- Email: [email protected]
Efficient DNA extraction from hair shafts
Forensic Science International: Genetics Supplement Series 3 (2011) e319–e320
Contents lists available at ScienceDirect
Forensic Science International: Genetics Supplement Series journal homepage: www.elsevier.com/locate/FSIGSS
Research article
Efficient DNA extraction from hair shafts M. Almeida a,*, E. Betancor a, R. Fregel a, N.M. Sua´rez b, J. Pestano a,b a b
Forensic Genetics Laboratory, Institute of Legal Medicine of Las Palmas, Las Palmas, Spain Forensic Genetics Service, Faculty of Medicine, University of Las Palmas de Gran Canaria, Las Palmas, Spain
A R T I C L E I N F O
A B S T R A C T
Article history: Received 17 August 2011 Received in revised form 6 September 2011 Accepted 14 September 2011
Hairs are common biological samples in crime scene investigation. However, most of this evidence is comprised of hair fragments without the root. As the major part of DNA is located in the root, hair shafts are usually problematic samples in forensic analysis. For these reasons, hair DNA typing is directed at mitochondrial DNA (mtDNA), which is present in high copy number in each cell, instead of nuclear DNA analysis. In our laboratory, we have used the PrepFiler BTATM extraction method for routinely processing difficult samples such as old bones or cigarette butts, obtaining good quality DNA in all cases. As the use of automatic extraction methods has been progressively introduced in forensic laboratories, we have tested the applicability of the PrepFiler BTATM extraction method in combination with AutoMate ExpressTM equipment, to the analysis of hair shafts. In order to determine the efficiency of the method, DNA extractions were quantified using a real-time PCR approach, and mtDNA fragments of different lengths were amplified to determine DNA degradation. We also processed several types of hairs, with different characteristics (thickness, gender, antiquity and hair dyeing) and from diverse ethnical groups. In all cases, the PrepFiler BTA ExpressTM extraction method showed very reproducible results in obtaining DNA from hair shafts, its application being highly recommendable as a routine protocol in forensic laboratories. ß 2011 Elsevier Ireland Ltd. All rights reserved.
Keywords: Hair shaft DNA extraction PrepFiler Express BTA Proteinase K Mitochondrial DNA
1. Introduction
2. Material and methods
Hair shafts are an important source of DNA in forensic genetics. However, it is known that only a low amount of DNA is conserved in hair shafts. For this reason, this evidence which is valuable in court, is problematic in the laboratory. There are several extraction methods but some of them are very laborious and prone to contamination, whereas the shorter protocols have a low DNA recovery yield. In forensic genetics it is necessary to develop extraction methods that are fast, simple, efficient and which can be automated. PrepFiler BTATM (Applied Biosystems) extraction has shown a large DNA recovery in low copy number samples [1]. In this work, we test the applicability of this method in combination with AutoMate ExpressTM (Applied Biosystems) apparatus to the extraction of DNA from hair shafts.
DNA extractions were performed with several types of hair shaft samples using 1 cm of hair. Modern hair shaft samples consisted of one male with thick hair and four women with thin, thick and/or dyed hair. With these samples we aimed to test differences between non-dyed vs. dyed hair shafts, and thin vs. thick hair. In addition, long hairs were used to study the relation between DNA recovery and the distance from the hair root. Three old hair samples (approximately 30 years old) from different geographical origins (African, Asian and Caucasian) were also extracted to test how hair age affects DNA recovery. For these old samples, DNA extraction with 1, 2, or 3 cm of hair was tested. Moreover, three animal hair samples from dog (Canis lupus familiaris), cat (Felis catus) and sea lion (Zalophus californianus) were extracted in order to test applicability in non-human samples. Prior to DNA extraction, hair shaft samples were decontaminated using a sodium hypochlorite 10% solution. Hair shafts were submerged in bleach for 5 min at room temperature and then, they were rinsed twice with sterile ddH2O. Finally, samples were allowed to dry at room temperature. All samples were analyzed in triplicate for testing reproducibility. Briefly, hair shafts were extracted using the PrepFiler BTA
* Corresponding author at: Institute of Legal Medicine of Las Palmas, Trasera del Paseo Blas Felipe Cabrera s/n 35016, Las Palmas de Gran Canaria, Spain. Tel.: +34 928 32 3183; fax: +34 928 32 3245. E-mail address: [email protected] (M. Almeida). 1875-1768/$ – see front matter ß 2011 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.fsigss.2011.09.022
e320
M. Almeida et al. / Forensic Science International: Genetics Supplement Series 3 (2011) e319–e320
ExpressTM protocol and using the AutoMate ExpressTM apparatus (Applied Biosystems), following manufacturer recommendations. Different incubation times in the lysis step (the recommended 2 h vs. 18 h) were tested in order to optimize the protocol. All DNA extractions were quantified in triplicate to calculate media and standard deviation in DNA quantity values. Human mtDNA quantification was performed on an Applied Biosystems 7500 Real Time PCR system, using a final volume of 20 ml. PCR mixtures included 10 ml of TaqMan1 Universal Master Mix, no UNG (Applied Biosystems), 900 nM of both SDS primers (mtDNA_DF: GAACAGCTCTTTGGACACTAGGAAA; mtDNA_DR: GCTTTCTTAATTGGTGGCTGCTT), 200 nM of a TaqMan MGB probe (FAM-ACACCCATAGTAGGCCTA-MGB-NFQ), 0.35 ml of 5 U/ml AmpliTaq Gold1 enzyme, 0.32 ml of BSA (New England Biolabs), and 2 ml of sample. Non-human DNA samples were quantified using an interspecific mtDNA quantification method (unpublished results) that allowed us to distinguish non-human from human mtDNA. Quantification data was collected on an Applied Biosystems 7500 SDS instrument. PCR conditions were: one 10 min 95 8C polymerase activation step, followed by 45 cycles of two-step qPCR (15 s of 95 8C denaturation, 60 s of 60 8C combined anneal/ extension). Two different length mtDNA fragments were amplified in order to check DNA amplification and/or degradation. The long fragment of 420 bp was amplified using L00029 and H00408 primers [2], whereas the small fragment of 175 bp was amplified using L4FN and H5R primers [3]. PCR fragments were ethanol-precipitated and sequenced with both forward and reverse primers used in amplification. Sequencing reactions were performed with the BigDye v3.1 Terminator Cycle Sequencing kit (Applied Biosystems) and run on an ABI PRISM 3130 XL Genetic Analyzer (Applied Biosystems) following manufacturer recommendations. DNA sequences were analyzed using BioEdit software v.7.0.9.0. In order to avoid DNA contamination, blank samples were used in all the steps of the protocol. Moreover, mtDNA of all the researchers was typed in order to detect contamination due to manipulation in the laboratory. 3. Results and discussion Both hair shafts were completely lysated after 2 and 18 h. DNA quantification of triplicated extractions showed that DNA quantity was similar for the two incubation times (x = 245.1 molecules/ml, s = 7.7). These results indicate that DNA recovery is the same for the two protocols, for this reason an incubation time of 2 h was used in all the following steps. On the contrary, some very thick hairs were not visually disintegrated after 2 h. In these cases, an incubation of 18 h was used. Reproducibility assays showed that the same DNA quantity was obtained for three different hair shafts samples taken from the same individual in all the experiments, confirming that this method produces similar results in triplicated samples. Moreover, mtDNA amplification showed good results for all the modern samples using the 500 bp amplicon. Quantification results showed that the amount of DNA is more dependent on the thickness of the hair than on whether the hair is dyed or not, because thick dyed hair shafts exhibit more DNA quantity than non-dyed thin samples.
Fig. 1. Relation between DNA recovery and distance from the hair root. Triplicate samples were taken in the first, third and fifth centimeter of hair shaft.
Positive results were obtained for all the 30-year-old human hairs. However, the best DNA quantities were obtained for the old samples when 2 and 3 cm of hair shafts were used. MtDNA amplification was only possible for the 175 bp fragment due to DNA degradation. The sequencing of mtDNA amplification confirmed the authenticity of results as mtDNA haplotypes coincided with the geographical area of origin (L1b, N and HVR, respectively for the African, Asian and Caucasian samples). Quantification method confirms that non-human mtDNA was obtained for the three species tested. Human mtDNA was not obtained in any extraction. Finally, as expected, DNA recovery is dependent on the distance from the root. Concretely, when 1 cm hair shaft samples were taken with different distances from the root, a progressive decrease in the quantity of DNA obtained was observed (Fig. 1). In conclusion, the use of an automated platform and an extraction method for complicated samples is of vital importance when dealing with limiting samples such as hair shafts. For this reason, the use of the PrepFiler Express BTATM Forensic DNA Extraction method for extracting DNA from hair shafts is highly recommended in forensic laboratories, due to its good DNA recovery and its high reproducibility. Conflict of interest None. Acknowledgement We acknowledge Susan Cranfield for language correction. References [1] E. Betancor, R. Fregel, N.M. Sua´rez, V.M. Cabrera, J. Pestano, An efficient method of extracting DNA from bone remains from the Spanish Civil War—a comparative study of two methods: PrepFiler BTATM and DNAzol1 methods, Forensic News (January) (2011) 6–8. [2] K.M. Sullivan, R. Hopgood, P. Gill, Identification of human remains by amplification and automated sequencing of mitochondrial DNA, Int. J. Legal Med. 105 (1992) 83– 86. [3] N. Maca-Meyer, V.M. Cabrera, M. Arnay, C. Flores, R. Fregel, A.M. Gonzalez, J.M. Larruga, Mitochondrial DNA diversity in 17th–18th century remains from Tenerife (Canary Islands), Am. J. Phys. Anthropol. 127 (2005) 418–426.
Contents lists available at ScienceDirect
Forensic Science International: Genetics Supplement Series journal homepage: www.elsevier.com/locate/FSIGSS
Research article
Efficient DNA extraction from hair shafts M. Almeida a,*, E. Betancor a, R. Fregel a, N.M. Sua´rez b, J. Pestano a,b a b
Forensic Genetics Laboratory, Institute of Legal Medicine of Las Palmas, Las Palmas, Spain Forensic Genetics Service, Faculty of Medicine, University of Las Palmas de Gran Canaria, Las Palmas, Spain
A R T I C L E I N F O
A B S T R A C T
Article history: Received 17 August 2011 Received in revised form 6 September 2011 Accepted 14 September 2011
Hairs are common biological samples in crime scene investigation. However, most of this evidence is comprised of hair fragments without the root. As the major part of DNA is located in the root, hair shafts are usually problematic samples in forensic analysis. For these reasons, hair DNA typing is directed at mitochondrial DNA (mtDNA), which is present in high copy number in each cell, instead of nuclear DNA analysis. In our laboratory, we have used the PrepFiler BTATM extraction method for routinely processing difficult samples such as old bones or cigarette butts, obtaining good quality DNA in all cases. As the use of automatic extraction methods has been progressively introduced in forensic laboratories, we have tested the applicability of the PrepFiler BTATM extraction method in combination with AutoMate ExpressTM equipment, to the analysis of hair shafts. In order to determine the efficiency of the method, DNA extractions were quantified using a real-time PCR approach, and mtDNA fragments of different lengths were amplified to determine DNA degradation. We also processed several types of hairs, with different characteristics (thickness, gender, antiquity and hair dyeing) and from diverse ethnical groups. In all cases, the PrepFiler BTA ExpressTM extraction method showed very reproducible results in obtaining DNA from hair shafts, its application being highly recommendable as a routine protocol in forensic laboratories. ß 2011 Elsevier Ireland Ltd. All rights reserved.
Keywords: Hair shaft DNA extraction PrepFiler Express BTA Proteinase K Mitochondrial DNA
1. Introduction
2. Material and methods
Hair shafts are an important source of DNA in forensic genetics. However, it is known that only a low amount of DNA is conserved in hair shafts. For this reason, this evidence which is valuable in court, is problematic in the laboratory. There are several extraction methods but some of them are very laborious and prone to contamination, whereas the shorter protocols have a low DNA recovery yield. In forensic genetics it is necessary to develop extraction methods that are fast, simple, efficient and which can be automated. PrepFiler BTATM (Applied Biosystems) extraction has shown a large DNA recovery in low copy number samples [1]. In this work, we test the applicability of this method in combination with AutoMate ExpressTM (Applied Biosystems) apparatus to the extraction of DNA from hair shafts.
DNA extractions were performed with several types of hair shaft samples using 1 cm of hair. Modern hair shaft samples consisted of one male with thick hair and four women with thin, thick and/or dyed hair. With these samples we aimed to test differences between non-dyed vs. dyed hair shafts, and thin vs. thick hair. In addition, long hairs were used to study the relation between DNA recovery and the distance from the hair root. Three old hair samples (approximately 30 years old) from different geographical origins (African, Asian and Caucasian) were also extracted to test how hair age affects DNA recovery. For these old samples, DNA extraction with 1, 2, or 3 cm of hair was tested. Moreover, three animal hair samples from dog (Canis lupus familiaris), cat (Felis catus) and sea lion (Zalophus californianus) were extracted in order to test applicability in non-human samples. Prior to DNA extraction, hair shaft samples were decontaminated using a sodium hypochlorite 10% solution. Hair shafts were submerged in bleach for 5 min at room temperature and then, they were rinsed twice with sterile ddH2O. Finally, samples were allowed to dry at room temperature. All samples were analyzed in triplicate for testing reproducibility. Briefly, hair shafts were extracted using the PrepFiler BTA
* Corresponding author at: Institute of Legal Medicine of Las Palmas, Trasera del Paseo Blas Felipe Cabrera s/n 35016, Las Palmas de Gran Canaria, Spain. Tel.: +34 928 32 3183; fax: +34 928 32 3245. E-mail address: [email protected] (M. Almeida). 1875-1768/$ – see front matter ß 2011 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.fsigss.2011.09.022
e320
M. Almeida et al. / Forensic Science International: Genetics Supplement Series 3 (2011) e319–e320
ExpressTM protocol and using the AutoMate ExpressTM apparatus (Applied Biosystems), following manufacturer recommendations. Different incubation times in the lysis step (the recommended 2 h vs. 18 h) were tested in order to optimize the protocol. All DNA extractions were quantified in triplicate to calculate media and standard deviation in DNA quantity values. Human mtDNA quantification was performed on an Applied Biosystems 7500 Real Time PCR system, using a final volume of 20 ml. PCR mixtures included 10 ml of TaqMan1 Universal Master Mix, no UNG (Applied Biosystems), 900 nM of both SDS primers (mtDNA_DF: GAACAGCTCTTTGGACACTAGGAAA; mtDNA_DR: GCTTTCTTAATTGGTGGCTGCTT), 200 nM of a TaqMan MGB probe (FAM-ACACCCATAGTAGGCCTA-MGB-NFQ), 0.35 ml of 5 U/ml AmpliTaq Gold1 enzyme, 0.32 ml of BSA (New England Biolabs), and 2 ml of sample. Non-human DNA samples were quantified using an interspecific mtDNA quantification method (unpublished results) that allowed us to distinguish non-human from human mtDNA. Quantification data was collected on an Applied Biosystems 7500 SDS instrument. PCR conditions were: one 10 min 95 8C polymerase activation step, followed by 45 cycles of two-step qPCR (15 s of 95 8C denaturation, 60 s of 60 8C combined anneal/ extension). Two different length mtDNA fragments were amplified in order to check DNA amplification and/or degradation. The long fragment of 420 bp was amplified using L00029 and H00408 primers [2], whereas the small fragment of 175 bp was amplified using L4FN and H5R primers [3]. PCR fragments were ethanol-precipitated and sequenced with both forward and reverse primers used in amplification. Sequencing reactions were performed with the BigDye v3.1 Terminator Cycle Sequencing kit (Applied Biosystems) and run on an ABI PRISM 3130 XL Genetic Analyzer (Applied Biosystems) following manufacturer recommendations. DNA sequences were analyzed using BioEdit software v.7.0.9.0. In order to avoid DNA contamination, blank samples were used in all the steps of the protocol. Moreover, mtDNA of all the researchers was typed in order to detect contamination due to manipulation in the laboratory. 3. Results and discussion Both hair shafts were completely lysated after 2 and 18 h. DNA quantification of triplicated extractions showed that DNA quantity was similar for the two incubation times (x = 245.1 molecules/ml, s = 7.7). These results indicate that DNA recovery is the same for the two protocols, for this reason an incubation time of 2 h was used in all the following steps. On the contrary, some very thick hairs were not visually disintegrated after 2 h. In these cases, an incubation of 18 h was used. Reproducibility assays showed that the same DNA quantity was obtained for three different hair shafts samples taken from the same individual in all the experiments, confirming that this method produces similar results in triplicated samples. Moreover, mtDNA amplification showed good results for all the modern samples using the 500 bp amplicon. Quantification results showed that the amount of DNA is more dependent on the thickness of the hair than on whether the hair is dyed or not, because thick dyed hair shafts exhibit more DNA quantity than non-dyed thin samples.
Fig. 1. Relation between DNA recovery and distance from the hair root. Triplicate samples were taken in the first, third and fifth centimeter of hair shaft.
Positive results were obtained for all the 30-year-old human hairs. However, the best DNA quantities were obtained for the old samples when 2 and 3 cm of hair shafts were used. MtDNA amplification was only possible for the 175 bp fragment due to DNA degradation. The sequencing of mtDNA amplification confirmed the authenticity of results as mtDNA haplotypes coincided with the geographical area of origin (L1b, N and HVR, respectively for the African, Asian and Caucasian samples). Quantification method confirms that non-human mtDNA was obtained for the three species tested. Human mtDNA was not obtained in any extraction. Finally, as expected, DNA recovery is dependent on the distance from the root. Concretely, when 1 cm hair shaft samples were taken with different distances from the root, a progressive decrease in the quantity of DNA obtained was observed (Fig. 1). In conclusion, the use of an automated platform and an extraction method for complicated samples is of vital importance when dealing with limiting samples such as hair shafts. For this reason, the use of the PrepFiler Express BTATM Forensic DNA Extraction method for extracting DNA from hair shafts is highly recommended in forensic laboratories, due to its good DNA recovery and its high reproducibility. Conflict of interest None. Acknowledgement We acknowledge Susan Cranfield for language correction. References [1] E. Betancor, R. Fregel, N.M. Sua´rez, V.M. Cabrera, J. Pestano, An efficient method of extracting DNA from bone remains from the Spanish Civil War—a comparative study of two methods: PrepFiler BTATM and DNAzol1 methods, Forensic News (January) (2011) 6–8. [2] K.M. Sullivan, R. Hopgood, P. Gill, Identification of human remains by amplification and automated sequencing of mitochondrial DNA, Int. J. Legal Med. 105 (1992) 83– 86. [3] N. Maca-Meyer, V.M. Cabrera, M. Arnay, C. Flores, R. Fregel, A.M. Gonzalez, J.M. Larruga, Mitochondrial DNA diversity in 17th–18th century remains from Tenerife (Canary Islands), Am. J. Phys. Anthropol. 127 (2005) 418–426.