Efficient germ-line transformation of the economically important pest species Lucilia cuprina and Lucilia sericata (Diptera, Calliphoridae)

Insect Biochemistry and Molecular Biology 41 (2011) 70e75

Contents lists available at ScienceDirect

Insect Biochemistry and Molecular Biology journal homepage: www.elsevier.com/locate/ibmb

Short Communication

Efficient germ-line transformation of the economically important pest species Lucilia cuprina and Lucilia sericata (Diptera, Calliphoridae) Carolina Concha 1, Esther J. Belikoff, Brandi-lee Carey, Fang Li, Anja H. Schiemann, Maxwell J. Scott* Institute of Molecular BioSciences, Massey University, Private Bag 11222, Palmerston North, New Zealand

a r t i c l e i n f o

a b s t r a c t

Article history: Received 7 January 2010 Received in revised form 3 August 2010 Accepted 14 September 2010

The green blowfly species Lucilia cuprina and Lucilia sericata are economically important pests for the sheep industries of Australia and New Zealand. L. cuprina has long been considered a good target for a genetic pest management program. In addition, L. sericata maggots are used in the cleaning of wounds and necrotic tissue of patients suffering from ulcers that are difficult to treat by other methods. Development of efficient transgenesis methods would greatly facilitate the development of strains ideal for genetic control programs or could potentially improve “maggot therapy”. We have previously reported the germ-line transformation of L. cuprina and the design of a “female killing system” that could potentially be applied to this species. However, the efficiency of transformation obtained was low and transformed lines were difficult to detect due to the low expression of the EGFP marker used. Here we describe an efficient and reliable method for germ-line transformation of L. cuprina using new piggyBac vector and helper plasmids containing the strong promoter from the L. cuprina hsp83 gene to drive expression of the transposase and fluorescent protein marker gene. We also report, for the first time, the germ-line transformation of L. sericata using the new piggyBac vector/helper combination. Ó 2010 Elsevier Ltd. All rights reserved.

Keywords: Lucilia cuprina Lucilia sericata PiggyBac Transformation Transgenesis Maggot therapy Flystrike

1. Introduction The Australian sheep blowfly Lucilia cuprina is a major cause of sheep myiasis in Australia and New Zealand (Heath and Bishop, 2006; Wardhaugh et al., 2007). This disease costs the wool and meat industries millions of dollars every year in lost production. Consequently, L. cuprina has long been considered an excellent target for a genetic pest management program (Foster et al., 1985). We have been developing tetracycline-repressible female lethal and heat inducible female to male transformation systems for use in transgenic L. cuprina (Concha and Scott, 2009; Heinrich and Scott, 2000; Scott et al., 2004). The application of such systems to the development of a strain of L. cuprina that is suitable for a field trial requires the use of an efficient method for germ-line transformation. We previously reported that transgenic L. cuprina could be made using a piggyBac vector containing an EGFP marker gene driven by the Drosophila ubiquitin gene promoter (Heinrich et al., 2002). However, the overall transformation efficiency was only 1e2% and most experiments failed to produce transformed flies. * Corresponding author. Present address: Department of Genetics, North Carolina State University, Campus Box 7614, Raleigh, NC 27695-7614, USA. Tel.: þ1 919 5150275; fax: þ1 919 515 3355. E-mail addresses: [email protected] (C. Concha), [email protected] (M.J. Scott). 1 Present address: LBCMCP- CNRS UMR 5088, Batiment 4R3b1, Universite Paul Sabatier, 118 Route de Narbonne, 31062 Toulouse Cedex 09, France. 0965-1748/$ e see front matter Ó 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.ibmb.2010.09.006

The European green blowfly Lucilia sericata is also a pest species associated with fly strike in New Zealand (Heath and Bishop, 2006). In addition, sterile L. sericata maggots are used in several countries for the treatment of wounds, particularly of foot ulcers of diabetic patients (Sherman et al., 2000). L. sericata maggots ingest bacteria and secrete a potent mix of proteinases that break down the necrotic tissue and increase the pH in the wound, thus inhibiting bacterial growth (Nigam et al., 2006). The maggots also secrete a complex mixture of antibacterial compounds and may actively promote wound healing. The development of transgenesis techniques for the genetic engineering of this insect could prove advantageous for the improvement of biotechnological applications to the treatment of wounds. However, germ-line transformation of L. sericata has not been previously reported. In this study we have developed a routine and efficient method for the germ-line transformation of L. cuprina and we have successfully used this method to efficiently transform L. sericata. 2. Materials and methods 2.1. Insect strains and rearing The “flock house” wild type strain of L. cuprina used in this study is of New Zealand origin. The “ICI strain” of L. sericata has been maintained in New Zealand for many years and was originally sourced from

C. Concha et al. / Insect Biochemistry and Molecular Biology 41 (2011) 70e75

Schering-Plough Animal Health Ltd, Upper Hutt, New Zealand. Lucilia were reared as described previously (Concha and Scott, 2009). 2.2. Molecular constructs Expression constructs containing a green fluorescent proteincoding region controlled by the Lchsp83 gene promoter and with the Lcatub 30 end, were made using a three step cloning strategy. The coding regions for ZsGreen and EGFP were amplified by PCR from pZsGreen (Clontech) and pEGFP-1 (Clontech) respectively, digested using BamHI and HindIII and inserted into pBC KS (Stratagene). Similarly, the coding region of TurboGFP was excised from pTurboGFP-B (Evrogen) by digestion with BamHI and HindIII and then inserted into pBC KS. Secondly, a 1.4 kb PCR product containing 322 bp of the 30 UTR and 1100 bp of the 30 flanking region of the atubulin gene was obtained from L. cuprina genomic DNA. This fragment includes a polyadenylation signal (AATAAA) that is 47 bp from the 30 end of the a-tubulin gene. The PCR product was digested using HindIII and KpnI and ligated into the respective sites in the pBC-GFP constructs. In the third cloning step, a 3.4 kb PCR fragment of the Lchsp83 gene containing 2642 bp of 50 flanking DNA, the 202 bp first exon, 519 bp first intron and 54 bp of the second exon was inserted into the SacI and BamHI restriction sites of the pBC-GFP-atub constructs. The Lchsp83 gene fragment includes the start codon and 51 bp of the coding region. Thus, including the polylinker, this adds 20 amino acids to the amino end of the fluorescent proteins. To make the pB[Lchsp83-ZsGreen] transformation vector, the cassette containing the Lchsp83 promoter, ZsGreen gene and atubulin 30 flanking region was excised using XhoI and NotI (sites had been incorporated in the Luchsp83-C2 and LuctubC4 primers respectively) and inserted into these sites in pBAC2. To make pBAC2, p3E1.2 (gift of M. Fraser) was digested with BglII and Pst I and ligated with a polylinker that was made by prior annealing of the oligonucleotides 50 -GGGTAACCACCGGTTCTAGACTCGAGGCGGC CGCGTCGACCCGCGGCCATGGAGGCCTGGTACCA-30 and 50 -GATCTG GTACCAGGCCTCCATGGCCGCGGGTCGACGCGGCCGCCTCGAGTCTAG AACCGGTGGTTACCCTGCA-30 . To make the pB[Lchsp83-ZsGreen]attP transformation vector, pTAattP (Groth et al., 2000) was digested with ScaI and NotI, a 170 bp fragment purified and ligated with pB[Lchsp83-ZsGreen] that had been digested with StuI and NotI then treated with calf intestinal phosphatase. The Lchsp83-pBac helper used in germ-line transformation of Lucilia, was created by ligation of a fragment containing the gene promoter with pXL15 that had been previously digested with SmaI and SacI. pXL15 contains the piggyBac coding region and 30 end but lacks the promoter (Li et al., 2001). 2.3. Germ-line transformation and marker detection L. cuprina embryos were collected at 30 minute intervals, placed on double-stick tape within the depression of a twin concavity glass slide then co-injected with the pB[Lchsp83-ZsGreen] vector and the phspBac helper (Handler and Harrell, 1999) at a concentration of 650 : 325 ng/ml, respectively, in injection buffer. A second assay was performed microinjecting a mixture of the pB[Lchsp83ZsGreen] vector and the Lchsp83-piggyBac helper at a donor:helper concentration of 700:300 ng/ml in injection buffer. L. sericata embryos were injected with a mixture of the pB[Lchsp83-ZsGreen]attP vector and the Lchsp83-piggyBac helper at a concentration of 700:300 ng/ml, respectively, in injection buffer. Needles were made from quartz glass (1.0 mm OD, 0.7 mm ID, Sutter #QF100-70-10) using a Sutter P-2000 micropipette puller and ends sharpened with a Sutter BV-10 micropipette beveller. Following injection, embryos were covered with halocarbon 27 oil (Sigma), transferred to a MIC 101 modular incubator chamber (billups-rothenberg) and

71

incubated in an oxygen-rich environment for 21e24 h at 21  C. Surviving G0 adults were backcrossed to wild type individuals in groups of 2 G0 females to 3 wild type males or one G0 male to three wild type females. The progeny of each cross was screened at the late embryo/early first instar larval for green fluorescence using an Olympus SZX12-RFL3 microscope with appropriate filter set (EX460e490 nm, EM510e550 nm). Images were captured using an Olympus DP70 digital camera. Statistical analysis of transformation frequencies was performed using the Minitab software. A binary logistic regression analysis was used to determine if the proportion of G0 crosses that produced transgenic offspring obtained with the Lchsp83-piggyBac helper was significantly different than that obtained with the phspBac helper. 2.4. PCR, inverse PCR and Southern hybridization analysis To amplify the Lchsp83 promoter, cycling conditions were: 94  C for 2 min, 94  C for 24 s and 67  C for 6 min for 7 cycles followed by 32 cycles of 94  C for 25 s, 65  C for 1 min and 67  C for 6 min, with a final extension of 67  C for 7 min. The amplification of the atubulin 30 UTR and flanking region used the LucTubC3 and LucTubC4 primers and the following cycling conditions: 94  C for 2 min, 94  C for 25 s, 59  C for 1 min and 68  C for 2 min for 7 cycles followed by 32 cycles of 94  C for 25 s and 68  C for 2 min, with a final extension of 68  C for 5 min. To amplify the ZsGreen and EGFP coding regions from plasmid templates, the cycling conditions used were: 94  C for 2 min, 94  C for 15 s, 52  C for 1 min and 68  C for 1 min with a final extension of 68  C for 7 min. For a positive control of PCR amplification of genomic DNA, a fragment of the Lcatubulin gene was amplified using the Luc-atub-2 and Luc-atub-3 primers with the following cyclic conditions: 94  C for 2 min, 94  C for 1 min, 52  C for 45 s and 72  C for 1 min with a final extension of 72  C for 10 min. All PCR reactions were performed using Advantage 2 polymerase mix (Clontech) in buffer supplied by the manufacturer with 0.2 mM dNTP. Amplified DNA was sub-cloned into pGEMÒ-T Easy (Promega) and DNA sequence determined using T7 and SP6 primers. The primers used were as follows: ZsGreen1: 50 -GGATCCATGGCTCAGTCAAAGCACGGT-30 ZsGreen2: 50 -AAGCTTTCAGGGCAATGCAGATCCG-30 EGFP1-1: 50 -GGATCCATGGTGAGCAAGGGCGAGGAG-30 EGFP1-2: 50 -AAGCTTTTACTTGTACAGCTCGTCCATGCC-30 LucTubC3: 50 -AAGCTTGCAGCCAAACCCATCATCGAC-30 LucTubC4: 50 -GGTACCGCGGCCGCGGGCTGGTGTAGTCAAAAACTT TGATTT-30 Luchsp83-C1: 50 -GGATCCTTTAAGCTGAGCAATTTCAGCTTGGAAA GCAAAAG-30 Luchsp83-C2: 50 -GAGCTCCTCGAGGCGCCCTCTTTTGTCCTTAGTTT CATATGT-30 Luc-atub-2: 50 -ATCTCAATTTCTTCTTGTGTGTGTTAAAG-30 Luc-atub-3: 50 -TGCCATGTTCCAAGCAGTACAATTC-30 Inverse PCR was performed with Sau3A and TaqI digested genomic DNA templates as described previously (Li et al., 2001). Similarly, agarose gel electrophoresis of HindIII digested genomic DNA (15 mg per lane), Southern transfer to a nylon membrane and hybridization with a [32P]-labelled DNA probe were performed using standard procedures as previously described (Li et al., 2001). 3. Results and discussion 3.1. An improved marker gene for transformation of L. cuprina Although transgenic L. cuprina were previously obtained using the pB[PUbnlsEGFP] vector, transformed individuals were difficult

72

C. Concha et al. / Insect Biochemistry and Molecular Biology 41 (2011) 70e75

Table 1 Germ line transformation of L. cuprina using the pB[Lchsp83-ZsGreen] vector.a Transformation Vector

Helper

Experiment No.

No. G0 adults

No. fertile crosses

pB[Lchsp83-ZsGreen]

Dmhsp70-piggyBac

1 2 3 Total

60 31 16 107

30 21 15 66

2 1 1 4

6.7% 4.8% 6.7% 6.1%

pB[Lchsp83-ZsGreen]

Lchsp83-piggyBac

1 2 3 4 Total

22 26 20 9 77

16 17 13 6 52

2 6 2 1 11

12.5% 35.3% 15.4% 16.7% 21%

a b

No. Crosses with ZsGreen positive larvae

Transformation frequencyb

In total, approx. 1000 embryos were injected with each helper/vector combination. Calculated as a percentage of fertile crosses that had transgenic offspring.

to distinguish from non-transformed siblings (Heinrich et al., 2002). This raised the possibility that transgenic individuals were not being identified because of poor expression of the EGFP marker gene. We considered that one explanation for the low marker gene expression was because the Drosophila ubiquitin gene promoter was poorly active in L. cuprina. Other Drosophila gene promoters such as those from the hsp70 and act5C genes have been reported to have very low activity in L. cuprina (Coates et al., 1996). These observations suggested a need for native Lucilia promoters to achieve strong expression of the marker gene. We have recently isolated and characterised the promoters of the L.

cuprina hsp23, hsp70 and hsp83 genes (C. Concha, A. Schiemann, B. Cary and M. Scott, unpublished results). Of the three L. cuprina heat shock promoters, Lchsp83 showed the highest constitutive activity and was therefore chosen to drive the expression of the marker gene. We also investigated whether other fluorescent proteins could be easier to detect in L. cuprina than EGFP. Green fluorescent proteins were preferred as the background green autofluorescence is lower at larval stages than red or blue autofluorescence. A fluorescent marker that could be detected in the early stages of Lucilia development would be ideal as this would eliminate much of the

Fig. 1. ZsGreen marker gene expression in transgenic L. cuprina. Adult flies were observed with either a GFP filter set (A) or white light (B). First (C) and third instar larvae (D) were also observed with a GFP filter set. Arrows indicate non-transgenic individuals. Transgenic individuals show bright green fluorescence in all cells from the mid-embryo stage through to adult. (E) A schematic representation of the pB[Lchsp83-ZsGreen] transformation vector. Small arrows indicate the location of PCR primers used to amplify the ZsGreen gene from genomic DNA.

C. Concha et al. / Insect Biochemistry and Molecular Biology 41 (2011) 70e75

more laborious work required to screen for adult transformants. Since TurboGFP matures quickly after synthesis, it was an appealing marker as L. cuprina completes embryogenesis within 15e16 h at 25  C. We also chose to test ZsGreen as it is a fast maturing protein that we had previously shown to be a strong marker in transgenic Drosophila (Sarkar et al., 2006). Three marker constructs were made using the Lchsp83 gene promoter and EGFP, ZsGreen and TurboGFP marker genes. To promote efficient polyadenylation and mRNA stability, the marker constructs contained the 30 UTR, poly A site and 30 flanking DNA from the L. cuprina a-tubulin gene. The new marker constructs were evaluated using a transient expression assay. Plasmid DNA was injected into preblastoderm embryos and examined for fluorescence intensity in newly hatched first instar larvae. All marker genes were efficiently expressed (Supplementary Fig. 1). However, larvae injected with the Lchsp83ZsGreen marker gene consistently gave brighter fluorescence.

73

Consequently, a piggyBac vector containing this marker gene was constructed for transgenic experiments. Three independent injection experiments were performed with the pB[Lchsp83-ZsGreen] vector and the phspBac helper plasmid (Handler and Harrell, 1999). The helper plasmid uses the D. melanogaster hsp70 promoter to drive expression of the piggyBac transposase. This heat inducible promoter is well known to have a low but significant basal level of activity at 25  C (Simon and Lis, 1987). We previously reported that postinjection survival of L. cuprina embryos was highly variable between independent experiments (Heinrich et al., 2002). Replacing the commercial femtotips (Eppendorf) used previously with very sharp needles made from quartz glass led to more consistent postinjection survival (data not shown). G0 adults were crossed to several stock flies and the offspring examined for green fluorescence at the first instar larval stage. Crosses contained either a single G0 male or two

Fig. 2. Molecular analysis of transgenic L. cuprina and L. sericata. (A) Schematic representation of an integrated Lchsp83-ZsGreen transgene. The wavy lines indicate Lucilia genomic DNA. The vector used to transform L. sericata contains a phiC31 attP site (0.17kb) inserted between the L. cuprina a-tubulin 30 flanking DNA and the 50 piggyBac sequence. (B-D) Genomic DNA was purified from the L. sericata “ICI” strain, L. sericata transgenic line 5 and L. cuprina transgenic lines 56, BIF, 39, hs14 and AB1. (B) DNA was amplified by PCR using primer pairs for the ZsGreen coding region. An amplification product of 0.7 kb band was expected from the transgenic lines but not control strain. (C) Southern blot hybridization analysis of HindIII digested genomic DNA. The 3.8 kb band is due to hybridization of the probe to the endogenous Lucilia alpha-tubulin gene and is present in all samples. The 2.1 kb band contains the ZsGreen marker gene and is present in DNA from all transgenic lines. An additional band of varying size is detected for each transgene insertion event. In lines Ls5 and LcAB1, this additional band migrates slightly higher than the 3.8 kb band and shown by an asterisk (*). The presence of 4 bands in the Lc56 lane is consistent with this line containing two transgenes. (D) Amplification products obtained by inverse PCR from genomic DNA digested with either Sau3A (top) or TaqI (bottom). The DNA sequences flanking each transgene are shown to the right of the respective panels. All insertions were in a TTAA target site. This analysis confirmed all lines carry a single transgene with the exception of Lc56, which has two insertions.

74

C. Concha et al. / Insect Biochemistry and Molecular Biology 41 (2011) 70e75

G0 females. Each injection experiment resulted in the generation of at least one transgenic line. The overall frequency of transformation was 6.1% (Table 1). All transgenic lines were easily identified at the first instar stage due to very bright fluorescence from the ZsGreen marker. The marker was visible at all larval stages and in newly eclosed adults (Fig. 1). To determine how early in development the marker can be identified transgenic males were crossed with stock females. Fluorescent embryos could be clearly identified from midembryogenesis (8e9 h) onwards. Thus by using a bright marker gene controlled by a L. cuprina gene promoter we could routinely obtain transgenic lines at a frequency at least three times higher than previously reported. 3.2. An improved helper construct for transformation of L. cuprina We previously reported that the use of a strong constitutive promoter to control the expression of the piggyBac transposase led to high transformation efficiencies in D. melanogaster (Li et al., 2001). Transcripts from the Lchsp83 gene are detected by qRTPCR analysis at high levels at all stages of L. cuprina development (C. Concha, A. Schiemann, B. Cary and M. Scott, unpublished results). For example, in non heat-shocked embryos, Lchsp83 RNA is present at similar levels as a-tubulin RNA and approximately 1000 fold higher than Lchsp70 RNA. To determine if modification of the piggyBac helper could improve transformation of L. cuprina, we constructed a new helper plasmid that used the Lchsp83 promoter.

From a total of four independent injection experiments, 11 of the 52 fertile G0 crosses produced transgenic offspring. The overall transformation frequency was 21%, significantly higher than with the phspBac helper (Binary logistic regression or G-test, P-value ¼0.014, G ¼ 6.044, DF ¼ 1). Each independent injection experiment produced at least one transformant line. Thibault and colleagues achieved high piggyBac remobilization rates in D. melanogaster by using a transposase gene construct that had the a1-tubulin gene promoter and the fs(1)K10 30 UTR for transcript stability in the germline (Thibault et al., 2004). The observed remobilization rates were higher than achieved by using the Dmhsp70 promoter to control transposase transcription. These results are consistent with our present finding that the highest transformation efficiency of L. cuprina was achieved by using the strong constitutive Lchsp83 gene promoter to drive expression of the transposase. High levels of piggyBac expression also led to increased transposition in mammalian cells (Cadinanos and Bradley, 2007). For some transposon systems (e.g. Sleeping Beauty), transposition rates decrease when the level of transposase exceeds a threshold amount, which is known as overproduction inhibition (Geurts et al., 2003). However, comparison of transposition rates with increasing levels of transposase indicates that piggyBac is not subject to overproduction inhibition (Wilson et al., 2007). Thus using a strong constitutive or strong germ-line specific promoter to drive expression of the piggyBac transposase gene could, in general, be a successful strategy for improving the

Fig. 3. ZsGreen marker gene expression in transgenic L. sericata. Adult flies were observed with either a GFP filter set (A) or white light (B). First (C) and third instar larvae (D) were also observed with a GFP filter set. Arrows indicate non-transgenic individuals. Transgenic individuals show bright green fluorescence from the mid-embryo stage through to adult. A region in first instar larvae that showed a low level of fluorescence in all lines is indicated with an arrowhead (C). (E) A schematic representation of the pB[Lchsp83-ZsGreen]-attP transformation vector. Small arrows indicate the location of PCR primers used to amplify the ZsGreen gene from genomic DNA.

C. Concha et al. / Insect Biochemistry and Molecular Biology 41 (2011) 70e75

efficiency of germ-line transformation for the insect species of interest. 3.3. Molecular analyses of transformant lines Transgene integration was confirmed by PCR analysis of genomic DNA with a primer pair specific for the ZsGreen marker gene (Fig. 2B). To determine the number of integrated copies of the transgene we performed Southern blot hybridization and inverse PCR analyses (Fig. 2C and D). The Southern blot hybridization analysis showed that each line had a single copy of the transgene with the exception of Lc56 which has two copies (Fig. 2C). Following inverse PCR, one major amplification product was obtained with all genomic DNA templates with the exception of line Lc56, which produced two (Fig. 2D). A number of minor lower molecular weight amplification products were obtained with the LcAB1 DNA from Sau3A digested DNA. Sequence analysis of the amplification products confirmed that all transgenes had inserted into a TTAA target site and that each line was due to an independent integration event (Fig. 2D). Further, the minor products obtained with the LcAB1 DNA were found to be due to non-specific amplification. With an efficient transformation system and the recent isolation of L. cuprina sex determination genes (e.g. transformer) (Concha and Scott, 2009) and female-specific gene promoters (A. Sarkar and M. J. Scott, manuscript in preparation), the development of a molecular genetic sexing strain of L. cuprina is now readily achievable. 3.4. Germ-line transformation of Lucilia sericata We next sought to determine if our improved piggyBac vector/ helper combination could be used to transform L. sericata, as this has not been previously achieved. The pB[Lchsp83ZsGreen] vector was modified slightly by the inclusion of an attP recognition site for the 4C31 recombinase (Groth et al., 2000). Thus any transgenic line obtained could potentially be used for subsequent site-specific recombination. Approximately 900 L. sericata embryos from the “ICI” strain were co-injected with the pB[Lchsp83ZsGreen]-attP vector and Lchsp83-piggyBac helper. 60 G0 adults were collected and crossed back to the parental strain. Of the 27 fertile G0 crosses, 3 produced transgenic lines, thus achieving a transformation efficiency of 11%. As in L. cuprina, the ZsGreen marker gene was clearly visible throughout larval development and in newly eclosed adults (Fig. 3). Integration of the marker gene was confirmed by molecular analysis of genomic DNA from one of the lines (Fig. 2). L. sericata larvae are used in the treatment of wounds and of foot ulcers, particularly in diabetic patients (Sherman et al., 2000). This insect is also used in research for comparative studies of insect development and evolution (Mellenthin et al., 2006). An efficient transformation method will facilitate research on L. sericata genes that play important roles in early development or in wound healing. Acknowledgements We thank Neville Haack (AgResearch) for providing the “flock house” strain of L. cuprina and Dallas Bishop for providing the “ICI” strain of L. sericata. We thank Alisdair Noble for performing the statistical analysis of the Lucilia transformation data and Helen Fitzsimons for comments on the manuscript. We are grateful to Al

75

Handler, Malcolm Fraser and Michele Calos for gifts of plasmid DNA. This research has been supported by contract EC456 from Australian Wool Innovation Inc and a Massey University technicians award.

Appendix. Supplementary data Supplementary data associated with this article can be found in the online version, at doi:10.1016/j.ibmb.2010.09.006.

References Cadinanos, J., Bradley, A., 2007. Generation of an inducible and optimized piggyBac transposon system. Nucleic Acids Res. 35, e87. Coates, C.J., Howells, A.J., O’Brochta, D.A., Atkinson, P.W., 1996. The 50 regulatory region from the Drosophila pseudoobscura hsp82 gene results in a high level of reporter gene expression in Lucilia cuprina embryos. Gene 175, 199e201. Concha, C., Scott, M.J., 2009. Sexual development in Lucilia cuprina (Diptera, Calliphoridae) is controlled by the Transformergene. Genetics 182, 785e798. Foster, G.G., Vogt, W.G., Woodburn, T.L., 1985. Genetic analysis of field trials of sexlinked translocation strains for genetic control of the Australian sheep blowfly Lucilia cuprina (Wiedemann). Aust. J. Biol. Sci. 38, 275e293. Geurts, A.M., Yang, Y., Clark, K.J., Liu, G., Cui, Z., Dupuy, A.J., Bell, J.B., Largaespada, D.A., Hackett, P.B., 2003. Gene transfer into genomes of human cells by the sleeping beauty transposon system. Mol. Ther. 8, 108e117. Groth, A.C., Olivares, E.C., Thyagarajan, B., Calos, M.P., 2000. A phage integrase directs efficient site-specific integration in human cells. Proc. Natl. Acad. Sci. U.S.A. 97, 5995e6000. Handler, A.M., Harrell 2nd, R.A., 1999. Germline transformation of Drosophila melanogaster with the piggyBac transposon vector. Insect Mol. Biol. 8, 449e457. Heath, A.C., Bishop, D.M., 2006. Flystrike in New Zealand: an overview based on a 16-year study, following the introduction and dispersal of the Australian sheep blowfly, Lucilia cuprina Wiedemann (Diptera: Calliphoridae). Vet. Parasitol. 137, 333e344. Heinrich, J.C., Li, X., Henry, R.A., Haack, N., Stringfellow, L., Heath, A.C., Scott, M.J., 2002. Germ-line transformation of the Australian sheep blowfly Lucilia cuprina. Insect Mol. Biol. 11, 1e10. Heinrich, J.C., Scott, M.J., 2000. A repressible female-specific lethal genetic system for making transgenic insect strains suitable for a sterile-release program. Proc. Natl. Acad. Sci. U.S.A. 97, 8229e8232. Li, X., Heinrich, J.C., Scott, M.J., 2001. piggyBac-mediated transposition in Drosophila melanogaster: an evaluation of the use of constitutive promoters to control transposase gene expression. Insect Mol. Biol. 10, 447e455. Mellenthin, K., Fahmy, K., Ali, R.A., Hunding, A., Da Rocha, S., Baumgartner, S., 2006. Wingless signaling in a large insect, the blowfly Lucilia sericata: a beautiful example of evolutionary developmental biology. Dev. Dyn. 235, 347e360. Nigam, Y., Bexfield, A., Thomas, S., Ratcliffe, N.A., 2006. Maggot therapy: the science and implication for CAM Part II-Maggots combat infection. Evid. Based Compl. Alternat. Med. 3, 303e308. Sarkar, A., Atapattu, A., Belikoff, E.J., Heinrich, J.C., Li, X., Horn, C., Wimmer, E.A., Scott, M.J., 2006. Insulated piggyBac vectors for insect transgenesis. BMC Biotechnol. 6, 27. Scott, M.J., Heinrich, J.C., Li, X., 2004. Progress towards the development of a transgenic strain of the Australian sheep blowfly (Lucilia cuprina) suitable for a male-only sterile release program. Insect Biochem. Mol. Biol. 34, 185e192. Sherman, R.A., Hall, M.J., Thomas, S., 2000. Medicinal maggots: an ancient remedy for some contemporary afflictions. Annu. Rev. Entomol. 45, 55e81. Simon, J.A., Lis, J.T., 1987. A germline transformation analysis reveals flexibility in the organization of heat shock consensus elements. Nucleic Acids Res. 15, 2971e2988. Thibault, S.T., Singer, M.A., Miyazaki, W.Y., Milash, B., Dompe, N.A., Singh, C.M., Buchholz, R., Demsky, M., Fawcett, R., Francis-Lang, H.L., Ryner, L., Cheung, L.M., Chong, A., Erickson, C., Fisher, W.W., Greer, K., Hartouni, S.R., Howie, E., Jakkula, L., Joo, D., Killpack, K., Laufer, A., Mazzotta, J., Smith, R.D., Stevens, L.M., Stuber, C., Tan, L.R., Ventura, R., Woo, A., Zakrajsek, I., Zhao, L., Chen, F., Swimmer, C., Kopczynski, C., Duyk, G., Winberg, M.L., Margolis, J., 2004. A complementary transposon tool kit for Drosophila melanogaster using P and piggyBac. Nat. Genet. 36, 283e287. Wardhaugh, K.G., Morton, R., Bedo, D., Horton, B.J., Mahon, R.J., 2007. Estimating the incidence of fly myiases in Australian sheep flocks: development of a weatherdriven regression model. Med. Vet. Entomol. 21, 153e167. Wilson, M.H., Coates, C.J., George Jr., A.L., 2007. PiggyBac transposon-mediated gene transfer in human cells. Mol. Ther. 15, 139e145.