- Email: [email protected]
Efficient binding of nickel ions to recombinant Bacillus subtilis spores
Research in Microbiology 161 (2010) 757e764 www.elsevier.com/locate/resmic
Efficient binding of nickel ions to recombinant Bacillus subtilis spores Krzysztof Hinc a,b,1, Soheila Ghandili c,1, Gholamreza Karbalaee c, Abbas Shali c, Kambiz Akbari Noghabi c, Ezio Ricca a, Gholamreza Ahmadian c,* a Department of Structural and Functional Biology, Federico II University, via Cinthia 4, 80126 Naples, Italy Laboratory of Molecular Bacteriology, Intercollegiate Faculty of Biotechnology, Medical University of Gdansk, De˛binki 1, 80-211 Gdansk, Poland c Department of Molecular Genetics, National Institute of Genetic Engineering and Biotechnology, 1497716316, P.O.BOX: 14965/161, Tehran, Iran
b
Received 18 June 2010; accepted 20 July 2010 Available online 21 September 2010
Abstract We report the use of recombinant spores of Bacillus subtilis as a potential bioremediation tool for adsorption of nickel ions. The spore surface protein CotB, previously used for the display of heterologous antigens, was engineered to express eighteen histidine residues within the spore coat. Wild type and recombinant spores were then analyzed to assess their efficiency in adsorbing nickel ions, and the latter proved to be significantly more efficient than wild type spores in metal-binding. The quantities of spores used in the adsorption reaction significantly affected nickel binding, while other factors such as pH and temperature did not show relevant effects. In addition, simple washing procedures were used to partially release spore-bound nickel ions by wild type and recombinant spores. The efficiency of nickel binding, together with the simple purification procedure, the high robustness and safety of B. subtilis spores and the possibility of recovering bound nickel, makes the recombinant spore a new and potentially powerful tool for the treatment of contaminated ecosystems. Ó 2010 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved. Keywords: Bioremediation; Biosorption; Heavy metals
1. Introduction Accumulation of heavy metals in natural ecosystems is a worldwide concern. Some metals, including copper, cobalt, selenium, zinc, manganese, iron and molybdenum, are essential for cell growth at low concentrations (mg ml1 or less), but became toxic to plants and animals at higher concentrations. Other metals, such as cadmium, lead, chromium, nickel, mercury and arsenic, have toxic effects on living organisms and are considered as contaminants even at concentrations of 1 mg ml1 or less. Heavy metals are discharged into natural
* Corresponding author. E-mail addresses: [email protected] (K. Hinc), sghandili2000@ yahoo.com (S. Ghandili), [email protected] (G. Karbalaee), shali. [email protected] (A. Shali), [email protected] (E. Noghabi), ericca@ unina.it (E. Ricca), [email protected] (G. Ahmadian). 1 These two authors equally contributed to the work.
environments as a result of various industrial operations, including sludge disposal, mining or refining operations, incineration of waste materials, metal plating, manufacturing of electrical equipments, paints, batteries or the use of pesticides (Ahalya et al., 2003). Several chemical methods have been developed to treat and remove heavy metals from polluted ecosystems and the most important processes include precipitation-dissolution, adsorption-desorption, complexation (He et al., 2005), lime coagulation, reverse osmosis and solvent extraction (Ahalya et al., 2003). All those methods have, however, major drawbacks such as high reagent and energy requirements, or generation of toxic sludge or other waste products that require careful and expensive disposal (Ahalya et al., 2003). Those disadavantages stimulated the development of biological systems to remove heavy metals from soil and aquatic ecosystems. Biosorption is a method that uses the ability of biological materials to bind and accumulate pollutants such as heavy
0923-2508/$ - see front matter Ó 2010 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved. doi:10.1016/j.resmic.2010.07.008
758
K. Hinc et al. / Research in Microbiology 161 (2010) 757e764
metals (Fourest and Roux, 1992). Major advantages of biosorption over conventional treatment methods include low cost, high efficiency, no accumulation of biological sludge, regeneration of adsorbed biomaterials and, in some cases, metal recovery (Kratochvil and Volesky, 1998a,b) By-products or waste materials from large-scale industrial operations such as mycelia from fermentation processes, olive mill solid residues and activated sludge from sewage treatment plants have been used as inexpensive biological materials in biosorption experiments (Keskinkan et al., 2003; Norton, 2003). The biosorption process involves a solid phase (biological material) and a liquid phase containing a dissolved species to be sorbed (metal ions). Due to the affinity of the biological material for the metal ions, the latter is attracted and bound by different mechanisms. The process continues until equilibrium is reached between the amount of solid-bound ions and the portion remaining into solution. The degree of affinity for the metal ions determines the ion distribution between the solid and liquid phases (Ahalya et al., 2003). Heavy metals bind biological materials following various complex mechanisms such as ion exchange, chelation, entrapment in inter- and intrafibrilliar capillaries and in structural polysaccharide networks. There are several chemical groups that could attract and sequester the metals in biomass: amino and phosphate groups in nucleic acids, amido, amino, sulfhydryl and carboxyl groups in proteins, hydroxyls, carboxyls and sulfates in polysaccharides. However, the presence of a specific functional group does not guarantee biosorption, that also depends on steric, conformational or other barriers. Examples of molecules able to bind metal ions are cysteine-rich metallothioneins (MTs) or Cys-His rich synthetic peptides, known to bind cadmium (Cd2þ) and mercury (Hg2þ) with very high affinity. The use of engineered microorganisms displaying heterologous proteins or peptides for biosorption of heavy metals has been widely explored (Krishnaswamy and Wilson, 2000). The main advantages of surface expression-based biosorbent methods over systems of metal accumulation inside the cell are the fast kinetics of the binding reaction and the possibility of recycling rare metals without cell disruption (Kuroda and Ueda, 2006). Eukaryotic MTs have been expressed and displayed on the surface of Escherichia coli cells through fusion to the porin LamB, with a significant increase in capacity for Cd2þ accumulation of the recombinant cell with respect to its parental strain (Sousa et al., 1996, 1998). In other studies, the mouse MT was displayed on the surface of Ralstonia metallidurans CH34 (Valls et al., 2000a) and Pseudomonas putida (Valls et al., 2000b), resulting in a 3-fold increase in binding and removal of Cd2þ, sufficient to improve plant growth in contaminated soil (Valls et al., 2000b). Synthetic phytochelatins (ECn) with the repetitive metal-binding motif (Glu-Cys) nGly have been displayed on the surface of Moraxella sp. cells causing a 10-fold improvement in Hg2þ intracellular accumulation (Bae et al., 2000, 2001, 2002). Synthetic polyhistidenes have been fused to the porin LamB and exposed on the surface of E. coli, obtaining a recombinant bacterium 11fold more efficient than the wild type strain in Cd2þ-binding activity (Sousa et al., 1996).
Also, specialized cell forms such as bacterial endospores (spores) have been analyzed as biosorbents. Lee and Tebo (1994) found that spores of a marine Bacillus sp. strain (SG1) bind heavy metals and oxydize manganese (Mn(II)) and cobalt (Co(II)). Oxidation of heavy metals was then identified as a common feature of environmental isolates of the Bacillus genus (Mayhew et al., 2008) and the enzyme MnxG was proposed to catalyze a novel type of two sequential oneelectron oxidations from Mn(II) to Mn(III) and from Mn(III) to Mn(IV) (Dick et al., 2008). Bacillus spores are well known for their stability and resistance to harsh conditions, including extremes of pH and temperature, UV irradiation and the presence of lytic enzymes and toxic chemicals (Henriques and Moran, 2007). Those peculiar properties make the spore potentially interesting as a bioremediation tool. Here we report the use of a recombinant strain of Bacillus subtilis expressing 18 histidine residues at the C-terminus of the spore coat protein CotB as a potential bioremediation agent. CotB is localized in the outer layer of the coat, the multilayered structure surrounding and protecting the mature spore (see Henriques and Moran, 2007 for a recent review). CotB hads been previously used as a carrier to display heterologous antigens on the spore surface (Isticato et al., 2001; Hinc et al., 2010). Isogenic wild type and recombinant spores carrying the 18 His tagged version of CotB were analyzed for their efficiency in nickel adsorption and desorption. The Taguchi experimental method was used to determine optimal adsorption conditions and evaluate the effects of pH, temperature and amount of spores on nickel binding. 2. Materials and methods 2.1. Bacterial strains and transformation B. subtilis strains PY79 (Youngman et al., 1984) and RH201 (Isticato et al., 2001) were used as wild type and isogenic cotB null mutants. Plasmid amplification for nucleotide sequencing, subcloning experiments and transformation of B. subtilis competent cells was performed with E. coli strain Top10 (F mcrA D(mrr-hsdRMS-mcrBC) Phi80lacZM15 D-lacX74 recA1 araD139 D(ara-leu)7697 galU galK rpsL (StrR) endA1 nupG; Invitrogen). Bacterial strains were transformed by previously described procedures: CaCl2-mediated transformation of E. coli-competent cells (Sambrook et al., 1989) and two-step transformation of B. subtilis (Cutting and Vander Horn, 1990). 2.2. Construction of gene fusions and chromosomal integration A DNA fragment of 825 bp containing the cotB promoter and a region coding for the N-terminal 275 amino acids of CotB was PCR-amplified by using chromosomal DNA of strain PY79 as a template and oligonucleotides CotB2 (50 -ACAand Cot TAAGCTTACGGATTAGGCCGTTTGTCC-30 ) B3 (50 -GAAAGATCTGGATGATTGATCATCTGAAG-30 ) to prime the reaction. The PCR product was digested with
K. Hinc et al. / Research in Microbiology 161 (2010) 757e764
HindIII and BglII (inserted at the cotB2 and cotB3 primers, respectively) and ligated to the shuttle vector pDHAFB previously digested with the same enzymes. The resulting construct, pDH-cotB, was used to clone in frame with cotB a synthetic DNA coding for 18 histidine residues (18 His). Synthetic oligonucleotides 18XHis-F (50 -CTAGACACCATCACCATCACCATCACCATCACCATCACCATCA CCATCACCATCACCATTGAGCATG-30 ) and 18XHis-R (CT CAATGGTGATGGTGATGGTGATGGTGATGGTGATGGTGATGGTGATGGTGATGGTGT-30 ) were annealed to each other and the resulting double-stranded DNA fragment carrying sticky ends complementary to restriction sites BglII and SphI was cloned into plasmid pDH-cotB previously digested with the same enzymes. By this strategy, the synthetic DNA was cloned at the 30 end of cotB, yielding plasmid pDH-cotB-His. Plasmid pDH-cotB-His was checked by nucleotide sequence analysis, linearized by digestion with PstI and used to transform competent cells of B. subtilis strain PY79. Cmr clones were the result of a double-crossover recombination event, resulting in the interruption of the non-essential amyE gene on the B. subtilis chromosome. All Cmr clones were tested by PCR using chromosomal DNA as a template and oligonucleotides cotB2 and pdhseq (50 -ACTCAAACATCAAATCTTAC-30 ) to prime the reaction. One of the positive clones, CotB18His, was selected for further studies. 2.3. Sporulation and extraction of coat proteins Sporulation of wild type and recombinant strains was induced by the exhaustion method (Cutting and Vander Horn, 1990). After 30 h growth in Difco Sporulation (DS) medium at 37 C, spores were collected, washed four times and purified by lysozyme treatment as previously described. N, the number of spores, was determined by direct counting with a Burker chamber under an optical microscope (Olympus BH-2 with 40 lenses). Spore coat proteins were extracted from 50 ml of a suspensions of spores at high density (1 1010 spores per ml) using decoating extraction buffer as described elsewhere (Monroe and Setlow, 2006). Extracted proteins were assessed for integrity by SDS-polyacrylamide gel electrophoresis (PAGE) and for concentration by two independent methods: the Pierce BCA protein assay (Pierce) and the BioRad DC protein assay kit (Bio-Rad). 2.4. Western blot and immunofluorescence analysis Aliquots of 1010 spores suspended in 0.3 ml of distilled water were used to extract coat proteins by SDS-DTT treatment as previously reported (Cutting and Vander Horn, 1990). Extracted proteins were fractionated on 10 or 12.5% denaturing polyacrylamide gels, electrotransferred to nitrocellulose filters (Bio-Rad) and used for western blot analysis by standard procedures. Two antibodies were used in the western blotting experiments: monoclonal anti-His from mouse (Serotec) and anti-CotB antibody (Hinc et al., 2010). For immunofluorescence experiments inducing sporulation by the exhaustion method, samples were collected at different
759
times after the onset of sporulation and fixed directly in the medium as described by Harry et al. (1995), with the following modifications: after suspension in GTE-lysozyme (50 mM glucose, 20 mM TriseHCl [pH 7.5], 10 mM EDTA, 2 mg of lysozyme/ml), samples (30 ml) were immediately applied to a microscope slide previously coated with 0.01% (wt/vol) poly-L-lysine (Sigma). After 3 min, the liquid was removed and the microscope slide allowed to dry (2 h at room temperature). The microscope slides were washed three times in phosphate-buffered saline (PBS) (pH 7.4), blocked for 30 min with 3% milk in PBS at room temperature and then washed nine more times with PBS. Samples were incubated overnight at 4 C with anti-UreA antibody (raised in mouse), washed ten times and then incubated with anti-mouse IgG-TR conjugates with Texas Red (Santa Cruz Biotechnology, Inc.) for 2 h at room temperature. After ten washes, the coverslip was mounted onto a microscope slide and viewed using an Olympus BX51 fluorescence microscope using the same exposure time for all samples. Images were captured using a Olympus DP70 digital camera, processed with analysis software and saved in TIFF format. 2.5. Ni2þ ion adsorption and desorption Purified spores were lyophilized and incubated in a 30 ml final volume of a nickel solution (3 ppm) in 100 ml conical flasks. Flasks were incubated at different temperatures for different incubation times in shaking conditions. Spores were then collected by centrifugation and the filter-sterilized buffer analyzed for nickel content by atomic adsorption (PerkinElmer, 1100B-Spectrometer, USA). Nickel concentration was determined using an atomic absorption spectrometer according to the manufacturer’s instruction, using a wavelength of 352.5 nm. The instrument was calibrated within the linear range of analysis and a correlation coefficient of 0.98 was obtained for the calibration curve. Three readings were obtained for each sample and a mean value was computed along with standard deviations for each sample. The amount of nickel bound to the biomass was calculated as the difference between the initial metal concentration and that found in the supernatant. Desorption experiments were carried out at 25 C, pH 7.0 with a biomass of 20 mg of spores in a 200 ml flask for 10 min. Spore suspensions were then treated for desorption using exposure to 5 mM EDTA pH 8.0 or a solution of 500 mM NaCl, 20 mM Na2HPO4 pH 4.0 for 30 min on ice. The suspensions were then centrifuged and the supernatants analyzed for the amount of nickel ions released onto the solution using atomic adsorption. 2.6. Experimental design and statistical analysis The adsorption experiments were carried out at different temperatures (25, 35 and 45 C), pH values (5, 7 and 9) and spore biomass (10, 20 and 30 mg). The batch adsorption experiments were performed under agitation-incubation conditions (150 rpm). All factors were changed simultaneously and in a systematic way
760
K. Hinc et al. / Research in Microbiology 161 (2010) 757e764
by using an experimental design approach based on the Taguchi method (Daneshvar et al., 2007; Hesampour et al., 2008a,b). Three three-level factors are positioned in an L9 orthogonal array (Table 1). The method is based on the definition of “quality” (Hesampour et al., 2008a) and the best quality is achieved when the variation is minimized. For a set of experiments with multiple factors, quality is expressed in statistical form as the ratio of the desired factor (signal) compared to uncountable factors (noise) (S/N ratio) (Hesampour et al., 2008a). The S/N ratio represents the signal to noise ratio and is used to transform quality characteristics and optimize the process (Kim et al., 2007). The following equation was used to calculate the S/N ratio: S=N ¼ 10 log10
3. Results and discussion 3.1. Construction and analysis of CotB18His spores In order to obtain recombinant B. subtilis spores displaying an 18-amino acid-long His tag, the CotB structural gene was PCR-amplified (Materials and methods) and cloned into the integrative vector pDHAFB (Yamamoto et al., 1999). The 30 end of cotB, containing repetitive sequences and coding for the C-terminal 105 amino acid residues, was not included in the amplified fragment to avoid potential stability problems in gene fusion (Isticato et al., 2001). Synthetic DNA coding for 18 histidine residues (18His) was then cloned in frame to the 30 end of the truncated form of cotB (corresponding to codon 275), yielding plasmid pDH-CotB-His. The linearized plasmid was used to transform B. subtilis PY79 yielding strain CotB18His that carries gene fusion integrated at the amyE locus (Materials and methods). Spores were purified from strain CotB18His, from its isogenic parental strain, PY79 and from an isogenic strain, RH201 carrying a null mutation in cotB (Isticato et al., 2001). Spore coat proteins were extracted as previously described (Monroe and Setlow, 2006) and used for western blot analysis with anti-CotB and anti-His antibodies. As shown in Fig. 1A, two and three proteins were recognized by anti-CotB antibody in PY79 and CotB18His spores, respectively. All those proteins are CotB-specific, since none of them was found in cotB mutant spores (Fig. 1A, lane 2). The two proteins found in wild type and CotB18His spores corresponded to the mature form of CotB (approx. 66 kDa) and to an additional form of about 35 kDa, never observed before. We hypothesized that the 35 kDa form of CotB was a degradation product visible in the experiments reported here but not in previous studies, because of the overexposure we used to visualize the recombinant protein (see below).
1 MSD
ðY1 Þ þðY2 Þ þ/ þ ðYN Þ N 2
MSD ¼
compared to the error term. It means that the factors with an Fratio less than one have no significant effect compared to the error.
2
2
where MSD is the mean square deviation, Y is the response factor (nickel adsorption) and N is the number of observations or repetitions (two in this study). The relevance of the three factors and their interaction effects on metal adsorption were determined by analysis of variance (ANOVA), which was performed using software Qualitek-4 Version 4.75 and SPSS Version 11.5. In Table 2, “Error” indicates the noise (errors caused by uncontrollable factors) and experimental errors. In general, error values below 50% are considered acceptable (Hesampour et al., 2008a). In Table 2, the calculated error is 14.66 and 19.53% for wild type and CotB18His spores, respectively, indicating that in both cases the “Error” is not significant. The percent contribution of each factor to the response is defined as the influence of one factor on the total variance observed in the experiment (Table 2). A high percent value indicates a high contribution of a factor to the final result. The optimum conditions, given by ANOVA, are determined according to the significance of the factors. This is expressed by the F-ratio (Table 2), which is defined as the ratio of variance due to the effect of a special factor on the variance Table 1 Proposed experimental plan for the L9 array, nickel adsorption and S/N ratio. Wild type spores
CotB18His spores
Trial
pH
Temp ( C)
Spore mass (mg)
Initial [Ni2þ] (ppm)
Free [Ni2þ] (ppm)a,b
Adsorbed [Ni2þ] (ppm)a,c
S/N ratio
Free [Ni2þ] (ppm)a,b
Adsorbed [Ni2þ] (ppm)a,c
S/N ratio
1 2 3 4 5 6 7 8 9
5 5 5 7 7 7 9 9 9
25 35 45 25 35 45 25 35 45
10 20 30 20 30 10 30 10 20
3.2 3.2 3.2 3.2 3.1 3.2 3.0 2.9 3.0
2.54 2.36 2.34 2.23 2.15 2.63 2.12 2.48 2.23
0.66 0.84 0.86 0.97 0.95 0.57 0.88 0.42 0.77
3.24 1.18 0.98 L0.26 0.79 4.53 1.26 7.99 2.00
2.22 2.20 2.12 2.00 1.90 2.32 1.85 2.03 1.86
0.98 1.00 1.08 1.20 1.20 0.88 1.15 0.87 1.14
0.78 0.13 0.86 1.39 1.18 1.31 0.93 1.59 0.89
a b c
2.48 2.29 2.27 2.23 2.22 2.58 2.15 2.52 2.18
Results of two experiments are given. Nickel left in solution after incubation with spores. Calculated by subtracting the concentration of free nickel from the initial [Ni2þ].
0.72 0.91 0.93 0.97 0.88 0.62 0.85 0.38 0.82
2.34 2.23 2.07 2.05 2.00 2.38 1.92 2.10 1.92
0.86 0.97 1.13 1.15 1.10 0.84 1.08 0.80 1.08
K. Hinc et al. / Research in Microbiology 161 (2010) 757e764
761
Table 2 Results of ANOVA for nickel adsorption by wild type and recombinant spores. Factors
pH Temp Biomass Error a
DOFa (F)
Sum of squares (S)
Variance (V)
F-ratio (F)
Pure sum (S)
Percent
wt
CotB18His
wt
CotB18His
wt
CotB18His
wt
CotB18His
wt
CotB18His
wt
CotB18His
2 2 2 2
2 2 2 2
7.23 4.68 34.60 1.77
0.32 0.72 8.81 0.57
3.61 2.34 17.30 0.88
0.16 0.36 4.40 0.28
4.09 2.65 19.56
0.56 1.26 15.41
5.46 2.92 32.83
0 0.15 8.24
11.31 6.04 68.00 14.66
0 1.45 79.02 19.53
Degree of freedom.
The third protein extracted only from CotB18His spores (Fig. 1A, lane 3) has an apparent molecular weight that correlates well with the deduced mass of the recombinant protein (275 amino acids of CotB plus 18 histidine residues: approximately 36 kDa). This protein was the only one visualized by western blot with anti-His antibody (Fig. 1B), indicating that it is the recombinant form of CotB with the 18 His residues replacing the C-terminus of CotB. This recombinant protein was not abundant within the coat protein fraction extracted from CotB18His spores and long exposure was needed to visualize it. 3.2. Surface display of CotB18His To verify whether recombinant protein CotB18His was displayed on the spore surface, we used an immunofluorescence microscopy approach. Sporulating cells of strain CotB18His were reacted with anti-His antibody and then with an anti-mouse IgG-TR conjugated with Texas Red secondary antibody (Materials and methods). As shown in Fig. 2, fluorescence was not found in the mother cell of sporulating cells but only around prespores, suggesting that the recombinant
protein is assembled around the forming spores. However, fluorescence was only associated with the surface of sporulating cells and was not found around mature spores. Since we extracted CotB18His from mature spores (Fig. 1) and observed a fluorescent signal around forming spores but not around mature spores (Fig. 2), we hypothesized that the histidine residues were within the coat of recombinant spores on the spore surface during the process of spore formation but were covered by some other coat protein or by the recently discovered spore crust (McKenney et al., 2010) and no longer accessible to anti-His antibody in mature spores. An alternative possibility was that the His tag was partially cleaved on the mature spore by an unknown enzyme and that the remaining unproteolyzed CotB18His was not accessible to the antibody. Either way, we would expect that nickel ions, because of their size, could infiltrate the proteins of the coat and reach the His residues, making possible their adsorption. 3.3. Ni2þ ions adsorption In a first experiment, 20 mg of wild type or recombinant spores were incubated at 45 C in a nickel sulfate solution
Fig. 1. Western blot analysis performed with purified spores of a wild type strain of B. subtilis (lanes 1) and with isogenic strains deleted of cotB (lanes 2) or carrying the cotB18His allele together with the wild type cotB allele (lanes 3). Proteins were reacted with anti-CotB (A) or anti-His (B) antibodies. Molecular weight markers were loaded in the first lane of each panel.
762
K. Hinc et al. / Research in Microbiology 161 (2010) 757e764
Fig. 2. Microscopy analysis of recombinant spores. The same microscopy field is observed by phase contrast (A) and fluorescence (B) microscopy. Panel C reports the combination of A and B panels. Sporulating cells were analyzed 8 h after the onset of sporulation.
(3 ppm, pH 9.0). Spores were then collected by centrifugation and the supernatants were filter-sterilized and analyzed for nickel content by atomic adsorption (Materials and methods). Similarly to what was observed with other systems (Bae et al., 2001; Kuroda and Ueda, 2006), nickel binding occurred within 10 min of incubation and after that time binding sites appeared saturated (Fig. 3A). As reported in Fig. 3B, both wild type and
recombinant spores were able to bind nickel ions, reducing the amount of free nickel in the solution. However, recombinant spores were able to remove a statistically significantly higher amount of nickel ions than wild type spores, indicating that the presence of the His tag increased nickel adsorption (Fig. 3B). Those results indicated that the 18 His tag, although not exposed on the spore surface, significantly contributed to nickel binding and, in turn, suggested that the approach to constructing recombinant spores that express a His tag within the coat can be successful for nickel bioremediation. Fusions of the His tag either to other regions of CotB or to a different coat component, or to more than one coat component, will have to be constructed and analyzed to identify the recombinant strain most efficient in nickel binding. The observation that wild type spores can bind nickel ions is also interesting and is in agreement with a previous report showing that the carboxylate and phosphate groups present on the spore surface determine a negative surface charges that make the spore a potent scavenger of cations (He et al., 2005). 3.4. Conditions of Ni2þ ions adsorption
Fig. 3. (A) Effect of incubation time on nickel adsorption. At the indicated times, the adsorption reaction was stopped, samples centrifuged and cell-free supernatants analyzed for nickel concentration. Recombinant spores (open symbols) are compared with samples not treated with spores (closed symbols). Identical kinetics were observed with the wild type spore. (B) The amount of nickel remaining in solution after incubation with wild type and CotB18His spores is reported (*between white and gray bars, P < 0.05; **between gray and black bars, P < 0.05). The control (white) bar indicates the amount of nickel initially present in solution. The adsorption reaction was performed at pH 9.0 and 45 C using 20 mg of spores.
It has been shown in other bioremediation systems that metal adsorption is highly dependent on the experimental conditions utilized (Fourest and Roux, 1992; He et al., 2005; Hesampour et al., 2008a). We therefore decided to analyze whether factors such as pH, temperature and amount of spores used in the reaction affected the efficiency of nickel adsorption. To this aim and to minimize the number of experiments, we used the Taguchi experimental design method, a fractional factorial design system which uses an orthogonal array to analyze the influence of various factors with only a small number of experiments (Hesampour et al., 2008a,b; Rao et al., 2008; Yang and Tarng, 1998). The set of experiments, designed using the Taguchi approach, consisted of 9 trials (Table 1). By this method, the highest value of S/N ratio (Materials and methods) is indicative of ideal conditions. As reported in Table 1, for both wild type and recombinant spores, the highest S/N ratio was obtained in trial 4, therefore, indicating that, for both types of spores, the ideal conditions for nickel binding were pH 7.0, 25 C and 20 mg of spores.
K. Hinc et al. / Research in Microbiology 161 (2010) 757e764 Table 3 Desorption rates.
763
References
Desorbents
Desorbed nickel (%) wt
CotB18His
Phosphate buffer (pH 4.0) EDTA (5 mM)
40 37
43 42
The influence and relative importance of the three analyzed factors are quantitatively shown by the analysis of variance (ANOVA) (Materials and methods) and are reported in Table 2. The percent contribution of each factor to the response is reported in the last column of Table 2. The highest value was observed for the amount of biomass used in the reaction that, therefore played a relevant role in nickel adsorption. The optimum conditions, determined according to the significance of the factors, is expressed by the F-ratio (Table 2). Since an F-ratio lower than one has no significant effect compared to the error (Materials and methods), pH was not considered to be a relevant factor (Table 2). In agreement with the percent contribution of each factor discussed above (last column of Table 2), the highest F-ratio was observed for the factor “biomass” for both types of spores. Our statistical analysis led us to conclude that: i) for all experimental conditions analyzed, adsorption of nickel was higher for the recombinant than for the wild type spores (Table 1); ii) the optimum conditions for nickel adsorption are those used in Trial 4 (Table 1: pH 7.0, 25 C and 20 mg of spores); iii) the amount of biomass used in the reaction significantly affects nickel adsorption; iv) pH and temperature do not affect the reaction. 3.5. Ni2þ ion desorption In order to assess whether nickel ions that bound to wild type and recombinant spores could be released and nickel recovered, we performed desorption experiments as described in Materials and methods. With phosphate buffer, 40 and 43 percent of the previously adsorbed nickel ions were released by wild type and recombinant spores, respectively (Table 3). Only slightly less efficient desorption was observed using 5 mM EDTA as desorbent (Table 3). Therefore, an acidic condition or a chelating agent had similar efficiency at eluting nickel ions from both wild type and recombinant spores. The possibility of recovering at least part of the adsorbed nickel ions is an additional useful property of both wild type and recombinant spores that contributes to considering spores as new and potentially powerful bioremediation agents. Acknowledgments This work was supported by grant n. 232 from the Ministry of Science, Research and Technology, Iran to G.A. and by grant n. KBBE-2007-207948 from the EU 7th Framework to E.R.
Ahalya, N., Ramachandra, T.V., Kanamadi, R.D., 2003. Biosorption of heavy metals. Res. J. Chem. Environ. 7, 71e80. Bae, W., Chen, W., Mulchandani, A., Mehra, R., 2000. Enhanced bioaccumulation of heavy metals by bacterial cells displaying synthetic phytochelatins. Biotechnol. Bioeng. 70, 518e524. Bae, W., Mehra, R., Mulchandani, A., Chen, W., 2001. Genetic engineering of Escherichia coli for enhanced uptake and bioaccumulation of mercury. Appl. Environ. Microbiol. 67, 5335e5338. Bae, W., Mulchandani, A., Chen, W., 2002. Cell surface display of synthetic phytochelatins using ice nucleation protein for enhanced heavy metal bioaccumulation. J. Inorg. Biochem. 88, 223e227. Cutting, S., Vander Horn, P.B., 1990. Genetic analysis. In: Harwood, C., Cutting, S. (Eds.), Molecular Biological Methods for Bacillus. John Wiley and Sons, Chichester, UK, pp. 27e74. Daneshvar, N., Khataee, A.R., Rasoulifard, M.H., Pourhassan, M., 2007. Biodegradation of dye solution containing Malachite Green: optimization of effective parameters using Taguchi method. J. Haz. Mater. 143, 214e219. Dick, G.J., Torpey, J.W., Beveridge, T.J., Tebo, B.M., 2008. Direct identification of a bacterial manganese(II) oxidase, the multicopper oxidase MnxG, from spores of several different marine Bacillus species. Appl. Environ. Microbiol. 74, 1527e1534. Fourest, E., Roux, J., 1992. Heavy metal biosorption by fungal mycelial byproduct: mechanisms and influence of pH. Appl. Microbiol. Biotechnol. 37, 399e403. He, Z.L., Yang, X.E., Stoffella, P.J., 2005. Trace elements in agroecosystems and impacts on the environment. J. Trace. Elem. Med. Biol. 19, 125e140. Henriques, A.O., Moran Jr., C.P., 2007. Structure, assembly and function of the spore surface layers. Ann. Rev. Microbiol. 61, 555e588. Hinc, K., Isticato, R., Dembek, M., Karczewska, J., Iwanicki, A., PeszynskaSularz, G., De Felice, M., Obukowski, M., Ricca, E., 2010. Expression and display of UreA of Helicobacter acinonychis on the surface of Bacillus subtilis spores. Microb. Cell Factories 9, 2. Harry, E.J., Pogliano, K., Losick, R., 1995. Use of immunofluorescence to visualize cell-specific gene expression during sporulation in Bacillus subtilis. J. Bacteriol. 177, 3386e3393. Hesampour, M., Krzyzaniak, A., Nystro¨m, M., 2008a. Treatment of waste water from metal working by ultrafiltration, considering the effects of operating conditions. Desalination 222, 212e221. Hesampour, M., Krzyzaniak, A., Nystro¨m, M., 2008b. The influence of different factors on the stability and ultrafiltration of emulsified oil in water. J. Membr. Sci. 325, 199e208. Isticato, R., Cangiano, G., Tran, H.T., Ciabattini, A., Medaglini, D., Oggioni, M. R., De Felice, M., Pozzi, G., Ricca, E., 2001. Surface display of recombinant proteins on Bacillus subtilis spores. J. Bacteriol. 183, 6294e6301. Keskinkan, O., Goksu, M.Z.L., Yuceer, A., Basibuyuk, M., Forster, C.F., 2003. Heavy metal adsorption characteristics of a submerged aquatic plant (Myriophyllum spicatum). Process Biochem. 39, 179e183. Kim, K.D., Choi, D.W., Choa, Y.H., Him, H.T., 2007. Optimization of parameters for the synthesis of zinc oxide nanoparticles by Taguchi robust design method. Colloids Surf. Physicochem. Eng. Aspects 311, 170e173. Kratochvil, D., Volesky, B., 1998a. Advances in the biosorption of heavy metals. Trends Biotechnol. 16, 291e300. Kratochvil, D., Volesky, B., 1998b. Biosorption of Cu from ferruginous wastewater by algal biomass. Wat. Res. 32, 2760e2768. Krishnaswamy, R., Wilson, D., 2000. Construction and characterization of an Escherichia coli strain genetically engineered for Ni(II) bioaccumulation. Appl. Environ. Microbiol. 66, 5383e5386. Kuroda, K., Ueda, M., 2006. Effective display of metallothionein tandem repeats on the bioadsorption of cadmium ion. Appl. Microbiol. Biotechnol. 70, 458e463. Lee, Y., Tebo, B.M., 1994. Cobalt oxidation by the marine manganese(II)oxidizing Bacillus sp. strain SG-1. Appl. Environ. Microbiol. 60, 2949e2957. Mayhew, L.E., Swanner, E.D., Martin, A.P., Templeton, A.S., 2008. Phylogenetic relationships and functional genes: distribution of a gene (mnxG)
764
K. Hinc et al. / Research in Microbiology 161 (2010) 757e764
encoding a putative manganese-oxidizing enzyme in Bacillus species. Appl. Environ. Microbiol. 74, 7265e7271. McKenney, P.T., Driks, A., Eskandarian, H.A., Grabowski, P., Guberman, J., Wang, K.H., Gitai, Z., Eichenberger, P., 2010. A distance-weighted interaction map reveals a previously uncharacterized layer of the Bacillus subtilis spore coat. Curr. Biol. 20, 934e938. Monroe, A., Setlow, P., 2006. Localization of the transglutaminase crosslinking sites in the Bacillus subtilis spore coat protein GerQ. J. Bacteriol. 188, 7609e7616. Norton, L., 2003. Biosorption of zinc from aqueous solutions using biosolids. Adv. Environ. Res. 56, 156e162. Rao, R.S., Kumar, C.G., Prakasham, R.S., Hobbs, P.J., 2008. The Taguchi methodology as a statistical tool for biotechnological applications: a critical appraisal. Biotechnol. J. 3, 510e523. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning. A Laboratory Manual, second ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, US. Sousa, C., Cebolla, A., de Lorenzo, V., 1996. Enhanced metalloadsorption of bacterial cells displaying poly-His peptides. Nat. Biotechnol. 14, 1017e1020.
Sousa, C., Kotrba, P., Ruml, T., Cebolla, A., De Lorenzo, V., 1998. Metalloadsorption by Escherichia coli cells displaying yeast and mammalian metallothioneins anchored to the outer membrane protein LamB. J. Bacteriol. 180, 2280e2284. Valls, M., Atrian, S., de Lorenzo, V., Fernandez, L.A., 2000a. Engineering a mouse metallothionein on the cell surface of Ralstonia eutropha CH34 fro immobilization of heavy metals in soli. Nat. Biotechol. 18, 661e665. Valls, M., de Lorenzo, V., Gonzalez-Duarte, R., Atrian, S., 2000b. Engineering outer-membrane proteins in Pseudomonas putida for enhanced heavymetal bioadsorption. J. Inorg. Biochem. 79, 219e223. Yamamoto, H., Mori, M., Sekiguchi, J., 1999. Transcription of genes near the sspE locus of the Bacillus subtilis genome. Microbiology 145, 2171e2180. Yang, W.H., Tarng, Y.S., 1998. Design optimization of cutting parameters for turning operations based on the Taguchi method. J. Mater. Proces. Technol. 84, 122e129. Youngman, P., Perkins, J.B., Losick, R., 1984. A novel method for the rapid cloning in Escherichia coli of Bacillus subtilis chromosomal DNA adjacent to Tn917 insertion. Mol. Gen. Genet. 195, 424e433.
Efficient binding of nickel ions to recombinant Bacillus subtilis spores Krzysztof Hinc a,b,1, Soheila Ghandili c,1, Gholamreza Karbalaee c, Abbas Shali c, Kambiz Akbari Noghabi c, Ezio Ricca a, Gholamreza Ahmadian c,* a Department of Structural and Functional Biology, Federico II University, via Cinthia 4, 80126 Naples, Italy Laboratory of Molecular Bacteriology, Intercollegiate Faculty of Biotechnology, Medical University of Gdansk, De˛binki 1, 80-211 Gdansk, Poland c Department of Molecular Genetics, National Institute of Genetic Engineering and Biotechnology, 1497716316, P.O.BOX: 14965/161, Tehran, Iran
b
Received 18 June 2010; accepted 20 July 2010 Available online 21 September 2010
Abstract We report the use of recombinant spores of Bacillus subtilis as a potential bioremediation tool for adsorption of nickel ions. The spore surface protein CotB, previously used for the display of heterologous antigens, was engineered to express eighteen histidine residues within the spore coat. Wild type and recombinant spores were then analyzed to assess their efficiency in adsorbing nickel ions, and the latter proved to be significantly more efficient than wild type spores in metal-binding. The quantities of spores used in the adsorption reaction significantly affected nickel binding, while other factors such as pH and temperature did not show relevant effects. In addition, simple washing procedures were used to partially release spore-bound nickel ions by wild type and recombinant spores. The efficiency of nickel binding, together with the simple purification procedure, the high robustness and safety of B. subtilis spores and the possibility of recovering bound nickel, makes the recombinant spore a new and potentially powerful tool for the treatment of contaminated ecosystems. Ó 2010 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved. Keywords: Bioremediation; Biosorption; Heavy metals
1. Introduction Accumulation of heavy metals in natural ecosystems is a worldwide concern. Some metals, including copper, cobalt, selenium, zinc, manganese, iron and molybdenum, are essential for cell growth at low concentrations (mg ml1 or less), but became toxic to plants and animals at higher concentrations. Other metals, such as cadmium, lead, chromium, nickel, mercury and arsenic, have toxic effects on living organisms and are considered as contaminants even at concentrations of 1 mg ml1 or less. Heavy metals are discharged into natural
* Corresponding author. E-mail addresses: [email protected] (K. Hinc), sghandili2000@ yahoo.com (S. Ghandili), [email protected] (G. Karbalaee), shali. [email protected] (A. Shali), [email protected] (E. Noghabi), ericca@ unina.it (E. Ricca), [email protected] (G. Ahmadian). 1 These two authors equally contributed to the work.
environments as a result of various industrial operations, including sludge disposal, mining or refining operations, incineration of waste materials, metal plating, manufacturing of electrical equipments, paints, batteries or the use of pesticides (Ahalya et al., 2003). Several chemical methods have been developed to treat and remove heavy metals from polluted ecosystems and the most important processes include precipitation-dissolution, adsorption-desorption, complexation (He et al., 2005), lime coagulation, reverse osmosis and solvent extraction (Ahalya et al., 2003). All those methods have, however, major drawbacks such as high reagent and energy requirements, or generation of toxic sludge or other waste products that require careful and expensive disposal (Ahalya et al., 2003). Those disadavantages stimulated the development of biological systems to remove heavy metals from soil and aquatic ecosystems. Biosorption is a method that uses the ability of biological materials to bind and accumulate pollutants such as heavy
0923-2508/$ - see front matter Ó 2010 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved. doi:10.1016/j.resmic.2010.07.008
758
K. Hinc et al. / Research in Microbiology 161 (2010) 757e764
metals (Fourest and Roux, 1992). Major advantages of biosorption over conventional treatment methods include low cost, high efficiency, no accumulation of biological sludge, regeneration of adsorbed biomaterials and, in some cases, metal recovery (Kratochvil and Volesky, 1998a,b) By-products or waste materials from large-scale industrial operations such as mycelia from fermentation processes, olive mill solid residues and activated sludge from sewage treatment plants have been used as inexpensive biological materials in biosorption experiments (Keskinkan et al., 2003; Norton, 2003). The biosorption process involves a solid phase (biological material) and a liquid phase containing a dissolved species to be sorbed (metal ions). Due to the affinity of the biological material for the metal ions, the latter is attracted and bound by different mechanisms. The process continues until equilibrium is reached between the amount of solid-bound ions and the portion remaining into solution. The degree of affinity for the metal ions determines the ion distribution between the solid and liquid phases (Ahalya et al., 2003). Heavy metals bind biological materials following various complex mechanisms such as ion exchange, chelation, entrapment in inter- and intrafibrilliar capillaries and in structural polysaccharide networks. There are several chemical groups that could attract and sequester the metals in biomass: amino and phosphate groups in nucleic acids, amido, amino, sulfhydryl and carboxyl groups in proteins, hydroxyls, carboxyls and sulfates in polysaccharides. However, the presence of a specific functional group does not guarantee biosorption, that also depends on steric, conformational or other barriers. Examples of molecules able to bind metal ions are cysteine-rich metallothioneins (MTs) or Cys-His rich synthetic peptides, known to bind cadmium (Cd2þ) and mercury (Hg2þ) with very high affinity. The use of engineered microorganisms displaying heterologous proteins or peptides for biosorption of heavy metals has been widely explored (Krishnaswamy and Wilson, 2000). The main advantages of surface expression-based biosorbent methods over systems of metal accumulation inside the cell are the fast kinetics of the binding reaction and the possibility of recycling rare metals without cell disruption (Kuroda and Ueda, 2006). Eukaryotic MTs have been expressed and displayed on the surface of Escherichia coli cells through fusion to the porin LamB, with a significant increase in capacity for Cd2þ accumulation of the recombinant cell with respect to its parental strain (Sousa et al., 1996, 1998). In other studies, the mouse MT was displayed on the surface of Ralstonia metallidurans CH34 (Valls et al., 2000a) and Pseudomonas putida (Valls et al., 2000b), resulting in a 3-fold increase in binding and removal of Cd2þ, sufficient to improve plant growth in contaminated soil (Valls et al., 2000b). Synthetic phytochelatins (ECn) with the repetitive metal-binding motif (Glu-Cys) nGly have been displayed on the surface of Moraxella sp. cells causing a 10-fold improvement in Hg2þ intracellular accumulation (Bae et al., 2000, 2001, 2002). Synthetic polyhistidenes have been fused to the porin LamB and exposed on the surface of E. coli, obtaining a recombinant bacterium 11fold more efficient than the wild type strain in Cd2þ-binding activity (Sousa et al., 1996).
Also, specialized cell forms such as bacterial endospores (spores) have been analyzed as biosorbents. Lee and Tebo (1994) found that spores of a marine Bacillus sp. strain (SG1) bind heavy metals and oxydize manganese (Mn(II)) and cobalt (Co(II)). Oxidation of heavy metals was then identified as a common feature of environmental isolates of the Bacillus genus (Mayhew et al., 2008) and the enzyme MnxG was proposed to catalyze a novel type of two sequential oneelectron oxidations from Mn(II) to Mn(III) and from Mn(III) to Mn(IV) (Dick et al., 2008). Bacillus spores are well known for their stability and resistance to harsh conditions, including extremes of pH and temperature, UV irradiation and the presence of lytic enzymes and toxic chemicals (Henriques and Moran, 2007). Those peculiar properties make the spore potentially interesting as a bioremediation tool. Here we report the use of a recombinant strain of Bacillus subtilis expressing 18 histidine residues at the C-terminus of the spore coat protein CotB as a potential bioremediation agent. CotB is localized in the outer layer of the coat, the multilayered structure surrounding and protecting the mature spore (see Henriques and Moran, 2007 for a recent review). CotB hads been previously used as a carrier to display heterologous antigens on the spore surface (Isticato et al., 2001; Hinc et al., 2010). Isogenic wild type and recombinant spores carrying the 18 His tagged version of CotB were analyzed for their efficiency in nickel adsorption and desorption. The Taguchi experimental method was used to determine optimal adsorption conditions and evaluate the effects of pH, temperature and amount of spores on nickel binding. 2. Materials and methods 2.1. Bacterial strains and transformation B. subtilis strains PY79 (Youngman et al., 1984) and RH201 (Isticato et al., 2001) were used as wild type and isogenic cotB null mutants. Plasmid amplification for nucleotide sequencing, subcloning experiments and transformation of B. subtilis competent cells was performed with E. coli strain Top10 (F mcrA D(mrr-hsdRMS-mcrBC) Phi80lacZM15 D-lacX74 recA1 araD139 D(ara-leu)7697 galU galK rpsL (StrR) endA1 nupG; Invitrogen). Bacterial strains were transformed by previously described procedures: CaCl2-mediated transformation of E. coli-competent cells (Sambrook et al., 1989) and two-step transformation of B. subtilis (Cutting and Vander Horn, 1990). 2.2. Construction of gene fusions and chromosomal integration A DNA fragment of 825 bp containing the cotB promoter and a region coding for the N-terminal 275 amino acids of CotB was PCR-amplified by using chromosomal DNA of strain PY79 as a template and oligonucleotides CotB2 (50 -ACAand Cot TAAGCTTACGGATTAGGCCGTTTGTCC-30 ) B3 (50 -GAAAGATCTGGATGATTGATCATCTGAAG-30 ) to prime the reaction. The PCR product was digested with
K. Hinc et al. / Research in Microbiology 161 (2010) 757e764
HindIII and BglII (inserted at the cotB2 and cotB3 primers, respectively) and ligated to the shuttle vector pDHAFB previously digested with the same enzymes. The resulting construct, pDH-cotB, was used to clone in frame with cotB a synthetic DNA coding for 18 histidine residues (18 His). Synthetic oligonucleotides 18XHis-F (50 -CTAGACACCATCACCATCACCATCACCATCACCATCACCATCA CCATCACCATCACCATTGAGCATG-30 ) and 18XHis-R (CT CAATGGTGATGGTGATGGTGATGGTGATGGTGATGGTGATGGTGATGGTGATGGTGT-30 ) were annealed to each other and the resulting double-stranded DNA fragment carrying sticky ends complementary to restriction sites BglII and SphI was cloned into plasmid pDH-cotB previously digested with the same enzymes. By this strategy, the synthetic DNA was cloned at the 30 end of cotB, yielding plasmid pDH-cotB-His. Plasmid pDH-cotB-His was checked by nucleotide sequence analysis, linearized by digestion with PstI and used to transform competent cells of B. subtilis strain PY79. Cmr clones were the result of a double-crossover recombination event, resulting in the interruption of the non-essential amyE gene on the B. subtilis chromosome. All Cmr clones were tested by PCR using chromosomal DNA as a template and oligonucleotides cotB2 and pdhseq (50 -ACTCAAACATCAAATCTTAC-30 ) to prime the reaction. One of the positive clones, CotB18His, was selected for further studies. 2.3. Sporulation and extraction of coat proteins Sporulation of wild type and recombinant strains was induced by the exhaustion method (Cutting and Vander Horn, 1990). After 30 h growth in Difco Sporulation (DS) medium at 37 C, spores were collected, washed four times and purified by lysozyme treatment as previously described. N, the number of spores, was determined by direct counting with a Burker chamber under an optical microscope (Olympus BH-2 with 40 lenses). Spore coat proteins were extracted from 50 ml of a suspensions of spores at high density (1 1010 spores per ml) using decoating extraction buffer as described elsewhere (Monroe and Setlow, 2006). Extracted proteins were assessed for integrity by SDS-polyacrylamide gel electrophoresis (PAGE) and for concentration by two independent methods: the Pierce BCA protein assay (Pierce) and the BioRad DC protein assay kit (Bio-Rad). 2.4. Western blot and immunofluorescence analysis Aliquots of 1010 spores suspended in 0.3 ml of distilled water were used to extract coat proteins by SDS-DTT treatment as previously reported (Cutting and Vander Horn, 1990). Extracted proteins were fractionated on 10 or 12.5% denaturing polyacrylamide gels, electrotransferred to nitrocellulose filters (Bio-Rad) and used for western blot analysis by standard procedures. Two antibodies were used in the western blotting experiments: monoclonal anti-His from mouse (Serotec) and anti-CotB antibody (Hinc et al., 2010). For immunofluorescence experiments inducing sporulation by the exhaustion method, samples were collected at different
759
times after the onset of sporulation and fixed directly in the medium as described by Harry et al. (1995), with the following modifications: after suspension in GTE-lysozyme (50 mM glucose, 20 mM TriseHCl [pH 7.5], 10 mM EDTA, 2 mg of lysozyme/ml), samples (30 ml) were immediately applied to a microscope slide previously coated with 0.01% (wt/vol) poly-L-lysine (Sigma). After 3 min, the liquid was removed and the microscope slide allowed to dry (2 h at room temperature). The microscope slides were washed three times in phosphate-buffered saline (PBS) (pH 7.4), blocked for 30 min with 3% milk in PBS at room temperature and then washed nine more times with PBS. Samples were incubated overnight at 4 C with anti-UreA antibody (raised in mouse), washed ten times and then incubated with anti-mouse IgG-TR conjugates with Texas Red (Santa Cruz Biotechnology, Inc.) for 2 h at room temperature. After ten washes, the coverslip was mounted onto a microscope slide and viewed using an Olympus BX51 fluorescence microscope using the same exposure time for all samples. Images were captured using a Olympus DP70 digital camera, processed with analysis software and saved in TIFF format. 2.5. Ni2þ ion adsorption and desorption Purified spores were lyophilized and incubated in a 30 ml final volume of a nickel solution (3 ppm) in 100 ml conical flasks. Flasks were incubated at different temperatures for different incubation times in shaking conditions. Spores were then collected by centrifugation and the filter-sterilized buffer analyzed for nickel content by atomic adsorption (PerkinElmer, 1100B-Spectrometer, USA). Nickel concentration was determined using an atomic absorption spectrometer according to the manufacturer’s instruction, using a wavelength of 352.5 nm. The instrument was calibrated within the linear range of analysis and a correlation coefficient of 0.98 was obtained for the calibration curve. Three readings were obtained for each sample and a mean value was computed along with standard deviations for each sample. The amount of nickel bound to the biomass was calculated as the difference between the initial metal concentration and that found in the supernatant. Desorption experiments were carried out at 25 C, pH 7.0 with a biomass of 20 mg of spores in a 200 ml flask for 10 min. Spore suspensions were then treated for desorption using exposure to 5 mM EDTA pH 8.0 or a solution of 500 mM NaCl, 20 mM Na2HPO4 pH 4.0 for 30 min on ice. The suspensions were then centrifuged and the supernatants analyzed for the amount of nickel ions released onto the solution using atomic adsorption. 2.6. Experimental design and statistical analysis The adsorption experiments were carried out at different temperatures (25, 35 and 45 C), pH values (5, 7 and 9) and spore biomass (10, 20 and 30 mg). The batch adsorption experiments were performed under agitation-incubation conditions (150 rpm). All factors were changed simultaneously and in a systematic way
760
K. Hinc et al. / Research in Microbiology 161 (2010) 757e764
by using an experimental design approach based on the Taguchi method (Daneshvar et al., 2007; Hesampour et al., 2008a,b). Three three-level factors are positioned in an L9 orthogonal array (Table 1). The method is based on the definition of “quality” (Hesampour et al., 2008a) and the best quality is achieved when the variation is minimized. For a set of experiments with multiple factors, quality is expressed in statistical form as the ratio of the desired factor (signal) compared to uncountable factors (noise) (S/N ratio) (Hesampour et al., 2008a). The S/N ratio represents the signal to noise ratio and is used to transform quality characteristics and optimize the process (Kim et al., 2007). The following equation was used to calculate the S/N ratio: S=N ¼ 10 log10
3. Results and discussion 3.1. Construction and analysis of CotB18His spores In order to obtain recombinant B. subtilis spores displaying an 18-amino acid-long His tag, the CotB structural gene was PCR-amplified (Materials and methods) and cloned into the integrative vector pDHAFB (Yamamoto et al., 1999). The 30 end of cotB, containing repetitive sequences and coding for the C-terminal 105 amino acid residues, was not included in the amplified fragment to avoid potential stability problems in gene fusion (Isticato et al., 2001). Synthetic DNA coding for 18 histidine residues (18His) was then cloned in frame to the 30 end of the truncated form of cotB (corresponding to codon 275), yielding plasmid pDH-CotB-His. The linearized plasmid was used to transform B. subtilis PY79 yielding strain CotB18His that carries gene fusion integrated at the amyE locus (Materials and methods). Spores were purified from strain CotB18His, from its isogenic parental strain, PY79 and from an isogenic strain, RH201 carrying a null mutation in cotB (Isticato et al., 2001). Spore coat proteins were extracted as previously described (Monroe and Setlow, 2006) and used for western blot analysis with anti-CotB and anti-His antibodies. As shown in Fig. 1A, two and three proteins were recognized by anti-CotB antibody in PY79 and CotB18His spores, respectively. All those proteins are CotB-specific, since none of them was found in cotB mutant spores (Fig. 1A, lane 2). The two proteins found in wild type and CotB18His spores corresponded to the mature form of CotB (approx. 66 kDa) and to an additional form of about 35 kDa, never observed before. We hypothesized that the 35 kDa form of CotB was a degradation product visible in the experiments reported here but not in previous studies, because of the overexposure we used to visualize the recombinant protein (see below).
1 MSD
ðY1 Þ þðY2 Þ þ/ þ ðYN Þ N 2
MSD ¼
compared to the error term. It means that the factors with an Fratio less than one have no significant effect compared to the error.
2
2
where MSD is the mean square deviation, Y is the response factor (nickel adsorption) and N is the number of observations or repetitions (two in this study). The relevance of the three factors and their interaction effects on metal adsorption were determined by analysis of variance (ANOVA), which was performed using software Qualitek-4 Version 4.75 and SPSS Version 11.5. In Table 2, “Error” indicates the noise (errors caused by uncontrollable factors) and experimental errors. In general, error values below 50% are considered acceptable (Hesampour et al., 2008a). In Table 2, the calculated error is 14.66 and 19.53% for wild type and CotB18His spores, respectively, indicating that in both cases the “Error” is not significant. The percent contribution of each factor to the response is defined as the influence of one factor on the total variance observed in the experiment (Table 2). A high percent value indicates a high contribution of a factor to the final result. The optimum conditions, given by ANOVA, are determined according to the significance of the factors. This is expressed by the F-ratio (Table 2), which is defined as the ratio of variance due to the effect of a special factor on the variance Table 1 Proposed experimental plan for the L9 array, nickel adsorption and S/N ratio. Wild type spores
CotB18His spores
Trial
pH
Temp ( C)
Spore mass (mg)
Initial [Ni2þ] (ppm)
Free [Ni2þ] (ppm)a,b
Adsorbed [Ni2þ] (ppm)a,c
S/N ratio
Free [Ni2þ] (ppm)a,b
Adsorbed [Ni2þ] (ppm)a,c
S/N ratio
1 2 3 4 5 6 7 8 9
5 5 5 7 7 7 9 9 9
25 35 45 25 35 45 25 35 45
10 20 30 20 30 10 30 10 20
3.2 3.2 3.2 3.2 3.1 3.2 3.0 2.9 3.0
2.54 2.36 2.34 2.23 2.15 2.63 2.12 2.48 2.23
0.66 0.84 0.86 0.97 0.95 0.57 0.88 0.42 0.77
3.24 1.18 0.98 L0.26 0.79 4.53 1.26 7.99 2.00
2.22 2.20 2.12 2.00 1.90 2.32 1.85 2.03 1.86
0.98 1.00 1.08 1.20 1.20 0.88 1.15 0.87 1.14
0.78 0.13 0.86 1.39 1.18 1.31 0.93 1.59 0.89
a b c
2.48 2.29 2.27 2.23 2.22 2.58 2.15 2.52 2.18
Results of two experiments are given. Nickel left in solution after incubation with spores. Calculated by subtracting the concentration of free nickel from the initial [Ni2þ].
0.72 0.91 0.93 0.97 0.88 0.62 0.85 0.38 0.82
2.34 2.23 2.07 2.05 2.00 2.38 1.92 2.10 1.92
0.86 0.97 1.13 1.15 1.10 0.84 1.08 0.80 1.08
K. Hinc et al. / Research in Microbiology 161 (2010) 757e764
761
Table 2 Results of ANOVA for nickel adsorption by wild type and recombinant spores. Factors
pH Temp Biomass Error a
DOFa (F)
Sum of squares (S)
Variance (V)
F-ratio (F)
Pure sum (S)
Percent
wt
CotB18His
wt
CotB18His
wt
CotB18His
wt
CotB18His
wt
CotB18His
wt
CotB18His
2 2 2 2
2 2 2 2
7.23 4.68 34.60 1.77
0.32 0.72 8.81 0.57
3.61 2.34 17.30 0.88
0.16 0.36 4.40 0.28
4.09 2.65 19.56
0.56 1.26 15.41
5.46 2.92 32.83
0 0.15 8.24
11.31 6.04 68.00 14.66
0 1.45 79.02 19.53
Degree of freedom.
The third protein extracted only from CotB18His spores (Fig. 1A, lane 3) has an apparent molecular weight that correlates well with the deduced mass of the recombinant protein (275 amino acids of CotB plus 18 histidine residues: approximately 36 kDa). This protein was the only one visualized by western blot with anti-His antibody (Fig. 1B), indicating that it is the recombinant form of CotB with the 18 His residues replacing the C-terminus of CotB. This recombinant protein was not abundant within the coat protein fraction extracted from CotB18His spores and long exposure was needed to visualize it. 3.2. Surface display of CotB18His To verify whether recombinant protein CotB18His was displayed on the spore surface, we used an immunofluorescence microscopy approach. Sporulating cells of strain CotB18His were reacted with anti-His antibody and then with an anti-mouse IgG-TR conjugated with Texas Red secondary antibody (Materials and methods). As shown in Fig. 2, fluorescence was not found in the mother cell of sporulating cells but only around prespores, suggesting that the recombinant
protein is assembled around the forming spores. However, fluorescence was only associated with the surface of sporulating cells and was not found around mature spores. Since we extracted CotB18His from mature spores (Fig. 1) and observed a fluorescent signal around forming spores but not around mature spores (Fig. 2), we hypothesized that the histidine residues were within the coat of recombinant spores on the spore surface during the process of spore formation but were covered by some other coat protein or by the recently discovered spore crust (McKenney et al., 2010) and no longer accessible to anti-His antibody in mature spores. An alternative possibility was that the His tag was partially cleaved on the mature spore by an unknown enzyme and that the remaining unproteolyzed CotB18His was not accessible to the antibody. Either way, we would expect that nickel ions, because of their size, could infiltrate the proteins of the coat and reach the His residues, making possible their adsorption. 3.3. Ni2þ ions adsorption In a first experiment, 20 mg of wild type or recombinant spores were incubated at 45 C in a nickel sulfate solution
Fig. 1. Western blot analysis performed with purified spores of a wild type strain of B. subtilis (lanes 1) and with isogenic strains deleted of cotB (lanes 2) or carrying the cotB18His allele together with the wild type cotB allele (lanes 3). Proteins were reacted with anti-CotB (A) or anti-His (B) antibodies. Molecular weight markers were loaded in the first lane of each panel.
762
K. Hinc et al. / Research in Microbiology 161 (2010) 757e764
Fig. 2. Microscopy analysis of recombinant spores. The same microscopy field is observed by phase contrast (A) and fluorescence (B) microscopy. Panel C reports the combination of A and B panels. Sporulating cells were analyzed 8 h after the onset of sporulation.
(3 ppm, pH 9.0). Spores were then collected by centrifugation and the supernatants were filter-sterilized and analyzed for nickel content by atomic adsorption (Materials and methods). Similarly to what was observed with other systems (Bae et al., 2001; Kuroda and Ueda, 2006), nickel binding occurred within 10 min of incubation and after that time binding sites appeared saturated (Fig. 3A). As reported in Fig. 3B, both wild type and
recombinant spores were able to bind nickel ions, reducing the amount of free nickel in the solution. However, recombinant spores were able to remove a statistically significantly higher amount of nickel ions than wild type spores, indicating that the presence of the His tag increased nickel adsorption (Fig. 3B). Those results indicated that the 18 His tag, although not exposed on the spore surface, significantly contributed to nickel binding and, in turn, suggested that the approach to constructing recombinant spores that express a His tag within the coat can be successful for nickel bioremediation. Fusions of the His tag either to other regions of CotB or to a different coat component, or to more than one coat component, will have to be constructed and analyzed to identify the recombinant strain most efficient in nickel binding. The observation that wild type spores can bind nickel ions is also interesting and is in agreement with a previous report showing that the carboxylate and phosphate groups present on the spore surface determine a negative surface charges that make the spore a potent scavenger of cations (He et al., 2005). 3.4. Conditions of Ni2þ ions adsorption
Fig. 3. (A) Effect of incubation time on nickel adsorption. At the indicated times, the adsorption reaction was stopped, samples centrifuged and cell-free supernatants analyzed for nickel concentration. Recombinant spores (open symbols) are compared with samples not treated with spores (closed symbols). Identical kinetics were observed with the wild type spore. (B) The amount of nickel remaining in solution after incubation with wild type and CotB18His spores is reported (*between white and gray bars, P < 0.05; **between gray and black bars, P < 0.05). The control (white) bar indicates the amount of nickel initially present in solution. The adsorption reaction was performed at pH 9.0 and 45 C using 20 mg of spores.
It has been shown in other bioremediation systems that metal adsorption is highly dependent on the experimental conditions utilized (Fourest and Roux, 1992; He et al., 2005; Hesampour et al., 2008a). We therefore decided to analyze whether factors such as pH, temperature and amount of spores used in the reaction affected the efficiency of nickel adsorption. To this aim and to minimize the number of experiments, we used the Taguchi experimental design method, a fractional factorial design system which uses an orthogonal array to analyze the influence of various factors with only a small number of experiments (Hesampour et al., 2008a,b; Rao et al., 2008; Yang and Tarng, 1998). The set of experiments, designed using the Taguchi approach, consisted of 9 trials (Table 1). By this method, the highest value of S/N ratio (Materials and methods) is indicative of ideal conditions. As reported in Table 1, for both wild type and recombinant spores, the highest S/N ratio was obtained in trial 4, therefore, indicating that, for both types of spores, the ideal conditions for nickel binding were pH 7.0, 25 C and 20 mg of spores.
K. Hinc et al. / Research in Microbiology 161 (2010) 757e764 Table 3 Desorption rates.
763
References
Desorbents
Desorbed nickel (%) wt
CotB18His
Phosphate buffer (pH 4.0) EDTA (5 mM)
40 37
43 42
The influence and relative importance of the three analyzed factors are quantitatively shown by the analysis of variance (ANOVA) (Materials and methods) and are reported in Table 2. The percent contribution of each factor to the response is reported in the last column of Table 2. The highest value was observed for the amount of biomass used in the reaction that, therefore played a relevant role in nickel adsorption. The optimum conditions, determined according to the significance of the factors, is expressed by the F-ratio (Table 2). Since an F-ratio lower than one has no significant effect compared to the error (Materials and methods), pH was not considered to be a relevant factor (Table 2). In agreement with the percent contribution of each factor discussed above (last column of Table 2), the highest F-ratio was observed for the factor “biomass” for both types of spores. Our statistical analysis led us to conclude that: i) for all experimental conditions analyzed, adsorption of nickel was higher for the recombinant than for the wild type spores (Table 1); ii) the optimum conditions for nickel adsorption are those used in Trial 4 (Table 1: pH 7.0, 25 C and 20 mg of spores); iii) the amount of biomass used in the reaction significantly affects nickel adsorption; iv) pH and temperature do not affect the reaction. 3.5. Ni2þ ion desorption In order to assess whether nickel ions that bound to wild type and recombinant spores could be released and nickel recovered, we performed desorption experiments as described in Materials and methods. With phosphate buffer, 40 and 43 percent of the previously adsorbed nickel ions were released by wild type and recombinant spores, respectively (Table 3). Only slightly less efficient desorption was observed using 5 mM EDTA as desorbent (Table 3). Therefore, an acidic condition or a chelating agent had similar efficiency at eluting nickel ions from both wild type and recombinant spores. The possibility of recovering at least part of the adsorbed nickel ions is an additional useful property of both wild type and recombinant spores that contributes to considering spores as new and potentially powerful bioremediation agents. Acknowledgments This work was supported by grant n. 232 from the Ministry of Science, Research and Technology, Iran to G.A. and by grant n. KBBE-2007-207948 from the EU 7th Framework to E.R.
Ahalya, N., Ramachandra, T.V., Kanamadi, R.D., 2003. Biosorption of heavy metals. Res. J. Chem. Environ. 7, 71e80. Bae, W., Chen, W., Mulchandani, A., Mehra, R., 2000. Enhanced bioaccumulation of heavy metals by bacterial cells displaying synthetic phytochelatins. Biotechnol. Bioeng. 70, 518e524. Bae, W., Mehra, R., Mulchandani, A., Chen, W., 2001. Genetic engineering of Escherichia coli for enhanced uptake and bioaccumulation of mercury. Appl. Environ. Microbiol. 67, 5335e5338. Bae, W., Mulchandani, A., Chen, W., 2002. Cell surface display of synthetic phytochelatins using ice nucleation protein for enhanced heavy metal bioaccumulation. J. Inorg. Biochem. 88, 223e227. Cutting, S., Vander Horn, P.B., 1990. Genetic analysis. In: Harwood, C., Cutting, S. (Eds.), Molecular Biological Methods for Bacillus. John Wiley and Sons, Chichester, UK, pp. 27e74. Daneshvar, N., Khataee, A.R., Rasoulifard, M.H., Pourhassan, M., 2007. Biodegradation of dye solution containing Malachite Green: optimization of effective parameters using Taguchi method. J. Haz. Mater. 143, 214e219. Dick, G.J., Torpey, J.W., Beveridge, T.J., Tebo, B.M., 2008. Direct identification of a bacterial manganese(II) oxidase, the multicopper oxidase MnxG, from spores of several different marine Bacillus species. Appl. Environ. Microbiol. 74, 1527e1534. Fourest, E., Roux, J., 1992. Heavy metal biosorption by fungal mycelial byproduct: mechanisms and influence of pH. Appl. Microbiol. Biotechnol. 37, 399e403. He, Z.L., Yang, X.E., Stoffella, P.J., 2005. Trace elements in agroecosystems and impacts on the environment. J. Trace. Elem. Med. Biol. 19, 125e140. Henriques, A.O., Moran Jr., C.P., 2007. Structure, assembly and function of the spore surface layers. Ann. Rev. Microbiol. 61, 555e588. Hinc, K., Isticato, R., Dembek, M., Karczewska, J., Iwanicki, A., PeszynskaSularz, G., De Felice, M., Obukowski, M., Ricca, E., 2010. Expression and display of UreA of Helicobacter acinonychis on the surface of Bacillus subtilis spores. Microb. Cell Factories 9, 2. Harry, E.J., Pogliano, K., Losick, R., 1995. Use of immunofluorescence to visualize cell-specific gene expression during sporulation in Bacillus subtilis. J. Bacteriol. 177, 3386e3393. Hesampour, M., Krzyzaniak, A., Nystro¨m, M., 2008a. Treatment of waste water from metal working by ultrafiltration, considering the effects of operating conditions. Desalination 222, 212e221. Hesampour, M., Krzyzaniak, A., Nystro¨m, M., 2008b. The influence of different factors on the stability and ultrafiltration of emulsified oil in water. J. Membr. Sci. 325, 199e208. Isticato, R., Cangiano, G., Tran, H.T., Ciabattini, A., Medaglini, D., Oggioni, M. R., De Felice, M., Pozzi, G., Ricca, E., 2001. Surface display of recombinant proteins on Bacillus subtilis spores. J. Bacteriol. 183, 6294e6301. Keskinkan, O., Goksu, M.Z.L., Yuceer, A., Basibuyuk, M., Forster, C.F., 2003. Heavy metal adsorption characteristics of a submerged aquatic plant (Myriophyllum spicatum). Process Biochem. 39, 179e183. Kim, K.D., Choi, D.W., Choa, Y.H., Him, H.T., 2007. Optimization of parameters for the synthesis of zinc oxide nanoparticles by Taguchi robust design method. Colloids Surf. Physicochem. Eng. Aspects 311, 170e173. Kratochvil, D., Volesky, B., 1998a. Advances in the biosorption of heavy metals. Trends Biotechnol. 16, 291e300. Kratochvil, D., Volesky, B., 1998b. Biosorption of Cu from ferruginous wastewater by algal biomass. Wat. Res. 32, 2760e2768. Krishnaswamy, R., Wilson, D., 2000. Construction and characterization of an Escherichia coli strain genetically engineered for Ni(II) bioaccumulation. Appl. Environ. Microbiol. 66, 5383e5386. Kuroda, K., Ueda, M., 2006. Effective display of metallothionein tandem repeats on the bioadsorption of cadmium ion. Appl. Microbiol. Biotechnol. 70, 458e463. Lee, Y., Tebo, B.M., 1994. Cobalt oxidation by the marine manganese(II)oxidizing Bacillus sp. strain SG-1. Appl. Environ. Microbiol. 60, 2949e2957. Mayhew, L.E., Swanner, E.D., Martin, A.P., Templeton, A.S., 2008. Phylogenetic relationships and functional genes: distribution of a gene (mnxG)
764
K. Hinc et al. / Research in Microbiology 161 (2010) 757e764
encoding a putative manganese-oxidizing enzyme in Bacillus species. Appl. Environ. Microbiol. 74, 7265e7271. McKenney, P.T., Driks, A., Eskandarian, H.A., Grabowski, P., Guberman, J., Wang, K.H., Gitai, Z., Eichenberger, P., 2010. A distance-weighted interaction map reveals a previously uncharacterized layer of the Bacillus subtilis spore coat. Curr. Biol. 20, 934e938. Monroe, A., Setlow, P., 2006. Localization of the transglutaminase crosslinking sites in the Bacillus subtilis spore coat protein GerQ. J. Bacteriol. 188, 7609e7616. Norton, L., 2003. Biosorption of zinc from aqueous solutions using biosolids. Adv. Environ. Res. 56, 156e162. Rao, R.S., Kumar, C.G., Prakasham, R.S., Hobbs, P.J., 2008. The Taguchi methodology as a statistical tool for biotechnological applications: a critical appraisal. Biotechnol. J. 3, 510e523. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning. A Laboratory Manual, second ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, US. Sousa, C., Cebolla, A., de Lorenzo, V., 1996. Enhanced metalloadsorption of bacterial cells displaying poly-His peptides. Nat. Biotechnol. 14, 1017e1020.
Sousa, C., Kotrba, P., Ruml, T., Cebolla, A., De Lorenzo, V., 1998. Metalloadsorption by Escherichia coli cells displaying yeast and mammalian metallothioneins anchored to the outer membrane protein LamB. J. Bacteriol. 180, 2280e2284. Valls, M., Atrian, S., de Lorenzo, V., Fernandez, L.A., 2000a. Engineering a mouse metallothionein on the cell surface of Ralstonia eutropha CH34 fro immobilization of heavy metals in soli. Nat. Biotechol. 18, 661e665. Valls, M., de Lorenzo, V., Gonzalez-Duarte, R., Atrian, S., 2000b. Engineering outer-membrane proteins in Pseudomonas putida for enhanced heavymetal bioadsorption. J. Inorg. Biochem. 79, 219e223. Yamamoto, H., Mori, M., Sekiguchi, J., 1999. Transcription of genes near the sspE locus of the Bacillus subtilis genome. Microbiology 145, 2171e2180. Yang, W.H., Tarng, Y.S., 1998. Design optimization of cutting parameters for turning operations based on the Taguchi method. J. Mater. Proces. Technol. 84, 122e129. Youngman, P., Perkins, J.B., Losick, R., 1984. A novel method for the rapid cloning in Escherichia coli of Bacillus subtilis chromosomal DNA adjacent to Tn917 insertion. Mol. Gen. Genet. 195, 424e433.