Efficient biodegradation of dihalogenated benzonitrile herbicides by recombinant Escherichia coli harboring nitrile hydratase-amidase pathway

Accepted Manuscript Title: Efficient biodegradation of dihalogenated benzonitrile herbicides by recombinant Escherichia coli harboring nitrile hydratase-amidase pathway Authors: Xiaolin Pei, Jiapao Wang, Wei Guo, Jiang Miao, Anming Wang PII: DOI: Reference:

S1369-703X(17)30146-8 http://dx.doi.org/doi:10.1016/j.bej.2017.05.021 BEJ 6717

To appear in:

Biochemical Engineering Journal

Received date: Revised date: Accepted date:

14-11-2016 23-5-2017 29-5-2017

Please cite this article as: Xiaolin Pei, Jiapao Wang, Wei Guo, Jiang Miao, Anming Wang, Efficient biodegradation of dihalogenated benzonitrile herbicides by recombinant Escherichia coli harboring nitrile hydratase-amidase pathway, Biochemical Engineering Journalhttp://dx.doi.org/10.1016/j.bej.2017.05.021 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Title page Title Efficient biodegradation of dihalogenated benzonitrile herbicides by recombinant Escherichia coli harboring nitrile hydratase-amidase pathway Author names and affiliations Xiaolin Peia,*, Jiapao Wanga, Wei Guoa, Jiang Miaob, Anming Wanga,* a

College of Material, Chemistry and Chemical Engineering, Hangzhou Normal

University, Hangzhou, 310012, PR China b

College of Pharmaceutical Science, Zhejiang Chinese Medical University, Hangzhou,

310053, PR China *

Corresponding author at: College of Material, Chemistry and Chemical Engineering,

Hangzhou Normal University, Hangzhou, 310012, PR China. Tel.: +86-0571-28865978

E-mail address: [email protected] (X. Pei); [email protected] (A. Wang)

1

Graphical Abstract

Highlights 

Benzonitrile herbicides were efficiently degraded by recombinant Escherichia coli.



Dichlobenil and ioxynil were degraded to corresponding carboxylic acids.



Recombinant E. coli harbored NHase-amidase pathway using gene recombination.



Hydratase and amidase were functionally co-expressed using plasmid pCDFDuet-1.

Abstract Worldwide use of benzonitrile herbicides has caused a contamination hazard for groundwater, and their removal has attracted increasing attention. Microbial degradation has been considered as a major route of removing toxic nitriles from the environment. However, the process is very inefficient for degrading benzonitrile herbicides by natural microbes. In this study, a recombinant microbial cell was constructed to degrade benzonitrile herbicides by co-expression of nitrile hydratase and amidase in Escherichia coli. Both enzymes were functionally over-expressed in the cytoplasm of E. coli. The NHase activities of the cell reactor on dichlobenil and ioxynil were 15.4 and 21.3 U/mg dry cell weigh (DCW), respectively. And the amidase activities on 2,62

dichlorobenzamide and 3,5-iodo-4-hydroxybenzamide were 8.3 and 13.6 U/mg DCW, respectively. Furthermore, the degradation of dichlobenil and ioxynil was investigated using the recombinant cell reactor. The degradation process suggested that dichlobenil and ioxynil were degraded to corresponding carboxylic acids via nitrile hydrataseamidase pathway, and the intermediate amides (2,6-dichlorobenzamide and 3,5-iodo-4hydroxybenzamide) did not accumulate in the reaction mixture. The degradation rates of dichlobenil and ioxynil were 43 and 185 mg/g DCW/h, respectively. The recombinant E. coli cell reactor was observed to be promising catalysts for the bioremediation of wastewater containing benzonitrile herbicides. Keywords: Biodegradation; ; ; ; , Biocatalysis, Nitrile hydratase, Amidase, Benzonitrile herbicides

3

1. Introduction The occurrence of herbicides and their residues in the environment has caused great concern worldwide [1,2]. Dichlobenil (2,6-dichlorobenzonitile), bromoxynil (3,5dibromo-4-hydroxybenzonitrile) and ioxynil (3,5-diiodo-4-hydroxybenzonitrile) are a group of benzonitrile herbicides containing a cyano-group and a dihalogenated phenyl [3]. Dichlobenil is a broad-spectrum contact herbicide, and used mostly in gardens, fruit orchards and plant nurseries. Bromoxynil and ioxynil are used for post-emergence control of broad-leaved weeds. According to statistics of Danish Environmental Protection Agency and United States Environmental Protection Agency, 556 tons of dichlohbenil, 106 tons of bromoxynil and 96 tons of ioxynil were sold between 20092011 in Denmark, and 68-102 tons of dichlohbenil was used between 1993-1995 in the United States [4,5]. These herbicides have caused a contamination hazard for soil and groundwater, and may threaten human health [6,7]. Particularly, the risk associated with the persistent metabolites of benzonitrile herbicides has recently been increasingly investigated because of their mobility and toxicity [8,9]. Dichlobenil can be slowly degraded to 2,6-dichlorobenzamide (BAM) by microorganisms in soil [10,11]. The solubility of BAM in water (1830 mg/L) is significantly higher than dichlobenil (21.2 mg/L) (data from Pesticide Properties DataBase, PPDB) [12]. BAM is recalcitrant to further degradation and easily leaches through the soil profile to contaminate groundwater. Therefore, dichlobenil was detected in only 0.9% of Danish drinking water abstraction wells, but BAM was found in 20.5% of wells in the period from 19922002 [13]. The metabolite was also detected in groundwater in the Netherlands, 4

Germany, and Italy [14]. 3,5-dibromo-4-hydroxybenzamide (BrAM) and 3,5-iodo-4hydroxybenzamide (IAM) from bromoxynil and ioxynil are also biodegraded by soil microbes and detected in groundwater [15,16]. Dichlobenil exhibits lower acute toxicity than bromoxynil and ioxynil. The toxicity of BAM is decreased compared to the parental nitrile, while BrAM and IAM all exhibit a higher toxicity than the corresponding nitriles [17]. To decrease the toxicity of benzonitrile herbicides, it is necessary to further degrade these amides to corresponding acids. Therefore, how to efficiently remove nitrile herbicides and their metabolites from the environment remains an important research subject. Microbial degradation has been demonstrated to be an efficient and environmentally friendly method for removing toxic contaminants [18]. Microbial degradation of nitriles to corresponding carboxylic acids generally occurs via the hydrolytic route, which consists of two enzymatic systems [19,20]. Nitrile hydratase (NHase, EC 4.2.1.84) catalyzes nitriles to amides, which are subsequently converted to carboxylic acids and ammonia by amidase (EC 3.5.1.4). Alternatively, nitrilase (EC 3.5.5.1) directly converts nitrile compounds into corresponding carboxylic acid and ammonia (Fig. 1). These nitrile-degrading enzymes have received increasing general attention for enzymatic production of chemicals, biosynthesis of plant hormones, and bioremediation of toxic nitriles [21,22]. For the NHase/amidase system, NHase and amidase generally exist in a complex gene cluster. Some elements in gene cluster precisely control the biosynthesis of NHases, particularly activator gene [23]. The activator gene is adjacent to α- or βsubunit gene of NHase, and is necessary for the functional expression of NHase and 5

amidase in vivo. The characteristic gene cluster means that it is difficult to efficiently express NHase and amidase in native microbes because the two enzymes were generally induced by different inducers [23]. Recently, the degradation of BAM, BrAM and IAM was reported by Rhodococcus erythropolis A4 and Aminobacter sp. MSH1, but the degradation efficiency was very low [11,17]. Therefore, it is necessary to reconstruct novel microbes for efficiently degrading benzonitrile herbicides from the environment. With the development of gene recombination techniques, it is an alternative strategy to construct a cell reactor harboring NHase and amidase for degradation of benzonitrile herbicides. Given the convenience to express NHase and amidase in the host cell, the removal of environmental pollutants must be more efficient than wild microbes. In our previous studies, various NHase genes and amidase genes were discovered by genome mining and further functionally expressed in Escherichia coli [24,25]. In this study, NHases and amidases were investigated for degrading dichlobenil and ioxynil and their metabolites (BAM and IAM). Furthermore, some recombinant cell reactors were constructed by the co-expression of NHase and amidases in E. coli. Then the cell reactors were investigated in terms of degradation efficiency of dichlobenil and ioxynil. The strategy highlights the potential of recombinant E. coli cell reactors in the removal of toxic nitrile pollutions from the environment. 2. Methods 2.1. Chemicals, bacterial strain and plasmids Chemicals used in this study were purchased from Sinopharm Chemical Reagent (Shanghai, China) unless otherwise specified. Dichlobenil (DCB), 2,66

dichlorobenzamide (BAM) and 2,6-dichlorobenzoic acid (DCBA) were purchased from Sigma-Aldrich. Ioxynil (DIHB), 3,5-iodo-4-hydroxybenzamide (IAM) and 3,5-iodo-4hydroxybenzoic acid (DIHBA) were purchased from Energy Chemical (Shanghai, China). Acetonitrile and methanol for HPLC analysis were purchased from Merck (Darmstadt, Germany). Yeast extract and tryptone were obtained from OXOID (Basingstoke, England). Escherichia coli strains and plasmids used in this study are listed in Table 1. E. coli DH5α and BL21 (DE3) were served as cloning and recombinant protein expression hosts, respectively. Plasmids pET24a and pCDFDuet-1 were employed to construct recombinant vector for recombinant expression of NHase and amidase. 2.2. Medium and culture for enzyme expression Luria–Bertani (LB) medium was used for the growth of recombinant E. coli. LB media were supplemented with appropriate antibiotic (100 μg/mL ampicillin, 50 μg/mL kanamycin or 50 μg/mL streptomycin) and isopropyl β-D-1-thiogalactopyranoside (IPTG, 100 μM) as required. Recombinant E. coli harboring different plasmids were cultivated in 100 mL LB media at 37 °C until the OD600 reached 0.8. Then, IPTG was added to a final concentration of 0.1 mM to induce the expression of recombinant enzymes at 18 °C for 12 h. 2.3. Construction of recombinant cell bioreactors The recombinant plasmids containing NHase and amidase gene had been constructed and preserved in our laboratory. To achieve the co-expression of NHase and amidase in E. coli, two strategies were designed: two genes in two compatible plasmids and two 7

genes in a plasmid (Fig. 2). Primers used in this study are described in Table 2. In the first scenario, the NHase gene was cloned into plasmid pET24a, and the amidase gene was cloned into plasmid pCDFDuet-1. The amidase gene from Rhodococcus erythropolis was amplified with plasmid pEAm02 as a template through polymerase chain reaction (PCR) using primers Rho_Am-F and Rho_Am-R, and the amidase gene from Agrobacterium tumfaciens D3 was amplified with plasmid pEAm03 as a template using primers Agro_Am-F and Agro_Am-R. PCRs were conducted with PrimeSTARTM Max DNA polymerase [Takara (Dalian) Biotech, China]. PCRs were carried out as follows: a preliminary denaturation was conducted at 95 °C for 2 min, followed by 30 cycles of 10 s denaturation at 95 °C, 15 sec annealing at 58 °C, and 15 sec extension at 72 °C. Final extension was conducted at 72 °C for 5 min. The PCR products were recovered using a DNA gel extraction kit (Axygen, New York, USA). A fragment of approximately 1.6 kb was digested by NdeI/XhoI or NdeI/EcoRV and ligated into pCDFDuet-1 with the same restriction digestion to obtain recombinant plasmids pCAm02 and pCAm03, respectively (Table 2). Recombinant plasmid pENh11 containing NHase gene from Bradyrhizobium japonicum USDA 110 was cotransformed into E. coli BL21 (DE3) with pCAm02 or pCAm03, and the positive clones were placed on LB agar plates supplemented with kanamycin and streptomycin. In the second scenario, the NHase gene from B. japonicum USDA 110 was amplified using primers Bra_NHase-F and Bra_NHase-R, and inserted into pCAm02 and pCAm03 to obtain recombinant pCNh11-Am02 and pCNh11-Am03, respectively. Recombinant plasmids pCNh11-Am02 and pCNh11-Am03 were respectively transformed into E. coli 8

BL21 (DE3), and the positive clones were screened by streptomycin on LB agar plates. The positive clones were further sequenced (Sangon Biotech, Shanghai, China). 2.4. Screening of enzymes to degrade dichlobenil and ioxynil A resting cell system was adopted in all screening and degradation experiments. Recombinant E. coli cells were harvested by centrifugation at 8000 × g and 4 °C for 5 min. The collected cells (approximate 3.2 mg DCW from 5 ml LB culture) were washed twice with 50 mM phosphate buffer (pH 7.0) at room temperature and were incubated in an Eppendorf tube containing 2 mL 50 mM phosphate buffer (pH 7.0) supplemented with 100 μmol/L dichlobenil and ioxynil. The tubes containing equal amounts of each nitrile but not recombinant E. coli cells were designated as controls. The cultures were incubated at 30 °C in an orbital shaker at 200 rpm, and samples were collected at regular intervals. The concentrations of different nitriles, amides and carboxylic acids were determined by high performance liquid chromatography (HPLC, Agilent 1100, Palo Alto, USA). 2.5. Biodegradation of benzonitrile herbicides The recombinant E. coli containing pCNh11-Am02 or pCNh11-Am03 (approximate 3.2 mg DCW) was suspended in 2 mL buffers supplemented with 100 μmol/L dichlobenil and ioxynil. The degradation of bezonitrile herbicides was measured at different pH values between 5.2 and 10.0 to determine the optimum reaction pH, and the optimum temperature was determined at 25-55 °C. The following buffers were used: 50 mM citric acid-Na2HPO4 buffer (pH 5.2-6.8), 50 mM sodium phosphate buffer (pH 6.8-7.6), 50 mM Tris-HCl buffer (7.6-8.4), and 50 mM glycine-NaOH buffer (pH 9.2-10). To 9

examine the effect of the substrate concentration on the degradation of bezonitrile herbicides, the concentration of dichlobenil or ioxynil (i.e., 0.1 mM to 20 mM) varied in the 2 mL reaction mixture. The cultures were incubated at 30 °C in an orbital shaker at 200 rpm for 48 h. The biodegradation of benzonitrile herbicides was implemented in 250-mL Erlemeyer flasks containing 50 mL 50 mM sodium phosphate buffer of 2.0 mM dichlobenil or/and ioxynil. Recombinant E. coli resting cell was added at a concentration of approximately 1.6 g/L DCW. The cultures were incubated at 30 °C in an orbital shaker at 200 rpm, and samples were collected at regular intervals. All experiments were performed in triplicate, and controls without biomass were also conducted. 2.6. Identification of nitrile degradation and metabolic products The concentrations of different nitriles, amides and carboxylic acids in the reaction mixture were analyzed using a reversed-phase HPLC equipped with a C18 reverse phase column (Varian pursuit C18, 5 μm, 4.6 ×250 mm) [27]. The mixture of deionized H2OMeOH-AcOH (40:60:0.5, v/v/v) was used as a mobile phase, and the flow rate was 0.5 mL/min. The wavelength of detection was 254 nm, and 5 μL of sample was injected. All measurements were carried out at 35 °C. All samples were centrifuged at 8000 × g for 5 min, and the supernatant was filtered through a 0.45-μm nylon filter before analysis. 2.7. Enzyme assays and other Analytical methods NHase and amidase activities were determined using 100 μmol/L nitrile or amide as the substrate, respectively. Assays for these enzymes were performed in a standard reaction 10

mixture (0.5 ml) containing 50 mM phosphate buffer (pH 7.0), 10 mM substrate and an appropriate amount of recombinant E. coli cells. The reaction was incubated at 30 °C for 10 min and stopped by adding 0.5 ml acetonitrile. The same reaction system without recombinant E. coli cells was used as a reaction blank. The cells were removed by centrifugation at 8000 × g for 2 min. NHase activity was determined based on amides production, and amidase activity was determined based on acids production. One unit (U) of NHase or amidase activity was defined as the amount of enzyme that catalyzed the formation of one nmol of product in 1 min. Cell density was determined by measuring the optical density of the culture medium at 600 nm (OD600), and dry cell weigh (DCW) was determined by drying sample at 105 °C for 24h. Expression of recombinant NHase and amidase was analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE, 16%) with 4% stacking gel. The protein marker [Premixed protein marker low, 14.3 kDa to 97.2 kDa, Takara (Dalian) Biotech; ProteinRulerTM II, 12 kDa-120 kDa, TransGen Biotech, Beijing] was used as reference. The gels were stained with Coomassie brilliant blue G250. 3. Results and Discussion 3.1 Screening of NHase for degrading dichlobenil and ioxyni In order to screen the desired NHase to hydrate dichlobenil and ioxynil, we compared 13 recombinant NHases expressed in E. coli [25,26]. The results showed that NHase-01, NHase-02 and NHase-04 preferentially hydrated dichlobenil, and NHase-03, NHase-05, NHase-08, NHase-09, NHase-10, NHase-12 and NHase-13 efficiently hydrated ioxynil, 11

and NHase-11 can completely hydrate dichlobenil and ioxynil (Table 3). The deduced amino acid sequence of NHase-11 showed that a conserved metal ion-binding motif (CTLCSCY) existed in the α-subunit, and the activity of recombinant NHase-11 expressed in E. coli was cobalt-dependent. Therefore, NHase-11 from B. japonicum USDA 110 was determined as a member of Co-type NHase family. It is accepted that Co-type NHases are more robust and have wider substrate specificity than Fe-type NHases [28]. Our results showed Co-type NHases from different microbes exhibited significant biases in the degradation of benzonitrile herbicides. It may be because of the steric effect of different double halogen substitution. The results suggest that the Cotype NHase from B. japonicum USDA 110 possesses a higher affinity for dichlobenil and ioxynil, and is chosen for the future research. 3.2 Screening of amidase for degrading dichlobenil and ioxynil Amidase can catalyze the hydrolysis of amides into corresponding carboxylic acids and ammonia, and is increasingly important for detoxifying various environmental toxicants [29]. Four recombinant amidases were investigated to degrade the metabolites amides of dichlobenil and ioxynil (Table 4). The results showed that amidase-02 from R. erythropolis MP50 can efficiently convert 2,6-dichlorobenzamide (BAM) to corresponding carboxylic acid, but shows no activity for 3,5-diiodo-4hydroxybenzamide (IAM). On the contrary, amidase-03 from A. tumfaciens D3 showed activity for IAM, but not for BAM. The results showed that amidase exhibited a narrow substrate specificity for halogenated aromatic amides, which might be the main reason that the metabolites (BAM, BrAM and IAM) of benzonitrile herbicides are excessively 12

accumulated in the environment. Holtze et al. investigated the degradation processes of dichlobenil and benzonitrile by soil bacteria, such as Rhodococcus, Rhizobium and Pseudomonas, and showed that benzonitrile was degraded to benzoic acid by nitrile hydratase and amidase, but dichlobenil was only degraded to BAM [15]. The amidases from R. erythropolis MP50 and A. tumfaciens D3 can also efficiently transform benzamide to benzoic acid, however exhibited low activities in catalyzing BAM and IAM [30,31]. The difference is mainly due to the steric and electronic effects of the halogenated atom on dichlobenil and ioxynil [32]. 3.3 Cell reactor for co-expression of nitrile hydratase and amidase For the degradation of benzonitrile herbicides, a multi-enzymatic system containing NHase and amidase is an alternative strategy. In this study, we designed two multienzymatic one-pot processes, namely NHase and amidase in two plasmids or in one plasmid. In the first scenario, pENH-11 and pCAm02 or pCAm03 were co-transformed into E. coli, which contained NHase gene from B. japonicum USDA 110, and amidase gene from R. erythropolis MP50 or A. tumfaciens D3. SDS-PAGE showed that NHase and amidase were efficiently expressed in E. coli (Fig. 3 A-C). The NHase activities on dichlobenil and ioxynil were 8.4 U/mg and 10.6 U/mg dry weight cell (DWC), and the amidase activities on BAM and IAM were 4.7 U/mg and 7.3 U/ mg DWC, respectively. In the second scenario, pCNh11-Am02 and pCNh11-Am03 were constructed to express NHase and amidase. SDS-PAGE showed that recombinant enzymes were more efficiently expressed in the cytoplasm of E. coli compared with the first scenario (Fig. 3 D-F). The NHase activities on dichlobenil and ioxynil were 15.4 U/mg and 21.3 U/mg 13

DCW, and the amidase activities on BAM and IAM were 8.3 U/mg and 13.6 U/mg DWC, respectively. In addition, the growth rate of recombinant E. coli harboring two recombinant plasmids (pENh-11 and pCAm-02 or pCAm-03) was significantly decreased compared to that of one plasmid (pCNh11-Am02 and pCNh11-Am03), their final biomass (OD600) were approximately 1.3 and 1.7, respectively (Fig. 3 G and H). The growth curve suggested that the expression of recombinant NHase and amidase did not affect the growth of recombinant E. coli cell. SDS-PAGEs showed that the expression levels of NHase and amidase were different in two strategies. The copy number of plasmids might be one of the main reasons for the difference. The replicons of pET24a and pCDFDuet-1 are pBR322 and CloDF13derived CDF, and their copy numbers are 15~20 and 10~90, respectively. When pENh11, pCAm02, and pCAm03 derived from pET24a and pCDFDuet-1 were co-existed in E. coli, their replication competition would affect the expression of recombinant enzymes and the cell growth. The copy number and replication of the polycistronic plasmid containing NHase and amidase (pCNh11-Am02 and pCNh11-Am03) were fixed, and the expression of two enzymes were more efficient in E. coli cell. However, the expression of the recombinant proteins may be affected by differences in the rate of transcription, translation and the stability of RNA and protein products [34]. Based on the expression of recombinant NHase and amidase, the recombinant plasmids pCNh11Am02 and pCNh11-Am03 were further characterized in this work. 3.4 Influence of pH and temperature

14

The reaction pH and temperature play critical roles in the catalytic performance of recombinant E. coli cell containing pCNh11-Am02 or pCNh11-Am03 because of the effect on the activities of NHase and amidase. Therefore, a series of experiments were implemented to evaluate the catalytic ability of the cell reactor at different pHs and temperatures for the degradation of benzonitrile herbicides. The degradation of dichlobenil and ioxynil was tested at several solution pHs ranging from 5 to 10, and the degradation efficiency was highest at a pH range of 6.8~7.6 (Fig. 4A and B). Approximately 99% of parent nitriles (DCB and DIHB) were degraded to corresponding carboxylic acids after 48 h reaction time, and their intermediate metabolites (BAM and IAM) were not accumulated in the reaction mixture. When the reaction pH was adjusted to 6 or 9.2, approximately 50% of nitriles were degraded to corresponding carboxylic acids, and only approximately 3% of dichlobenil and ioxynil were degraded at pH 5.2 and 10.0. The results are consistent with the pH characteristics of NHase from B. japonicum USDA, amidases from R. erythropolis and A. tumfaciens D3, and they showed the highest catalytic activity at 7.0 to 8.0 [33,34]. In addition, it may also be a contributing factor that the cell viability of recombinant E. coli was maintained at neutral pH environment. The effect of the reaction temperature on the degradation of dichlobenil and ioxynil was examined (Fig. 4C and D). In the temperature range of 25 to 35 °C, dichlobenil and ioxynil were completely converted to corresponding carboxylic acids, and BAM and IAM were not detected in the reaction mixture. However, when the temperature was raised to 40 °C, the degradation efficiency of benzonitrile herbicides was decreased the 15

increasing temperature. At 50 °C, only approximately 6.3% and 11.0% dichlobenil and ioxynil were converted to corresponding acids, and BAM and IAM also accumulated in the reaction mixture. Therefore, a temperature of 30 °C was selected for efficient degradation of dichlobenil and ioxynil by recombinant E. coli cell. 3.5 Influence of dichlobenil and ioxynil concentrations The influence of initial substrate concentration on the degradation efficiency of recombinant E. coil cell was investigated (Fig. 5). When the initial concentration of dichlobenil was not more than 2 mM, dichlobenil was completely transformed to carboxylic acids. The critical concentration was 10 mM for ioxynil. When the initial concentration of nitriles in the mixed reaction solution increased to 20 mM, only 68.3% ioxynil and 16.4% dichlobenil were degraded to corresponding acids at 48 h. The result suggest that a high substrate concentration will affect the degradation efficiency of dichlobenil and ioxynil, and a longer time would be need to completely degrade target substrate. 3.6 Degradation of dichlobenil and ioxynil using recombinant E. coli cell The degradation rate of dichlobenil and ioxynil by recombinant E. coli cell were investigated (Fig. 6). The result showed similar characteristic changes in the degradation performance of dichlobenil as the degradation of ioxynil. However, the degradation of dichlobenil appeared to be slower and took approximately 24 h for complete degradation (in contrast to 16 h for ioxynil). BAM was generated and its concentration increased to a maximum of 0.75 mM at 16 h, and then decreased to zero at 40 h. IAM increased to a maximum of 0.45 mM at 8 h and decreased to zero at 20 h. 16

The degradation rates of dichlobenil and ioxynil were measured as 43 and 185 mg/g DCW/h respectively, which were significantly higher than those of natural microbes. The results suggest that dichlobenil and ioxynil can be efficiently degraded to corresponding carboxylic acids by the recombinant E. coli cell harboring NHase and amidase. However, how to degrade these aromatic carboxylic acids completely remains a challenge. The mixed-culture of the recombinant cell and other degrading bacteria, or a combination with a photocatalytic degradation system may be good strategies, which will be carried out in our future study. 4. Conclusions The present work has constructed recombinant E. coli harboring NHase and amidase using two co-expression strategies. These recombinant cell reactors were demonstrated to efficiently degrade dichlobenil and ioxynil to corresponding carboxylic acids, and their respective intermediate metabolite amides (BAM and IAM) did not accumulate in the reaction mixture. The degradation process performance suggested that dichlobenil and ioxynil were first converted to amides and further to carboxylic acids by nitrile hydratase-amidase system. The different degradation rates of ioxynil and dichlobenil were explained by the differences in the catalysis properties of recombinant NHase and amidases. The optimum reaction conditions were determined to be at near neutral pH and room temperature. The recombinant E. coli cell reactor harboring nitrile hydrataseamidase pathway seems useful for further bioremediation of wastewater containing benzonitrile herbicides.

17

Acknowledgments This work was financially supported by the Zhejiang Provincial Natural Science Foundation of China (No. LY15B060011, LQ12B06007), the Hangzhou Science and Technology Project (No. 20130533B17, 20151232I34), the National Natural Science Foundation of China (No. 21576062, 21206024).

18

References [1] C. Cruzeiro, E. Rocha, M.Ȃ. Pardal, M.J. Rocha, Environmental assessment of pesticides in the Mondego River Estuary (Portugal), Mar. Pollut. Bull. 103 (2016) 240-246. [2] B. Rashid, T. Husnain, S. Riazuddin, Herbicides and pesticides as potential pollutant: a global problem, in: M. Ashrat, M. Ozturk, M.S.A. Ahmad (Eds.), Plant adaptation and phytoremediation, Springer Netherlands, 2010, pp. 427-447. [3] D. Müller, J. Gabriel, Bacterial degradation of the herbicide Bromoxynil by Agrobacterium radiobacter in biofilm, Folia Microbiol. 44 (1999) 377-379. [4] Miljøministeriet,

Bekæmpelsesmiddelstatistik

Environmental

Protection

Agency),

2010.

Miljøstyrelsen Copenhagen

(Danish (2011).

http://www2.mst.dk/udgiv/publikationer/2011/10/978-87-92779-45-8.pdf. [5] US EPA, 1998. Reregistration Eligibility Decision (RED). Dichlobenil. https://archive.epa.gov/pesticides/reregistration/web/pdf/0263red.pdf. [6] Z. Frková, N. Badawi, A. Johansen, N. Schultz-Jensen, K. Bester, S.R. Sørensen, U.G. karlson, Degradation of the three benzonitrile herbicides by Aminobacter MSH1 versus soli microbial communities: pathways and kinetics, Pest Manag. Sci. 70 (2014) 1291-1298. [7] F. Xie, J. D’Agostino, X. Zhou, X. Ding, Bioactivation of the nasal toxicant 2,6dichlorobenzonitrile: an assessment of metabolic activity in human nasal mucosa and identification of indicators of exposure and potential toxicity, Chem. Res. Toxicol. 26 (2013) 388-398. 19

[8] V. Pukkila, MH. Kontro, Dichlobenil and 2,6-dichlorobenzamide (BAM) dissipation in topsoil and deposits from groundwater environment within the boreal region in southern Finland. Environ. Sci. Pollut. Res. 21 (2014) 2289-2297. [9] T. Reemtsma, L. Alder, U. Banasiak, Emerging pesticide metabolites in groundwater and surface water as determined by the application of a multimethod for 150 pesticide metabolites, Water Res. 47 (2013) 5535-5545. [10] M.S. Holtze, S.R. Sørensen, J. Sørensen, J. Aamand, Microbial degradation of the benzonitrile herbicides dichlobenil, bromoxynil and ioxynil in soil and subsurface environments – Insights into degradation pathways, persistent metabolites and involved degrader organisms, Environ. Pollut. 154 (2008) 155-168. [11] O.R. Sjøholm, O. Nybroe, J. Aamand, J. Sørensen, 2,6-Dichlorobenzamide (BAM) herbicide mineralisation by Aminobacter sp. MSH1during starvation depends on a subpopulation of intact cells maintaining vital membrane functions, Environ. Pollut. 158 (2010) 3618-3625. [12] K. Lewis, A. Green, The pesticide properties database: Beyond FOOTPRINT, Eur. J. Prev. Cardiolog. 21 (2014) 12-20. [13] S.R. Sørensen, M.S. Holtze, A. Simonsen, J. Aamand, Degradation and mineralization of nanomolar concentrations of the herbicide dichlobenil and its persistent metabolite 2,6-dichlorobenzamide by Aminobacter spp. isolated from dichlobenil-treated soils, Appl. Environ. Microbiol. 73 (2007) 399-406. [14] E. Porazzi, M.P. Martinez, R. Fanelli, E. Benfenati, GC-MS analysis of dichlobenil and its metabolites in groundwater, Talanta. 68 (2005) 146-154. 20

[15] M.S. Holtze, J. Sørensen, H. Christian, J. Aamand, Transformation of the herbicide 2,6-dichlorobenzonitrile to the persistent metabolite 2,6-dichlorobenzamide (BAM) by soil bacteria known to harbor nitrile hydratase or nitrilase, Biodegradation 17 (2006) 503-510. [16] P. Rosenbrock, J.C. Munch, I. Scheunert, U. Dörfler, Biodegradation of the herbicide bromoxynil and its plant cell wall bound residues in an agricultural soil, Pestic. Biochem. Phys. 78 (2004) 49-57. [17] A.B. Veselá, H. Pelantová, M. Šulc, M. Macková, P. Lovecká, M. Markéta, M. Thimová, F. Pasquarelli, M. Pičmanová, M. Pátek, T.C. Bhalla, L. Martínková, Biotransformation of benzonitrile herbicides via the nitrile hydratase-amidase pathway in Rhodococci, J. Ind. Mcirobiol. Biotechnol. 39 (2012) 1811-1819. [18] R.R. Dash, A. Gaur, C. Balomajumder, Cyanide in industrial wastewaters and its removal: A review on biotreatment, J. Hazard. Mater. 163 (2009) 1-11. [19] K. Häkansson, U. Welander, B. Mattiasson, Degradation of acetonitrile through a sequence of microbial reactors, Water Res. 39 (2005) 648-654. [20] P.W. Ramteke, N.G. Maurice, B. Joseph, B.J. Wadher, Nitrile-converting enzymes: an eco-friendly tool for industrial biocatalysis, Biotechnol. Appl. Biochem. 60 (2013) 459-481. [21] S. Fang, X. An, H. Liu, Y. Cheng, N. Hou, L. Feng, X. Huang, C. Li, Enzymatic degradation of aliphatic nitriles by Rhodococcus rhodochrous BX2, a versatile nitrile-degrading bacterium, Bioresource Technol. 185 (2015) 28-34. [22] J.S. Gong, J.S. Shi, Z.M. Lu, H. Li, Z.M. Zhou, Z.H. Xu, Nitrile-converting enzymes as a tool to improve biocatalysis in organic synthesis: recent insights and promises, 21

Crit. Rev. Biotechnol. 25 (2015) 1-13. [23] T. Sakashita, Y. Hashimoto, K.I. Oinuma, M. Kobayashi, Transcriptional regulation of the nitrile hydratase gene cluster in Pseudomonas Chlororaphis B23, J. Bacteriol. 190 (2008) 4210-4217 [24] M.K.K. Nielsen, M.S Holtz, B. Sevensmark, R. Juhler, Demonstrating formation of potentially persistent transformation products from the herbicides bromoxynil and ioxynil using liquid chromatography-tandem mass spectrometry (LC-MS/MS), Pest Manag. Sci. 63 (2007) 141-149. [25] F. Guo, J. Wu, L. Yang, G. Xu, Soluble and functional expression of a recombinant enantioselective amidase from Klebsiella oxytoca KCTC1686 in Escherichia coli and its biochemical characterization, Process Biotechem. 50 (2015) 1264-1271. [26] X. Pei, H. Zhang, L. Meng, G. Xu, L. Yang, J. Wu, Efficient cloning and expression of a thermostable nitrile hydratase in Escherichia coli using an auto-induction fedbatch strategy, Process Biochem. 48 (2013) 1921-1927. [27] X. Pei, L. Yang, G. Xu, Q. Wang, J. Wu, Discovery of a new Fe-type nitrile hydratase efficiently hydrating aliphatic and aromatic nitriles by genome mining, J. Mol. Catal. B-Enzym. 99 (2014) 26-33. [28] J. Gabriel, J. Věková, J. Vosáhlo, High-performance liquid chromatographic study of the aromatic nitrile metabolism in soil bacteria, J. Chromatogr. B Biomed. Sci. Appl. 681 (1996) 191-195. [29] L.V. Desai, M. Zimmer, Substrate selectivity and conformational space available to bromoxynil and acrylonitrile in iron nitrile hydratase, Dalton Trans. 6 (2004) 827877. 22

[30] W. Shen, H. Chen, K. Jia, J. Ni, X. Yan, S. Li, Cloning and characterization of a novel amidase from Paracoccus sp. M-1, showing aryl acylamidase and acyl transferase activities, Appl. Microbiol Biotechnol. 94 (2012) 1007-10018. [31] B. Hirrlinger, A. Stolz, H.J. Knackmuss, Purification and properties of an amidase from Rhodococcus erythopolis MP50 which enantioselectively hydrolyzes 2arylpropionamides, J. Bacteriol. 178 (1996) 3501-3507. [32] S. Trott, R. Bauer, H.J. Knackmuss, A. Stolz, Genetic and biochemical characterization of an enantioselective amidase from Agrobacterium tumefaciens strain d3, Microbiol. 147 (2001) 1815-1824. [33] B.Y. Xie, L.Q. Jin, Y.G. Zheng, Y.C. Shen, Advance in the substrate specificity of amidase, Agrochemicals 51 (2012) 473-481.

[34] K.J. Kim, H.E. Kim, K.H. Lee, W. Han, M.J. Yi, Two-promoter vector is highly efficient for overproduction of protein complexes, Protein Sci. 13 (2004) 1698-1703.

23

1

Tables

2

Table 1 Strains and plasmids used in this study Strain or plasmid

Relevant genotype or characteristic

Source

E. coli strains BL21 (DE3)

E. coli B, F—, dcm, lon, ompT, hsdS(rB—, a mB—), gal, λ(DE3 [lacI, lacUV5-T7, gene 1, TransGen ind1, sam7, nin5])

DH5α

F—, φ80dlacZΔM15, Δ(lacZYAargF)U169, deoR, recA1, endA1, hsdR17(rk-，mk+), supE44, λ-, thi-1, gyrA96, relA1, phoA

TransGen

pET24a

PT7lac, Ori (pBR322), KanR

Novagen b

pCDFDuet-1

PT7lac, Ori (CloDF13-derived CDF), SmR, two MCS c

Novagen

pCAm02

Expression vector, pCDFDuet-1 derivative, SmR, containing the amidase gene from R. erythropolis

in this study

pCAm03

Expression vector, pCDFDuet-1 derivative, SmR, containing the amidase gene from A. tumfaciens D3

in this study

pCNh11-Am03

Expression vector, pCDFDuet-1 derivative, SmR, containing nitrile hydratase gene and amidase gene from B. japonicum USDA 110 and A. tumfaciens D3, respectively

in this study

pCNh11-Am02

Expression vector, pCDFDuet-1 derivative, SmR, containing nitrile hydratase gene and amidase gene from B. japonicum USDA 110 and R. erythropolis, respectively

in this study

Plasmids

Recombinant plasmids

24

3

Beijing TransGen Biotech CO., LTD., PR China; b Merck KGaA, Darmstadt, Germany; c MCS: Multiple cloning sites; d Takara Biotechnology (Dalian) Co., LTD., China.

4

Table 2 Primer sequences used to clone NHase and amidase genes

1 2

a

Primer

5

a

Sequence a

Restriction site

Rho_Am-F

GGAATTCCATATGCGACCCAATCGCCCATTCGG

Nde I

Rho_Am-R

CCGGATATCTTACCGCAGCACCGGTGCGC

EcoR V

Agro_Am-F

GGAATTCCATATGAGTCTGGGACCAGAGCTTGC

Nde I

Agro_Am-R

CCGCTCGAGTTACATTTTCCGCCAGTCGCC

Xho I

Bra_NHase-F

CGGAATCCGATGCAGCCCATCCCATGGC

EcoR I

Bra_NHase-R

CCCAAGCTTCTACCTAAAATCCTCCGGC

Hind III

The restriction sites are underlined in italics

6

25

1

Table 3 Analysis of dichlobenil and ioxynil degradation with Recombinant NHases

Enzyme No.

Recombinant plasmida

NHase01

GenBank accession number of α subunit

Conversion (%) Type

Gene source

pCNH01/pCD ABQ78862.1 FDuet-1

Fetype

NHase02

pENH02/pET 30a

AAC18418.1

NHase03

pENH03/pET 24a

NHase04

dichlobeni l

ioxyni l

Pseudomonas putida F1

>99%

15.2%

Cotype

Pseudomonas putida 5B

>99%

2.4%

QBQ64036.1

Cotype

Mesorhizobium loti

64.3%

>99%

pENH04/pET 28a

SHK14531.1

Cotype

Pseudonocardia thermophile JCM3095

>99%

30.4%

NHase05

pENH05/pET 28a

EAP83682.1

Cotype

Sulfitobacter sp EE-36

ndb

>99%

NHase06

pENH06/pET 28a

AAV94603.1

Cotype

Silicibacter pomeroyi DSS-3

17.8%

75.3%

26

NHase07

pENH07/pET 24a

CAA14531.1

Cotype

Rhodococcus rhodochrous J1

nd

34.3%

NHase08

pENH08/pET 28a

KP236109.1

Cotype

Aurantimonas manganoxydans SI85-9A1

28.4%

>99%

NHase09

pENH08/pET 28a

AEH78490.1

Cotype

Sinorhizobium meliloti SM11

62.3%

>99%

NHase10

pENH08/pET 24a

EAV46030.1

Cotype

Labrenzia aggregata IAM12614

47.5%

>99%

NHase11

pENH11/pET24a

BAC49763.1

Cotype

Bradyrhizobium japonicum USDA 110

>99%

>99%

NHase12

pENH12/pET28a

ABQ36151.1

Cotype

Bradyrhizobium sp. BATi1

2.8%

>99%

NHase13

pENH13/pET28a

EKT78341.1

Cotype

Rhodococcus opacus M213

52.1%

>99%

1

a

The name of recombinant plasmid and the used expressed plasmid.

2

b

nd: not detected

27

1

Table 4 Analysis of BAM and IAM degradation with recombinant amidase

Enzyme No.

Recombina nt Plasmida

GenBank accession number of amidases

Conversion (%) Gene source

pEAM01/p ET24a

AEX05824.1

pEAM02/p ET24a

BAMa

IAMb

Klebsiella oxytoca KCTC 1686

16.9%

ndc

AY026386.1

Rhodococcus erythropolis

nd

>99%

pEAM03/p ET24a

AAK28498. 1

Agrobacterium tumfaciens D3

>99%

nd

pEAM04/p ET24a

ABQ78861.1

Pseudomonas putida F1

2.4%

1.5%

Amidase -01 Amidase -02 Amidase -03 Amidase -04

2

a

BAM: 2,6-dichlorobenzamide

3

b

IAM: 3,5-diiodo-4- hydroxybenzamide 28

1

c

nd: not detected

29

Figure captions Fig 1. Three dihalogenated benzonitrile herbicides and hydrolysis by nitrile-degrading enzymes. Fig. 2. The experimental strategies to achieve the co-expression of NHase and amidase genes in E. coli. Fig. 3. The expression of NHase and amidase analyzed by SDS-PAGE (A-F) and the growth curves (G, H) of recombinant E. coli containing different plasmids. A: pET28a+pCDFDuet, B: pENh11+pCAm02, C: pENh11+pCAm03, D: pCDFDuet, E: pCNh11-Am02, F: pCNh11-Am03. M: protein markers; W: whole cell proteins; S: soluble part and I: insoluble part of whole cell protein. Fig. 4. The influence of the reaction pH and the reaction temperature on the degradation of dichlobenil and ioxynil by recombinant E. coli containing pCNh11-Am03 (A, C) or pCNh11-Am02 (B, D). DCB: dichlobenil, BAM: 2,6-dichlorobenzamide, DCBA: 2,6dichlorobenzoic acid, DIHB: ioxynil, IAM: 3,5-iodo-4-hydroxybenzamide, DIHBA: 3,5-iodo-4-hydroxybenzoic acid. Fig. 5. The influence of initial substrate concentration on the degradation of dichlobenil and ioxynil by recombinant E. coli. Fig. 6. Changes of various metabolic products during the degradation of dichlobenil (A) and ioxynil (B) by recombinant E. coli. The initial concentrations of dichlobenil and ioxynil were 2.0 mM. (■) parent compounds: dichlobenil and bromoxynil. (●) 2,6-

30

dichlorobenzamide (BAM) and 3,5-iodo-4-hydroxybenzamide (IAM). (▲) 2,6dichlorobenzoic acid (DCBA) and 3,5-iodo-4-hydroxybenzoic acid (DIHBA).

31

32

33

Figr-1

34

Figr-2

35

Figr-3

36

Figr-4

37

Figr-5

38

Figr-6

39