- Email: [email protected]
VWM syndrome
CLB-09071; No. of pages: 7; 4C: Clinical Biochemistry xxx (2015) xxx–xxx
Contents lists available at ScienceDirect
Clinical Biochemistry journal homepage: www.elsevier.com/locate/clinbiochem
Efficient detection of frequent eIF2B mutations for the rapid molecular diagnosis of CACH/VWM syndrome Marie-Céleste Ferreira a,b,⁎,1, Imen Dorboz c, Odile Boespflug-Tanguy c,d a
CHU Clermont-Ferrand, Molecular Biology Laboratory, Biochemistry Department, Clermont-Ferrand, France GReD, UMR INSERM 931, CNRS 6247, Faculty of Medicine, Clermont-Ferrand, France Inserm U1141, Paris Diderot University, Sorbonne Paris Cité, DHU PROTECT, Robert Debré Hospital, Paris, France d Reference Center For Leukodystrophies, Department of Neuropediatrics and Metabolic Diseases, Robert Debré Hospital, AP-HP, Paris, France b c
a r t i c l e
i n f o
Article history: Received 4 March 2015 Received in revised form 5 June 2015 Accepted 2 July 2015 Available online xxxx Keywords: CACH/VWM syndrome eIF2B mutations Multiplex single-nucleotide primer extension
a b s t r a c t Objectives: The aim of this study was to develop a reliable, rapid and cost-effective molecular diagnostic assay allowing widespread routine investigation of eIF2B-related disorders (CACH/VWM syndrome). This heterogeneous disease is caused by autosomal recessive mutations in the genes encoding the five subunits of the translation-initiation factor eIF2B. Such a diagnostic method would be particularly adapted to the apparently acute presentation of the disease. Design and methods: We developed a multiplex PCR amplification method for 7 genomic regions of the eIF2B genes in a single run. This method targeted the 8 most frequent mutations representing 61.4% of all mutations identified to date in our laboratory. These mutations affected eIF2B2 exon 5, eIF2B3 exon 2, eIF2B4 exons 8 and 11 and eIF2B5 exons 5, 7 and 8. PCR products were then pooled and subjected to a primer-extension assay validated using previously genotyped samples. Results: The results were compared to screening and/or direct sequencing methods: 100% agreement between methods confirmed equivalent sensitivity and specificity. The new assay was highly superior in terms of cost, time to results and robustness despite sample heterogeneity. Conclusions: This genotyping strategy allows the detection of all eIF2B mutations targeted. A second multiplex primer-extension assay is in development to detect the 11 next-most frequent mutations, thus raising the global detection rate to 76.8%. Our approach is widely applicable as it involves standard techniques and equipment. Moreover, it can easily be further adapted to the clinical and genetic heterogeneity of eIF2B-related disorders by including or excluding mutations. © 2015 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.
1. Introduction Eukaryotic initiation factor 2B (eIF2B)-related disorders are a group of clinically heterogeneous leukodystrophies with a wide clinical spectrum: from congenital and rapidly lethal forms to slowly progressive or even asymptomatic adult forms, sometimes associated with ovarian failure [1–4]. The childhood-onset form occurring between 2 and 5 years of age represents the classic form, also described as Childhood Ataxia with CNS Hypomyelination (CACH) syndrome. Disease severity is correlated with age of onset, stress triggers and aggravating ⁎ Corresponding author at: Laboratoire de Biologie Moléculaire, CHU de ClermontFerrand, Faculté de Médecine, 4eR3, 28 place Henri Dunant, 63 001 Clermont-Ferrand cedex 1, France. E-mail addresses: [email protected] (M.-C. Ferreira), [email protected] (I. Dorboz), odile.boespfl[email protected] (O. Boespflug-Tanguy). 1 Present address: Laboratoire Gen-Bio, 8 rue Jacqueline Auriol, 63 965 ClermontFerrand cedex 9, France.
factors [5,6]. The initial diagnosis is based on magnetic resonance imaging (MRI). The typical pattern is a diffuse cerebrospinal-fluid-like aspect of the white matter in the cerebral hemispheres, described as vanishing white matter (VWM). This pattern allows the selection of patients eligible for molecular diagnosis [7]. Autosomal recessive mutations are found in genes encoding the five subunits of eIF2B, eIF2B1-5 [8,9]. The eIF2B complex is involved in translation initiation, converting the eIF2 factor from the inactive to the active form through its guanine nucleotide exchange (GEF) activity [10]. Mutations described in the eIF2B1-5 genes usually result in decreased GEF activity, which correlates with the severity of the disease [11]. The molecular analysis of eIF2B1-5 genes is undertaken based on clinical and MRI criteria. From 2000 to 2010, 266 families suspected of being affected by eIF2B-related disorders were analyzed in our lab. Of these, only 70 were found to carry eIF2B mutations, with the large majority being missense or frameshift mutations. Our analytical strategy was to analyze the five genes in the order of frequency of the mutations reported in the literature (eIF2B5 → eIF2B2 → eIF2B4 → eIF2B3 → eIF2B1)
http://dx.doi.org/10.1016/j.clinbiochem.2015.07.004 0009-9120/© 2015 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.
Please cite this article as: M.-C. Ferreira, et al., Efficient detection of frequent eIF2B mutations for the rapid molecular diagnosis of CACH/VWM syndrome, Clin Biochem (2015), http://dx.doi.org/10.1016/j.clinbiochem.2015.07.004
2
M.-C. Ferreira et al. / Clinical Biochemistry xxx (2015) xxx–xxx
[3,5,12,13]. For this, we used denaturing high-performance liquid chromatography (DHPLC) screening, followed by selective sequencing for abnormal eIF2B5, eIF2B2 and eIF2B4 profiles; eIF2B3 and eIF2B1 were analyzed by direct sequencing due to their low frequency of mutation. A diagnosis of eIF2B-related disorders is frequently discussed in the context of acute or subacute neurological deterioration following head trauma or infection [14–16], requiring rapid and efficient molecular confirmation. For this purpose, we evaluated the efficiency of a multiplex primerextension assay targeting the most frequent mutations in eIF2B1-5. In light of its intended implementation in routine diagnostics, many criteria were evaluated: workload, dedicated equipment needs, time to results, time saved throughout the analytical process, costs, flexibility, robustness, sensitivity and specificity. 2. Materials and methods 2.1. Patients and genomic DNA extraction Two series of samples were successively analyzed during our study. All samples were from our cohort of 266 families related to CACH patients, sent to our lab for molecular diagnosis and previously analyzed by other genotyping methods. The first series, selected to optimize the specificity and sensitivity of our new method, consisted of 14 patients (P1 to P14) affected by one of the eIF2B mutations selected for the assay: eight were heterozygous and six were homozygous (Table 1). An additional group of three controls (C1 to C3) not affected by the mutations of interest was identically analyzed for the seven genomic regions. The second series analyzed consisted of 9 patients (P15 to P23) referred by neurologists for eIF2B analysis in accordance with their suggestive clinical and MRI features; these samples were fully or partially analyzed by DHPLC and/or sequencing for all five genes (Table 1). These samples were used to estimate the robustness of our method as a function of the DNA extraction protocol, aging of the sample, nature of blood anticoagulants used and presence of several nucleotide variations other than those targeted by the assay.
For most patients, genomic DNA was isolated from 3 to 10 ml of peripheral blood, with the patient's informed consent, using the Nucleon BACC 3 kit (Amersham Biosciences, Uppsala, Sweden). We also tested DNA samples received from other laboratories extracted using unknown methods, as well as DNA obtained using manual (QiaAmp DNA blood mini kit, Qiagen, Hilden, Germany) or automated (Magtration, Bionobis, Guyancourt, France) methods. Two sources of DNA were tested: small volumes of blood and cell pellets (fibroblasts, lymphoblasts). All extractions performed at our laboratory followed the manufacturer's recommendations and DNA concentrations were quantified by measuring optical density. 2.2. Amplification and design of internal primers The PCR primers used to amplify the seven eIF2B coding regions of interest for the primer-extension assay were the same as those used for exon and exon–intron boundary analysis by DHPLC and/or sequencing (Table 2). As PCR products were pooled before the primer-extension reaction, internal primers were designed with a minimum length difference of 4–6 nucleotides to avoid signal overlaps. First, the probe was designed using Primer3.0 software such as to obtain annealing immediately adjacent to the variation site on either the sense or the anti-sense DNA strand, and to prevent secondary structures and potential primer dimers [17]. Then, the Ensembl database and dbSNP database were used to ensure that the hybridization of primers and probes would not be affected by polymorphisms already reported, irrespective of their frequency. Then internal primer length was adjusted by adding nonhomologous polynucleotides at the 5′ end (Table 3) [18]. After synthesis, all primers were purified by HPLC (Eurogentec, Seraing, Belgium) to remove incomplete synthesis products that would interfere during fluorescence detection. 2.3. PCR amplification of eIF2B1-5 selected exons PCR reactions were performed on a Veriti 96-well Thermal Cycler (Applied Biosystems) in a 50 μl final volume using 50 to 150 ng of genomic DNA, 0.25 mM of each dNTP, 0.8 μM of each primer, 1× PCR buffer,
Table 1 Samples used to optimize and validate the multiplex primer-extension assay for the detection of the eight most frequent eIF2B mutations in our cohort of CACH patients. Sample
Gene
P1 P2 P3 P4 P5 P6 P7 P8 P9 P10 P11 P12 P13 P14 C1 C2 C3 P15 P16 P17 P18 P19 P20 P21 P22 P23
eIF2B5 5 c.338GNA eIF2B5 5 c.338GNA eIF2B5 7 c.943CNT eIF2B5 8 c.1160ANG eIF2B5 8 c.1280CNT eIF2B5 8 c.1280CNT eIF2B4 8 c.728CNT eIF2B4 8 c.728CNT eIF2B4 11 c.1120CNT eIF2B4 11 c.1120CNT eIF2B2 5 c.638ANG eIF2B2 5 c.638ANG eIF2B3 2 c.260CNT eIF2B3 2 c.260CNT – – – – – – – – – eIF2B5 3–7 c.338GNA–c.943CNT eIF2B5 7 c.943CNT–c.1015CNT eIF2B5 3–8 c.338GNA–c.1280CNT eIF2B2 5 c.599GNT–c.638ANG eIF2B3 2 SNP c.243CNT eIF2B mutations other than those screened by our method identified by DHPLC and/or sequencing
Exon
Mutation
Status
Extraction method
Aging of DNA (years)
Anticoagulant or sample type
Heterozygous Homozygous Heterozygous Heterozygous Heterozygous Homozygous Heterozygous Homozygous Heterozygous Homozygous Heterozygous Homozygous Heterozygous Homozygous Wild-type Wild-type Wild-type Compound heterozygous Compound heterozygous Compound heterozygous Compound heterozygous Homozygous
Ref Ref External lab Ref Ref External lab Ref Ref External lab — column External lab — column Ref External lab Ref External lab Ref Ref Ref External lab External lab External lab External lab External lab Column Column Automated Automated
2 2 7 6 7 7 5 5 9–b1 8–2 1 7 3 4 7 2 9 3 3 5 5 8 b1 year
Lithium heparin EDTA NI EDTA EDTA NI EDTA EDTA NI — cell pellet NI — cell pellet EDTA NI EDTA NI EDTA EDTA Lithium heparin NI NI NI NI NI EDTA
Ref: reference method for DNA extraction (Nucleon BACC 3 kit, Amersham Biosciences); column: manual method for DNA extraction (QiaAmp DNA blood mini kit, Qiagen); automated: automated method for DNA extraction (Magtration, Bionobis); NI: not indicated.
Please cite this article as: M.-C. Ferreira, et al., Efficient detection of frequent eIF2B mutations for the rapid molecular diagnosis of CACH/VWM syndrome, Clin Biochem (2015), http://dx.doi.org/10.1016/j.clinbiochem.2015.07.004
M.-C. Ferreira et al. / Clinical Biochemistry xxx (2015) xxx–xxx
3
Table 2 Primers used for PCR amplification of seven genomic regions including the eight mutations selected for eIF2B1-5 multiplex primer-extension assay. Gene
Exon
eIF2B5 eIF2B5 eIF2B5
3 7 8
eIF2B4 eIF2B4 eIF2B2 eIF2B3
8 11 5 2
Mutation
Forward primer 5′-3′
Reverse primer 5′-3′
Fragment size (bp)
c.338GNA c.943CNT c. 1160ANG c.1280CNT c.728CNT c.1120CNT c.638ANG c.260CNT
CGAGAAGGACTGTGAGTGCTGA TTTGTGGCAGTGAGAGGCAGA CTCTATGAAGGGCTCTGCTC
CAGGGCTCTGCTGGTCTTTA ACTGTCCCTTGTGTAGCCATC GCATCCTGATAATGAGAGCAAC
337 521 334
CAGAACATTTTCCTCAGTGAAGC CCACTTGCCTTTGGGAATAA GGAAATTATGTGCTGGATATG AATTGAAATAATGGAACCACTGT
TGAAAAGAGAGATAGAAAAGCAGGA CGCTGCACTCCATCCTTATC ACTTTATTCTCTCACCGTGGAT AATGCACTGGGAAAACATAAGA
253 374 313 289
1.5 mM to 2.25 mM MgCl2, and 1 to 1.5 units of Taq DNA polymerase (Ampli Taq Gold, Applied Biosystems). After optimization, the following PCR conditions were used: 12 min at 95 °C, 37 cycles of 30 s at 95 °C, 30 s at hybridization temperature (53 to 58 °C) and 1 min at 72 °C, followed by 10 min at 72 °C (Table 4). Amplicon quality was evaluated by electrophoresis in a 12% acrylamide gel prior to purification using the QIAquick Purification kit (Qiagen) according to the manufacturer's instructions. 2.4. Multiplex single-base primer extension Purified PCR products were eluted with empirically adjusted volumes and pooled in variable proportions in order to homogenize final fluorescent intensities (Table 4). Multiplex single-base primer extension was performed using the SNaPshot kit (Applied Biosystems) according to the manufacturer's protocol. The final reaction volume was 10 μl, containing 2 μl of pooled purified PCR products, 5 μl of SNaPshot Ready Reaction Premix containing the four fluorescent dideoxynucleotides (ddNTPs), and 0.2 μM of internal primers targeting each mutation site. The SNaPshot reaction was then purified using Centri-Sep plates (Applied Biosystems) to remove excess fluorescent ddNTPs according to the manufacturer's recommendations before detection by capillary electrophoresis. 2.5. Capillary electrophoresis conditions Fluorescence (intensity and wavelength) and size of extended internal primers were determined by capillary electrophoresis on an ABI PRISM 3130xl genetic analyzer (Applied Biosystems) using POP-7 polymer and 36-cm long capillaries. SNaPshot fragments (2 μl) were loaded with 10 μl of deionized formamide and 0.5 μl of GeneScan 120 Liz size standards (Applied Biosystems) after heat denaturation. Data were analyzed using GeneMapper v4.0 software and genotyping results were compared to the corresponding DHPLC screening or direct sequencing results. 2.6. DHPLC and sequencing analysis DHPLC analysis of amplicons was performed on a 3500A WAVE DNA Fragment Analysis System® (Transgenomic, San Jose, USA). eIF2B-related disorders are recessive diseases and around 30–40% of
patients present a homozygous mutation not directly detected by DHPLC; each amplicon was therefore injected both alone (to detect heterozygous mutations) and mixed with a wild-type amplicon (in order to artificially form heteroduplexes for the detection of homozygous mutations). Patient profiles were compared to the wild-type profile and discordant results were subjected to sequencing in order to identify nucleotide variations. Purified PCR products were directly sequenced using BigDye Terminator v1.1 cycle sequencing kit (Applied Biosystems) according to the manufacturer's instructions. The sequencing reaction was performed using the same primers as for PCR. Fragments were detected on an ABI Prism 3130xl Genetic Analyzer (Applied Biosystems) and results analyzed using SeqScape® v6.0 software. 3. Results 3.1. The multiplex assay A multiplex primer-extension assay was designed for the simultaneous screening of the 8 most frequent mutations identified in our cohort of 266 index CACH cases, representing 61.4% of all eIF2B mutations in this cohort (Table 5). The selected strategy was based on a one-run PCR amplification of 7 coding regions spread over 4 of the 5 eIF2B genes, coupled with a SNaPshot reaction to detect potential substitutions. This assay included the 4 most frequent mutations in eIF2B5 (representing 66% of eIF2B5 mutations): c.338GNA, c.943CNT, c.1160A NG and c.1280C NT; the 2 most frequent mutations in eIF2B4 (representing 55% of eIF2B4 mutations): c.728CN T and c.1120CNT; the most frequent mutation in eIF2B2 (representing 50% of eIF2B2 mutations): c.638AN G; and the most frequent mutation in eIF2B3 (representing 40% of eIF2B3 mutations): c.260CNT. 3.2. Optimization and validation First, PCR conditions had to be optimized to allow amplification of the seven genomic regions of interest with a single thermal cycler run. We wanted to use the same primers as for DHPLC and sequencing. The concentrations of Taq polymerase, MgCl2 and DNA, the hybridization temperature and the number of cycles were adjusted (Table 4). As
Table 3 Internal oligonucleotides used for the multiplex primer-extension assay for the detection of the wild-type and mutated alleles of the eight eIF2B1-5 mutations targeted. Fluorescent fragments detected Gene
Exon
Mutation
Internal primer 5′-3′ (tail sequence and specific sequence)
Primer length (bp)
Wild-type allele size (bp) — color
Mutated allele size (bp) — color
eIF2 B5 eIF2 B5 eIF2 B5 eIF2 B5 eIF2 B4 eIF2 B4 eIF2 B2 eIF2 B3
3 7 8 8 8 11 5 2
c.338GNA c.943CNT c. 1160ANG c.1280CNT c.728CNT c.1120CNT c.638ANG c.260CNT
CTTTAGGAAGTCAAAGTGGTGCC CCCTTAATCCTTAGGTAGCTGTCTGTGCTGACGTCATC CACAATTAGCAACTGACTAAACTAGGTGCCACGTCGTGAAAGTCTGACAACCCATCCTGAGCCAGGTG ATGCTCAGACACAATTAGCGCGACCAAGGAACGAGTGACACTGAA CTATAGGTGATTCAGGATTACACAACAC ATGCTCAGACACAATTAGCGCGACCCTTAATCCTTAGGTAGACACCAGCATGGACTAGAGAAC ACTAAACTAGGTGCCACGTCGTGAAAGTCTGAATTTGTCCAAAGCAGGTATTG TGAAAGTCTGACAAGACGCTGACATGGGAACTG
23 38 68 47 28 63 53 33
31 — blue 46 — black 71 — green 51 — black 35 — black 65 — blue 58 — green 40 — black
32 — green 47 — red 69 — blue 52 — red 37 — red 66 — green 57 — blue 41 — red
Please cite this article as: M.-C. Ferreira, et al., Efficient detection of frequent eIF2B mutations for the rapid molecular diagnosis of CACH/VWM syndrome, Clin Biochem (2015), http://dx.doi.org/10.1016/j.clinbiochem.2015.07.004
4
M.-C. Ferreira et al. / Clinical Biochemistry xxx (2015) xxx–xxx
Table 4 Amplification conditions of the seven eIF2B regions of interest, elution volumes of purified PCR products and proportion of each amplicon subjected to multiplex primer-extension reaction. Gene
Exon
MgCl2 (mM)
Taq polymerase (units)
Genomic DNA (ng)
Hybridization temp. (°C)
Elution vol. (μl)
Amplicon mix (μl)
eIF2B5 eIF2B5 eIF2B5 eIF2B4 eIF2B4 eIF2B2 eIF2B3
3 7 8 8 11 5 2
2.25 2.25 2.5 2.25 1.5 1.5 2.25
1 1.5 1 1.5 1.5 1.5 1
100 150 100 150 150 150 100
58 58 55 58 58 53 55
30 30 30 40 20 30 20
2 5 2.5 6 2 1.5 7
genomic DNA quality can be highly variable, particularly in long-term family genetic studies, and could compromise the reliability of the results, the specificity and intensity of amplification were checked by acrylamide gel electrophoresis. Some DNA samples were around 10 years old and needed to be purified by ethanol precipitation to be suitable for amplification for the subsequent steps. The resulting amplicons were purified and elution volume adjusted to compensate for differences in PCR yields (Table 4). Then the seven purified PCR products were pooled and the SNaPshot reaction performed. The first test was performed on known wild-type controls, and heterozygous and homozygous mutated samples (Table 2, P1 to C3). Singleplex reactions were first performed to check the efficiency of internal primer extension. At this step, two primers had to be redesigned, one because of a signal overlap (the tail sequence was adapted) and the other due to the absence of signal (the primer on the anti-sense DNA strand was redesigned). Then, all internal primers were pooled and the multiplex SNaPshot reaction performed. In order to homogenize signal intensities, the concentration of each primer was first modified, but this compensation was not sufficient. The alternative was to adjust the proportion of amplicons in the mixture before the SNaPshot reaction (Table 4). Then, the adjustment of the reaction volume loaded onto the genetic analyzer and electrophoresis parameters (injection time and voltage) allowed us to obtain intensities between 500 and 4000 relative fluorescence units (rfu) for all mutated and wild-type samples (Fig. 1). As the mobility of the fragments depends on the fluorescent dyelabeled ddNTPs added and cannot be estimated in advance, an allelic
ladder was produced. A polymorphic amplicon derived from a heterozygous patient was generated for each mutation; then all 7 resulting reactions were pooled after purification in the same proportions as determined previously (Table 4). Alleles were identified according to the fluorescent nucleotide added to the 3′ end of the probes, and fragment length deduced by comparison with co-migrating size standards. This allelic ladder showed no signal overlaps between adjacent fragments even when all 16 alleles were present. Moreover, the correct fluorescent labeling of all expected allelic fragments was confirmed. This new artificial sample represented a positive control for the next series of diagnostic tests (Fig. 1B). To evaluate the specificity and sensitivity of the method, 3 wild-type controls and 14 heterozygous and homozygous mutated samples were tested (Table 2, P1 to C3). SNaPshot results were fully consistent with DHPLC and sequence screening (Fig. 1A and B). The robustness of this method was then evaluated using a second series of samples whose origins, anti-coagulants for blood samples, DNA extraction methods and age of extracts were different (Table 2, P1 to P23). No discrepancy in results was observed between reference and SNaPshot methods. Similarly, four samples containing compound heterozygous mutations (Table 2, P15 to P18) were correctly genotyped (Fig. 1C and D). Finally a homozygous polymorphic sample (Table 2, P19) presenting the rare substitution c.243C NT in eIF2B3 was tested. This polymorphism could potentially have prevented probe hybridization as it affects the third 5′ nucleotide and could not be avoided when the probes were designed (Fig. 1E). No negative impact on sensitivity and specificity was observed.
Table 5 Recurrent mutations identified in index cases affected by eIF2B-related disorders in our cohort of 266 families.
4. Discussion
Gene
Exon Mutation
Heterozygous Homozygous % of gene % of total cases cases mutations eIF2B mutations
First multiplex primer-extension reaction eIF2B5 3 c.338GNA 13 eIF2B4 8 c.728CNT – eIF2B5 8 c.1280CNT 3 eIF2B2 5 c.638ANG 3 eIF2B3 2 c.260CNT 2 eIF2B5 7 c.943CNT 3 eIF2B5 8 c.1160ANG 3 eIF2B4 11 c.1120CNT 1
21 4 1 1 1 – – 1
Second multiplex primer-extension reaction planned eIF2B5 8 c.584GNA 2 – eIF2B5 5 c.877CNG – 1 eIF2B5 2 c.896GNA 2 – eIF2B5 7 c.911ANC – 1 eIF2B5 8 c.925GNC – 1 eIF2B5 11 c.944GNA 2 – eIF2B5 3 c.1015CNT 2 – eIF2B4 8 c.626GNA – 1 eIF2B4 8 c.1069CNT – 1 eIF2B4 5 c.1465TNC 2 – eIF2B3 2 c.1023TNG – 1
55 40 5 50 40 3 3 15
39.3 5.7 3.6 3.6 2.9 2.1 2.1 2.1 Total: 61.4%
40 50 40 3 3 15 55 40 5 50 40
1.4 1.4 1.4 1.4 1.4 1.4 1.4 1.4 1.4 1.4 1.4 Total: 76.8%
4.1. Aims of the new assay Next-generation sequencing tools are completely changing the way molecular diagnostic laboratories are organized, and will soon allow for the simultaneous testing of several genes, a development of particular interest for heterogeneous genetic disorders. However, until these methods are put into place in the majority of laboratories, current analytical methods for disorders such as those related to eIF2B, which involve screening 57 genomic regions spread over 5 genes, are costly and time-consuming. To date, the only hotspot mutation identified in the eIF2B genes is the c.338GN A substitution in eIF2B5 exon 3, accounting for around 25% of all mutations in the literature as a whole [4,13], and 39% in our cohort. However, the large majority of eIF2B mutations occur at low frequencies, making classic molecular methods such as direct sequencing or screening by DHPLC or High-Resolution Melt analysis less efficient. Other recently developed screening tools, such as assays for asialotransferrin deficiency in the cerebrospinal fluid [19,20] or decreased GEF activity in transformed patient lymphocytes [11,21], make it possible to select patients eligible for molecular diagnosis. In this report, we have proposed a multiplex primer-extension test to detect the eight most frequent eIF2B mutations, representing around 61.4% of all mutations, as the first step in this process. Our aim was to implement an efficient and cost-effective test in order to quickly determine a streamlined course of action.
Please cite this article as: M.-C. Ferreira, et al., Efficient detection of frequent eIF2B mutations for the rapid molecular diagnosis of CACH/VWM syndrome, Clin Biochem (2015), http://dx.doi.org/10.1016/j.clinbiochem.2015.07.004
M.-C. Ferreira et al. / Clinical Biochemistry xxx (2015) xxx–xxx
5
Fig. 1. GeneMapper electropherograms of eIF2B multiplex primer-extension reaction products.
4.2. Methodological strategy A significant proportion of eIF2B mutations occur in the homozygous state. One could thus expect that a SNaPshot assay would be able to immediately genotype some patients. In our cohort, 29 patients (41.4% of mutated patients) were homozygous for one of the eight mutations targeted. The assay could also be expected to detect compound heterozygous patients affected by 2 of the 8 mutations of interest, a condition fulfilled by 5 patients (7.1%) of our cohort. Moreover, the two mutational
events always occur in the same eIF2B gene; a compound heterozygous patient with mutations in two different genes has never been reported. With a combined rate of detection of around 61.4%, the SNaPshot assay would thus be able to highlight the gene to be directly screened as soon as the first mutation is detected, rendering it unnecessary to screen all five genes in their order of frequency until all mutations are identified. The last strategic step is to propose an alternative level of molecular investigation for borderline patients presenting moderately suggestive signs of the disease [14–16]. Taking into account its cost and the time
Please cite this article as: M.-C. Ferreira, et al., Efficient detection of frequent eIF2B mutations for the rapid molecular diagnosis of CACH/VWM syndrome, Clin Biochem (2015), http://dx.doi.org/10.1016/j.clinbiochem.2015.07.004
6
M.-C. Ferreira et al. / Clinical Biochemistry xxx (2015) xxx–xxx
required, this assay could be more easily prescribed when multiple clinical hypotheses are being considered. After a negative result, clinicians could choose to pursue the molecular analysis by classic methods or abandon the hypothesis of an eIF2B-related disorder. 4.3. The development of a specific allelic ladder Our assay is based on the well-known single-base primer-extension technique, already used for molecular diagnostics in the clinical context [22–25]. The protocol is based on a commercially available kit that provides a ready-to-use reaction mix, a multiplex control template and the corresponding primers. The purpose of these reagents is to provide a positive control to validate the technical process. However, control primers and templates could react in a very different way from ours under standard conditions; we thus developed a home-made control to be used as a specific allelic ladder. This allelic ladder includes all extension fragments corresponding to wild-type and mutated alleles (Fig. 1B), and was included in each analytical series in order to validate the reliability of the SNaPshot reaction, electrophoretic detection and genotype interpretation. 4.4. Validation and reliability of the method The first mutations to be included in the assay were selected based on statistics from the 266 families investigated for eIF2B-related disorders in our laboratory. The eight most common missense mutations were selected, representing 61.4% of all mutations identified to date in probands, and spread widely over 4 of the 5 eIF2B genes (Table 1). Of these, only one is a hotspot mutation: c.338GNA on eIF2B5 (39.3%); the others occur at lower frequencies. The critical steps in developing a SNaPshot assay are sequence analysis and primer/probe design. Internal primers were designed to include substitution sites and amplification conditions were adjusted to conserve the PCR primers used by conventional methods, in order to produce amplicons that could be explored by different methods, since these are all highly sensitive and allow the use of small amounts of material. By also adjusting primer extension and electrophoretic conditions, all 8 mutations could be genotyped by a single-run PCR and a single multiplex SNaPshot reaction. In this method, the heterozygous or homozygous status of patients could be determined by the number of fluorescent bands on the electropherogram, while wild-type or mutated status could be deduced from the color of the bands. This approach eliminates a part of the problem of false negative reactions: whatever the patient's status, one or two different nucleotide types must be incorporated, generating one or two different signals. However a false negative result due to a sequence mismatch cannot be excluded if it affects the mutated allele. In this case, the second mutation can be detected by the SNaPshot assay if it is included among the screened mutations. Otherwise the sample needs to be further investigated by reference methods, according to clinical and MRI finding and the expert clinician's prescription. All these results confirm that our method is reliable and can be used widely and routinely in a diagnostic context. 4.5. The clinical use of the method This multiplex SNaPshot assay is now currently used in our department for molecular diagnostic ends in eIF2B-related disorders. It represents a time-saving and cost-effective tool: results can be obtained within 2–3 days after the collection of blood samples and the primerextension reaction to detect the 8 mutations costs the equivalent of 2 sequencing reaction in our laboratory, as this assay does not require any specific equipment, reagents or technical processes other than those already in use (DNA extraction, PCR, fragment purification, capillary electrophoresis, bioinformatics and interpretation). Moreover, the high sensitivity of the method allows us to use excess PCR products for sequence analysis or screening, saving time when
complementary methods have to be used to search for a second mutation. At present, this multiplex SNaPshot assay allows the rapid detection of 61.4% of all identified eIF2B mutations. We propose, as the next step, the completion of the molecular diagnostic process for eIF2B-related disorders by a second assay including the 11 next most frequent mutations (Table 1). This second test would raise the global detection rate from 61.4% to 76.8%. The remaining mutations are very rare variations that cannot justify the development of a new multiplex assay. The coverage rate of mutations would thus increase from 66% to 80% for eIF2B5, from 55% to 85% for eIF2B4 and from 40% to 80% for eIF2B3; the coverage rate for eIF2B2 and eIF2B1 would remain unchanged (50% for eIF2B2 and no mutation identified in eIF2B1 to date). As new mutations are regularly reported, the final advantage of this SNaPshot strategy would be the constant adaptability of the assays according to the clinical and genetic heterogeneity of eIF2B-related disorders. In conclusion, we propose an efficient, flexible, and cost-effective multiplex SNaPshot assay to detect the eight most frequent eIF2B mutations in our cohort of 266 probands affected by eIF2B-related disorders. This method represents an interesting initial step of a streamlined global molecular diagnostic process, particularly in the context of acute neurological impairment or prenatal care. Acknowledgments The patients and their families are warmly acknowledged for their participation. This work was supported by grants from the European Leukodystrophy Association (ELA) Grant number FP7#241622. We thank Sowmyalakshmi Rasika (DHU PROTECT) for corrections of the manuscript and Eleonore Eymard-Pierre (Cytogenetic Department, CHU Clermont-Ferrand) for providing patient's samples from the LEUKOFRANCE Biobank. References [1] R. Schiffmann, J.R. Moller, B.D. Trapp, H.H. Shih, R.G. Farrer, D.A. Katz, et al., Childhood ataxia with diffuse central nervous system hypomyelination, Ann. Neurol. 35 (1994) 331–340. [2] A. Fogli, D. Rodriguez, E. Eymard-Pierre, F. Bouhour, P. Labauge, B.F. Meaney, et al., Ovarian failure related to eukaryotic initiation factor 2b mutations, Am. J. Hum. Genet. 72 (2003) 1544–1550. [3] A. Fogli, O. Boespflug-Tanguy, The large spectrum of eIF2B-related diseases, Biochem. Soc. Trans. 34 (2006) 22–29. [4] J. Maletkovic, R. Schiffmann, J.R. Gorospe, E.S. Gordon, M. Mintz, E.P. Hoffman, et al., Genetic and clinical heterogeneity in eIF2B-related disorder, J. Child Neurol. 23 (2008) 205–215. [5] A. Fogli, R. Schiffmann, E. Bertini, S. Ughetto, P. Combes, E. Eymard-Pierre, et al., The effect of genotype on the natural history of eIF2B-related leukodystrophies, Neurology 62 (2004) 1509–1517. [6] P. Labauge, L. Horzinski, X. Ayrignac, P. Blanc, S. Vukusic, D. Rodriguez, et al., Natural history of adult-onset eIF2B-related disorders: a multi-centric survey of 16 cases, Brain 132 (2009) 2161–2169. [7] R. Schiffmann, M.S. van der Knaap, Invited article: an MRI-based approach to the diagnosis of white matter disorders, Neurology 72 (2009) 750–759. [8] P.A. Leegwater, G. Vermeulen, A.A. Konst, S. Naidu, J. Mulders, A. Visser, et al., Subunits of the translation initiation factor eIF2B are mutant in leukoencephalopathy with vanishing white matter, Nat. Genet. 29 (2001) 383–388. [9] M.S. van der Knaap, P.A. Leegwater, A.A. Konst, A. Visser, S. Naidu, C.B. Oudejans, et al., Mutations in each of the five subunits of translation initiation factor eIF2B can cause leukoencephalopathy with vanishing white matter, Ann. Neurol. 51 (2002) 264–270. [10] E. Gomez, G.D. Pavitt, Identification of domains and residues within the epsilon subunit of eukaryotic translation initiation factor 2b (eIF2Bepsilon) required for guanine nucleotide exchange reveals a novel activation function promoted by eIF2B complex formation, Mol. Cell. Biol. 20 (2000) 3965–3976. [11] A. Fogli, R. Schiffmann, L. Hugendubler, P. Combes, E. Bertini, D. Rodriguez, et al., Decreased guanine nucleotide exchange factor activity in eIF2B-mutated patients, Eur. J. Hum. Genet. 12 (2004) 561–566. [12] J.C. Pronk, B. van Kollenburg, G.C. Scheper, M.S. van der Knaap, Vanishing white matter disease: a review with focus on its genetics, Ment. Retard. Dev. Disabil. Res. Rev. 12 (2006) 123–128. [13] O. Scali, C. Di Perri, A. Federico, The spectrum of mutations for the diagnosis of vanishing white matter disease, Neurol. Sci. 27 (2006) 271–277. [14] M.S. van der Knaap, P.G. Barth, F.J. Gabreels, E. Franzoni, J.H. Begeer, H. Stroink, et al., A new leukoencephalopathy with vanishing white matter, Neurology 48 (1997) 845–855.
Please cite this article as: M.-C. Ferreira, et al., Efficient detection of frequent eIF2B mutations for the rapid molecular diagnosis of CACH/VWM syndrome, Clin Biochem (2015), http://dx.doi.org/10.1016/j.clinbiochem.2015.07.004
M.-C. Ferreira et al. / Clinical Biochemistry xxx (2015) xxx–xxx [15] M.S. van der Knaap, P.A. Leegwater, C.G. van Berkel, C. Brenner, E. Storey, M. Di Rocco, et al., Arg113His mutation in eIF2Bepsilon as cause of leukoencephalopathy in adults, Neurology 62 (2004) 1598–1600. [16] M. Mascalchi, D. De Grandis, A. Ginestroni, A. Pratesi, R. Della Nave, G.C. Scheper, et al., Early MR imaging and spectroscopy appearance of eIF2B-related leukoencephalopathy, Neurology 67 (2006) 537–538. [17] S. Rozen, H. Skaletsky, Primer3 on the www for general users and for biologist programmers, Methods Mol. Biol. 132 (2000) 365–386. [18] K. Lindblad-Toh, E. Winchester, M.J. Daly, D.G. Wang, J.N. Hirschhorn, J.P. Laviolette, et al., Large-scale discovery and genotyping of single-nucleotide polymorphisms in the mouse, Nat. Genet. 24 (2000) 381–386. [19] A. Vanderver, R. Schiffmann, M. Timmons, K.A. Kellersberger, D. Fabris, E.P. Hoffman, et al., Decreased asialotransferrin in cerebrospinal fluid of patients with childhoodonset ataxia and central nervous system hypomyelination/vanishing white matter disease, Clin. Chem. 51 (2005) 2031–2042. [20] A. Vanderver, Y. Hathout, J. Maletkovic, E.S. Gordon, M. Mintz, M. Timmons, et al., Sensitivity and specificity of decreased CSF asialotransferrin for eIF2B-related disorder, Neurology 70 (2008) 2226–2232. [21] L. Horzinski, A. Huyghe, M.C. Cardoso, C. Gonthier, L. Ouchchane, R. Schiffmann, et al., Eukaryotic initiation factor 2b (eIF2B) GEF activity as a diagnostic tool for eIF2B-related disorders, PLoS One 4 (2009) e8318.
7
[22] S. Filippini, A. Blanco, A. Fernandez-Marmiesse, V. Alvarez-Iglesias, C. Ruiz-Ponte, A. Carracedo, et al., Multiplex snapshot for detection of BRCA1/2 common mutations in Spanish and Spanish related breast/ovarian cancer families, BMC Med. Genet. 8 (2007) 40. [23] J. Di Cristofaro, M. Silvy, J. Chiaroni, P. Bailly, Single PCR multiplex snapshot reaction for detection of eleven blood group nucleotide polymorphisms: optimization, validation, and one year of routine clinical use, J. Mol. Diagn. 12 (2010) 453–460. [24] K. Balschun, A.K. Wenke, C. Rocken, J. Haag, Detection of KRAS and BRAF mutations in advanced colorectal cancer by allele-specific single-base primer extension, Expert. Rev. Mol. Diagn. 11 (2011) 799–802. [25] S. Magnin, E. Viel, A. Baraquin, S. Valmary-Degano, B. Kantelip, J.L. Pretet, et al., A multiplex snapshot assay as a rapid method for detecting KRAS and BRAF mutations in advanced colorectal cancers, J. Mol. Diagn. 13 (2011) 485–492.
Web References (last access: May 29th 2015) Primer 3.0 program: http://frodo.wi.mit.edu/ Ensembl database: http://www.ensembl.org dbSNP database: http://www.ncbi.nlm.nih.gov/projects/SNP/
Please cite this article as: M.-C. Ferreira, et al., Efficient detection of frequent eIF2B mutations for the rapid molecular diagnosis of CACH/VWM syndrome, Clin Biochem (2015), http://dx.doi.org/10.1016/j.clinbiochem.2015.07.004
Contents lists available at ScienceDirect
Clinical Biochemistry journal homepage: www.elsevier.com/locate/clinbiochem
Efficient detection of frequent eIF2B mutations for the rapid molecular diagnosis of CACH/VWM syndrome Marie-Céleste Ferreira a,b,⁎,1, Imen Dorboz c, Odile Boespflug-Tanguy c,d a
CHU Clermont-Ferrand, Molecular Biology Laboratory, Biochemistry Department, Clermont-Ferrand, France GReD, UMR INSERM 931, CNRS 6247, Faculty of Medicine, Clermont-Ferrand, France Inserm U1141, Paris Diderot University, Sorbonne Paris Cité, DHU PROTECT, Robert Debré Hospital, Paris, France d Reference Center For Leukodystrophies, Department of Neuropediatrics and Metabolic Diseases, Robert Debré Hospital, AP-HP, Paris, France b c
a r t i c l e
i n f o
Article history: Received 4 March 2015 Received in revised form 5 June 2015 Accepted 2 July 2015 Available online xxxx Keywords: CACH/VWM syndrome eIF2B mutations Multiplex single-nucleotide primer extension
a b s t r a c t Objectives: The aim of this study was to develop a reliable, rapid and cost-effective molecular diagnostic assay allowing widespread routine investigation of eIF2B-related disorders (CACH/VWM syndrome). This heterogeneous disease is caused by autosomal recessive mutations in the genes encoding the five subunits of the translation-initiation factor eIF2B. Such a diagnostic method would be particularly adapted to the apparently acute presentation of the disease. Design and methods: We developed a multiplex PCR amplification method for 7 genomic regions of the eIF2B genes in a single run. This method targeted the 8 most frequent mutations representing 61.4% of all mutations identified to date in our laboratory. These mutations affected eIF2B2 exon 5, eIF2B3 exon 2, eIF2B4 exons 8 and 11 and eIF2B5 exons 5, 7 and 8. PCR products were then pooled and subjected to a primer-extension assay validated using previously genotyped samples. Results: The results were compared to screening and/or direct sequencing methods: 100% agreement between methods confirmed equivalent sensitivity and specificity. The new assay was highly superior in terms of cost, time to results and robustness despite sample heterogeneity. Conclusions: This genotyping strategy allows the detection of all eIF2B mutations targeted. A second multiplex primer-extension assay is in development to detect the 11 next-most frequent mutations, thus raising the global detection rate to 76.8%. Our approach is widely applicable as it involves standard techniques and equipment. Moreover, it can easily be further adapted to the clinical and genetic heterogeneity of eIF2B-related disorders by including or excluding mutations. © 2015 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.
1. Introduction Eukaryotic initiation factor 2B (eIF2B)-related disorders are a group of clinically heterogeneous leukodystrophies with a wide clinical spectrum: from congenital and rapidly lethal forms to slowly progressive or even asymptomatic adult forms, sometimes associated with ovarian failure [1–4]. The childhood-onset form occurring between 2 and 5 years of age represents the classic form, also described as Childhood Ataxia with CNS Hypomyelination (CACH) syndrome. Disease severity is correlated with age of onset, stress triggers and aggravating ⁎ Corresponding author at: Laboratoire de Biologie Moléculaire, CHU de ClermontFerrand, Faculté de Médecine, 4eR3, 28 place Henri Dunant, 63 001 Clermont-Ferrand cedex 1, France. E-mail addresses: [email protected] (M.-C. Ferreira), [email protected] (I. Dorboz), odile.boespfl[email protected] (O. Boespflug-Tanguy). 1 Present address: Laboratoire Gen-Bio, 8 rue Jacqueline Auriol, 63 965 ClermontFerrand cedex 9, France.
factors [5,6]. The initial diagnosis is based on magnetic resonance imaging (MRI). The typical pattern is a diffuse cerebrospinal-fluid-like aspect of the white matter in the cerebral hemispheres, described as vanishing white matter (VWM). This pattern allows the selection of patients eligible for molecular diagnosis [7]. Autosomal recessive mutations are found in genes encoding the five subunits of eIF2B, eIF2B1-5 [8,9]. The eIF2B complex is involved in translation initiation, converting the eIF2 factor from the inactive to the active form through its guanine nucleotide exchange (GEF) activity [10]. Mutations described in the eIF2B1-5 genes usually result in decreased GEF activity, which correlates with the severity of the disease [11]. The molecular analysis of eIF2B1-5 genes is undertaken based on clinical and MRI criteria. From 2000 to 2010, 266 families suspected of being affected by eIF2B-related disorders were analyzed in our lab. Of these, only 70 were found to carry eIF2B mutations, with the large majority being missense or frameshift mutations. Our analytical strategy was to analyze the five genes in the order of frequency of the mutations reported in the literature (eIF2B5 → eIF2B2 → eIF2B4 → eIF2B3 → eIF2B1)
http://dx.doi.org/10.1016/j.clinbiochem.2015.07.004 0009-9120/© 2015 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.
Please cite this article as: M.-C. Ferreira, et al., Efficient detection of frequent eIF2B mutations for the rapid molecular diagnosis of CACH/VWM syndrome, Clin Biochem (2015), http://dx.doi.org/10.1016/j.clinbiochem.2015.07.004
2
M.-C. Ferreira et al. / Clinical Biochemistry xxx (2015) xxx–xxx
[3,5,12,13]. For this, we used denaturing high-performance liquid chromatography (DHPLC) screening, followed by selective sequencing for abnormal eIF2B5, eIF2B2 and eIF2B4 profiles; eIF2B3 and eIF2B1 were analyzed by direct sequencing due to their low frequency of mutation. A diagnosis of eIF2B-related disorders is frequently discussed in the context of acute or subacute neurological deterioration following head trauma or infection [14–16], requiring rapid and efficient molecular confirmation. For this purpose, we evaluated the efficiency of a multiplex primerextension assay targeting the most frequent mutations in eIF2B1-5. In light of its intended implementation in routine diagnostics, many criteria were evaluated: workload, dedicated equipment needs, time to results, time saved throughout the analytical process, costs, flexibility, robustness, sensitivity and specificity. 2. Materials and methods 2.1. Patients and genomic DNA extraction Two series of samples were successively analyzed during our study. All samples were from our cohort of 266 families related to CACH patients, sent to our lab for molecular diagnosis and previously analyzed by other genotyping methods. The first series, selected to optimize the specificity and sensitivity of our new method, consisted of 14 patients (P1 to P14) affected by one of the eIF2B mutations selected for the assay: eight were heterozygous and six were homozygous (Table 1). An additional group of three controls (C1 to C3) not affected by the mutations of interest was identically analyzed for the seven genomic regions. The second series analyzed consisted of 9 patients (P15 to P23) referred by neurologists for eIF2B analysis in accordance with their suggestive clinical and MRI features; these samples were fully or partially analyzed by DHPLC and/or sequencing for all five genes (Table 1). These samples were used to estimate the robustness of our method as a function of the DNA extraction protocol, aging of the sample, nature of blood anticoagulants used and presence of several nucleotide variations other than those targeted by the assay.
For most patients, genomic DNA was isolated from 3 to 10 ml of peripheral blood, with the patient's informed consent, using the Nucleon BACC 3 kit (Amersham Biosciences, Uppsala, Sweden). We also tested DNA samples received from other laboratories extracted using unknown methods, as well as DNA obtained using manual (QiaAmp DNA blood mini kit, Qiagen, Hilden, Germany) or automated (Magtration, Bionobis, Guyancourt, France) methods. Two sources of DNA were tested: small volumes of blood and cell pellets (fibroblasts, lymphoblasts). All extractions performed at our laboratory followed the manufacturer's recommendations and DNA concentrations were quantified by measuring optical density. 2.2. Amplification and design of internal primers The PCR primers used to amplify the seven eIF2B coding regions of interest for the primer-extension assay were the same as those used for exon and exon–intron boundary analysis by DHPLC and/or sequencing (Table 2). As PCR products were pooled before the primer-extension reaction, internal primers were designed with a minimum length difference of 4–6 nucleotides to avoid signal overlaps. First, the probe was designed using Primer3.0 software such as to obtain annealing immediately adjacent to the variation site on either the sense or the anti-sense DNA strand, and to prevent secondary structures and potential primer dimers [17]. Then, the Ensembl database and dbSNP database were used to ensure that the hybridization of primers and probes would not be affected by polymorphisms already reported, irrespective of their frequency. Then internal primer length was adjusted by adding nonhomologous polynucleotides at the 5′ end (Table 3) [18]. After synthesis, all primers were purified by HPLC (Eurogentec, Seraing, Belgium) to remove incomplete synthesis products that would interfere during fluorescence detection. 2.3. PCR amplification of eIF2B1-5 selected exons PCR reactions were performed on a Veriti 96-well Thermal Cycler (Applied Biosystems) in a 50 μl final volume using 50 to 150 ng of genomic DNA, 0.25 mM of each dNTP, 0.8 μM of each primer, 1× PCR buffer,
Table 1 Samples used to optimize and validate the multiplex primer-extension assay for the detection of the eight most frequent eIF2B mutations in our cohort of CACH patients. Sample
Gene
P1 P2 P3 P4 P5 P6 P7 P8 P9 P10 P11 P12 P13 P14 C1 C2 C3 P15 P16 P17 P18 P19 P20 P21 P22 P23
eIF2B5 5 c.338GNA eIF2B5 5 c.338GNA eIF2B5 7 c.943CNT eIF2B5 8 c.1160ANG eIF2B5 8 c.1280CNT eIF2B5 8 c.1280CNT eIF2B4 8 c.728CNT eIF2B4 8 c.728CNT eIF2B4 11 c.1120CNT eIF2B4 11 c.1120CNT eIF2B2 5 c.638ANG eIF2B2 5 c.638ANG eIF2B3 2 c.260CNT eIF2B3 2 c.260CNT – – – – – – – – – eIF2B5 3–7 c.338GNA–c.943CNT eIF2B5 7 c.943CNT–c.1015CNT eIF2B5 3–8 c.338GNA–c.1280CNT eIF2B2 5 c.599GNT–c.638ANG eIF2B3 2 SNP c.243CNT eIF2B mutations other than those screened by our method identified by DHPLC and/or sequencing
Exon
Mutation
Status
Extraction method
Aging of DNA (years)
Anticoagulant or sample type
Heterozygous Homozygous Heterozygous Heterozygous Heterozygous Homozygous Heterozygous Homozygous Heterozygous Homozygous Heterozygous Homozygous Heterozygous Homozygous Wild-type Wild-type Wild-type Compound heterozygous Compound heterozygous Compound heterozygous Compound heterozygous Homozygous
Ref Ref External lab Ref Ref External lab Ref Ref External lab — column External lab — column Ref External lab Ref External lab Ref Ref Ref External lab External lab External lab External lab External lab Column Column Automated Automated
2 2 7 6 7 7 5 5 9–b1 8–2 1 7 3 4 7 2 9 3 3 5 5 8 b1 year
Lithium heparin EDTA NI EDTA EDTA NI EDTA EDTA NI — cell pellet NI — cell pellet EDTA NI EDTA NI EDTA EDTA Lithium heparin NI NI NI NI NI EDTA
Ref: reference method for DNA extraction (Nucleon BACC 3 kit, Amersham Biosciences); column: manual method for DNA extraction (QiaAmp DNA blood mini kit, Qiagen); automated: automated method for DNA extraction (Magtration, Bionobis); NI: not indicated.
Please cite this article as: M.-C. Ferreira, et al., Efficient detection of frequent eIF2B mutations for the rapid molecular diagnosis of CACH/VWM syndrome, Clin Biochem (2015), http://dx.doi.org/10.1016/j.clinbiochem.2015.07.004
M.-C. Ferreira et al. / Clinical Biochemistry xxx (2015) xxx–xxx
3
Table 2 Primers used for PCR amplification of seven genomic regions including the eight mutations selected for eIF2B1-5 multiplex primer-extension assay. Gene
Exon
eIF2B5 eIF2B5 eIF2B5
3 7 8
eIF2B4 eIF2B4 eIF2B2 eIF2B3
8 11 5 2
Mutation
Forward primer 5′-3′
Reverse primer 5′-3′
Fragment size (bp)
c.338GNA c.943CNT c. 1160ANG c.1280CNT c.728CNT c.1120CNT c.638ANG c.260CNT
CGAGAAGGACTGTGAGTGCTGA TTTGTGGCAGTGAGAGGCAGA CTCTATGAAGGGCTCTGCTC
CAGGGCTCTGCTGGTCTTTA ACTGTCCCTTGTGTAGCCATC GCATCCTGATAATGAGAGCAAC
337 521 334
CAGAACATTTTCCTCAGTGAAGC CCACTTGCCTTTGGGAATAA GGAAATTATGTGCTGGATATG AATTGAAATAATGGAACCACTGT
TGAAAAGAGAGATAGAAAAGCAGGA CGCTGCACTCCATCCTTATC ACTTTATTCTCTCACCGTGGAT AATGCACTGGGAAAACATAAGA
253 374 313 289
1.5 mM to 2.25 mM MgCl2, and 1 to 1.5 units of Taq DNA polymerase (Ampli Taq Gold, Applied Biosystems). After optimization, the following PCR conditions were used: 12 min at 95 °C, 37 cycles of 30 s at 95 °C, 30 s at hybridization temperature (53 to 58 °C) and 1 min at 72 °C, followed by 10 min at 72 °C (Table 4). Amplicon quality was evaluated by electrophoresis in a 12% acrylamide gel prior to purification using the QIAquick Purification kit (Qiagen) according to the manufacturer's instructions. 2.4. Multiplex single-base primer extension Purified PCR products were eluted with empirically adjusted volumes and pooled in variable proportions in order to homogenize final fluorescent intensities (Table 4). Multiplex single-base primer extension was performed using the SNaPshot kit (Applied Biosystems) according to the manufacturer's protocol. The final reaction volume was 10 μl, containing 2 μl of pooled purified PCR products, 5 μl of SNaPshot Ready Reaction Premix containing the four fluorescent dideoxynucleotides (ddNTPs), and 0.2 μM of internal primers targeting each mutation site. The SNaPshot reaction was then purified using Centri-Sep plates (Applied Biosystems) to remove excess fluorescent ddNTPs according to the manufacturer's recommendations before detection by capillary electrophoresis. 2.5. Capillary electrophoresis conditions Fluorescence (intensity and wavelength) and size of extended internal primers were determined by capillary electrophoresis on an ABI PRISM 3130xl genetic analyzer (Applied Biosystems) using POP-7 polymer and 36-cm long capillaries. SNaPshot fragments (2 μl) were loaded with 10 μl of deionized formamide and 0.5 μl of GeneScan 120 Liz size standards (Applied Biosystems) after heat denaturation. Data were analyzed using GeneMapper v4.0 software and genotyping results were compared to the corresponding DHPLC screening or direct sequencing results. 2.6. DHPLC and sequencing analysis DHPLC analysis of amplicons was performed on a 3500A WAVE DNA Fragment Analysis System® (Transgenomic, San Jose, USA). eIF2B-related disorders are recessive diseases and around 30–40% of
patients present a homozygous mutation not directly detected by DHPLC; each amplicon was therefore injected both alone (to detect heterozygous mutations) and mixed with a wild-type amplicon (in order to artificially form heteroduplexes for the detection of homozygous mutations). Patient profiles were compared to the wild-type profile and discordant results were subjected to sequencing in order to identify nucleotide variations. Purified PCR products were directly sequenced using BigDye Terminator v1.1 cycle sequencing kit (Applied Biosystems) according to the manufacturer's instructions. The sequencing reaction was performed using the same primers as for PCR. Fragments were detected on an ABI Prism 3130xl Genetic Analyzer (Applied Biosystems) and results analyzed using SeqScape® v6.0 software. 3. Results 3.1. The multiplex assay A multiplex primer-extension assay was designed for the simultaneous screening of the 8 most frequent mutations identified in our cohort of 266 index CACH cases, representing 61.4% of all eIF2B mutations in this cohort (Table 5). The selected strategy was based on a one-run PCR amplification of 7 coding regions spread over 4 of the 5 eIF2B genes, coupled with a SNaPshot reaction to detect potential substitutions. This assay included the 4 most frequent mutations in eIF2B5 (representing 66% of eIF2B5 mutations): c.338GNA, c.943CNT, c.1160A NG and c.1280C NT; the 2 most frequent mutations in eIF2B4 (representing 55% of eIF2B4 mutations): c.728CN T and c.1120CNT; the most frequent mutation in eIF2B2 (representing 50% of eIF2B2 mutations): c.638AN G; and the most frequent mutation in eIF2B3 (representing 40% of eIF2B3 mutations): c.260CNT. 3.2. Optimization and validation First, PCR conditions had to be optimized to allow amplification of the seven genomic regions of interest with a single thermal cycler run. We wanted to use the same primers as for DHPLC and sequencing. The concentrations of Taq polymerase, MgCl2 and DNA, the hybridization temperature and the number of cycles were adjusted (Table 4). As
Table 3 Internal oligonucleotides used for the multiplex primer-extension assay for the detection of the wild-type and mutated alleles of the eight eIF2B1-5 mutations targeted. Fluorescent fragments detected Gene
Exon
Mutation
Internal primer 5′-3′ (tail sequence and specific sequence)
Primer length (bp)
Wild-type allele size (bp) — color
Mutated allele size (bp) — color
eIF2 B5 eIF2 B5 eIF2 B5 eIF2 B5 eIF2 B4 eIF2 B4 eIF2 B2 eIF2 B3
3 7 8 8 8 11 5 2
c.338GNA c.943CNT c. 1160ANG c.1280CNT c.728CNT c.1120CNT c.638ANG c.260CNT
CTTTAGGAAGTCAAAGTGGTGCC CCCTTAATCCTTAGGTAGCTGTCTGTGCTGACGTCATC CACAATTAGCAACTGACTAAACTAGGTGCCACGTCGTGAAAGTCTGACAACCCATCCTGAGCCAGGTG ATGCTCAGACACAATTAGCGCGACCAAGGAACGAGTGACACTGAA CTATAGGTGATTCAGGATTACACAACAC ATGCTCAGACACAATTAGCGCGACCCTTAATCCTTAGGTAGACACCAGCATGGACTAGAGAAC ACTAAACTAGGTGCCACGTCGTGAAAGTCTGAATTTGTCCAAAGCAGGTATTG TGAAAGTCTGACAAGACGCTGACATGGGAACTG
23 38 68 47 28 63 53 33
31 — blue 46 — black 71 — green 51 — black 35 — black 65 — blue 58 — green 40 — black
32 — green 47 — red 69 — blue 52 — red 37 — red 66 — green 57 — blue 41 — red
Please cite this article as: M.-C. Ferreira, et al., Efficient detection of frequent eIF2B mutations for the rapid molecular diagnosis of CACH/VWM syndrome, Clin Biochem (2015), http://dx.doi.org/10.1016/j.clinbiochem.2015.07.004
4
M.-C. Ferreira et al. / Clinical Biochemistry xxx (2015) xxx–xxx
Table 4 Amplification conditions of the seven eIF2B regions of interest, elution volumes of purified PCR products and proportion of each amplicon subjected to multiplex primer-extension reaction. Gene
Exon
MgCl2 (mM)
Taq polymerase (units)
Genomic DNA (ng)
Hybridization temp. (°C)
Elution vol. (μl)
Amplicon mix (μl)
eIF2B5 eIF2B5 eIF2B5 eIF2B4 eIF2B4 eIF2B2 eIF2B3
3 7 8 8 11 5 2
2.25 2.25 2.5 2.25 1.5 1.5 2.25
1 1.5 1 1.5 1.5 1.5 1
100 150 100 150 150 150 100
58 58 55 58 58 53 55
30 30 30 40 20 30 20
2 5 2.5 6 2 1.5 7
genomic DNA quality can be highly variable, particularly in long-term family genetic studies, and could compromise the reliability of the results, the specificity and intensity of amplification were checked by acrylamide gel electrophoresis. Some DNA samples were around 10 years old and needed to be purified by ethanol precipitation to be suitable for amplification for the subsequent steps. The resulting amplicons were purified and elution volume adjusted to compensate for differences in PCR yields (Table 4). Then the seven purified PCR products were pooled and the SNaPshot reaction performed. The first test was performed on known wild-type controls, and heterozygous and homozygous mutated samples (Table 2, P1 to C3). Singleplex reactions were first performed to check the efficiency of internal primer extension. At this step, two primers had to be redesigned, one because of a signal overlap (the tail sequence was adapted) and the other due to the absence of signal (the primer on the anti-sense DNA strand was redesigned). Then, all internal primers were pooled and the multiplex SNaPshot reaction performed. In order to homogenize signal intensities, the concentration of each primer was first modified, but this compensation was not sufficient. The alternative was to adjust the proportion of amplicons in the mixture before the SNaPshot reaction (Table 4). Then, the adjustment of the reaction volume loaded onto the genetic analyzer and electrophoresis parameters (injection time and voltage) allowed us to obtain intensities between 500 and 4000 relative fluorescence units (rfu) for all mutated and wild-type samples (Fig. 1). As the mobility of the fragments depends on the fluorescent dyelabeled ddNTPs added and cannot be estimated in advance, an allelic
ladder was produced. A polymorphic amplicon derived from a heterozygous patient was generated for each mutation; then all 7 resulting reactions were pooled after purification in the same proportions as determined previously (Table 4). Alleles were identified according to the fluorescent nucleotide added to the 3′ end of the probes, and fragment length deduced by comparison with co-migrating size standards. This allelic ladder showed no signal overlaps between adjacent fragments even when all 16 alleles were present. Moreover, the correct fluorescent labeling of all expected allelic fragments was confirmed. This new artificial sample represented a positive control for the next series of diagnostic tests (Fig. 1B). To evaluate the specificity and sensitivity of the method, 3 wild-type controls and 14 heterozygous and homozygous mutated samples were tested (Table 2, P1 to C3). SNaPshot results were fully consistent with DHPLC and sequence screening (Fig. 1A and B). The robustness of this method was then evaluated using a second series of samples whose origins, anti-coagulants for blood samples, DNA extraction methods and age of extracts were different (Table 2, P1 to P23). No discrepancy in results was observed between reference and SNaPshot methods. Similarly, four samples containing compound heterozygous mutations (Table 2, P15 to P18) were correctly genotyped (Fig. 1C and D). Finally a homozygous polymorphic sample (Table 2, P19) presenting the rare substitution c.243C NT in eIF2B3 was tested. This polymorphism could potentially have prevented probe hybridization as it affects the third 5′ nucleotide and could not be avoided when the probes were designed (Fig. 1E). No negative impact on sensitivity and specificity was observed.
Table 5 Recurrent mutations identified in index cases affected by eIF2B-related disorders in our cohort of 266 families.
4. Discussion
Gene
Exon Mutation
Heterozygous Homozygous % of gene % of total cases cases mutations eIF2B mutations
First multiplex primer-extension reaction eIF2B5 3 c.338GNA 13 eIF2B4 8 c.728CNT – eIF2B5 8 c.1280CNT 3 eIF2B2 5 c.638ANG 3 eIF2B3 2 c.260CNT 2 eIF2B5 7 c.943CNT 3 eIF2B5 8 c.1160ANG 3 eIF2B4 11 c.1120CNT 1
21 4 1 1 1 – – 1
Second multiplex primer-extension reaction planned eIF2B5 8 c.584GNA 2 – eIF2B5 5 c.877CNG – 1 eIF2B5 2 c.896GNA 2 – eIF2B5 7 c.911ANC – 1 eIF2B5 8 c.925GNC – 1 eIF2B5 11 c.944GNA 2 – eIF2B5 3 c.1015CNT 2 – eIF2B4 8 c.626GNA – 1 eIF2B4 8 c.1069CNT – 1 eIF2B4 5 c.1465TNC 2 – eIF2B3 2 c.1023TNG – 1
55 40 5 50 40 3 3 15
39.3 5.7 3.6 3.6 2.9 2.1 2.1 2.1 Total: 61.4%
40 50 40 3 3 15 55 40 5 50 40
1.4 1.4 1.4 1.4 1.4 1.4 1.4 1.4 1.4 1.4 1.4 Total: 76.8%
4.1. Aims of the new assay Next-generation sequencing tools are completely changing the way molecular diagnostic laboratories are organized, and will soon allow for the simultaneous testing of several genes, a development of particular interest for heterogeneous genetic disorders. However, until these methods are put into place in the majority of laboratories, current analytical methods for disorders such as those related to eIF2B, which involve screening 57 genomic regions spread over 5 genes, are costly and time-consuming. To date, the only hotspot mutation identified in the eIF2B genes is the c.338GN A substitution in eIF2B5 exon 3, accounting for around 25% of all mutations in the literature as a whole [4,13], and 39% in our cohort. However, the large majority of eIF2B mutations occur at low frequencies, making classic molecular methods such as direct sequencing or screening by DHPLC or High-Resolution Melt analysis less efficient. Other recently developed screening tools, such as assays for asialotransferrin deficiency in the cerebrospinal fluid [19,20] or decreased GEF activity in transformed patient lymphocytes [11,21], make it possible to select patients eligible for molecular diagnosis. In this report, we have proposed a multiplex primer-extension test to detect the eight most frequent eIF2B mutations, representing around 61.4% of all mutations, as the first step in this process. Our aim was to implement an efficient and cost-effective test in order to quickly determine a streamlined course of action.
Please cite this article as: M.-C. Ferreira, et al., Efficient detection of frequent eIF2B mutations for the rapid molecular diagnosis of CACH/VWM syndrome, Clin Biochem (2015), http://dx.doi.org/10.1016/j.clinbiochem.2015.07.004
M.-C. Ferreira et al. / Clinical Biochemistry xxx (2015) xxx–xxx
5
Fig. 1. GeneMapper electropherograms of eIF2B multiplex primer-extension reaction products.
4.2. Methodological strategy A significant proportion of eIF2B mutations occur in the homozygous state. One could thus expect that a SNaPshot assay would be able to immediately genotype some patients. In our cohort, 29 patients (41.4% of mutated patients) were homozygous for one of the eight mutations targeted. The assay could also be expected to detect compound heterozygous patients affected by 2 of the 8 mutations of interest, a condition fulfilled by 5 patients (7.1%) of our cohort. Moreover, the two mutational
events always occur in the same eIF2B gene; a compound heterozygous patient with mutations in two different genes has never been reported. With a combined rate of detection of around 61.4%, the SNaPshot assay would thus be able to highlight the gene to be directly screened as soon as the first mutation is detected, rendering it unnecessary to screen all five genes in their order of frequency until all mutations are identified. The last strategic step is to propose an alternative level of molecular investigation for borderline patients presenting moderately suggestive signs of the disease [14–16]. Taking into account its cost and the time
Please cite this article as: M.-C. Ferreira, et al., Efficient detection of frequent eIF2B mutations for the rapid molecular diagnosis of CACH/VWM syndrome, Clin Biochem (2015), http://dx.doi.org/10.1016/j.clinbiochem.2015.07.004
6
M.-C. Ferreira et al. / Clinical Biochemistry xxx (2015) xxx–xxx
required, this assay could be more easily prescribed when multiple clinical hypotheses are being considered. After a negative result, clinicians could choose to pursue the molecular analysis by classic methods or abandon the hypothesis of an eIF2B-related disorder. 4.3. The development of a specific allelic ladder Our assay is based on the well-known single-base primer-extension technique, already used for molecular diagnostics in the clinical context [22–25]. The protocol is based on a commercially available kit that provides a ready-to-use reaction mix, a multiplex control template and the corresponding primers. The purpose of these reagents is to provide a positive control to validate the technical process. However, control primers and templates could react in a very different way from ours under standard conditions; we thus developed a home-made control to be used as a specific allelic ladder. This allelic ladder includes all extension fragments corresponding to wild-type and mutated alleles (Fig. 1B), and was included in each analytical series in order to validate the reliability of the SNaPshot reaction, electrophoretic detection and genotype interpretation. 4.4. Validation and reliability of the method The first mutations to be included in the assay were selected based on statistics from the 266 families investigated for eIF2B-related disorders in our laboratory. The eight most common missense mutations were selected, representing 61.4% of all mutations identified to date in probands, and spread widely over 4 of the 5 eIF2B genes (Table 1). Of these, only one is a hotspot mutation: c.338GNA on eIF2B5 (39.3%); the others occur at lower frequencies. The critical steps in developing a SNaPshot assay are sequence analysis and primer/probe design. Internal primers were designed to include substitution sites and amplification conditions were adjusted to conserve the PCR primers used by conventional methods, in order to produce amplicons that could be explored by different methods, since these are all highly sensitive and allow the use of small amounts of material. By also adjusting primer extension and electrophoretic conditions, all 8 mutations could be genotyped by a single-run PCR and a single multiplex SNaPshot reaction. In this method, the heterozygous or homozygous status of patients could be determined by the number of fluorescent bands on the electropherogram, while wild-type or mutated status could be deduced from the color of the bands. This approach eliminates a part of the problem of false negative reactions: whatever the patient's status, one or two different nucleotide types must be incorporated, generating one or two different signals. However a false negative result due to a sequence mismatch cannot be excluded if it affects the mutated allele. In this case, the second mutation can be detected by the SNaPshot assay if it is included among the screened mutations. Otherwise the sample needs to be further investigated by reference methods, according to clinical and MRI finding and the expert clinician's prescription. All these results confirm that our method is reliable and can be used widely and routinely in a diagnostic context. 4.5. The clinical use of the method This multiplex SNaPshot assay is now currently used in our department for molecular diagnostic ends in eIF2B-related disorders. It represents a time-saving and cost-effective tool: results can be obtained within 2–3 days after the collection of blood samples and the primerextension reaction to detect the 8 mutations costs the equivalent of 2 sequencing reaction in our laboratory, as this assay does not require any specific equipment, reagents or technical processes other than those already in use (DNA extraction, PCR, fragment purification, capillary electrophoresis, bioinformatics and interpretation). Moreover, the high sensitivity of the method allows us to use excess PCR products for sequence analysis or screening, saving time when
complementary methods have to be used to search for a second mutation. At present, this multiplex SNaPshot assay allows the rapid detection of 61.4% of all identified eIF2B mutations. We propose, as the next step, the completion of the molecular diagnostic process for eIF2B-related disorders by a second assay including the 11 next most frequent mutations (Table 1). This second test would raise the global detection rate from 61.4% to 76.8%. The remaining mutations are very rare variations that cannot justify the development of a new multiplex assay. The coverage rate of mutations would thus increase from 66% to 80% for eIF2B5, from 55% to 85% for eIF2B4 and from 40% to 80% for eIF2B3; the coverage rate for eIF2B2 and eIF2B1 would remain unchanged (50% for eIF2B2 and no mutation identified in eIF2B1 to date). As new mutations are regularly reported, the final advantage of this SNaPshot strategy would be the constant adaptability of the assays according to the clinical and genetic heterogeneity of eIF2B-related disorders. In conclusion, we propose an efficient, flexible, and cost-effective multiplex SNaPshot assay to detect the eight most frequent eIF2B mutations in our cohort of 266 probands affected by eIF2B-related disorders. This method represents an interesting initial step of a streamlined global molecular diagnostic process, particularly in the context of acute neurological impairment or prenatal care. Acknowledgments The patients and their families are warmly acknowledged for their participation. This work was supported by grants from the European Leukodystrophy Association (ELA) Grant number FP7#241622. We thank Sowmyalakshmi Rasika (DHU PROTECT) for corrections of the manuscript and Eleonore Eymard-Pierre (Cytogenetic Department, CHU Clermont-Ferrand) for providing patient's samples from the LEUKOFRANCE Biobank. References [1] R. Schiffmann, J.R. Moller, B.D. Trapp, H.H. Shih, R.G. Farrer, D.A. Katz, et al., Childhood ataxia with diffuse central nervous system hypomyelination, Ann. Neurol. 35 (1994) 331–340. [2] A. Fogli, D. Rodriguez, E. Eymard-Pierre, F. Bouhour, P. Labauge, B.F. Meaney, et al., Ovarian failure related to eukaryotic initiation factor 2b mutations, Am. J. Hum. Genet. 72 (2003) 1544–1550. [3] A. Fogli, O. Boespflug-Tanguy, The large spectrum of eIF2B-related diseases, Biochem. Soc. Trans. 34 (2006) 22–29. [4] J. Maletkovic, R. Schiffmann, J.R. Gorospe, E.S. Gordon, M. Mintz, E.P. Hoffman, et al., Genetic and clinical heterogeneity in eIF2B-related disorder, J. Child Neurol. 23 (2008) 205–215. [5] A. Fogli, R. Schiffmann, E. Bertini, S. Ughetto, P. Combes, E. Eymard-Pierre, et al., The effect of genotype on the natural history of eIF2B-related leukodystrophies, Neurology 62 (2004) 1509–1517. [6] P. Labauge, L. Horzinski, X. Ayrignac, P. Blanc, S. Vukusic, D. Rodriguez, et al., Natural history of adult-onset eIF2B-related disorders: a multi-centric survey of 16 cases, Brain 132 (2009) 2161–2169. [7] R. Schiffmann, M.S. van der Knaap, Invited article: an MRI-based approach to the diagnosis of white matter disorders, Neurology 72 (2009) 750–759. [8] P.A. Leegwater, G. Vermeulen, A.A. Konst, S. Naidu, J. Mulders, A. Visser, et al., Subunits of the translation initiation factor eIF2B are mutant in leukoencephalopathy with vanishing white matter, Nat. Genet. 29 (2001) 383–388. [9] M.S. van der Knaap, P.A. Leegwater, A.A. Konst, A. Visser, S. Naidu, C.B. Oudejans, et al., Mutations in each of the five subunits of translation initiation factor eIF2B can cause leukoencephalopathy with vanishing white matter, Ann. Neurol. 51 (2002) 264–270. [10] E. Gomez, G.D. Pavitt, Identification of domains and residues within the epsilon subunit of eukaryotic translation initiation factor 2b (eIF2Bepsilon) required for guanine nucleotide exchange reveals a novel activation function promoted by eIF2B complex formation, Mol. Cell. Biol. 20 (2000) 3965–3976. [11] A. Fogli, R. Schiffmann, L. Hugendubler, P. Combes, E. Bertini, D. Rodriguez, et al., Decreased guanine nucleotide exchange factor activity in eIF2B-mutated patients, Eur. J. Hum. Genet. 12 (2004) 561–566. [12] J.C. Pronk, B. van Kollenburg, G.C. Scheper, M.S. van der Knaap, Vanishing white matter disease: a review with focus on its genetics, Ment. Retard. Dev. Disabil. Res. Rev. 12 (2006) 123–128. [13] O. Scali, C. Di Perri, A. Federico, The spectrum of mutations for the diagnosis of vanishing white matter disease, Neurol. Sci. 27 (2006) 271–277. [14] M.S. van der Knaap, P.G. Barth, F.J. Gabreels, E. Franzoni, J.H. Begeer, H. Stroink, et al., A new leukoencephalopathy with vanishing white matter, Neurology 48 (1997) 845–855.
Please cite this article as: M.-C. Ferreira, et al., Efficient detection of frequent eIF2B mutations for the rapid molecular diagnosis of CACH/VWM syndrome, Clin Biochem (2015), http://dx.doi.org/10.1016/j.clinbiochem.2015.07.004
M.-C. Ferreira et al. / Clinical Biochemistry xxx (2015) xxx–xxx [15] M.S. van der Knaap, P.A. Leegwater, C.G. van Berkel, C. Brenner, E. Storey, M. Di Rocco, et al., Arg113His mutation in eIF2Bepsilon as cause of leukoencephalopathy in adults, Neurology 62 (2004) 1598–1600. [16] M. Mascalchi, D. De Grandis, A. Ginestroni, A. Pratesi, R. Della Nave, G.C. Scheper, et al., Early MR imaging and spectroscopy appearance of eIF2B-related leukoencephalopathy, Neurology 67 (2006) 537–538. [17] S. Rozen, H. Skaletsky, Primer3 on the www for general users and for biologist programmers, Methods Mol. Biol. 132 (2000) 365–386. [18] K. Lindblad-Toh, E. Winchester, M.J. Daly, D.G. Wang, J.N. Hirschhorn, J.P. Laviolette, et al., Large-scale discovery and genotyping of single-nucleotide polymorphisms in the mouse, Nat. Genet. 24 (2000) 381–386. [19] A. Vanderver, R. Schiffmann, M. Timmons, K.A. Kellersberger, D. Fabris, E.P. Hoffman, et al., Decreased asialotransferrin in cerebrospinal fluid of patients with childhoodonset ataxia and central nervous system hypomyelination/vanishing white matter disease, Clin. Chem. 51 (2005) 2031–2042. [20] A. Vanderver, Y. Hathout, J. Maletkovic, E.S. Gordon, M. Mintz, M. Timmons, et al., Sensitivity and specificity of decreased CSF asialotransferrin for eIF2B-related disorder, Neurology 70 (2008) 2226–2232. [21] L. Horzinski, A. Huyghe, M.C. Cardoso, C. Gonthier, L. Ouchchane, R. Schiffmann, et al., Eukaryotic initiation factor 2b (eIF2B) GEF activity as a diagnostic tool for eIF2B-related disorders, PLoS One 4 (2009) e8318.
7
[22] S. Filippini, A. Blanco, A. Fernandez-Marmiesse, V. Alvarez-Iglesias, C. Ruiz-Ponte, A. Carracedo, et al., Multiplex snapshot for detection of BRCA1/2 common mutations in Spanish and Spanish related breast/ovarian cancer families, BMC Med. Genet. 8 (2007) 40. [23] J. Di Cristofaro, M. Silvy, J. Chiaroni, P. Bailly, Single PCR multiplex snapshot reaction for detection of eleven blood group nucleotide polymorphisms: optimization, validation, and one year of routine clinical use, J. Mol. Diagn. 12 (2010) 453–460. [24] K. Balschun, A.K. Wenke, C. Rocken, J. Haag, Detection of KRAS and BRAF mutations in advanced colorectal cancer by allele-specific single-base primer extension, Expert. Rev. Mol. Diagn. 11 (2011) 799–802. [25] S. Magnin, E. Viel, A. Baraquin, S. Valmary-Degano, B. Kantelip, J.L. Pretet, et al., A multiplex snapshot assay as a rapid method for detecting KRAS and BRAF mutations in advanced colorectal cancers, J. Mol. Diagn. 13 (2011) 485–492.
Web References (last access: May 29th 2015) Primer 3.0 program: http://frodo.wi.mit.edu/ Ensembl database: http://www.ensembl.org dbSNP database: http://www.ncbi.nlm.nih.gov/projects/SNP/
Please cite this article as: M.-C. Ferreira, et al., Efficient detection of frequent eIF2B mutations for the rapid molecular diagnosis of CACH/VWM syndrome, Clin Biochem (2015), http://dx.doi.org/10.1016/j.clinbiochem.2015.07.004