- Email: [email protected]
Efficient method of seed transformation via Agrobacterium tumefaciens for obtaining transgenic plants of Hibiscus cannabinus L.
Industrial Crops & Products 113 (2018) 274–282
Contents lists available at ScienceDirect
Industrial Crops & Products journal homepage: www.elsevier.com/locate/indcrop
Efficient method of seed transformation via Agrobacterium tumefaciens for obtaining transgenic plants of Hibiscus cannabinus L.
T
⁎
Mohsen Hananaa, , Rekaya Ayadib,d, Rim Mzida, Mohamed Larbi Khoujac, Amel Salhi Hanachid, Lamia Hamrounib a
Laboratory of Extremophile Plants, Biotechnology Center of Borj-Cedria, B.P. 901, 2050 Hammam Lif, Tunisia Laboratory of Management and Valorization of Forest Resources, National Institute of Rural Engineering, Waters and Forest Researches, P.B. 10, 2080 Ariana, Tunisia c Laboratory of Forest Ecology, National Institute of Rural Engineering, Waters and Forest Researches, P.B. 10, 2080 Ariana, Tunisia d Molecular Genetics Laboratory, Immunology and Biotechnology, Faculty of Sciences of Tunis, University of Tunis El Manar, Campus universities, El Manar 2, 2092, Tunisia b
A R T I C L E I N F O
A B S T R A C T
Keywords: Agrobacterium tumefaciens Genetic transformation Kenaf Seed transformation PCR
Kenaf (Hibiscus cannabinus L.) is an economic and ecological fiber crop but suffers severe losses in fiber yield and quality under the stressful conditions of excess salinity and drought. Therefore, in order to obtain new cultivars of kenaf that could face and overcome abiotic stress, it is crucial to have a suitable protocol of genetic transformation. Therein, experiments were carried out on transformation of kenaf mature seeds using a co-culture of Agrobacterium tumefaciens. In this study, a A. tumefaciens-mediated transformation of kenaf seed have been developed by tissue-culture-independent procedure. The GV3010 Agrobacterium strain harboring the pGreenII binary vector that carries the neomymycin phosphotransferase II (npt II) gene for selection was used for transformation. The presence of the transgene and its stable expression were confirmed by PCR. In addition, the transgenic character of the selected transgenic T0 and T1 plants has been confirmed by germination test in the presence of kanamycin. Molecular analysis of F0 plants of three transgenic lines revealed the real integration of VvWRKY2 gene into the kenaf genome. Thus, our described method was an efficient, fast, and reliable procedure by which stable transgenic flowering plants were obtained within a short period of 3 months with 6% transformation efficiency.
1. Introduction Kenaf (Hibiscus cannabinus L.) is a fiber crop of the Malvaceae family growing mostly in the tropical regions of Asia and Africa. It has great potential uses in the pulp and paper industry, oil absorption and potting media, filtration media, and animal feed (Keshk et al., 2006; Ayadi et al., 2011, 2017). Hence, this species harbors economic and ecological interests and represents a promising industrial multipurpose crop (Niu et al., 2015; Ayadi et al., 2017). Production of good quality fiber is a prerequisite for profitable marketing in kenaf industry but it suffers severe losses in fiber yield and quality under the stressful environmental conditions. Drought and salinity are becoming particular widespread in many regions, affecting more than 10% of arable land and causing a global decline in the average yields of major crops by more than 50% (Bartels and Sunkar, 2005). Therefore, genetic engineering has emerged as a valuable alternative and a complementary
approach to improve plant tolerance and adaptation. However, the capacity to achieve successful genetic transformation depends largely on efficient plant regeneration systems. Hence, it is necessary to generate kenaf plants that can tolerate the adverse environmental conditions while maintaining high fiber yields. Plant adaptation strategy is primarily dependent on the temporal and spatial regulation of gene transcription activity through the transcription factors (TFs) (Roy Choudhury et al., 2008; Zhang and Feng, 2014; Banerjee and Roychoudhury, 2015). Although recently discovered of among candidate genes involved in crop improvement, the WRKY transcription factors family is becoming one of the best-characterized classes of plant transcription factors. Previous works have demonstrated that WRKY transcription factors participate in various biotic stress responses (Eulgem et al., 2000; Pandey and Somssich, 2009; Chen et al., 2012; Wang et al., 2017), several developmental and physiological processes like embryogenesis, trichome development, and
Abbreviations: GUS, ß-glucuronidase; MS, Murashige and Skoog; LB, Luria Bertani; TFs, transcription factors ⁎ Corresponding author at: 23 Rue d’Amérique, La Marsa 2070, Tunisia. E-mail addresses: [email protected] (M. Hanana), [email protected] (R. Ayadi), [email protected] (R. Mzid), [email protected] (M.L. Khouja), [email protected] (A.S. Hanachi), [email protected] (L. Hamrouni). https://doi.org/10.1016/j.indcrop.2018.01.050 Received 13 October 2017; Received in revised form 15 January 2018; Accepted 19 January 2018 0926-6690/ © 2018 Elsevier B.V. All rights reserved.
Industrial Crops & Products 113 (2018) 274–282
M. Hanana et al.
the VvWRKY2 transcription factor candidate gene. The strategy essentially involves the direct inoculation of the embryonic axes of mature seeds allowing them to grow into adult plants under controlled conditions.
seed coat, leaf senescence, and regulation of biosynthetic pathways of hormone signaling (Johnson et al., 2002; Zou et al., 2004; Guillaumie et al., 2010; Zhang et al., 2016; Amato et al., 2017). Currently, some researchers focused on their role in plant response to abiotic stresses such as salinity, drought, cold, and nutrient deficiency. In particular, VvWRKY2 from Vitis vinifera L. has been demonstrated to be involved in responses to both abiotic and biotic stresses, as well as in plant development and signaling mechanisms (Mzid et al., 2007; Guo et al., 2014; Zhang and Feng, 2014; Mzid et al., unpublished), in addition to its implication in lignin biosynthesis pathway and cell wall formation (Guillaumie et al., 2010;). Thereby, due to the versatility and diversity of VvWRKY2 function, the latter would be an interesting candidate gene for kenaf genetic transformation and improvement. Modification of Hibiscus cannabinus genome using genetic engineering methods can facilitate rapid development of new varieties with characteristics that confer resistance to abiotic (drought and salinity) stresses or induce some interesting agronomical traits (i.e. better yields and fiber content) (Wielgus et al., 2012). Genetic transformation of kenaf species has been first reported in 1993 by Banks et al. who successfully transformed callus tissue but were unable to obtain transgenic plants. As well, Srivatanakul et al. (2001) couldn’t obtain stable transformant by working on shoot apices, even playing on several factors such as Agrobacterium strain, temperature, and acetosyringone concentration. Likewise, Herath et al. (2005) did not achieve any shoot regeneration from in vitro agro-infected calli, although using different kenaf cultivars, plasmid vectors, and duration of pre- and co-culture, while obtaining few stable transgenic plants. Indeed, proliferating meristems that were induced by growth regulators represent an alternative target for gene delivery due to their natural ability to regenerate new buds, from them, transgenic shoots (Sarmah et al., 2004). In those studies, kenaf plants were transformed using A. tumefaciens by the conventional method by which a transgene is introduced into callus or cells through tissue culture. Agrobacterium-mediated genetic transformation has been considered as a promising tool for the introducing of genes of interest into several plant species, so it has been reported for different plant species such as Brassica napus L. for whom transgenic plants were so far produced primarily from tissue culture of cotyledon petioles (Zhang et al., 2006; Song et al., 2009) and hypocotyl segments (Peng et al., 2006; Zhang et al., 2006). Additionally, for Agrobacterium-mediated transformation, a series of tissue culture including co-cultivation, callus induction, shoot initiation, and root inducing is required to culture tissue cell and often 2–5 months are required to obtain complete transgenic plantlets in canola (Ponstein et al., 2002; Das et al., 2006). However, a potential limitation of the tissue culture method is the availability of a regeneration protocol via callus neoformation; in addition, somaclonal variation events generated through tissue culture can induce unwanted mutations (Venkatachalam et al., 2000). Tissue culture procedures also have some other adverse effects, such as somatic mutations (RakoczyTrojanowska, 2002), plant chimera, and losing plants in transplanting with complicated culture medium (Song et al., 2008). Transformation procedures which avoid tissue culture would be highly advantageous. Recently, in planta transformation protocol free from tissue culture applied onto kenaf shoot apexes have been performed via Agrobacterium tumefaciens and resulted in the direct development of transgenic shoots (Samanthi Priyanka Withanage et al., 2015). As far as, direct seed transformation would be a tempting alternative procedure as that transgene doesn't depend on tissue culture steps and regenerates rapidly a large numbers of transgenic plants. To the best of our knowledge, in the literature there is no direct genetic transformation of kenaf plants. Earlier, Ayadi et al. (2011) have developed a micropropagation technique and already optimized a protocol of regeneration from kenaf shoot tissues which is a preliminary step and prerequisite before starting a program of genetic transformation. Therefore, the aim of our study is to perform and obtain a successful protocol of kenaf genetic transformation using mature seeds via Agrobacterium tumefaciens with
2. Materials and methods 2.1. Plant material and explants preparation Seeds of Hibiscus cannabinus L. (Chinese variety “Guangdong 7432”) were surface sterilized by fungicide (Benlate, 1 g/l) supplemented with a few drops of Tween 20 for 30 min and rinsed 3 times with sterile distilled water. After 24 h of imbibing in sterile distilled water, the seed coats were carefully removed with forceps and scalpels to keep intact the cotyledons with embryonic axis which is the subject of in planta genetic transformation.
2.2. Bacterial strains and vector The gene construction consists in the full VvWRKY2 cDNA (GenBank Accession number AY596466) that is subcloned into the corresponding sites of the binary vector pGreen (http://www.pgreen.ac.uk), under the control of the 35S promoter of the cauliflower mosaic virus. The vector pGreen-VvWRKY2 was mobilized into Agrobacterium tumefaciens (GV3010 strain) by electroporation. This vector also carries the nptII gene (neomycin phosphotransferase II) under the control of the P35S promoter and Nopaline Synthase Terminator, for selecting the transformed plants by their resistance to kanamycin (Fig. 1).
2.3. Agrobacterium strain culture for transformation The Agrobacterium cultures were initiated from glycerol stocks at −80 °C and incubated in the dark at 28 °C for 2 days in Luria-Burtani (LB) solid medium supplemented with appropriate antibiotics (40 μg/ ml carbenicillin and 50 μg/ml kanamycin). The bacterial colonies were grown overnight in 3 ml LB liquid medium with the same appropriate antibiotics at 28 °C on a gyratory shaker at 200 rpm to obtain an exponential growth phase at an optimum density (OD600 = 0.5 to 1). The bacterial cells were collected by centrifuging at 5000 rpm for 5 min and the pellet was re-suspended in 30 ml liquid MS medium, supplemented with different concentrations of acetosyringone (0, 50, 100, and 150 μM) to activate Agrobacterium virulence genes. Acetosyringone was added 2 h prior to inoculation.
Fig. 1. Genetic construction of the plasmid pGreen-VvWRKY2. Km, Neomycin phosphotransferase II gene; LB: left border; 35Sp: cauliflower mosaic virus 35S promoter; RB: right border.
275
Industrial Crops & Products 113 (2018) 274–282
M. Hanana et al.
each variable was statistically calculated using Analysis of Variance (ANOVA) to determine the significance of each variable of a parameter on the transformation efficiency.
2.4. Transformation procedure The mature seeds were incubated in Agrobacterium culture on rotary shaker (200 rpm) for 6 h, co-cultivated for 24 h in agro-culture added with acetosyringone at the same different concentrations. Following cocultivation, explants were washed three times with sterile distilled water containing 40 μg/ml of carbenicillin to inhibit the growth of Agrobacterium, blotted on sterile Whatman paper and placed in Petri dishes with sterile perlite containing half MS mineral elements (Murashige and Skoog, 1962) with 50 μg/m1 of kanamycin. To study the effect of a selection medium, we have tested the germination of mature seeds of non-transgenic kenaf (wild type). After disinfection with the same procedure, the seeds were cultured in Petri dishes containing perlite added with a solution of MS/2 with 50 μg/ml of kanamycin. After 7 days on selection medium, green and healthy seedling attached with cotyledons were transferred in pots containing a sterilized mixture of compost and perlite, and were allowed to grow in the greenhouse with the same selection pressure. Transgenic plants were assessed by PCR amplification.
3. Results 3.1. Optimization of transformation protocol The systematic optimization of various parameters enabled us to obtain very high levels of putative transgenic plants. Our optimized protocol was used in subsequent stable transformation experiments to obtain transgenic kenaf plants. The feasibility of the transformation strategy adopted in this study was initially evaluated by the number of kenaf mature seed germinating into normal seedlings following infection by infection with Agrobacterium treatment. An effective selection strategy is very important for developing an efficient genetic transformation procedure. This can be achieved by the use of a selective agent which prevents non-transformed tissues from regenerating, while permitting the development of transformed cells into shoots without any lethality of the explants tissues (Song et al., 2012). The choice of selection agent depends on the plant nature, and each plant species responds differently to the selection agent. The bacterial nptII is the most frequently used selectable marker gene used for generating transgenic plants. Genetic transformations of kenaf plants have been reported in previous studies (Banks et al., 1993; Srivatanakul et al., 2001) and where, kenaf plants were transformed by the conventional method in which a transgene was introduced into a callus or cells in tissue culture using A. tumefaciens. In this paper, we describe a procedure for transforming mature seeds of kenaf with a disarmed Agrobacterium strain GV3010 harboring a pGreenII vector which carried the nptII gene for selecting the transformed plants by their resistance to kanamycin. The Fig. 2 resumes the procedure of direct genetic transformation of mature seed of kenaf. The transformation was conducted on three batches of seeds each having a single concentration of acetosyringone. After a period of imbibing, explants were inoculated in inoculum solution supplemented with acetosyringone added 2 h after inoculation. After 6 h, the explants are then placed in the co-culture medium with the same concentration of acetosyringone used for inoculation. The latter being incubated for 24 h at 28 °C. The temperature at which occurs the co-culture step is critical; high temperatures make the bacteria losing their virulence, and the transfer of genetic information into plant cells does not release. Afterwards, excess of Agrobacterium should be eliminated and putative transgenic explants selected through the use of antibiotic selection agent. Antibiotics are widely used in genetic transformation technology to select transgenic tissues and/or to eliminate Agrobacterium from the cultures when its presence is no longer required. Eliminating A. tumefaciens from cultures is important, because microbial contaminants in cultured plants can reduce multiplication and rooting rates or induce plant death (Estopa et al., 2001). In our experiment, carbenicillin was used to eliminate the Agrobacterium from the medium and kanamycin to select the transgenic plants (Fig. 1). After 7 days of the selection phase, explants developing cotyledonary seedlings are transferred in pot containing a mixture of compost and perlite under greenhouse. Three weeks above, leaves of untransformed plants turn bleaching. Whereas, putative transgenic plants displaying green cotyledons and healthy chlorophyll leaves (Fig. 3G) continued to grow and produced flowers (Fig. 3H), fruits and set seeds whose germination gave thereafter seedlings, showing thus intact fertility.
2.5. DNA molecular analysis To confirm T-DNA delivery inside the kenaf genome, genomic DNA was extracted from leaves of 3–4 months old putative transgenic kenaf plants cultivated under greenhouse and analyzed by the Polymerase Chain Reaction (PCR). As control leaves from untransformed plants were sampled with the same procedure. Genomic DNA was extracted using Zymo RESEARCH kit according to the manufacturer’s instructions. PCR was performed using specific primers for VvWRKY2 genes and those for P35S/TerNos universal primers and PCR conditions are described in Table 1. PCR products were then analyzed using electrophoresis on 1% agarose gel stained with 2% ethidium bromide. 2.6. Germination kanamycin resistance assay The antibiotic resistance of transgenic plants was determined by seed germination in the presence of an antibiotic. Kanamycin was used to assay the germination of seed T0 and T1 progeny transformed by A. tumefaciens harboring the binary vector. Sterile seeds from each line were placed on perlite filled pots and irrigated with distilled water solution of kanamycin (50 μg/ml) under greenhouse conditions. Sensitivity of the treated plants to the kanamycin (50 μg/ml) resistance was investigated 10 days after culture. 2.7. Determination of transformation efficiency The transformation efficiency was determined by counting the successfully transformed seedlings based on positive PCR tested sample per total number of experimentally transformed seeds. The effect of Table 1 Primers and PCR conditions used in this study. Genes
Primers (5′- 3′)
PCR condition and amplicon size
P35S TerNos
F: GGAAAGGCCATCGTTGAAGA R: TCATCGCAAGACCGGCAACA
VvWRKY2 VvWRKY2
F: AAGTAATATTGATCAATGGCTGAA R: GATATTCTACATCGCCTTGCC
95 °C for 2 min, followed by undergoing 35 cycles of 94 °C for 1 min, 62 °C for 40 s, 72 °C for 1 min 45 s, followed by 72 °C for 7 min (1.65Kb) 94 °C for 2 min, followed by undergoing 35 cycles of 94 °C for 1 min, 58 °C for 40 s, 72 °C for 1 min 45 s, followed by 72 °C for 10 min (1.63 Kb)
3.2. Effect of acetosyringone on the efficiency of genetic transformation The acetosyringone is known to activate the Agrobacterium tumefaciens virulence genes, thereby triggering the different stages leading to the transfer of genetic information to target plant cells. It is frequently used in the context of plant genetic transformation protocols (Bettany 276
Industrial Crops & Products 113 (2018) 274–282
M. Hanana et al.
Fig. 2. Procedure for genetic transformation of mature seeds of kenaf.
grow in pots under ambient conditions until maturity. The result in Table 2 shows that acetosyringone improved significantly the transformation efficiencies. In fact, the concentration of 100 μM acetosyringone improved significantly transformation efficiency with 72% of germination capacity of putative transgenic seed. Interestingly, the transformation efficiency decreased when the concentrations of acetosyringone are low or high, respectively 50 and 150 μM. Thus, the annulations of the mean number of germinated seed caused by the hypersensitivity response of explants to acetosyringone. This suggests that acetosyringone can be used to obtain significant improvements in transformation and the concentration of 100 μM is the most favorable to direct genetic transformation of mature seeds of kenaf.
Table 2 Effect of acetosyringone concentration on the efficiency of transformation. Concentration of acetosyringone (μM)
Germination capacity (%) Plants with light green cotyledons (%) Plants with yellow cotyledons (%) Plants with yellow cotyledons (%) Transformation frequency (%) after 1 month of selection
0 0d 0c
50 0d 0c
100 72b 32b
150 7,5c 0,44c
Control 100a 98a
0c 0c 0b
0c 0c 0b
24a 16a 6a
4,88b 2,22b 0b
1c 1b 0b
*Means followed by the same letter are not significantly different at 5% level by Duncan’s Test.
3.3. Plant transformation and recovery of transformants et al., 2003; Ernandes et al., 2015). In order to improve the genetic transformation rate of Hibiscus cannabinus L. by Agrobacterium tumefaciens, we studied the effect of different acetosyringone doses at the time of inoculation of the explants and the co-culture medium. For mature seeds inoculation, the bacterial suspension was added 2 h before inoculation with acetosyringone at different doses for activating the virulence genes of the Agrobacterium strain. Subsequently, the explants were placed in the co-culture medium supplemented with the same doses of the acetosyringone. After 1 day of the co-culture, the bacteria were removed with an appropriate antibiotic. The explants were then cultured in Petri dish containing a sterile perlite soaked by a MS/2 solution with kanamycin (50 μg/ml) to select putative transformed plants. The levels of acetosyringone (0, 50, 100, and 150 μM) were used in the inoculation and the co-cultivation medium for observing its effect on transformation capacity. The data was obtained from the germination rate of transformed seed of kenaf was calculated 7 days after the end of the first stage of selection. The state of the cotyledons transformed plants was obtained after one week of cultivation on the selective medium. After one month of selection by kanamycin under greenhouse we calculated the explants survival rates can continue to
Discrimination between transformed explants and non-transformed is based on their resistance to a selective agent (i.e. antibiotic, herbicide). For instance, we use an early selection of transformed seed in germinal stage with selective antibiotic: kanamycin in the irrigation solution. After 7 days of cultivation in Petri dish, mature kenaf seeds cocultivated with Agrobacterium started to germinate but on selection medium, they lacked chlorophyll, staying etiolated for one week. The transformed plants started turning green after 10 days on selection medium and developed thereafter in green healthy plants. The cultivated embryos produced plants in 30 days of culture on selection medium containing 50 μg/ml of kanamycin. Only putative transformants grew well on the selective medium containing lethal dose of kanamycin. Non-transformed embryos did not germinate, becoming bleached rapidly and dying. The percentage of germinated seedling is significantly about 72% and the rate of plant with green cotyledons is 32%. The frequency transformation is expressed as a percentage of explants resistant after one month of selection by kanamycin and related to the number of explant cultured (Table 1). The results indicate that the frequency of transformation is decreased significantly for both 277
Industrial Crops & Products 113 (2018) 274–282
M. Hanana et al.
Fig. 3. Agrobacterium-mediated transformation of mature seeds of kenaf. (A) Brown cotyledons treated with 50 μM acetosyringone. (B) Yellow cotyledons treated with 100 and 150 μM acetosyringone. (C) Light green cotyledons treated with 100 μM acetosyringone. (D) Control seedling. (E) Transgenic putative plant after selection kanamycin solution. (F) Selected transgenic plant formed a novel leaf after 10 days. (G) Transfert to transgenic plant in pot. (H) Flowering of transgenic plant.
seedlings is obtained from the explants treated with 100 μM of acetosyringone. After second selection step by the same dose of kanamycin in greenhouse condition we obtained the vigorous and resistant plants. In the other hand, untransformed control seeds germinate quickly and produce seedlings with chlorophyll green cotyledons (Fig. 3D), but those who are treated with a solution of half MS strength supplemented with kanamycin (50 μg/ml) showed yellow and vitrified cotyledons whose died 10 days later. It can be concluded that the genetic transformation has affected seed germination and the variability of germination capacity, and efficiency of genetic transformation is related to different parameters such as the presence of excess Agrobacterium in the medium, the low or higher concentration of acetosyringone to activate the virulence gene of bacteria and the use of selective antibiotic which can inhibit germination and plant growth (Fig. 3).
concentrations of acetosyringone 50 and 150 μM. Furthermore, the transformation frequency is about 0.4% for all experimental tests used, against, it is 6% for the case of explants optimized protocol where the dose acetosyringone used is 100 μM. The observation of the transformed explants of different experiments shows different aspect of cotyledons, we noticed the presence of three types of appearance following the transformation cotyledons: brown and much withered cotyledons that do not resist the antibiotic concentration selection (Fig. 3A), yellow cotyledons that lacked chlorophyll and etiolated recent eventually die a few days of cultivation (Fig. 3B). Other of explants whose are clear green color (Fig. 3C) develop chlorophyll green seedlings after one week of their transfer in pot under greenhouse condition on selection medium (Fig. 3E) and subsequently developed a healthy plants having formed the first young green leaf (Fig. 3F). The result of Table 1 shows that the highest significantly rate of green cotyledons 278
Industrial Crops & Products 113 (2018) 274–282
M. Hanana et al.
Fig. 4. Molecular analysis of transgenic and nontransgenic kenaf plants. (A) PCR detection with P35S primers. (B) PCR detection withVvWRKY2 primers. M: 1 kb DNA Ladder. Ti: DNA of transgenic line i. WT: control DNA (wild type)
Fig. 5. Recovery of plants under test germination kanamycin resistant.
conditions (Fig. 4). This allowed us to confirm the stability of the integration of the transgene VvWRKY2 in the genome of the three lines of transgenic kenaf lines.
3.4. Confirmation of transgenic plants through PCR amplification Putative transgenic plants were PCR assayed to confirm the stable integration of the transgene VvWRKY2. In this case, leaves extracts of three transgenic lines (T1, T2, and T3) and wild type (WT) were subjected to a PCR using the specific primers for the transgene (P35S and VvWRKY2 gene). The size of the amplified sequences (1.6 Kb) was estimated using the 1Kb molecular weight markers. Multiple PCR amplification results showed at P35S (Fig. 4A) and VvWRKY2 (Fig. 4B) genes were detected the presence of a band corresponding well to the size of the transgene VvWRKY2 (1.6 Kb). The DNA from the wild-type (WT), used as a negative control, gave no amplification under the same
3.5. Selection of kanamycin-resistant transformants In this study, success of Agrobacterium-mediated transformation was also found to be related to the addition of acetosyringone to the coculture medium. For this deed, to test the reliability of the selection protocol, it was applied to seeds derived from the transformation of kenaf with a construct containing VvWRKY2gene. The construct was inserted into the binary vector pGreen containing the nptII selectable 279
Industrial Crops & Products 113 (2018) 274–282
M. Hanana et al.
Fig. 6. Comparison of sensitivity to kanamycin. (A) wild type (WT). (B) PCR-positive transgenic plants.
Agrobacterium is targeted to the wounded apical meristem of the differentiated seed embryo. Therefore, Agrobacterium tumefaciens transfers the gene into the genome of diverse cells which are already destined to develop into specific organs, and the meristematic cells still to be differentiated (Keshamma et al., 2008). In our experiment we represent a first report of H. cannabinus on the direct transformation from mature seed using explants. The is an alternative procedure as that transgene can go without tissue culture steps and generate large numbers of transgenic plants rapidly. In the current study, we have optimized a simple and rapid protocol to infect seed via Agrobacterium tumefaciens without processing wounding. Moreover, we have tested the effect of different concentrations of acetosyringone on the efficiency of transformation, and we have used kanamycin which is one of the most widely used selection agents for plant transformation to eliminate Agrobacterium in transgenic plants that is a pre-requisite in preventing the possibility of gene release when these plants are transferred to the soil. The result showed that the best capacity of putative transformation seedling is 72% at the concentration of 100 μM which is the best frequency of transformation (6%) in all the experiment uses. In the same context, Tian Zi et al. (2010) developed transgenic cotton plants by inoculating pistil drip into a solution of Agrobacterium and got transformation efficiency of 0.46 to 0,93%. Keshamma et al. (2008) developed an in planta transformation using apical meristem of the differentiated embryo of the germinating seedling (cotton seed). The efficiency of transformation in any crop using in planta transformation depends on a number of factors, and standard percentage efficiency cannot be set for any crop or experiment (Kumar et al., 2009). On the other hand, a very low frequency (1.6%) of explants showed the expression when acetosyringone was excluded from the co-cultivation medium, while no GUS expression was observed. These results suggest that even if acetosyringone is not essential for successful transformation, its inclusion in co-cultivation medium may influence the transformation frequency. This observation supports earlier works in a number of species showing that the addition of acetosyringone during co-cultivation increases the number of transformed cells in the target tissues (Ashok et al., 2007; Wu et al., 2003). In contrast, the vir gene induction treatments to enhance the transformation efficiency involved the use of tobacco leaf extract and acetosyringone. The use of Agrobacterium previously treated with acetosyringone (100 μM) did not have any effect on the transformation efficiency. Transformation efficiency is influenced by several factors, including Agrobacterium strain, addition of phenolic compounds (e.g. acetosyringone) in the co-cultivation medium, wounding treatment of target tissue (Afolabi-Balogun et al., 2014), and appropriate selection of transformed cells or tissue from majority of untransformed tissue. Indeed, our genetic transformation efficiency of 6% is also higher than 5.03% reported by Pavingerová and Ondrej, (1995) in the seed transformation obtained from Arabidopsis
marker, and transferred into mature kenaf. There is a statistically significant difference between the germination rate between wild type seeds and transgenic seeds both imposing kanamycin selection (Fig. 5). When wild-type and kanamycin-resistant seedlings growing on perlite containing kanamycin (50 μg/ml) were examined after 10 days period. Explants for kanamycin-resistant transformants can accumulate chlorophyll and continue to grow normally. However, non-transformants failed to accumulate chlorophyll and they remained pale, with either closed or unexpanded cotyledons (Fig. 6A). Transformants had green, open, expanded cotyledons (Fig. 6B). The presence of kanamycin selection produced green transformants that were easily distinguished from yellow non-transformants on medium containing kanamycin. These plants nevertheless showed healthy growth, flowered, and set seeds in due course. The seeds of T0 generation also showed rapid germination, and the T1 plants showed normal growth and vigour. Transgenic plants could be produced by seed transformation method, and the genetic characteristics (i.e. kanamycin resistance marker and VvWYRKY2 transgene) transmitted to the T1 progeny.
4. Discussion The genetic transformation procedure involves incorporation of the gene of interest into the plant genome and regeneration of the transformed cells into whole transgenic plants. The success of the genetic engineering technique depends mainly on the stability of the transgenes over a long period of time. Genetic manipulation of kenaf has been tried in the last 15 years. Although, Banks et al. (1993) were the first to report the expression of transgenes in kenaf callus; they did not achieve any shoot regeneration from calli (Herath et al., 2005) in vitro agroinfected kenaf seedling shoot tips, obtaining few stable transformants. Ruotolo et al. (2011), proposed a meristematic cell from mature embryos as target for genetic modification driven by Agrobacterium tumefaciens. All this experiments depend on tissue culture system, and for which calli were unable to differentiate in transgenic tissues. However, in planta transformation protocols are advantageous over other methods because they do not involve regeneration procedures, and therefore the tissue culture-induced somaclonal variations are avoided. Such in planta transformation techniques have also been standardized in other crops like wheat (Supartana et al., 2006), rice (Supartana et al., 2005), buckwheat (Supartana et al., 2006), kenaf (Kojima et al., 2004; Samanthi Priyanka Withanage et al., 2015), and mulberry (Ping et al., 2003). In all the crops, Agrobacterium is directed towards either the apical meristem or the meristems of axillary buds. One such viable in planta transformation protocol has also been standardized for other crops (Rohini and Sankara Rao, 2000a, 2000b, 2001). The strategy essentially involves in planta inoculation of embryo axes of germinating seeds and allowing them to grow into seedlings ex vitro. In this method, 280
Industrial Crops & Products 113 (2018) 274–282
M. Hanana et al.
thaliana by this transformation method and further found that the genetic characteristic (kanamycin resistance marker) can transmit into T2 and T3 progeny (Harrison et al., 2006).
Kojima, M., Shioiri, H., Nogawa, M., Nozue, M., Matsumoto, D., Wada, A., Saiki, Y., Kiguchi, K., 2004. In planta transformation of kenaf plants (Hibiscus cannabinus var. aokawa N°. 3) by Agrobacterium tumafaciens. J. Biosci. Bioeng. 98, 136–139. Kumar, M.A., Reddy, K.N., Rohini, S., Ganeshan, G., Udayakumar, M., 2009. Towards crop improvement in bell pepper (Capsicum annuum L.): Transgenics (uid A:hpt II) by a tissue-culture independent Agrobacterium-mediated in planta approach. Sci. Hortic. 119, 362–370. Murashige, T., Skoog, F., 1962. A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol. Plant. 15, 473–497. Mzid, R., Marchive, C., Blancard, D., Deluc, L., Barrieu, F., Corio-Costet, M.F., Drira, N., Hamdi, S., Lauvergeat, V., 2007. Overexpression of VvWRKY2 in tobacco enhances broad resistance to necrotrophic fungal pathogens. Physiol. Plant. 131, 434–447. Niu, X., Qi, J., Chen, M., Zhang, G., Tao, A., Fang, P., Xu, J., Onyedinma, S.A., Su, J., 2015. Reference genes selection for transcript normalization in kenaf (Hibiscus cannabinus L.) under salinity and drought stress. PeerJ 3, e1347. http://dx.doi.org/10. 7717/peerj.1347. Pandey, S.P., Somssich, I.E., 2009. The role of WRKY transcription factors in plant immunity. Plant Physiol. 150, 1648–1655. Pavingerová, D., Ondrej, M., 1995. Improvement of Arabidopsis thaliana seed transformation efficiency. Biol. Plant. 37, 467–471. Peng, R.H., Yao, Q.H., Xiong, A.S., Cheng, Z.M., Li, Y., 2006. Codon modifications and an endoplasmic reticulum-targeting sequence additively enhance expression of an Aspergillus phytase gene in transgenic canola. Plant Cell Rep. 25, 124–132. Ping, L.X., Nogawa, M., Nozue, M., Makita, M., Takeda, M., Bao, L., Kojima, M., 2003. Transformation of mulberry trees (Morus alba L.) by Agrobactetium tumefaciens. J. Insect Biotechnol. Sericol. 72, 177–184. Ponstein, A.S., Bade, J.B., Verwoerd, T.C., Molendijk, L., Storms, J., Beudeker, R.F., Pen, J., 2002. Stable expression of Phytase (phy A) in canola (Brassica napus) seeds: towards a commercial product. Mol. Breed. 10, 31–44. Rakoczy-Trojanowska, M., 2002. Alternative methods of plant transformation a short review. Cell. Mol. Biol. Lett. 7, 849–858. Rohini, V.K., Sankara Rao, K., 2000a. Transformation of peanut (Arachis hypogeae L.): a non-tissue culture based approach for generating transgenic plants. Plant Sci. 150, 41–49. Rohini, V.K., Sankara Rao, K., 2000b. Embryo transformation, a practical approach for realizing transgenic plants of safflower (Carthamus tinctorius L.). Ann. Bot. 86, 1043–1049. Rohini, V.K., Sankara Rao, K., 2001. Transformation of peanut (Arachis hypogaea L.) with tobacco chitinase gene: variable response of transformants to leaf spot disease. Plant Sci. 160, 883–892. Roy Choudhury, A., Gupta, B., Sengupta, D.N., 2008. Trans-acting factor designated OSBZ8 interacts with both typical abscisic acid responsive elements as well as abscisic acid responsive element-like sequences in the vegetative tissues of indica rice cultivars. Plant Cell Rep. 27, 779–794. Ruotolo, G., Toro, A.D., Chiaiese, P., Filippone, E., 2011. Multiple buds are an alternative target to genetic manipulation of kenaf (Hibiscus cannabinus L.). Ind. Crops Prod. 34, 937–942. Samanthi Priyanka Withanage, S.P., Hossain, M.A., Kumar, S., Roslan, H.A.B., Abdullah, M.P., Napis, S.B., Shukor, N.A.A., 2015. Overexpression of Arabidopsis thaliana gibberellic acid 20 oxidase (AtGA20ox) gene enhance the vegetative growth and fiber quality in kenaf (Hibiscus cannabinus L.) plants. Breed. Sci. 65, 177–191. http://dx. doi.org/10.1270/jsbbs.65.177. Sarmah, B.K., Moore, A., Tate, W., Molvig, L., Morton, R.L., Rees, D.P., Chiaiese, P., Chrispeels, M.J., Tabe, L.M., Higgins, T.J.V., 2004. Transgenic chickpea seeds expressing high levels of a bean α-amylase inhibitor. Mol. Breed. 14, 73–82. Song, L., Zhao, D.G., Wu, Y.J., Li, Y., 2008. Transient expression of chicken alpha interferon gene in lettuce. J. Zhejiang Univ. 9, 351–355. Song, L., De-gang Zh Yong-jun, W., Xiaoe, T., 2009. A simplified seed transformation method for obtaining transgenic Brassica napus plants. Agric. Sci. China 8, 658–663. Song, G.Q., Walworth, A., Hancock, J.F., 2012. Factors influencing Agrobacterium-mediated transformation of switch grass cultivars. Plant Cell Tissue Org. Cult. 108, 445–453. Srivatanakul, M., Park, S.H., Salas, M.G., Smith, R.H., 2001. Transformation parameters enhancing T-DNA expression in kenaf (Hibiscus cannabinus). J. Plant Physiol. 158, 255–260. Supartana, P., Shimizu, T., Shioiri, H., Nogawa, M., Nozue, M., Kojima, M., 2005. Development of simple and efficient in planta transformation method for rice (Oryza sativa L.) using Agrobacterium tumefaciens. J. Biosci. Bioeng. 100, 391–397. Supartana, P., Shimizu, T., Nogawa, M., Shioiri, H., Nakijima, T., Haramoto, N., Nozue, M., Kojima, M., 2006. Development of simple and efficient in Planta transformation method for wheat (Triticum aestivum L.) using Agrobacterium tumefaciens. J. Biosci. Bioeng. 102, 162–170. Tian Zi, Ch., Wu, Sh.J., Zhao, J., Guo, W.Zh., Zhang, T.Zh., 2010. Pistil drip following pollination: a simple in planta Agrobacterium-mediated transformation in cotton. Biotechnol. Lett. 32, 547–555. Venkatachalam, P., Gheeta, N., Khandelwal, A., Shaila, M.S., Lakshmi Sita, G., 2000. Agrobacterium mediated genetic transformation from cotyledonary explants of groundnut (Arachis hypogeae L.) via somatic embryogenesis. Curr. Sci. 78, 1130–1136. Wang, X., Guo, R., Tu, M., Wang, D., Guo, C., Wan, R., Li, Z., Wang, X., 2017. Ectopic expression of the wild grape WRKY transcription factor VqWRKY52 in arabidopsis thaliana enhances resistance to the biotrophic pathogen powdery mildew but not to the necrotrophic pathogen botrytis cinerea. Front. Plant Sci. 8, 97. Wielgus, K., Szalata, M., Słomski, R., 2012. Genetic engineering and biotechnology of natural textile fiber plants. In: Ryszard Kozłowski, M. (Ed.), Handbook of Natural Fibres, pp. 550–575 (Chap. 17).
5. Conclusion It can be concluded from the present study that the transgenic kenaf plants can be obtained by Agrobacterium mediated transformation, and transgene stability confirmed for F0 generations so it is necessary to confirm that on the other generation. This method therefore is advantageous because it avoids the need for tissue culture. This method is relatively fast, simple, and economical, as well as easy to apply in plant genetic transformation. This is the first report of kenaf seed transformation using mature seed explants, and therefore it is interesting to preserve the transgenic plants for a large scale by in vitro propagation method to study the overexpression of VvWRKY2 gene. References Afolabi-Balogun, N.B., Inuwa, H.M., Ishiyaku, M.F., Bakare-Odunola, M.T., Nok, A.J., Adebola, P.A., 2014. Effect of acetosyringone on Agrobacterium-mediated transformation of cotton. ARPN J. Agric. Biolo. Sci. 9, 284–286. Amato, A., Cavallini, E., Zenoni, S., Finezzo, L., Begheldo, M., Ruperti, B., Tornielli, G.B., 2017. A grapevine TTG2-Like WRKY transcription factor is involved in regulating vacuolar transport and flavonoid biosynthesis. Front. Plant Sci. 7, 1979. Ashok, K.Sh., Dir, k.B., Lorz, H., 2007. Agrobacterium tumefaciens-mediated genetic transformation of barley (Hordeum vulgare L.). Plant Sci. 172, 281–290. Ayadi, R., Hamrouni, L., Hanana, M., Bouzid, S., Trifi, M., Khouja, M.L., 2011. In vitro propagation and regeneration of an industrial plant kenaf (Hibiscus cannabinus L.). Ind. Crops Prod. 33, 474–480. Ayadi, R., Hanana, M., Mzid, R., Hamrouni, L., Khouja, M.L., Salhi Hanachi, A., 2017. Hibiscus cannabinus L. −Kenaf: a review paper. J. Nat. Fibers 14, 466–484. http://dx. doi.org/10.1080/15440478.2016.1240639. Banerjee, A., Roychoudhury, A., 2015. WRKY proteins: signaling and regulation of expression during abiotic stress responses. Sci. World J. 807560, 17 Article ID. Banks, S.W., Gossett, D.R., Lucas, M.C., Millhollon, E.P., Lacelle, M.G., 1993. Agrobacterium-mediated transformation of kenaf (Hibiscus cannabinus L.) with the bglucoronidase (GUS) gene. Plant Mol. Biol. Rep. 11, 101–104. Bartels, D., Sunkar, R., 2005. Drought and salt tolerance in plants. Crit. Rev. Plant Sci. 24, 23–58. http://dx.doi.org/10.1080/07352680590910410. Bettany, A.J.E., Dalton, S.J., Timms, E., Manderyck, B., Dhanoa, M.S., Morris, P., 2003. Agrobacterium tumefaciens-mediated transformation of Festuca arundinacea (Schreb.) and Lolium multiflorum (Lam.). Plant Cell Rep. 21, 437–444. Chen, L., Song, Y., Li Sh Zhang, L., Zou Ch Yu, D., 2012. The role of WRKY transcription factors in plant abiotic stresses. Biochim. Biophys. Acta 1819, 120–128. Das, B., Goswami, L., Ray, S., Ghosh, S., Bhattacharyya, S., Das, S., Majumder, A.L., 2006. Agrobacterium-mediated transformation of Brassica juncea with a cyanobacterial (Synechocystis PCC6803) delta-6 desaturase gene leads to production of gammalinolenic acid. Plant Cell Tissue Org. Cult. 86, 219–231. Ernandes, M., Yamazaki, L.E., Grando, M.F., Roesler, E.A., 2015. Acetosyringone, pH and temperature effects on transient genetic transformation of immature embryos of Brazilian wheat genotypes by Agrobacterium tumefaciens. Genet. Mol. Biol. 38, 470–476. Estopa, M., Marfa, V., Melec, E., Messeguer, J., 2001. Study of different antibiotic combinations for use in the elimination of Agrobacterium with kanamycin selection in carnation. Plant Cell Tissue Org. Cult. 65, 211–220. Eulgem, T., Rushton, P.J., Robatzek, S., Somssich, I.E., 2000. The WRKY superfamily of plant transcription factors. Trends Plant Sci. 5, 199–206. Guillaumie, S., Mzid, R., Méchin, V., Léon, C., Hichri, I., Destrac-Irvine, A., TrossatMagnin, C., Delrot, S., Lauvergeat, V., 2010. The grapevine transcription factor WRKY2 influences the lignin pathway and xylem development in tobacco. Plant Mol. Biol. 72, 215–234. Guo, C., Guo, R., Xu, X., Gao, M., Li, X., Song, J., Zheng, Y., Wang, X., 2014. Evolution and expression analysis of the grape (Vitis vinifera L.) WRKY gene family. J. Exp. Bot. 65, 1513–1528. http://dx.doi.org/10.1093/jxb/eru007. Harrison, S.J., Mott, E.K., Parsley, K., Aspinall, S., Gray, J.C., Cottage, A., 2006. A rapid and robust method of identifying transformed Arabidopsis thaliana seedlings following floral dip transformation. Plant Methods 19, 1–7. http://dx.doi.org/10.1186/ 1746-4811-2-19. Herath, S.P., Suzuki, T., Hattori, K., 2005. Factors influencing Agrobacterium mediated genetic transformation of kenaf. Plant Cell Tissue Org. Cult. 82, 201–206. Johnson, C.S., Kolevski, B., Smyth, D.R., 2002. Transparent testa Glabra2, a trichome and seed coat development gene of Arabidopsis, encodes a WRKY transcription factor. Plant Cell 14, 1359–1375. Keshamma, E., Rohini, S., Rao, K.S., Madhusudhan, B., Udaya Kumar, M., 2008. Tissue culture-independent in planta transformation strategy: an Agrobacterium tumefaciensmediated gene transfer method to overcome recalcitrance in cotton (Gossypium hirsutum L.). J. Cotton Sci. 12, 264–272. Keshk, S., Suwinarti, W., Sameshima, K., 2006. Physicochemical characterization of different treatment sequences on kenaf bast fiber. Carbohydr. Polym. 65, 202–206.
281
Industrial Crops & Products 113 (2018) 274–282
M. Hanana et al.
Mol. Biol. Rep. 24, 255a. Zhang, H., Zhao, M., Song, Q., Zhao, L., Wang, G., Zhou, C., 2016. Identification and function analyses of senescence-associated WRKYs in wheat. Biochem. Biophys. Res. Commun. 474, 761–767. Zou, X., Seemann, J.R., Neuman, D., Shen, Q.J., 2004. A WRKY gene from creosote bush encodes an activator of the abscisic acid signaling pathway. J. Biol. Chem. 279, 55770–55779.
Wu, H., Sparks, C., Amoah, B., Jones, H.D., 2003. Factors influencing successful Agrobacterium-mediated genetic transformation of wheat. Plant Cell Rep. 21, 659–668. Zhang, Y., Feng, J.C., 2014. Identification and characterization of the grape WRKY family. BioMed. Res. Int. 2014, 1–14. http://dx.doi.org/10.1155/2014/787680. Zhang, Y.X., Xu, J., Hua, L., Wei, W., Guan, Z.Q., Lin, C., Chai, T.Y., 2006. Efficient shoot regeneration and Agrobacterium-mediated transformation of Brassica juncea. Plant
282
Contents lists available at ScienceDirect
Industrial Crops & Products journal homepage: www.elsevier.com/locate/indcrop
Efficient method of seed transformation via Agrobacterium tumefaciens for obtaining transgenic plants of Hibiscus cannabinus L.
T
⁎
Mohsen Hananaa, , Rekaya Ayadib,d, Rim Mzida, Mohamed Larbi Khoujac, Amel Salhi Hanachid, Lamia Hamrounib a
Laboratory of Extremophile Plants, Biotechnology Center of Borj-Cedria, B.P. 901, 2050 Hammam Lif, Tunisia Laboratory of Management and Valorization of Forest Resources, National Institute of Rural Engineering, Waters and Forest Researches, P.B. 10, 2080 Ariana, Tunisia c Laboratory of Forest Ecology, National Institute of Rural Engineering, Waters and Forest Researches, P.B. 10, 2080 Ariana, Tunisia d Molecular Genetics Laboratory, Immunology and Biotechnology, Faculty of Sciences of Tunis, University of Tunis El Manar, Campus universities, El Manar 2, 2092, Tunisia b
A R T I C L E I N F O
A B S T R A C T
Keywords: Agrobacterium tumefaciens Genetic transformation Kenaf Seed transformation PCR
Kenaf (Hibiscus cannabinus L.) is an economic and ecological fiber crop but suffers severe losses in fiber yield and quality under the stressful conditions of excess salinity and drought. Therefore, in order to obtain new cultivars of kenaf that could face and overcome abiotic stress, it is crucial to have a suitable protocol of genetic transformation. Therein, experiments were carried out on transformation of kenaf mature seeds using a co-culture of Agrobacterium tumefaciens. In this study, a A. tumefaciens-mediated transformation of kenaf seed have been developed by tissue-culture-independent procedure. The GV3010 Agrobacterium strain harboring the pGreenII binary vector that carries the neomymycin phosphotransferase II (npt II) gene for selection was used for transformation. The presence of the transgene and its stable expression were confirmed by PCR. In addition, the transgenic character of the selected transgenic T0 and T1 plants has been confirmed by germination test in the presence of kanamycin. Molecular analysis of F0 plants of three transgenic lines revealed the real integration of VvWRKY2 gene into the kenaf genome. Thus, our described method was an efficient, fast, and reliable procedure by which stable transgenic flowering plants were obtained within a short period of 3 months with 6% transformation efficiency.
1. Introduction Kenaf (Hibiscus cannabinus L.) is a fiber crop of the Malvaceae family growing mostly in the tropical regions of Asia and Africa. It has great potential uses in the pulp and paper industry, oil absorption and potting media, filtration media, and animal feed (Keshk et al., 2006; Ayadi et al., 2011, 2017). Hence, this species harbors economic and ecological interests and represents a promising industrial multipurpose crop (Niu et al., 2015; Ayadi et al., 2017). Production of good quality fiber is a prerequisite for profitable marketing in kenaf industry but it suffers severe losses in fiber yield and quality under the stressful environmental conditions. Drought and salinity are becoming particular widespread in many regions, affecting more than 10% of arable land and causing a global decline in the average yields of major crops by more than 50% (Bartels and Sunkar, 2005). Therefore, genetic engineering has emerged as a valuable alternative and a complementary
approach to improve plant tolerance and adaptation. However, the capacity to achieve successful genetic transformation depends largely on efficient plant regeneration systems. Hence, it is necessary to generate kenaf plants that can tolerate the adverse environmental conditions while maintaining high fiber yields. Plant adaptation strategy is primarily dependent on the temporal and spatial regulation of gene transcription activity through the transcription factors (TFs) (Roy Choudhury et al., 2008; Zhang and Feng, 2014; Banerjee and Roychoudhury, 2015). Although recently discovered of among candidate genes involved in crop improvement, the WRKY transcription factors family is becoming one of the best-characterized classes of plant transcription factors. Previous works have demonstrated that WRKY transcription factors participate in various biotic stress responses (Eulgem et al., 2000; Pandey and Somssich, 2009; Chen et al., 2012; Wang et al., 2017), several developmental and physiological processes like embryogenesis, trichome development, and
Abbreviations: GUS, ß-glucuronidase; MS, Murashige and Skoog; LB, Luria Bertani; TFs, transcription factors ⁎ Corresponding author at: 23 Rue d’Amérique, La Marsa 2070, Tunisia. E-mail addresses: [email protected] (M. Hanana), [email protected] (R. Ayadi), [email protected] (R. Mzid), [email protected] (M.L. Khouja), [email protected] (A.S. Hanachi), [email protected] (L. Hamrouni). https://doi.org/10.1016/j.indcrop.2018.01.050 Received 13 October 2017; Received in revised form 15 January 2018; Accepted 19 January 2018 0926-6690/ © 2018 Elsevier B.V. All rights reserved.
Industrial Crops & Products 113 (2018) 274–282
M. Hanana et al.
the VvWRKY2 transcription factor candidate gene. The strategy essentially involves the direct inoculation of the embryonic axes of mature seeds allowing them to grow into adult plants under controlled conditions.
seed coat, leaf senescence, and regulation of biosynthetic pathways of hormone signaling (Johnson et al., 2002; Zou et al., 2004; Guillaumie et al., 2010; Zhang et al., 2016; Amato et al., 2017). Currently, some researchers focused on their role in plant response to abiotic stresses such as salinity, drought, cold, and nutrient deficiency. In particular, VvWRKY2 from Vitis vinifera L. has been demonstrated to be involved in responses to both abiotic and biotic stresses, as well as in plant development and signaling mechanisms (Mzid et al., 2007; Guo et al., 2014; Zhang and Feng, 2014; Mzid et al., unpublished), in addition to its implication in lignin biosynthesis pathway and cell wall formation (Guillaumie et al., 2010;). Thereby, due to the versatility and diversity of VvWRKY2 function, the latter would be an interesting candidate gene for kenaf genetic transformation and improvement. Modification of Hibiscus cannabinus genome using genetic engineering methods can facilitate rapid development of new varieties with characteristics that confer resistance to abiotic (drought and salinity) stresses or induce some interesting agronomical traits (i.e. better yields and fiber content) (Wielgus et al., 2012). Genetic transformation of kenaf species has been first reported in 1993 by Banks et al. who successfully transformed callus tissue but were unable to obtain transgenic plants. As well, Srivatanakul et al. (2001) couldn’t obtain stable transformant by working on shoot apices, even playing on several factors such as Agrobacterium strain, temperature, and acetosyringone concentration. Likewise, Herath et al. (2005) did not achieve any shoot regeneration from in vitro agro-infected calli, although using different kenaf cultivars, plasmid vectors, and duration of pre- and co-culture, while obtaining few stable transgenic plants. Indeed, proliferating meristems that were induced by growth regulators represent an alternative target for gene delivery due to their natural ability to regenerate new buds, from them, transgenic shoots (Sarmah et al., 2004). In those studies, kenaf plants were transformed using A. tumefaciens by the conventional method by which a transgene is introduced into callus or cells through tissue culture. Agrobacterium-mediated genetic transformation has been considered as a promising tool for the introducing of genes of interest into several plant species, so it has been reported for different plant species such as Brassica napus L. for whom transgenic plants were so far produced primarily from tissue culture of cotyledon petioles (Zhang et al., 2006; Song et al., 2009) and hypocotyl segments (Peng et al., 2006; Zhang et al., 2006). Additionally, for Agrobacterium-mediated transformation, a series of tissue culture including co-cultivation, callus induction, shoot initiation, and root inducing is required to culture tissue cell and often 2–5 months are required to obtain complete transgenic plantlets in canola (Ponstein et al., 2002; Das et al., 2006). However, a potential limitation of the tissue culture method is the availability of a regeneration protocol via callus neoformation; in addition, somaclonal variation events generated through tissue culture can induce unwanted mutations (Venkatachalam et al., 2000). Tissue culture procedures also have some other adverse effects, such as somatic mutations (RakoczyTrojanowska, 2002), plant chimera, and losing plants in transplanting with complicated culture medium (Song et al., 2008). Transformation procedures which avoid tissue culture would be highly advantageous. Recently, in planta transformation protocol free from tissue culture applied onto kenaf shoot apexes have been performed via Agrobacterium tumefaciens and resulted in the direct development of transgenic shoots (Samanthi Priyanka Withanage et al., 2015). As far as, direct seed transformation would be a tempting alternative procedure as that transgene doesn't depend on tissue culture steps and regenerates rapidly a large numbers of transgenic plants. To the best of our knowledge, in the literature there is no direct genetic transformation of kenaf plants. Earlier, Ayadi et al. (2011) have developed a micropropagation technique and already optimized a protocol of regeneration from kenaf shoot tissues which is a preliminary step and prerequisite before starting a program of genetic transformation. Therefore, the aim of our study is to perform and obtain a successful protocol of kenaf genetic transformation using mature seeds via Agrobacterium tumefaciens with
2. Materials and methods 2.1. Plant material and explants preparation Seeds of Hibiscus cannabinus L. (Chinese variety “Guangdong 7432”) were surface sterilized by fungicide (Benlate, 1 g/l) supplemented with a few drops of Tween 20 for 30 min and rinsed 3 times with sterile distilled water. After 24 h of imbibing in sterile distilled water, the seed coats were carefully removed with forceps and scalpels to keep intact the cotyledons with embryonic axis which is the subject of in planta genetic transformation.
2.2. Bacterial strains and vector The gene construction consists in the full VvWRKY2 cDNA (GenBank Accession number AY596466) that is subcloned into the corresponding sites of the binary vector pGreen (http://www.pgreen.ac.uk), under the control of the 35S promoter of the cauliflower mosaic virus. The vector pGreen-VvWRKY2 was mobilized into Agrobacterium tumefaciens (GV3010 strain) by electroporation. This vector also carries the nptII gene (neomycin phosphotransferase II) under the control of the P35S promoter and Nopaline Synthase Terminator, for selecting the transformed plants by their resistance to kanamycin (Fig. 1).
2.3. Agrobacterium strain culture for transformation The Agrobacterium cultures were initiated from glycerol stocks at −80 °C and incubated in the dark at 28 °C for 2 days in Luria-Burtani (LB) solid medium supplemented with appropriate antibiotics (40 μg/ ml carbenicillin and 50 μg/ml kanamycin). The bacterial colonies were grown overnight in 3 ml LB liquid medium with the same appropriate antibiotics at 28 °C on a gyratory shaker at 200 rpm to obtain an exponential growth phase at an optimum density (OD600 = 0.5 to 1). The bacterial cells were collected by centrifuging at 5000 rpm for 5 min and the pellet was re-suspended in 30 ml liquid MS medium, supplemented with different concentrations of acetosyringone (0, 50, 100, and 150 μM) to activate Agrobacterium virulence genes. Acetosyringone was added 2 h prior to inoculation.
Fig. 1. Genetic construction of the plasmid pGreen-VvWRKY2. Km, Neomycin phosphotransferase II gene; LB: left border; 35Sp: cauliflower mosaic virus 35S promoter; RB: right border.
275
Industrial Crops & Products 113 (2018) 274–282
M. Hanana et al.
each variable was statistically calculated using Analysis of Variance (ANOVA) to determine the significance of each variable of a parameter on the transformation efficiency.
2.4. Transformation procedure The mature seeds were incubated in Agrobacterium culture on rotary shaker (200 rpm) for 6 h, co-cultivated for 24 h in agro-culture added with acetosyringone at the same different concentrations. Following cocultivation, explants were washed three times with sterile distilled water containing 40 μg/ml of carbenicillin to inhibit the growth of Agrobacterium, blotted on sterile Whatman paper and placed in Petri dishes with sterile perlite containing half MS mineral elements (Murashige and Skoog, 1962) with 50 μg/m1 of kanamycin. To study the effect of a selection medium, we have tested the germination of mature seeds of non-transgenic kenaf (wild type). After disinfection with the same procedure, the seeds were cultured in Petri dishes containing perlite added with a solution of MS/2 with 50 μg/ml of kanamycin. After 7 days on selection medium, green and healthy seedling attached with cotyledons were transferred in pots containing a sterilized mixture of compost and perlite, and were allowed to grow in the greenhouse with the same selection pressure. Transgenic plants were assessed by PCR amplification.
3. Results 3.1. Optimization of transformation protocol The systematic optimization of various parameters enabled us to obtain very high levels of putative transgenic plants. Our optimized protocol was used in subsequent stable transformation experiments to obtain transgenic kenaf plants. The feasibility of the transformation strategy adopted in this study was initially evaluated by the number of kenaf mature seed germinating into normal seedlings following infection by infection with Agrobacterium treatment. An effective selection strategy is very important for developing an efficient genetic transformation procedure. This can be achieved by the use of a selective agent which prevents non-transformed tissues from regenerating, while permitting the development of transformed cells into shoots without any lethality of the explants tissues (Song et al., 2012). The choice of selection agent depends on the plant nature, and each plant species responds differently to the selection agent. The bacterial nptII is the most frequently used selectable marker gene used for generating transgenic plants. Genetic transformations of kenaf plants have been reported in previous studies (Banks et al., 1993; Srivatanakul et al., 2001) and where, kenaf plants were transformed by the conventional method in which a transgene was introduced into a callus or cells in tissue culture using A. tumefaciens. In this paper, we describe a procedure for transforming mature seeds of kenaf with a disarmed Agrobacterium strain GV3010 harboring a pGreenII vector which carried the nptII gene for selecting the transformed plants by their resistance to kanamycin. The Fig. 2 resumes the procedure of direct genetic transformation of mature seed of kenaf. The transformation was conducted on three batches of seeds each having a single concentration of acetosyringone. After a period of imbibing, explants were inoculated in inoculum solution supplemented with acetosyringone added 2 h after inoculation. After 6 h, the explants are then placed in the co-culture medium with the same concentration of acetosyringone used for inoculation. The latter being incubated for 24 h at 28 °C. The temperature at which occurs the co-culture step is critical; high temperatures make the bacteria losing their virulence, and the transfer of genetic information into plant cells does not release. Afterwards, excess of Agrobacterium should be eliminated and putative transgenic explants selected through the use of antibiotic selection agent. Antibiotics are widely used in genetic transformation technology to select transgenic tissues and/or to eliminate Agrobacterium from the cultures when its presence is no longer required. Eliminating A. tumefaciens from cultures is important, because microbial contaminants in cultured plants can reduce multiplication and rooting rates or induce plant death (Estopa et al., 2001). In our experiment, carbenicillin was used to eliminate the Agrobacterium from the medium and kanamycin to select the transgenic plants (Fig. 1). After 7 days of the selection phase, explants developing cotyledonary seedlings are transferred in pot containing a mixture of compost and perlite under greenhouse. Three weeks above, leaves of untransformed plants turn bleaching. Whereas, putative transgenic plants displaying green cotyledons and healthy chlorophyll leaves (Fig. 3G) continued to grow and produced flowers (Fig. 3H), fruits and set seeds whose germination gave thereafter seedlings, showing thus intact fertility.
2.5. DNA molecular analysis To confirm T-DNA delivery inside the kenaf genome, genomic DNA was extracted from leaves of 3–4 months old putative transgenic kenaf plants cultivated under greenhouse and analyzed by the Polymerase Chain Reaction (PCR). As control leaves from untransformed plants were sampled with the same procedure. Genomic DNA was extracted using Zymo RESEARCH kit according to the manufacturer’s instructions. PCR was performed using specific primers for VvWRKY2 genes and those for P35S/TerNos universal primers and PCR conditions are described in Table 1. PCR products were then analyzed using electrophoresis on 1% agarose gel stained with 2% ethidium bromide. 2.6. Germination kanamycin resistance assay The antibiotic resistance of transgenic plants was determined by seed germination in the presence of an antibiotic. Kanamycin was used to assay the germination of seed T0 and T1 progeny transformed by A. tumefaciens harboring the binary vector. Sterile seeds from each line were placed on perlite filled pots and irrigated with distilled water solution of kanamycin (50 μg/ml) under greenhouse conditions. Sensitivity of the treated plants to the kanamycin (50 μg/ml) resistance was investigated 10 days after culture. 2.7. Determination of transformation efficiency The transformation efficiency was determined by counting the successfully transformed seedlings based on positive PCR tested sample per total number of experimentally transformed seeds. The effect of Table 1 Primers and PCR conditions used in this study. Genes
Primers (5′- 3′)
PCR condition and amplicon size
P35S TerNos
F: GGAAAGGCCATCGTTGAAGA R: TCATCGCAAGACCGGCAACA
VvWRKY2 VvWRKY2
F: AAGTAATATTGATCAATGGCTGAA R: GATATTCTACATCGCCTTGCC
95 °C for 2 min, followed by undergoing 35 cycles of 94 °C for 1 min, 62 °C for 40 s, 72 °C for 1 min 45 s, followed by 72 °C for 7 min (1.65Kb) 94 °C for 2 min, followed by undergoing 35 cycles of 94 °C for 1 min, 58 °C for 40 s, 72 °C for 1 min 45 s, followed by 72 °C for 10 min (1.63 Kb)
3.2. Effect of acetosyringone on the efficiency of genetic transformation The acetosyringone is known to activate the Agrobacterium tumefaciens virulence genes, thereby triggering the different stages leading to the transfer of genetic information to target plant cells. It is frequently used in the context of plant genetic transformation protocols (Bettany 276
Industrial Crops & Products 113 (2018) 274–282
M. Hanana et al.
Fig. 2. Procedure for genetic transformation of mature seeds of kenaf.
grow in pots under ambient conditions until maturity. The result in Table 2 shows that acetosyringone improved significantly the transformation efficiencies. In fact, the concentration of 100 μM acetosyringone improved significantly transformation efficiency with 72% of germination capacity of putative transgenic seed. Interestingly, the transformation efficiency decreased when the concentrations of acetosyringone are low or high, respectively 50 and 150 μM. Thus, the annulations of the mean number of germinated seed caused by the hypersensitivity response of explants to acetosyringone. This suggests that acetosyringone can be used to obtain significant improvements in transformation and the concentration of 100 μM is the most favorable to direct genetic transformation of mature seeds of kenaf.
Table 2 Effect of acetosyringone concentration on the efficiency of transformation. Concentration of acetosyringone (μM)
Germination capacity (%) Plants with light green cotyledons (%) Plants with yellow cotyledons (%) Plants with yellow cotyledons (%) Transformation frequency (%) after 1 month of selection
0 0d 0c
50 0d 0c
100 72b 32b
150 7,5c 0,44c
Control 100a 98a
0c 0c 0b
0c 0c 0b
24a 16a 6a
4,88b 2,22b 0b
1c 1b 0b
*Means followed by the same letter are not significantly different at 5% level by Duncan’s Test.
3.3. Plant transformation and recovery of transformants et al., 2003; Ernandes et al., 2015). In order to improve the genetic transformation rate of Hibiscus cannabinus L. by Agrobacterium tumefaciens, we studied the effect of different acetosyringone doses at the time of inoculation of the explants and the co-culture medium. For mature seeds inoculation, the bacterial suspension was added 2 h before inoculation with acetosyringone at different doses for activating the virulence genes of the Agrobacterium strain. Subsequently, the explants were placed in the co-culture medium supplemented with the same doses of the acetosyringone. After 1 day of the co-culture, the bacteria were removed with an appropriate antibiotic. The explants were then cultured in Petri dish containing a sterile perlite soaked by a MS/2 solution with kanamycin (50 μg/ml) to select putative transformed plants. The levels of acetosyringone (0, 50, 100, and 150 μM) were used in the inoculation and the co-cultivation medium for observing its effect on transformation capacity. The data was obtained from the germination rate of transformed seed of kenaf was calculated 7 days after the end of the first stage of selection. The state of the cotyledons transformed plants was obtained after one week of cultivation on the selective medium. After one month of selection by kanamycin under greenhouse we calculated the explants survival rates can continue to
Discrimination between transformed explants and non-transformed is based on their resistance to a selective agent (i.e. antibiotic, herbicide). For instance, we use an early selection of transformed seed in germinal stage with selective antibiotic: kanamycin in the irrigation solution. After 7 days of cultivation in Petri dish, mature kenaf seeds cocultivated with Agrobacterium started to germinate but on selection medium, they lacked chlorophyll, staying etiolated for one week. The transformed plants started turning green after 10 days on selection medium and developed thereafter in green healthy plants. The cultivated embryos produced plants in 30 days of culture on selection medium containing 50 μg/ml of kanamycin. Only putative transformants grew well on the selective medium containing lethal dose of kanamycin. Non-transformed embryos did not germinate, becoming bleached rapidly and dying. The percentage of germinated seedling is significantly about 72% and the rate of plant with green cotyledons is 32%. The frequency transformation is expressed as a percentage of explants resistant after one month of selection by kanamycin and related to the number of explant cultured (Table 1). The results indicate that the frequency of transformation is decreased significantly for both 277
Industrial Crops & Products 113 (2018) 274–282
M. Hanana et al.
Fig. 3. Agrobacterium-mediated transformation of mature seeds of kenaf. (A) Brown cotyledons treated with 50 μM acetosyringone. (B) Yellow cotyledons treated with 100 and 150 μM acetosyringone. (C) Light green cotyledons treated with 100 μM acetosyringone. (D) Control seedling. (E) Transgenic putative plant after selection kanamycin solution. (F) Selected transgenic plant formed a novel leaf after 10 days. (G) Transfert to transgenic plant in pot. (H) Flowering of transgenic plant.
seedlings is obtained from the explants treated with 100 μM of acetosyringone. After second selection step by the same dose of kanamycin in greenhouse condition we obtained the vigorous and resistant plants. In the other hand, untransformed control seeds germinate quickly and produce seedlings with chlorophyll green cotyledons (Fig. 3D), but those who are treated with a solution of half MS strength supplemented with kanamycin (50 μg/ml) showed yellow and vitrified cotyledons whose died 10 days later. It can be concluded that the genetic transformation has affected seed germination and the variability of germination capacity, and efficiency of genetic transformation is related to different parameters such as the presence of excess Agrobacterium in the medium, the low or higher concentration of acetosyringone to activate the virulence gene of bacteria and the use of selective antibiotic which can inhibit germination and plant growth (Fig. 3).
concentrations of acetosyringone 50 and 150 μM. Furthermore, the transformation frequency is about 0.4% for all experimental tests used, against, it is 6% for the case of explants optimized protocol where the dose acetosyringone used is 100 μM. The observation of the transformed explants of different experiments shows different aspect of cotyledons, we noticed the presence of three types of appearance following the transformation cotyledons: brown and much withered cotyledons that do not resist the antibiotic concentration selection (Fig. 3A), yellow cotyledons that lacked chlorophyll and etiolated recent eventually die a few days of cultivation (Fig. 3B). Other of explants whose are clear green color (Fig. 3C) develop chlorophyll green seedlings after one week of their transfer in pot under greenhouse condition on selection medium (Fig. 3E) and subsequently developed a healthy plants having formed the first young green leaf (Fig. 3F). The result of Table 1 shows that the highest significantly rate of green cotyledons 278
Industrial Crops & Products 113 (2018) 274–282
M. Hanana et al.
Fig. 4. Molecular analysis of transgenic and nontransgenic kenaf plants. (A) PCR detection with P35S primers. (B) PCR detection withVvWRKY2 primers. M: 1 kb DNA Ladder. Ti: DNA of transgenic line i. WT: control DNA (wild type)
Fig. 5. Recovery of plants under test germination kanamycin resistant.
conditions (Fig. 4). This allowed us to confirm the stability of the integration of the transgene VvWRKY2 in the genome of the three lines of transgenic kenaf lines.
3.4. Confirmation of transgenic plants through PCR amplification Putative transgenic plants were PCR assayed to confirm the stable integration of the transgene VvWRKY2. In this case, leaves extracts of three transgenic lines (T1, T2, and T3) and wild type (WT) were subjected to a PCR using the specific primers for the transgene (P35S and VvWRKY2 gene). The size of the amplified sequences (1.6 Kb) was estimated using the 1Kb molecular weight markers. Multiple PCR amplification results showed at P35S (Fig. 4A) and VvWRKY2 (Fig. 4B) genes were detected the presence of a band corresponding well to the size of the transgene VvWRKY2 (1.6 Kb). The DNA from the wild-type (WT), used as a negative control, gave no amplification under the same
3.5. Selection of kanamycin-resistant transformants In this study, success of Agrobacterium-mediated transformation was also found to be related to the addition of acetosyringone to the coculture medium. For this deed, to test the reliability of the selection protocol, it was applied to seeds derived from the transformation of kenaf with a construct containing VvWRKY2gene. The construct was inserted into the binary vector pGreen containing the nptII selectable 279
Industrial Crops & Products 113 (2018) 274–282
M. Hanana et al.
Fig. 6. Comparison of sensitivity to kanamycin. (A) wild type (WT). (B) PCR-positive transgenic plants.
Agrobacterium is targeted to the wounded apical meristem of the differentiated seed embryo. Therefore, Agrobacterium tumefaciens transfers the gene into the genome of diverse cells which are already destined to develop into specific organs, and the meristematic cells still to be differentiated (Keshamma et al., 2008). In our experiment we represent a first report of H. cannabinus on the direct transformation from mature seed using explants. The is an alternative procedure as that transgene can go without tissue culture steps and generate large numbers of transgenic plants rapidly. In the current study, we have optimized a simple and rapid protocol to infect seed via Agrobacterium tumefaciens without processing wounding. Moreover, we have tested the effect of different concentrations of acetosyringone on the efficiency of transformation, and we have used kanamycin which is one of the most widely used selection agents for plant transformation to eliminate Agrobacterium in transgenic plants that is a pre-requisite in preventing the possibility of gene release when these plants are transferred to the soil. The result showed that the best capacity of putative transformation seedling is 72% at the concentration of 100 μM which is the best frequency of transformation (6%) in all the experiment uses. In the same context, Tian Zi et al. (2010) developed transgenic cotton plants by inoculating pistil drip into a solution of Agrobacterium and got transformation efficiency of 0.46 to 0,93%. Keshamma et al. (2008) developed an in planta transformation using apical meristem of the differentiated embryo of the germinating seedling (cotton seed). The efficiency of transformation in any crop using in planta transformation depends on a number of factors, and standard percentage efficiency cannot be set for any crop or experiment (Kumar et al., 2009). On the other hand, a very low frequency (1.6%) of explants showed the expression when acetosyringone was excluded from the co-cultivation medium, while no GUS expression was observed. These results suggest that even if acetosyringone is not essential for successful transformation, its inclusion in co-cultivation medium may influence the transformation frequency. This observation supports earlier works in a number of species showing that the addition of acetosyringone during co-cultivation increases the number of transformed cells in the target tissues (Ashok et al., 2007; Wu et al., 2003). In contrast, the vir gene induction treatments to enhance the transformation efficiency involved the use of tobacco leaf extract and acetosyringone. The use of Agrobacterium previously treated with acetosyringone (100 μM) did not have any effect on the transformation efficiency. Transformation efficiency is influenced by several factors, including Agrobacterium strain, addition of phenolic compounds (e.g. acetosyringone) in the co-cultivation medium, wounding treatment of target tissue (Afolabi-Balogun et al., 2014), and appropriate selection of transformed cells or tissue from majority of untransformed tissue. Indeed, our genetic transformation efficiency of 6% is also higher than 5.03% reported by Pavingerová and Ondrej, (1995) in the seed transformation obtained from Arabidopsis
marker, and transferred into mature kenaf. There is a statistically significant difference between the germination rate between wild type seeds and transgenic seeds both imposing kanamycin selection (Fig. 5). When wild-type and kanamycin-resistant seedlings growing on perlite containing kanamycin (50 μg/ml) were examined after 10 days period. Explants for kanamycin-resistant transformants can accumulate chlorophyll and continue to grow normally. However, non-transformants failed to accumulate chlorophyll and they remained pale, with either closed or unexpanded cotyledons (Fig. 6A). Transformants had green, open, expanded cotyledons (Fig. 6B). The presence of kanamycin selection produced green transformants that were easily distinguished from yellow non-transformants on medium containing kanamycin. These plants nevertheless showed healthy growth, flowered, and set seeds in due course. The seeds of T0 generation also showed rapid germination, and the T1 plants showed normal growth and vigour. Transgenic plants could be produced by seed transformation method, and the genetic characteristics (i.e. kanamycin resistance marker and VvWYRKY2 transgene) transmitted to the T1 progeny.
4. Discussion The genetic transformation procedure involves incorporation of the gene of interest into the plant genome and regeneration of the transformed cells into whole transgenic plants. The success of the genetic engineering technique depends mainly on the stability of the transgenes over a long period of time. Genetic manipulation of kenaf has been tried in the last 15 years. Although, Banks et al. (1993) were the first to report the expression of transgenes in kenaf callus; they did not achieve any shoot regeneration from calli (Herath et al., 2005) in vitro agroinfected kenaf seedling shoot tips, obtaining few stable transformants. Ruotolo et al. (2011), proposed a meristematic cell from mature embryos as target for genetic modification driven by Agrobacterium tumefaciens. All this experiments depend on tissue culture system, and for which calli were unable to differentiate in transgenic tissues. However, in planta transformation protocols are advantageous over other methods because they do not involve regeneration procedures, and therefore the tissue culture-induced somaclonal variations are avoided. Such in planta transformation techniques have also been standardized in other crops like wheat (Supartana et al., 2006), rice (Supartana et al., 2005), buckwheat (Supartana et al., 2006), kenaf (Kojima et al., 2004; Samanthi Priyanka Withanage et al., 2015), and mulberry (Ping et al., 2003). In all the crops, Agrobacterium is directed towards either the apical meristem or the meristems of axillary buds. One such viable in planta transformation protocol has also been standardized for other crops (Rohini and Sankara Rao, 2000a, 2000b, 2001). The strategy essentially involves in planta inoculation of embryo axes of germinating seeds and allowing them to grow into seedlings ex vitro. In this method, 280
Industrial Crops & Products 113 (2018) 274–282
M. Hanana et al.
thaliana by this transformation method and further found that the genetic characteristic (kanamycin resistance marker) can transmit into T2 and T3 progeny (Harrison et al., 2006).
Kojima, M., Shioiri, H., Nogawa, M., Nozue, M., Matsumoto, D., Wada, A., Saiki, Y., Kiguchi, K., 2004. In planta transformation of kenaf plants (Hibiscus cannabinus var. aokawa N°. 3) by Agrobacterium tumafaciens. J. Biosci. Bioeng. 98, 136–139. Kumar, M.A., Reddy, K.N., Rohini, S., Ganeshan, G., Udayakumar, M., 2009. Towards crop improvement in bell pepper (Capsicum annuum L.): Transgenics (uid A:hpt II) by a tissue-culture independent Agrobacterium-mediated in planta approach. Sci. Hortic. 119, 362–370. Murashige, T., Skoog, F., 1962. A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol. Plant. 15, 473–497. Mzid, R., Marchive, C., Blancard, D., Deluc, L., Barrieu, F., Corio-Costet, M.F., Drira, N., Hamdi, S., Lauvergeat, V., 2007. Overexpression of VvWRKY2 in tobacco enhances broad resistance to necrotrophic fungal pathogens. Physiol. Plant. 131, 434–447. Niu, X., Qi, J., Chen, M., Zhang, G., Tao, A., Fang, P., Xu, J., Onyedinma, S.A., Su, J., 2015. Reference genes selection for transcript normalization in kenaf (Hibiscus cannabinus L.) under salinity and drought stress. PeerJ 3, e1347. http://dx.doi.org/10. 7717/peerj.1347. Pandey, S.P., Somssich, I.E., 2009. The role of WRKY transcription factors in plant immunity. Plant Physiol. 150, 1648–1655. Pavingerová, D., Ondrej, M., 1995. Improvement of Arabidopsis thaliana seed transformation efficiency. Biol. Plant. 37, 467–471. Peng, R.H., Yao, Q.H., Xiong, A.S., Cheng, Z.M., Li, Y., 2006. Codon modifications and an endoplasmic reticulum-targeting sequence additively enhance expression of an Aspergillus phytase gene in transgenic canola. Plant Cell Rep. 25, 124–132. Ping, L.X., Nogawa, M., Nozue, M., Makita, M., Takeda, M., Bao, L., Kojima, M., 2003. Transformation of mulberry trees (Morus alba L.) by Agrobactetium tumefaciens. J. Insect Biotechnol. Sericol. 72, 177–184. Ponstein, A.S., Bade, J.B., Verwoerd, T.C., Molendijk, L., Storms, J., Beudeker, R.F., Pen, J., 2002. Stable expression of Phytase (phy A) in canola (Brassica napus) seeds: towards a commercial product. Mol. Breed. 10, 31–44. Rakoczy-Trojanowska, M., 2002. Alternative methods of plant transformation a short review. Cell. Mol. Biol. Lett. 7, 849–858. Rohini, V.K., Sankara Rao, K., 2000a. Transformation of peanut (Arachis hypogeae L.): a non-tissue culture based approach for generating transgenic plants. Plant Sci. 150, 41–49. Rohini, V.K., Sankara Rao, K., 2000b. Embryo transformation, a practical approach for realizing transgenic plants of safflower (Carthamus tinctorius L.). Ann. Bot. 86, 1043–1049. Rohini, V.K., Sankara Rao, K., 2001. Transformation of peanut (Arachis hypogaea L.) with tobacco chitinase gene: variable response of transformants to leaf spot disease. Plant Sci. 160, 883–892. Roy Choudhury, A., Gupta, B., Sengupta, D.N., 2008. Trans-acting factor designated OSBZ8 interacts with both typical abscisic acid responsive elements as well as abscisic acid responsive element-like sequences in the vegetative tissues of indica rice cultivars. Plant Cell Rep. 27, 779–794. Ruotolo, G., Toro, A.D., Chiaiese, P., Filippone, E., 2011. Multiple buds are an alternative target to genetic manipulation of kenaf (Hibiscus cannabinus L.). Ind. Crops Prod. 34, 937–942. Samanthi Priyanka Withanage, S.P., Hossain, M.A., Kumar, S., Roslan, H.A.B., Abdullah, M.P., Napis, S.B., Shukor, N.A.A., 2015. Overexpression of Arabidopsis thaliana gibberellic acid 20 oxidase (AtGA20ox) gene enhance the vegetative growth and fiber quality in kenaf (Hibiscus cannabinus L.) plants. Breed. Sci. 65, 177–191. http://dx. doi.org/10.1270/jsbbs.65.177. Sarmah, B.K., Moore, A., Tate, W., Molvig, L., Morton, R.L., Rees, D.P., Chiaiese, P., Chrispeels, M.J., Tabe, L.M., Higgins, T.J.V., 2004. Transgenic chickpea seeds expressing high levels of a bean α-amylase inhibitor. Mol. Breed. 14, 73–82. Song, L., Zhao, D.G., Wu, Y.J., Li, Y., 2008. Transient expression of chicken alpha interferon gene in lettuce. J. Zhejiang Univ. 9, 351–355. Song, L., De-gang Zh Yong-jun, W., Xiaoe, T., 2009. A simplified seed transformation method for obtaining transgenic Brassica napus plants. Agric. Sci. China 8, 658–663. Song, G.Q., Walworth, A., Hancock, J.F., 2012. Factors influencing Agrobacterium-mediated transformation of switch grass cultivars. Plant Cell Tissue Org. Cult. 108, 445–453. Srivatanakul, M., Park, S.H., Salas, M.G., Smith, R.H., 2001. Transformation parameters enhancing T-DNA expression in kenaf (Hibiscus cannabinus). J. Plant Physiol. 158, 255–260. Supartana, P., Shimizu, T., Shioiri, H., Nogawa, M., Nozue, M., Kojima, M., 2005. Development of simple and efficient in planta transformation method for rice (Oryza sativa L.) using Agrobacterium tumefaciens. J. Biosci. Bioeng. 100, 391–397. Supartana, P., Shimizu, T., Nogawa, M., Shioiri, H., Nakijima, T., Haramoto, N., Nozue, M., Kojima, M., 2006. Development of simple and efficient in Planta transformation method for wheat (Triticum aestivum L.) using Agrobacterium tumefaciens. J. Biosci. Bioeng. 102, 162–170. Tian Zi, Ch., Wu, Sh.J., Zhao, J., Guo, W.Zh., Zhang, T.Zh., 2010. Pistil drip following pollination: a simple in planta Agrobacterium-mediated transformation in cotton. Biotechnol. Lett. 32, 547–555. Venkatachalam, P., Gheeta, N., Khandelwal, A., Shaila, M.S., Lakshmi Sita, G., 2000. Agrobacterium mediated genetic transformation from cotyledonary explants of groundnut (Arachis hypogeae L.) via somatic embryogenesis. Curr. Sci. 78, 1130–1136. Wang, X., Guo, R., Tu, M., Wang, D., Guo, C., Wan, R., Li, Z., Wang, X., 2017. Ectopic expression of the wild grape WRKY transcription factor VqWRKY52 in arabidopsis thaliana enhances resistance to the biotrophic pathogen powdery mildew but not to the necrotrophic pathogen botrytis cinerea. Front. Plant Sci. 8, 97. Wielgus, K., Szalata, M., Słomski, R., 2012. Genetic engineering and biotechnology of natural textile fiber plants. In: Ryszard Kozłowski, M. (Ed.), Handbook of Natural Fibres, pp. 550–575 (Chap. 17).
5. Conclusion It can be concluded from the present study that the transgenic kenaf plants can be obtained by Agrobacterium mediated transformation, and transgene stability confirmed for F0 generations so it is necessary to confirm that on the other generation. This method therefore is advantageous because it avoids the need for tissue culture. This method is relatively fast, simple, and economical, as well as easy to apply in plant genetic transformation. This is the first report of kenaf seed transformation using mature seed explants, and therefore it is interesting to preserve the transgenic plants for a large scale by in vitro propagation method to study the overexpression of VvWRKY2 gene. References Afolabi-Balogun, N.B., Inuwa, H.M., Ishiyaku, M.F., Bakare-Odunola, M.T., Nok, A.J., Adebola, P.A., 2014. Effect of acetosyringone on Agrobacterium-mediated transformation of cotton. ARPN J. Agric. Biolo. Sci. 9, 284–286. Amato, A., Cavallini, E., Zenoni, S., Finezzo, L., Begheldo, M., Ruperti, B., Tornielli, G.B., 2017. A grapevine TTG2-Like WRKY transcription factor is involved in regulating vacuolar transport and flavonoid biosynthesis. Front. Plant Sci. 7, 1979. Ashok, K.Sh., Dir, k.B., Lorz, H., 2007. Agrobacterium tumefaciens-mediated genetic transformation of barley (Hordeum vulgare L.). Plant Sci. 172, 281–290. Ayadi, R., Hamrouni, L., Hanana, M., Bouzid, S., Trifi, M., Khouja, M.L., 2011. In vitro propagation and regeneration of an industrial plant kenaf (Hibiscus cannabinus L.). Ind. Crops Prod. 33, 474–480. Ayadi, R., Hanana, M., Mzid, R., Hamrouni, L., Khouja, M.L., Salhi Hanachi, A., 2017. Hibiscus cannabinus L. −Kenaf: a review paper. J. Nat. Fibers 14, 466–484. http://dx. doi.org/10.1080/15440478.2016.1240639. Banerjee, A., Roychoudhury, A., 2015. WRKY proteins: signaling and regulation of expression during abiotic stress responses. Sci. World J. 807560, 17 Article ID. Banks, S.W., Gossett, D.R., Lucas, M.C., Millhollon, E.P., Lacelle, M.G., 1993. Agrobacterium-mediated transformation of kenaf (Hibiscus cannabinus L.) with the bglucoronidase (GUS) gene. Plant Mol. Biol. Rep. 11, 101–104. Bartels, D., Sunkar, R., 2005. Drought and salt tolerance in plants. Crit. Rev. Plant Sci. 24, 23–58. http://dx.doi.org/10.1080/07352680590910410. Bettany, A.J.E., Dalton, S.J., Timms, E., Manderyck, B., Dhanoa, M.S., Morris, P., 2003. Agrobacterium tumefaciens-mediated transformation of Festuca arundinacea (Schreb.) and Lolium multiflorum (Lam.). Plant Cell Rep. 21, 437–444. Chen, L., Song, Y., Li Sh Zhang, L., Zou Ch Yu, D., 2012. The role of WRKY transcription factors in plant abiotic stresses. Biochim. Biophys. Acta 1819, 120–128. Das, B., Goswami, L., Ray, S., Ghosh, S., Bhattacharyya, S., Das, S., Majumder, A.L., 2006. Agrobacterium-mediated transformation of Brassica juncea with a cyanobacterial (Synechocystis PCC6803) delta-6 desaturase gene leads to production of gammalinolenic acid. Plant Cell Tissue Org. Cult. 86, 219–231. Ernandes, M., Yamazaki, L.E., Grando, M.F., Roesler, E.A., 2015. Acetosyringone, pH and temperature effects on transient genetic transformation of immature embryos of Brazilian wheat genotypes by Agrobacterium tumefaciens. Genet. Mol. Biol. 38, 470–476. Estopa, M., Marfa, V., Melec, E., Messeguer, J., 2001. Study of different antibiotic combinations for use in the elimination of Agrobacterium with kanamycin selection in carnation. Plant Cell Tissue Org. Cult. 65, 211–220. Eulgem, T., Rushton, P.J., Robatzek, S., Somssich, I.E., 2000. The WRKY superfamily of plant transcription factors. Trends Plant Sci. 5, 199–206. Guillaumie, S., Mzid, R., Méchin, V., Léon, C., Hichri, I., Destrac-Irvine, A., TrossatMagnin, C., Delrot, S., Lauvergeat, V., 2010. The grapevine transcription factor WRKY2 influences the lignin pathway and xylem development in tobacco. Plant Mol. Biol. 72, 215–234. Guo, C., Guo, R., Xu, X., Gao, M., Li, X., Song, J., Zheng, Y., Wang, X., 2014. Evolution and expression analysis of the grape (Vitis vinifera L.) WRKY gene family. J. Exp. Bot. 65, 1513–1528. http://dx.doi.org/10.1093/jxb/eru007. Harrison, S.J., Mott, E.K., Parsley, K., Aspinall, S., Gray, J.C., Cottage, A., 2006. A rapid and robust method of identifying transformed Arabidopsis thaliana seedlings following floral dip transformation. Plant Methods 19, 1–7. http://dx.doi.org/10.1186/ 1746-4811-2-19. Herath, S.P., Suzuki, T., Hattori, K., 2005. Factors influencing Agrobacterium mediated genetic transformation of kenaf. Plant Cell Tissue Org. Cult. 82, 201–206. Johnson, C.S., Kolevski, B., Smyth, D.R., 2002. Transparent testa Glabra2, a trichome and seed coat development gene of Arabidopsis, encodes a WRKY transcription factor. Plant Cell 14, 1359–1375. Keshamma, E., Rohini, S., Rao, K.S., Madhusudhan, B., Udaya Kumar, M., 2008. Tissue culture-independent in planta transformation strategy: an Agrobacterium tumefaciensmediated gene transfer method to overcome recalcitrance in cotton (Gossypium hirsutum L.). J. Cotton Sci. 12, 264–272. Keshk, S., Suwinarti, W., Sameshima, K., 2006. Physicochemical characterization of different treatment sequences on kenaf bast fiber. Carbohydr. Polym. 65, 202–206.
281
Industrial Crops & Products 113 (2018) 274–282
M. Hanana et al.
Mol. Biol. Rep. 24, 255a. Zhang, H., Zhao, M., Song, Q., Zhao, L., Wang, G., Zhou, C., 2016. Identification and function analyses of senescence-associated WRKYs in wheat. Biochem. Biophys. Res. Commun. 474, 761–767. Zou, X., Seemann, J.R., Neuman, D., Shen, Q.J., 2004. A WRKY gene from creosote bush encodes an activator of the abscisic acid signaling pathway. J. Biol. Chem. 279, 55770–55779.
Wu, H., Sparks, C., Amoah, B., Jones, H.D., 2003. Factors influencing successful Agrobacterium-mediated genetic transformation of wheat. Plant Cell Rep. 21, 659–668. Zhang, Y., Feng, J.C., 2014. Identification and characterization of the grape WRKY family. BioMed. Res. Int. 2014, 1–14. http://dx.doi.org/10.1155/2014/787680. Zhang, Y.X., Xu, J., Hua, L., Wei, W., Guan, Z.Q., Lin, C., Chai, T.Y., 2006. Efficient shoot regeneration and Agrobacterium-mediated transformation of Brassica juncea. Plant
282