and bone marrow cells were isolated and placed in disposable Petri dishes containing sterile, ice-cold PBS. The cells were released from the lymphatic organs by passing them through a nylon mesh and separating by centrifugation on a layer of Ficoll 400 Urografin 76%, density of 1.071 g/ml, at a ratio of 1:3. The lymphocytes were then collected from the interphase, washed with ice-cold PBS supplemented with 1% BSA and re-suspended in this solution at a density of 1×107 cells/ml. The viability of the cell suspension, determined by trypan blue dye-exclusion assay, was 90-98%. The cells were eventually re-suspended in 100 μl PBS containing 1% BSA. Then, they were stained with a monoclonal rat anti-mouse CD4:FITC/CD8:RPE dual colour reagent (Serotec, UK) or a monoclonal rat anti-mouse CD19:FITC/CD3:RPE dual colour

ro of

reagent (Serotec, UK) according to the manufacturer’s instructions. The cells were incubated at 4°C for 30 min and washed three times with ice-cold PBS. The fluorescence was analyzed using a flow cytometer (FACS Calibur; Becton Dickinson Biosciences, San Jose, CA, USA). Data acquisition and analysis were done using the CellQuest 3.1f software. A two-color

-p

analysis was performed: fluorescence 1 (FL1) – FITC: emission peak 525 nm, fluorescence 2 (FL2) – PE: emission peak 575 nm. Instrument settings used in this study were: FL1: log,

re

voltage 584, FL2: log, voltage 595, the fluorescence compensation: FL1: -1.7 %FL2; FL2: 22.3% FL1. A total of 10 000 events were collected. The cells were identified based on the

lP

level of CD expression within lymphocyte subpopulation as: CD4+CD8-, CD4-CD8+, CD4CD8-, CD4+CD8+, CD3+ and CD19+. The results were presented as a % of appropriate

na

lymphocyte subpopulations (mean ±SE).

2.8. Phenotypic determinations of B cells in bone marrow cell culture Bone marrow cells were cultured at a density of 4×105/100 μl/well with yolkin at a

ur

concentration range of 100-12.5 μg/ml. After overnight incubation cells were collected from the wells, washed twice with ice-cold PBS supplemented with 1% BSA and re-suspended in

Jo

500 μl of this solution. Rat anti-mouse CD19:FITC/CD3:RPE dual colour reagent (Serotec, UK) was used for cell staining. The cells were incubated with antibody solution at 4 °C for 30 min and washed three times with ice-cold PBS. The fluorescence was analyzed using a flow cytometer (FACS Calibur; Becton Dickinson Biosciences, San Jose, CA, USA). Data acquisition and analysis were done using the CellQuest 3.1f software. Cells with expression of CD19 antigen were analyzed. The results were presented as a % of B lymphocyte subpopulation.

8

2.9. Determination of nitric oxide produced by resident peritoneal macrophages stimulated by LPS Mice were given an i.p. injection of yolkin in a single dose on one or on five consecutive days and the resident peritoneal macrophages were harvested at 24h after the last dose of yolkin. Mice were subjected to anesthesia using isoflurane and sacrificed by cervical dislocation. Resident peritoneal macrophages were harvested using sterile, cold PBS supplemented with antibiotics. The cell suspension was centrifuged at 375×g and re-suspended in a culture medium consisting of RPMI 1640 supplemented with 10% FCS, 10 mM HEPES, 2 mM Lglutamine, 10 U/ml of penicillin and 10 μg/ml streptomycin. The viability of macrophages,

ro of

determined by staining with 0.2% trypan blue, was 90-95%. The purity of the cell population macrophages, determined by Pappenheim staining (MGG), was 65-75%. Macrophages were washed twice in the medium, re-suspended to a density of 1.5×106 cells/ml, and redistributed to 96-flat bottom wells (100 μl/well). The samples were cultured for 3h in a cell culture incubator. After the incubation the nonadherent cells were removed and a new culture

-p

medium was added. The cell cultures were subsequently incubated for 18h, the medium

2.5 µg/ml, and incubated for 24h.

re

removed, the cultures supplemented with a new medium containing LPS at a concentration of

The concentration of nitric oxide (NO) released from murine peritoneal macrophages,

lP

stimulated in vitro with LPS, was determined by measurement of nitrite level [25]. The absorbency of the samples was measured using a microplate autoreader at 550 nm wavelength. The concentration of the nitrite (nM) in the samples was calculated by reference

na

to a standard dilution of sodium nitrite ranging from 0.3125 to 20 nM and presented in nM (mean ±SE). Each sample was tested in duplicate.

ur

2.10. Cultures of WEHI 231 and Jurkat cells and total RNA isolation WEHI 231 – a murine B cell line (ATCC, CRL-1702) and Jurkat – a human T cell line

Jo

(ATCC, TIB-152) were obtained from the cell line bank of the Institute of Immunology and Experimental Therapy (Wrocław, Poland). WEHI 231 cells were cultured in medium consisting of DMEM supplemented with 10% fetal bovine serum, L-glutamine, 2mercaptoethanol and antibiotics, at a density of 5×105 cells/ml. Jurkat cells were cultured in medium consisting of RPMI 1640 supplemented with 10% fetal bovine serum, L-glutamine and antibiotics, at a density of 5×105 cells/ml. The cells cultures were exposed overnight to 50 μg/ml of yolkin.

9

Total RNA isolation was carried with TRIzol Reagent (Ambion) accordingly to manufacturer's recommendations. The cell pellet (2×106 cells) was suspended in 1 ml of TRIzol reagent, shaken, incubated for 10 min at room temperature (RT), supplemented with 0.2 ml of chloroform, shaken vigorously for 15 sec, incubated for 3 min at RT and centrifuged at 12 000×g for 15 min at 4 °C. The water phase was collected, transferred to a new tube, supplemented with 0.5 ml of isopropanol, incubated at RT for 10 min and centrifuged at 12 000×g for 10 min at 4 °C. The RNA pellet was washed with 1 ml of 75% ethanol, dried in air and dissolved in 20-30 μl of sterile diethylpyrocarbonate-treated Mili-Q water. RNA samples

ro of

were stored at -20 °C.

2.11. Reverse transcription

Single stranded complementary DNA (cDNA) was synthesized with oligo (dT)12-18 primers from 5 μg of total RNA using Novazym VerteKit, accordingly to the manufacturer's

-p

instruction.

2.12. Quantitation of gene expression by Real Time PCR

re

Expression of the genes, i.e. MAPK and IL-2R was measured using AmpliQ 5× HOT EvaGreen qPCR Mix (Novazym). The reaction was performed in Bio-Rad CFX thermocycler

lP

starting with 5 min of preincubation at 95 °C followed by 40 amplification cycles as follows: 15 sec of denaturation at 95 °C, 30 sec of annealing at 53 ºC and 30 sec of elongation at 72 ºC, and final elongation for 10 min at 72 ºC. GAPDH was used as a housekeeping gene for

listed in Table 1.

na

arbitrary unit calculation for every tested gene and equals 1. The sequences of primers are

ur

2.13. Proliferation test

Thymocytes were isolated from naive BALB/c mice and at a density of 5×105/well/100 μl in

Jo

the culture medium were preincubated for 1h with 100-12.5 μg/ml of yolkin, followed by addition of Con A (2.5 μg/ml). After 48h incubation in a cell culture incubator the rate of cell proliferation was measured using the MTT colorimetric assay [26]. The results are presented as mean optical density (OD) values from quadruplicate wells ±SE.

2.14. Treatment of WEHI 231 cells with yolkin and anti-mouse Ig antibodies The cells in microtiter wells (2.5×104 cells/well/100 μl in the culture medium) were preincubated with yolkin (50 μg/ml) for 4h followed by addition of anti-mouse Ig antibodies 10

(5-1.2 μg/ml). After 24h incubation the cell viability was determined by MTT colorimetric method [26].

2.15. Colorimetric MTT assay for cell growth A MTT colorimetric assay was used to establish of viability of cells [26]. Briefly, 25 µl of MTT (5 mg/ml) stock solution was added per well at the end of cell incubation period and the plates were incubated for additional 3h in a cell culture incubator. Then, 100 µl of the extraction buffer (20% SDS with 50% DMF, pH 4.7) was added. After an overnight incubation the OD was measured at 550 nm with the reference wavelength of 630 nm in a

ro of

Dynatech 5000 spectrophotometer.

2.16. Statistical analysis

Each experimental group consisted of 5-7 mice. The results were subjected to statistical analysis using analysis of variance (one-way ANOVA) in STATISTICA 7 for Windows.

-p

Brown-Forsyth’s test was used to determine the homogeneity of variance between groups. Due to non-constant variance, the data were analyzed using the non-parametric Kruskal-

re

Wallis’ analysis of variance, followed by Dunn’s test to estimate the significance of the difference between groups. Significance was determined at P < 0.05 and P < 0.01. The results

lP

are presented as mean values ± SE. with similar results were obtained in two other experiments.

na

3. Results

3.1. Effects of yolkin on the humoral immune response to sheep erythrocytes

ur

We established that four i.p. applications of yolkin, every 24h, before immunization, significantly elevated anti-SRBC hemagglutinin titer of IgM class on day 4 after

Jo

immunization (Table 2) and IgG class on day 7 after immunization (Table 3). The stimulatory effect of yolkin, given before immunization and determined by the antibody titer, was not dose-dependent. Interestingly, a significant increase in AFC number was registered upon application of yolkin at 0.1 and 0.01 mg/kg b.w but not at 1 mg/kg b.w. before immunization (Table 2). Similar and even stronger stimulatory effects on antibody titer and AFC number were observed when yolkin was administered in four daily doses after immunization (Table 2 and 3).

11

3.2. Effect of yolkin on the manifestation of contact sensitivity to oxazolone Yolkin, administered in four daily i.p. injections, at doses of 1, 0.1 or 0.01 mg/kg b.w., prior to sensitization of mice with oxazolone suppressed the ear edema measured 24h after application of an eliciting dose of antigen (Fig. 2). This effect was dose-dependent, i.e., 0.01 mg dose was not suppressive, 0.1 mg dose gave statistically significant suppression (P = 0.02) and 1 mg dose was less inhibitory. Similar results were obtained when we calculated inhibition of the ear edema without subtraction of nonspecific, background values (data not shown).

ro of

3.3. Effects of yolkin administration on phenotypic changes of T and B cells in the primary and secondary lymphoid organs

Due to a very high volume of experimental data generated using various protocols (single or multiple yolkin administrations, three doses of the protein and for the sake of clarity of data presentation), we show in the tables only the most significant results regarding changes of cell

-p

phenotype in the lymphoid organs. A complete set of experimental data regarding changes in cell phenotypes in respective organs is included in the Supplementary material.

re

The results indicate that yolkin significantly increased the content of single positive CD8+ cells and CD4+ cells in the thymus (Table 4). At the same time, the percentage of double

dose of 5 × 1 mg/kg b.w.

lP

positive cells was lower. Also, a significant increase of double negative cells took place at the

More evident changes in the composition of cell types were observed in the spleen (Table 5).

na

It appeared that yolkin significantly elevated the percentage of CD19+ cells in the spleen. In this case the lowest, repeatable application of yolkin was most effective (the effects of other protocols are not shown). Consequently, the content of cells bearing pan T cell marker (CD3),

ur

helper (CD4+) and suppressor/cytotoxic (CD8+) T cell phenotypes was lower. Interestingly, CD4+/CD8+ cell ratio increased from 3.33 to 4.39.

Jo

The phenotypic determination in the mesenteric lymph nodes was performed at 72h after the last dose (Table 6). Yolkin was administered on five consecutive days. The results show very significant increases of the content of CD19+ cells, distinctly dependent on the dose of yolkin used, i.e., the lower the dose of yolkin, the stronger the stimulatory effect. The content of CD3+ and CD4+ cells was consequently reduced. Of note, CD4+/CD8+ ratio was significantly increased at the lowest dose of yolkin.

12

3.4. Effect of yolkin administration on release of NO by resident peritoneal macrophages stimulated in vitro with LPS Irrespective of number of applications, as well as dose, yolkin did not change synthesis and release of IL-1 by resident macrophages stimulated by LPS (Supplementary material). On the other hand, administration of yolkin significantly decreased production of nitric oxide by resident peritoneal macrophages, stimulated in culture with LPS (Table 7). The strongest inhibitory action of yolkin was observed after five applications at a dose of 0.1 mg/kg b.w. No significant effect on nitric oxide production was noted for application of yolkin at 1 mg/kg

ro of

b.w. dose (five applications) and 0.01 mg/kg b.w. dose (one application).

3.5. Effect of yolkin on concanavalin A-induced thymocyte proliferation

Our preliminary experiments revealed that yolkin enhanced Con A-induced thymocyte proliferation in a dose-dependent manner. The degree of stimulation required a short-term preincubation with yolkin and depended on a cell density. The results show that the cell

-p

number of 5×105/well was optimal and the best stimulation was achieved at yolkin concentration range of 50-25 μg/ml (Fig. 3). The stimulation of thymocyte proliferation was

re

also found in double negative CD4-CD8- thymocyte subpopulation (data not shown).

lP

3.6. Recruitment of CD19+ cells in bone marrow cell culture

The above presented results documented significant increases in the content of CD19+ B cells in the spleen and mesenteric lymph nodes after i.p. administration of yolkin. It could be,

na

therefore, assumed that yolkin promoted migration of B cells from bone marrow to secondary lymphoid organs. Moreover, yolkin could also accelerate maturation of B cells in the bone marrow. Table 8 shows that overnight incubation of freshly isolated murine bone marrow

ur

cells with different concentration of yolkin (100-12.5 g/ml) increased the content of CD19+

Jo

cells when lymphocytes or all bone marrow cell population is analyzed. 3.7. Effect of yolkin on expression of MAP kinases in Jurkat cells The cell fate depends on eliciting respective cell signaling pathways which may result in cell activation, differentiation or apoptosis. Mitogen activated protein kinases are important in determining the cell fate and triggering of expression of all MAP groups leads to cell activation and differentiation [27]. The results shown in Table 9 indicate that yolkin (50

13

μg/ml) stimulates expression of all MAP kinases (ERK, p38 and JNK) in Jurkat immature T cell line. 3.8. Effect of yolkin on expression of IL-2R subunits and its effect on susceptibility of WEHI 231 cells to anti-mouse Ig treatment As shown above yolkin given to mice significantly elevated the content of CD19+ B cells in the mouse lymphoid organs (Tables 5 and 6) and in bone marrow cell cultures (Table 8). The effect of yolkin on B cells may also depend on promotion of B cell maturation. Loss of functionality of IL-2 receptor is associated with a maturation process in B cells [28]. The results presented in Table 10 indicate that in parallel to expression of MAP kinase genes

ro of

following incubation with yolkin (50 μg/ml) a loss of IL-2Rγ expression, responsible for signal transduction [29] was observed in WEHI 231 B immature cells.

In addition (Fig. 4) the pretreatment of WEHI 231 cells with yolkin partially protects the cells against anti-immunoglobulin treatment with a significant effect at anti-Ig concentration of 2.5

-p

and 1.2 μg/ml.

re

4. Discussion

In this investigation we demonstrated for the first time that yolkin, the product of vitellogenin

lP

degradation, applied in mice in several i.p. doses, may affect development of the immune response and cell phenotype in lymphoid organs. Yolkin potentiated the humoral immune response to SRBC, a T cell dependent antigen, measured by number of antibody forming cells

na

and specific hemagglutinin serum titer. Yolkin was also effective when applied after immunization. On the other hand, the cellular immune response, represented by the model of contact sensitivity, was inhibited. The adjuvant property of yolkin depended both on the dose

ur

and number of applications. The stimulatory actions of yolkin on the immune response were accompanied by phenotypic changes in thymus, spleen and lymph nodes. In addition, yolkin

Jo

decreased the release of nitric oxide by macrophages indicating an effect of the protein on cells of the innate immunity system. Yolkin was devoid of cytotoxic properties. On the contrary, at a higher concentration (100200 μg/ml) it even enhanced, although not significantly, the viability of murine lymphoblast D10.G4.1 cell line (ATCC, Rockville, MD, USA) (Supplementary material). Such a result suggests that yolkin may elicit signaling pathways leading to cell activation/survival and protection against apoptosis. In fact, yolkin significantly upregulated expression of MAP kinases (ERK1, ERK2, JNK1, JNK2, JNK3, p38 α, β and δ) in Jurkat cells.

14

Phenotypic determinations of T-cell subsets in the thymus revealed some significant changes, suggesting induction of a maturation process among thymocytes and an increased output of cells into periphery. Such a possibility may be supported by a significant decrease of double positive cells and an increase of single positive cell content, significant for both CD4+ and CD8+ cells. More significant increases were observed in the case of CD19+ B cells in the spleen and lymph nodes. Together with an increased CD4+/CD8+ cell ratio in the spleen, these changes may account for the elevated humoral immune response to SRBC, since this type of antigen is T-cell dependent and requires help from Th2 type CD4+ cells. As both the pretreatment and the delayed treatment of mice (following immunization) with yolkin were

ro of

comparably effective, one may assume that, in the first case, recruitment of a larger B cell pool was relevant as well as a stimulatory effect on antigen presenting cell function by peritoneal macrophages.

Interestingly, the effect of yolkin on development of contact sensitivity, a T-cell dependent delayed type immune response, was inhibitory albeit this action was not very significant as in

-p

the case of the humoral immune response. The protein exhibited a regulatory action, i.e., the lowest and the highest doses were not as efficient as the medium one, thus resembling a dose-

re

dependent, U-shaped action of lactoferrin in suppression of allergen-specific pleurisy in mice [30]. The inhibition of the cellular response by pretreatment with yolkin could be explained

lP

by a preferential expansion of B-cell pool and suppression of Th1 cell dependent cytokines, responsible for development of contact sensitivity reaction. In fact, since the effectual phase of contact sensitivity exhibits features of inflammation, the property of inhibition of inducible

na

nitric oxide synthesis may also serve as an explanation, since dilation of capillary blood vessels in the ear should be diminished in this way. Additional experiments with cells of the innate immune system revealed that yolkin also affected this important type of immunity.

ur

Yolkin exhibited an anti inflammatory action by inhibiting LPS-inducible nitric oxide production in macrophage cultures. Also, the protein (only at the highest, repeatable dose of 5

Jo

× 1 mg/kg b.w.) increased neutrophil phagocytosis of FITC-opsonized E. coli, measured as mean fluorescent intensity. Thus, yolkin may ameliorate an excessive inflammatory response by lowering activation of macrophage stimulated with bacterial products and increase phagocytic activity of neutrophils. In summary, our in vivo an ex vivo results showed that yolkin, administered at i.p. doses, may primarily promote development of the humoral arm of the immune response and, to a lesser degree, the activity of innate immunity cells. In vitro experiments provided some insight into possible mechanism of the immunotropic action of yolkin. Firstly, yolkin stimulated proliferation of thymocytes to concanavalin A 15

indicating that immature T cells are the targets for its action. The phenomenon may be associated with some increase of mature (single positive) T cell content in the thymus. Such an action of yolkin was supported by the upregulation of mitogen activated protein kinases expression in Jurkat T cells. The effect of yolkin on activation of B cell compartment was even more evident. The significant increases in B cell content in spleens and lymph nodes of mice treated with yolkin resulted probably from an increased recruitment of B cells in the bone marrow, as demonstrated in bone marrow cell cultures. Indeed, in the model of immature WEHI 231 B cells we showed that yolkin promoted cell maturation by inducing a loss of IL-2R function. Although internalization of IL-2 may be mediated via several combinations of IL-2R subunits [28] the expression of gamma IL-2R subunit is essential for

ro of

functionality of the receptor [29]. In fact, our results showed a block in the expression of γ chain following yolkin treatment of WEHI 231 cells, suggesting a significant loss of IL-2R function. Consequently, yolkin partially limited loss of viability in WEHI 231 cells upon treatment with anti-Ig antibodies, a feature of B cells in a more mature stage [31,32]. We

-p

found a similar action in the case of lactoferrin, a B cell maturation protein, using the same model [33].

re

In summary, the results presented in this work provided some insight regarding the mode of action of yolkin. Firstly, yolkin was shown to increase the recruitment of mature B cells in the

lP

bone marrow and significant increases of CD19+ cells in secondary lymphoid organs. Secondly, the action of yolkin on immature B cell WEHI 231 showed that the changes in expression of IL-2R subunits, reflecting a process of B cell maturation, were correlated with

na

the increased ability of these cells to resist anti-Ig-mediated apoptosis. T cells are also affected by yolkin as evidenced by some increase of mature thymocyte subset, stimulation of mitogen-induced proliferation of thymocytes and activation of all families of MAP kinases in

ur

Jurkat cells.

Jo

5. Conclusions

Overall, the effects of yolkin on cells of the immune system indicate preferential activation of cells constituting the humoral immune response. In addition, the results strongly suggest that yolkin may fulfill analogous role in promotion of immune system maturation of egg laying animals as the proline rich polypeptide, lactoferrin and other bioactive proteins in milk in mammals. Assuming that yolkin affects maturation and function of immunocompetent cells, our further efforts will be aimed at evaluation of preventive and therapeutic utility of yolkin in

16

mouse in vivo models corresponding to human diseases, as innate and pharmacologically induced immunodeficiencies.

CONFLICT OF INTEREST The authors declare no conflict of interest

Acknowledgement This work was co-financed by the European Union within the European Regional

ro of

Development Fund [Project No. POIG.01.03.01-00-133/08, Innovative Technologies of Production of Biopreparations based on New Generation Eggs (OVOCURA)].

We would like to thank Professors Antoni Polanowski and Tadeusz Trziszka (Department of Animal Products Technology and Quality Management, Faculty of Biotechnology and Food Sciences, Wrocław University of Environmental and Life Sciences, Wrocław, Poland) for

-p

producing and providing the active polypeptide complex, yolkin, from chicken egg yolk.

re

References

[1] E. Jauniaux, D. Jurkovic, B. Gulbis, C. Liesnard, C. Lees, S. Campbell, Materno-fetal

lP

immunoglobulin transfer and passive immunity during the first trimester of human pregnancy, Hum. Reprod. 10 (1995) 3297–3300. [2] M. Zimecki, A proline-rich polypeptide from ovine colostrum: colostrinin with

na

immunomodulatory activity, Adv. Exp. Med. Biol. 606 (2008) 241–250. [3] K. Rak, D. Kornafel, D. Mazurek, M. Bronkowska, Lactoferrin level in maternal serum is

ur

related to birth anthropometry – an evidence for an indirect biomarker of intrauterine homeostasis? J. Matern. Fetal. Neonatal. Med. 19 (2018) 1–8. [4] D. Sharma, S. Shastri, Lactoferrin and neonatology – role in neonatal sepsis and

Jo

necrotizing enterocolitis: present, past and future, J. Matern. Fetal Neonatal. Med. 29 (2016) 763–770.

[5] Y.F. Liu, I. Oey, P. Bremer, A. Carne, P. Silcock, Bioactive peptides derived from egg proteins: a review, Crit. Rev. Food Sci. Nutr. 13 (2017) 1–23. [6] A. Polson, M.B. von Wechmar, M.H. van Regenmortel, Isolation of viral IgY antibodies from yolks of immunized hens, Immunol. Commun. 9 (1980) 475–493.

17

[7] M. Da Silva, C. Dombre, A. Brionne, P. Monget, M. Chessé, M. De Pauw, M. Mills, L. Combes-Soia, V. Labas, N. Guyot, Y. Nys, S. Rehault-Godbert, The unique features of proteins depicting the chicken amniotic fluid, Mol. Cell. Proteomics (2018) pii: mcp.RA117.000459. [8] J.L. Christmann, M.J. Grayson, R.C. Huang, Comparative study of hen yolk phosvitin and plasma vitellogenin, Biochemistry 16 (1977) 3250–3256. [9] C. Li, F. Geng, X. Huang, M. Ma, X. Zhang, Phosvitin phosphorus is involved in chicken embryo bone formation through dephosphorylation, Poult. Sci. 93 (2014) 3065–3072. [10] L. Hu, C. Sun, S. Wang, F. Su, S. Zhang, Lipopolysaccharide neutralization by a novel

ro of

peptide derived from phosvitin, Int. J. Biochem. Cell. Biol. 45 (2013) 2622–2631. [11] S. Ishikawa, Y. Yano, K. Arihara, M. Itoh, Egg yolk phosvitin inhibits hydroxyl radical formation from the fenton reaction, Biosci. Biotechnol. Biochem. 68 (2004) 1324–1331. [12] R. Fujisawa, M. Mizuno, M. Tamura, Effect of dentin phosphoprotein on phosphateinduced apoptosis of odontoblast-like cells, Cells Tissues Organs 189 (2009) 60–64.

-p

[13] A. Polanowski, A. Sosnowska, A. Zabłocka, M. Janusz, T. Trziszka, Immunologically active peptides that accompany hen egg yolk immunoglobulin Y: separation and

re

identification, Biol. Chem. 394 (2013) 879–887.

[14] A. Polanowski, A. Zabłocka, A. Sosnowska, M. Janusz, T. Trziszka, Immunomodulatory

3096.

lP

activity accompanying chicken egg yolk immunoglobulin Y, Poult. Sci. 91 (2012) 3091– [15] A. Zabłocka, A. Sosnowska, A. Urbaniak, M. Janusz, A. Polanowski, Peptides chicken

egg

yolk

na

accompanying

IgY-alternative

methods

of

isolation

and

immunoregulatory activity, Food Funct. 5 (2014) 724–733. [16] A. Zambrowicz, A. Zabłocka, Ł. Bobak, J. Macała, M. Janusz, A. Polanowski, T.

ur

Trziszka, A simple and rapid method of isolation of active polypeptide complex, yolkin, from chicken egg yolk, Food Chem. 230 (2017) 705–711.

Jo

[17] A. Zambrowicz, A. Zabłocka, M. Sudoł, Ł. Bobak, P. Sosicka, T. Trziszka, The effect of carbohydrate moieties on immunoregulatory activity of yolkin polypeptides naturally occurring in egg yolk, LWT 88 (2018) 165–173.

[18] A. Zabłocka, A. Zambrowicz, J. Macała, W. Kazana, A. Polanowski, Yolkin – a polypeptide complex isolated from chicken egg yolk with potential neuroprotective and antioxidative activity, Neuropsychiatry (London) 8 (2018) 833–842. [19] M. Lemieszewska, M. Jakubik-Witkowska, B. Stańczykiewicz, A. Zambrowicz, A. Zabłocka, A. Polanowski, T. Trziszka, J. Rymaszewska, Pro-cognitive properties of the 18

immunomodulatory polypeptide complex, yolkin, from chicken egg yolk and colostrumderived substances: analyses based on animal model of age-related cognitive deficits, Arch. Immunol. Ther. Exp. 64 (2016) 425–434. [20] M. Janusz, K. Starościk, M. Zimecki, Z. Wieczorek, J. Lisowski, Physicochemical properties of a proline-rich polypeptide (PRP) from ovine colostrum, Arch. Immunol. Ther. Exp. 26 (1978) 17–21. [21] K.Y. Ko, D.U. Ahu, Preparation of immunoglobulin Y from egg yolk using ammonium sulfate precipitation and ion exchange chromatography, Poult. Sci. 86 (2007) 400–407. [22] R.I. Mishell, R.W. Dutton, 1967. Immunization of dissociated spleen cell cultures from normal mice, J. Exp. Med. 126 (1967) 423–442.

ro of

[23] A. Drynda, B. Obmińska-Mrukowicz, M. Mączyński, S. Ryng, The effect of 5-amino-3methyl-4-isoxazolecarboxylic acid hydrazide on lymphocyte subsets and humoral immune response in SRBC-immunized mice, Immunopharmacol. Immunotoxicol. 37 (2015) 148– 157.

-p

[24] F.P. Noonan, W.J. Halliday, Studies of contact hypersensitivity and tolerance in vitro and in vitro. I. Basic characteristics of the reactions and confirmation of an immune response

re

in tolerant mice, Int. Arch. Allergy Appl. Immunol. 56 (1978) 523–532. [25] D.J. Stuehr, M.A. Marletta, Mammalian nitrate biosynthesis: mouse macrophages

lP

produce nitrite and nitrate in response to Escherichia coli lipopolysaccharide, Proc. Natl. Acad. Sci. USA 82 (1985) 7738–7742.

[26] M.B. Hansen, S.E. Nielsen, K. Berg, Reexamination and further development of a

na

precise and rapid dye method for measuring cell growth/cell kill, J. Immunol. Methods, 119 (1989) 203–210

[27] C.L. Sutherland, A.W. Heath, S.L. Pelech, P.R. Young, M.R. Gold, Differential

ur

activation of the ERK, JNK, and p38 mitogen-activated protein kinases by CD40 and the B cell antigen receptor, J. Immunol. 157 (1996) 3381–3390.

Jo

[28] I. Steinberger, H. Ben-Bassat, E. Hochberg, H. Lorberboum-Galski, Interleukin-2 (IL-2) receptor α, β and γ subunit expression as a function of B-cell lineage ontogeny: the use of IL-2-PE66 (4Glu) to characterize internalization via IL-2 receptor subunits, Scand. J. Immunol. 46 (1997) 129–136. [29] K. Sugamura, T. Takeshita, H. Asao, S. Kumaki, K. Ohbo, K. Ohtani, M. Nakamura, The IL-2/IL-2 receptor system: involvement of a novel receptor subunit, gamma chain, in growth signal transduction, Tohoku J. Exp. Med. 168 (1992) 231–237.

19

[30] M. Zimecki, J. Artym, M. Kocięba, K. Kaleta-Kuratewicz, M.L. Kruzel, Lactoferrin restrains allergen-induced pleurisy in mice, Inflamm. Res. 61 (2012) 1247–1255. [31] M.C. Raff, J.J. Owen, M.D. Cooper, A.R. Lawton 3rd, M. Megson, W.E. Gathings, Differences in susceptibility of mature and immature mouse B lymphocytes to antiimmunoglobulin-induced immunoglobulin suppression in vitro. Possible implications for B-cell tolerance to self, J. Exp. Med. 142 (1975) 1052–1064. [32] J. Chen, A. Ma, F. Young, F.W. Alt, IL-2 receptor α chain expression during early B lymphocyte differentiation, Int. Immunol. 6 (1994) 1265–1268. [33] E. Zaczyńska, I. Kochanowska, M. Kruzel, M. Zimecki, Lactoferrin prevents

Jo

ur

na

lP

re

-p

differentiation, Folia Biol (Praha) 64 (2018) 16–22.

ro of

susceptibility of WEHI 231 cells to anti-Ig-induced cell death promoting cell

20

Jo

ur

na

lP

re

-p

ro of

Figure and table legends:

Scheme 1. Scheme of tests: humoral immune response (A) and contact sensitivity to oxazolone (B).

21

ro of -p re lP na ur

Jo

Fig. 1. Electrophoretic visualization of the yolkin preparation. Yolkin was isolated according to the procedure described above and subjected to SCD-PAGE analysis. The preparation contains two predominant proteins of 40 and 35 kDa with traces of proteins with 30 kDa MW.

22

ro of

Fig. 2. Suppression of ear edema in contact sensitivity reaction to oxazolone by yolkin.

-p

Mice were given four daily i.p. injections of yolkin (1, 0.1 and 0.01 mg/kg body weight) in a single dose on -4, -3, -2 and -1 before immunization with 0.5% oxazolone on abdomen (on

re

day 0). The contact sensitivity reaction was elicited 5 days later by application of 1% oxazolone on the ears. The ear edema was measured 24h later using a spring caliper. Antigen

lP

specific increase of ear thickness (BG is subtracted from the responses measured in sensitized mice) is presented and expressed as a mean value of ear thickness measured in 5 mice (10

Jo

ur

na

determinations) in mm ±SE. *statistically significant in comparison to control (P < 0.05)

23

ro of

-p

Fig. 3. Stimulatory action of yolkin on concanavalin A induced murine thymocyte proliferation.

Thymocytes were preincubated for 1h with 100-12.5 μg/ml of yolkin, followed by addition of

re

Con A. After a 48h incubation the rate of cell proliferation was measured using the MTT colorimetric assay. The results are presented as mean OD values from quadruplicate wells

Jo

ur

na

lP

±SE. *statistically significant in comparison to control (P < 0.05)

24

ro of

Fig. 4. Protective action of yolkin on anti-Ig-induced loss of viability in WEHI 231 cells.

The cells were preincubated with yolkin (50 μg/ml) for 4h followed by addition of anti-Ig antibodies (5-1.2 μg/ml). After 24h incubation the cell viability was determined by MTT

-p

colorimetric method. The results are presented as mean OD values from quadruplicate wells

Jo

ur

na

lP

re

±SE. *statistically significant in comparison to control (P < 0.05)

25

Table 1. Primer sequences used in this study.

Table 2. Effect of yolkin on the humoral immune response to SRBC measured as AFC numbers and serum antibody titer to SRBC on day 4 after immunization. Mice were given four daily i.p. injections of yolkin (doses 1, 0.1 and 0.01 mg/kg b.w.) in a single dose on -4, -3, -2 and -1 before immunization with SRBC (day 0) or 1h after immunization and on days 1, 2 and 3 following immunization. The number of AFC and antiSRBC hemagglutinin titers were determined on day 4 after the antigen stimulation. The

ro of

results are presented as the number of AFC per 106 viable splenocytes and as log2 hemagglutinin serum titer (mean values ±SE); *statistically significant in comparison to control (P < 0.05), **statistically significant in comparison to control (P < 0.01)

Table 3. Effect of yolkin on the humoral immune response to SRBC measured as the serum

-p

antibody titer to SRBC determined on day 7 after immunization.

Mice were given four daily i.p. injections of yolkin (1, 0.1 and 0.01 mg/kg b.w.) in a single

re

dose on -4, -3, -2 and -1 before immunization with SRBC (on day 0) or 1h after immunization and on days 1, 2 and 3 following immunization. Anti-SRBC hemagglutinin titers were

lP

determined on day 7 after the antigen stimulation. The results are presented as log2 hemagglutinin serum titer (mean values ±SE); *statistically significant in comparison to control (P < 0.05); **statistically significant in comparison to control (P < 0.01)

na

Table 4. The effect of yolkin on subpopulation of thymocytes in BALB/c mice. Mice were given i.p. injections of yolkin (1 and 0.1 mg/kg b.w.) in a single dose on five

ur

consecutive days and the phenotypic determination was performed 24h after the last dose of yolkin. The results were presented as a percentage of appropriate lymphocyte subpopulations (mean ±SE); *statistically significant in comparison to control (P < 0.05); **statistically

Jo

significant in comparison to control (P < 0.01)

Table 5. The effect of yolkin on the percentage of B cells and subpopulations of T cells in the spleen in BALB/c mice. Mice were given i.p. injections of yolkin (0.01 mg/kg b.w.) in a single dose on five consecutive days and the phenotypic determination was performed 72h after the last dose. The

26

results were presented as % of appropriate lymphocyte subpopulations (mean ±SE); **statistically significant in comparison to control (P < 0.01)

Table 6. The effect of yolkin on the percentage of B cells and subpopulations of T cells in the mesenteric lymph nodes. Mice were given i.p. injections of yolkin (1, 0.1 and 0.01 mg/kg b.w.) in a single dose on five consecutive days and the phenotypic determination was performed 72h after the last dose. The results were presented as a % of appropriate lymphocyte subpopulations (mean ±SE); *statistically significant in comparison to control (P < 0.05); **statistically significant in

ro of

comparison to control (P < 0.01)

Table 7. The effect of yolkin on synthesis and release of NO by mouse peritoneal macrophages stimulated with LPS.

Mice were given i.p. injections of yolkin (1, 0.1 and 0.01 mg/kg b.w.) in a single dose on one

-p

day or on five consecutive days and the resident peritoneal macrophages were harvested 24h after the last dose and incubated with LPS for 24h. Concentration of NO in the supernatants

re

was presented in nM (mean ±SE); *statistically significant in comparison to control (P <

lP

0.05); **statistically significant in comparison to control (P < 0.01)

Table 8. The effect of yolkin on the content of CD19+ B cells in bone marrow cell culture. Bone marrow cells were cultured at a density of 4×105/100 μl/well with yolkin at a

na

concentration range of 100-12.5 μg/ml. After an overnight culture the phenotypic determination was performed using rat anti-mouse CD19:FITC/CD3:RPE dual colour reagent

ur

(Serotec, UK) and the results were presented as a % of B lymphocyte subpopulation.

Table 9. The effect of yolkin on expression of MAP kinases in Jurkat cells.

Jo

Jurkat cells were cultured overnight at a density of 1×105 cells/ml with 50 μg/ml of yolkin. The procedures leading to determination of MAP kinase expression are described in the Material and methods section and the sequences of primers are presented in Table 1.

Table 10. The effect of yolkin on expression of MAP kinases and IL-2R subunits in WEHI 231 cells.

27

WEHI 231 cells were cultured overnight at concentration of 1×106 cells/ml with 50 μg/ml of yolkin. The procedures regarding molecular techniques are described above and the sequences of relevant primers are listed in Table 1.

Tables:

Table 1. Sequence

p38 p38δ JNK1 JNK2 JNK3 JNK IL-2Rα IL-2Rβ IL-2R

Table 2

ro of

p38β

5' CTCCACTCACGGCAAATTCAACGG 3' 5' GGTGAAGACACCAGTAGACTCCA 3' 5' TACCTGGACCAGCTCAACCACATT 3' 5' AGCAGGTCAAGAGCTTTGGAGTCA 3' 5' GGAACAGGTTGTTCCCAAATGCTGAC 3' 5' CTCCTTAGGTAAGTCGTCCAACTCC 3' 5' GAAGTCATCAGCTTTGTGCCACC 3' 5' CCACAAAGATAGGTGGACAGACG 3' 5' TGGCACCCATGAAATTGAGCAGTG 3' 5' GGCATATGTACACATCCGTGCATTCC 3' 5' GGACATTTGGTCCGTTGGCTGCAT 3' 5' CCATGTAGTTCTTGGCCTCTGC 3' 5' AGAAGGTGGCCATCAAGAAGCTGA 3' 5' TCCAGAAGCCCAATGACGTTCTCA 3'

-p

p38α

5' AGTCAGCCGCATCTTCTTTT 3' 5' TGAGGTCAATGAAGGGGTCA 3' 5' GTGGCCCCAGTTCAATCTC 3' 5' GGGTTTGAATGAGATGAGGGG 3' 5' TATTACGACCCGAGTGACGA 3' 5' AAGAACACCGATGTCTGAGC 3' 5' CTGAGGTATATCCACGCTGC 3' 5' TGTAGCGCATCCAATTCAAGA 3' 5' ACAGTGGATATCTGGTCCGT 3' 5' ATATATGTCCGGGCGTGTTC 3' 5' TATGCGTCTGACAGGAACAC 3' 5' GGGCCGCTGTAATTCTCTTA 3' 5' GGCACATGGCCTGTGTAATA 3' 5' TAGGAAATGTCCCCCACCTT 3' 5' GTCCTCCAACACCCGTACAT 3' 5' TGTGCTAAAGGAGAGGGCTG 3' 5' GCTCTGCGTCACCCATACAT 3' 5' GCATCTGTGCTGAAGGCTGA 3' 5' GCCTTCTCCTTCAGCACAG 3' 5' AGGCAGGCGGCTAGTCAC 3'

re

ERK2

Mouse

F R F R F R F R F R F R F R F R R F F R F R F R F R F R

lP

ERK1

Human

5' AGCTCGGAACACCTTGTCCTGAAT 3' 5' GGAGAGCTTCATCTACGGAGATCC 3'

5' AATGCACAAGCTCTGCCACT 3' 5' ATTTTGCAGACGCTCTCAGC 3' 5' CTCTGGGCTTTTAGTCTTTGCG 3' 5' AGCATGTGAACTGGGAAGTG 3' 5' CTCGTCAGTGAGATTCCCCC 3' 5' TGAAGGGGTGCTTACATGGG 3'

na

GAPDH

Vector

ur

Gene

Jo

Yolkin given before immunization (dose/kg b.w.) Parameter Control 4 × 1 mg 4 × 0.1 mg 4 × 0.01 mg 6 AFC/10 1293.57 1992.86 2422.86* 2730.43** cells ±88.76 ±264.35 ±290.0 ±261.92 IgM (log2) IgG (log2)

7.29 ±0.18 4.29 ±0.18

8.71** ±0.18 4.29 ±0.36

8.43** ±0.20 3.83 ±0.26

8.86** ±0.26 4.29 ±0.29

Yolkin given after immunization (dose/kg b.w.) 4 × 1 mg 4 × 0.1 mg 4 × 0.01 mg 2697.00** 2737.86** 2018.57 ±243.70 ±270.47 ±216.73 9.00** ±0.22 4.43 ±0.30

9.00** ±0.00 5.00 ±0.00

8.57** ±0.30 4.43 ±0.30

Table 3 28

Antibody titer

Control

IgM (log2) IgG (log2)

10.43 ±0.30 7.86 ±0.34

Yolkin given before immunization (dose/kg b.w.) 4 × 1 mg 4 × 0.1 mg 10.29 ±0.18 9.43* ±0.20

Yolkin given after immunization (dose/kg b.w.)

4 × 0.01 mg

4 × 1 mg

4 × 0.1 mg

4 × 0.01 mg

9.57 ±0.20 9.00 ±0.31

10.83 ±0.26 10.50** ±0.42

11.29 ±0.42 11.14** ±0.34

10.43 ±0.30 10.14** ±0.40

10.43 ±0.37 9.43** ±1.13

Table 4 Number of cells (×106)

CD4-CD8- CD4+CD8+

Yolkin 5 × 1 mg Yolkin 5 × 0.1 mg

2.03 ±0.21 3.12* ±0.26 2.28 ±0.27

Number of cells (×106)

86.00 ±6.49 71.33 ±2.46

Table 6

9.01 ±0.49 6.18* ±0.17 5.76** ±0.08

CD3+

CD4+

CD8+

CD4+/CD8+

54.03 ±0.93 63.18** ±1.13

37.74 ±0.25 29.91** ±1.01

28.02 ±0.49 23.28** ±0.53

8.54 ±0.20 5.52** ±0.27

3.33 ±0.10 4.39** ±0.25

ur

Yolkin 5 × 0.01 mg

1.07 ±0.09 1.70** ±0.12 1.76** ±0.09

CD19+

na

Control

9.05 ±0.21 10.82* ±0.52 10.44 ±0.37

Subpopulation of splenocytes (%)

lP

Group (dose/kg b.w.)

CD4+/CD8+

re

Table 5

87.97 ±0.33 83.37** ±0.75 85.52* ±0.59

CD8+

-p

39.43 ±3.01 44.00 ±1.80 45.43 ±4.78

Control

CD4+

ro of

Group (dose/kg b.w.)

Subpopulation of thymocytes (%)

Jo

Subpopulation of cells in the mesenteric lymph nodes (%)

Group (dose/kg b.w.) Control

Yolkin 5 × 0.1 mg Yolkin 5 × 0.01 mg

CD19+

CD3+

CD4+

CD8+

CD4+/CD8+

36.33 ±1.58 49.03** ±3.23 55.60** ±1.73

60.12 ±1.58 47.20** ±2.89 36.32** ±0.98

49.12 ±1.32 39.25** ±1.77 34.03** ±0.48

7.96 ±0.31 7.50 ±1.22 4.29** ±0.19

6.19 ±0.15 5.99 ±0.79 8.00* ±0.30

29

Table 7

Control

15.33 ±0.77 11.03* ±0.61 12.13 ±0.73 12.53 ±1.08 12.47 ±1.05 10.60** ±0.77 11.68* ±0.59

-p

Yolkin 1 × 1 mg Yolkin 1 × 0.1 mg Yolkin 1 × 0.01 mg Yolkin 5 × 1 mg Yolkin 5 × 0.1 mg Yolkin 5 × 0.01 mg

Nitric oxide (nM)

ro of

Group (dose/kg b.w.)

re

Table 8

na

lP

Content of CD19+ cells (%) Culture Gated for lymphocytes only Gated for all cells Control 80.2 17.5 Yolkin 100 μg/ml 87.2 27.7 Yolkin 50 μg/ml 88.6 26.0 Yolkin 25 μg/ml 88.6 23.9 Yolkin 12.5 μg/ml 88.4 23.5

Gene of MAP kinase ERK1 ERK2 p38α p38β p38γ p38δ JNK1 JNK2 JNK3 4.41 5.22 4.99 4.24 0.08 3.79 4.96 3.84 2.16

ur

Table 9

Jo

Yolkin 50 μg/ml

Table 10 Culture Yolkin 50 g/ml

Gene of MAP kinase Gene of IL-2R ERK1 ERK2 p38α p38β p38γ p38δ JNK IL-2Rα IL-2Rβ IL-2Rγ 1.17 1.14 1.16 1.16 1.06 0.55 1.12 0.80 2.97 0.00

30