Efficient methods for sample processing and cDNA synthesis by RT-PCR for the detection of grapevine viruses and viroids

Journal of Virological Methods 134 (2006) 244–249

Efficient methods for sample processing and cDNA synthesis by RT-PCR for the detection of grapevine viruses and viroids Ryoji Nakaune ∗ , Masaaki Nakano Department of Grape and Persimmon Research, National Institute of Fruit Tree Science, National Agriculture and Bio-oriented Research Organization, Akitsu 301-2, Higashi-hiroshima, Hiroshima 729-2494, Japan Received 4 August 2005; received in revised form 18 January 2006; accepted 19 January 2006 Available online 28 February 2006

Abstract Template preparation is important in reverse-transcription polymerase chain reaction (RT-PCR)-based detection methods. A TissueLyser with tungsten carbide beads was used for simultaneous processing of up to 48 samples under the same conditions in the development of a simple and rapid procedure to prepare a plant extract for RT reaction. A sandpaper method was also developed by which wood tissue of dormant cuttings could be macerated easily to process with minimal time and effort. It was also demonstrated that the combination use of random primers and oligo dT primer in an RT reaction was efficient for simultaneous cDNA synthesis of viral and viroid RNAs in plant extracts. These template preparation methods were used for the amplification of Grapevine leafroll-associated virus-1,-2, and -3; Grapevine virus A and B; Grapevine rupestris stem pitting-associated virus; Grapevine fleck virus; and Grapevine fanleaf virus. All these viruses tested in this study were reliably detected up to a 103 -fold or higher dilution of the original extract. Besides, Hop stunt viroid and Grapevine yellow speckle viroid 1 were well amplified in the same manner as the template preparation and following PCR for virus detection. These methods would contribute to cost-effective testing of a large number of samples through the year and help to detect viral pathogens in grapevine. © 2006 Elsevier B.V. All rights reserved. Keywords: RT-PCR; TissueLyser; Sandpaper; Template preparation; Grapevine viruses; Viroids

1. Introduction The extent of decrease in quality, yield and vine vigor of grapevine Japanese varieties as a result of viral infection has not yet been determined. Diagnosis is thought to have been inadequate for detection and subsequent study of viral diseases of grapevine. In Japan, enzyme-linked immunosorbent assay (ELISA) has been used to detect a few viruses, such as Grapevine leafroll associated virus (GLRaV)-3, Grapevine fleck virus (GFkV), and Grapevine fanleaf virus (GFLV). Biological assays with indicator plants have also been used for leafroll, rugose wood complex, and fleck. Serological methods are not sensitive enough, whereas biological methods show considerable sensitivity but they require 1–2 years for symptoms to develop, are time consuming, laborious and they require greenhouse facilities. Biological assays for rugose wood, in particular, are slow and require several years before symptoms appear on grapevine tunk. ∗

Corresponding author. Tel.: +81 846 45 4756; fax: +81 846 45 5370. E-mail address: [email protected] (R. Nakaune).

0166-0934/$ – see front matter © 2006 Elsevier B.V. All rights reserved. doi:10.1016/j.jviromet.2006.01.016

Recently, a sensitive method based on RT-PCR has been used for the diagnosis of grapevine viruses (Nolasco, 2003). In most methods based on RT-PCR, purified total RNA or doublestranded RNA (ds-RNA) has been used as the template for cDNA synthesis, which can be easily purified from grapevine materials using affinity chromatography (Mackenzie et al., 1997; Nassuth et al., 2000) and CF11 chromatography (Zhang et al., 1998b; Nolasco et al., 2000), respectively. However, RNA purification requires expensive reagents or time-consuming techniques, and these methods are rather unsuitable for handling a large number of samples. On the other hand, several simplified and rapid sample preparation methods have been developed for the detection of grapevine viruses (Levy et al., 1994; Minafra and Hadidi, 1994). However, the presence of inhibitors such as polyphenols and polysaccharides in the plant extracts often decreases detection sensitivity and different methods have been developed to eliminate their action (Minafra and Hadidi, 1994; Levy et al., 1994; La Notte et al., 1997; Rowhani et al., 2000). Recently, an improved nylon membrane spotting procedure has been used for the efficient removal of inhibitors, which allows the simultaneous detection of vitiviruses, foveaviruses, and closteroviruses

R. Nakaune, M. Nakano / Journal of Virological Methods 134 (2006) 244–249

by a nested RT-PCR using degenerate primers (Dovas and Katis, 2003a,b). As already mentioned, various methods have been devised for viral RNA extraction. Also, a simple and efficient method for processing plant material is an important factor for use of the method in routine diagnosis. Especially, an efficient technique for processing grapevine canes is necessary to detect grapevine viruses during the winter. In addition, cDNA synthesis also significantly affects the sensitivity and reliability of the subsequent PCR amplification. In this work, we describe two techniques for processing grapevine samples, including hard material such as a dormant cutting using the TissueLyser or sandpaper, and an efficient method for simultaneous cDNA synthesis from viral RNAs. 2. Materials and methods 2.1. Grapevine, virus and viroid sources Grapevine cultivars ‘Kyoho’ (Vitis labruscana), ‘Pione’ (V. labruscana), and ‘Neo Muscat’ (Vitis vinifera) were obtained from the vineyard or greenhouse (Department of Grape and Persimmon Research, National Institute of Fruit Tree Science). The cultivars were infected with either one or a combination of the following viruses and viroids: Grapevine leafrollassociated virus-1,-2,-3 (GLRaV-1, GLRaV-2, and GLRaV-3), Grapevine virus A (GVA), Grapevine virus B (GVB), Grapevine rupestris stem pitting-associated virus (GRSPaV), Grapevine fleck virus (GFkV), Hop stunt viroid (HSVd) and Grapevine yellow speckle viroid 1 (GYSVd1). ‘French Colombard’ infected with Grapevine fanleaf virus (GFLV) was obtained from the greenhouse. Petioles from mature leaves and dormant cuttings were obtained in late autumn and in February, respectively. 2.2. Plant extract preparation 2.2.1. TissueLyser method Plant extracts were prepared by modifying the method described previously (Minafra and Hadidi, 1994). About 50 mg of sliced petioles were mixed with 0.3 ml of modified extraction

245

buffer [50 mM sodium citrate pH 8.3, 20 mM diethyldithiocarbamate, and 4% polyvinylpyrrolidone K25, 10 mM dithiothreitol (DTT)] and single tungsten bead (5 mm diameter) in a 2-ml, round-bottom centrifugation tube. Plant material was mechanically disrupted using the TissueLyser system (QIAGEN, Tokyo, Japan) for 30 s at 25 Hz. After a brief centrifugation (4 ◦ C, 2500 × g, 10 s), 0.7 ml extraction buffer was added to the tube and mixed. The crude sap was transferred to a new tube and clarified by centrifugation (4 ◦ C, 10,000 × g, 10 min). The supernatant was then transferred to a new tube, and either used immediately for RT-PCR or stored at −40 ◦ C. 2.2.2. Sandpaper method Bark from dormant cuttings was scraped away with a razor blade to expose wood tissue. The extraction buffer described above (0.2 ml) was put on to a sheet (5 cm × 5 cm) of sandpaper (Abrasive cloth A-P80) (Okada MFG. Co. Ltd., Nara, Japan), and the wood tissue was macerated with the buffer (Fig. 1A). About 100 mg of the paste of macerated tissue (Fig. 1B) was transferred to 1 ml of the extraction buffer in a new centrifugation tube. After centrifugation (4 ◦ C, 10,000 × g, 10 min), the supernatant was used immediately for RT-PCR or stored at −40 ◦ C. 2.3. cDNA synthesis Four microlitres of the clarified plant extract was added to 16 ␮l of 0.5% Triton X-100, and heated at 75 ◦ C for 5 min. Immediately, 1 ␮l of the extraction was added to 9 ␮l of reverse transcription reaction mixture (GeneAmp Gold® RNA PCR Kit) (Applied Biosystems, Tokyo, Japan) containing 1× RT-PCR buffer, 2.5 mM MgCl2 , 0.25 mM each dNTP, 10 mM DTT, 5 units RNase inhibitor, 7.5 units MultiScribeTM Reverse Transcriptase and the following primers: (i) 1.25 ␮M random hexamers (Applied Biosystems), (ii) 1.25 ␮M random hexamers and 0.625 ␮M oligo d(T)16 (Applied Biosystems), (iii) 1.25 ␮M oligo d(T)16 . The RT reaction was carried out according to the following conditions: primer annealing (25 ◦ C for 10 min), cDNA synthesis (42 ◦ C for 20 min), and inactivation of RNase inhibitors (99 ◦ C for 5 min).

Fig. 1. Maceration of wood tissue with the Sandpaper method. Scraping of grapevine wooden tissue on a sandpaper in the presence of extraction buffer (A). A paste of macerated wood tissue (B).

246

R. Nakaune, M. Nakano / Journal of Virological Methods 134 (2006) 244–249

Table 1 PCR primers for the amplification of grapevine viruses and viroids Virus/viroida

Primer

Nucleotide sequence (5 -3 )b

Product size (bp)

Reference

GLRaV-1

LR1-9727U LR1-10019D LR2-12474U LR2-12806D LR3-8033U LR3-8408D GVA-6540U GVA-6880D C410 H28 RSP-up1 RSP-do2 RD1 RD2 M2 M3 HSV-83M HSV-78P PBCVd100C PBCVd194H

TCGTAACGGCCGCTTCAGTA GTTCGTAACGTGCACGGAAG TTGACAGCAGCCGATTAAGCG CTGACATTATTGGTGCGACGG TTACGGCACAAACGCTACCAG CTGGTGTGGTAGAGTAGTTCC TTTGGGTACATCGCGTTGGT TCTAAGCCCGACGCGAAGT GTGCTAAGAACGTCTTCACAGC ATCAGCAAACACGCTTGAACCG TGAGATGGTYGCTAATATCG CTATTAGTACGGTATTCCAG CYCARCAYAARGTVAACGA GCGCATGCABGTSAGRGGG YTRGATTTTAGGCTCAATGG TGYAARCCAGGRAAGAAAAT AACCCGGGGCTCCTTTCTCA AACCCGGGGCAACTCTTCTC AGACCCTTCGTCGACGACGA TGTCCCGCTAGTCGAGCGGA

293

This study

333

This study

376

This study

341

This study

460

Minafra and Hadidi (1994)

242

This study

386

Sabanadzovic et al. (2001)

290

Wetzel et al. (2002)

300

Sano et al. (2001)

220

Sano et al. (2000)

GLRaV-2 GLRaV-3 GVA GVB GRSPaV GFkV GFLV HSVd GYSVd1 a

GLRaV, Grapevine leafroll associated virus; GVA, Grapevine virus A; GVB, Grapevine virus B; GRSPaV, Grapevine rupestris stem pitting-associated virus; GFkV, Grapevine fleck virus; GFLV, Grapevine fanleaf virus; HSVd, Hop stunt viroid; GYSVd1, Grapevine yellow speckle viroid 1. b Y = C + T; R = A + G; V = A + G + C; B = T + C + G; S = G + C.

2.4. PCR amplification of grapevine viruses and viroids

3. Results and discussion

One microlitre of cDNA solution was added to 9 ␮l of PCR mixture (1× PCR buffer, 1.75 mM MgCl2 , 0.2 mM each dNTP and 0.4 units AmpliTaq® Gold DNA polymerase) containing 0.2 ␮M each primer (Table 1) for specific amplification according to the following cycling parameters: pre-activation at 95 ◦ C for 10 min, followed by 43 cycles of denaturation (94 ◦ C for 20 s), primer annealing (56 ◦ C for 20 s), and extension (72 ◦ C for 45 s). The cDNA synthesis and PCR amplification were carried out in a GeneAmp 9700 thermal cycler (Applied Biosystems). PCR products were analyzed by electrophoresis in 1.5% agarose gel, stained with ethidium bromide and visualized with UV light.

3.1. Plant extract preparation

2.5. Sequence analysis of RT-PCR products Primers listed in Table 1 were used for sequencing of amplified fragments. All PCR products were directly sequenced after removal of PCR primers. Sequencing was undertaken by the dideoxynucleotide termination cycle sequencing method using BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems). Both strands of the fragment were sequenced with an ABI PRISM® 3100 Genetic Analyzer (Applied Biosystems). In addition, some of the PCR products were sequenced after cloning into pCR® 4-TOPO® vector using TOPO TA Cloning® Kit (Invitrogen, Tokyo, Japan). The sequences were edited with GENETYX® -MAC Ver.13 (GENETYX Corporation, Tokyo, Japan), and compared for similarity against the sequence database of the DNA Data Bank of Japan (DDBJ) (National Institute of Genetics, Shizuoka, Japan) using the BLAST program.

A simple, rapid, and efficient method for sample processing and cDNA synthesis for RT-PCR detection of grapevine viruses was developed. Maceration of plant tissue in a mortar with a pestle is labor demanding for handling a large number of samples. The TissueLyser is an apparatus which provides high-throughput processing for simultaneous, rapid, and effective disruption of biological samples, including animal, plant tissue, and bacteria. With the TissueLyser method, 48 petiole samples could be processed simultaneously by vigorous shaking with a 5-mm tungsten bead. Additionally, cross-contamination at the sample processing stage is prevented by processing each sample in a different tube. However, dormant cuttings were not macerated well with the TissueLyser method. An efficient method to macerate a hard material such as canes is necessary to diagnose virus or viroid disease throughout the year. Therefore, we devised a sandpaper method for processing dormant cuttings and we were able to prepare an extract quickly and efficiently (Fig. 1). Moreover, sandpaper is cheap and disposable, reducing the cost of sample preparation and preventing cross-contamination during sample processing. Grapevine extracts prepared by these methods could be stored at −40 ◦ C for a long period, and could be also used for sample preparation for ELISA (data not shown). 3.2. cDNA synthesis and PCR amplification of grapevine viruses and viroids Another important aspect of this study was the improvement of cDNA synthesis. By using random primers together with oligo

R. Nakaune, M. Nakano / Journal of Virological Methods 134 (2006) 244–249

247

Fig. 2. Comparison of the detection sensitivity of grapevine viruses from cDNAs synthesized with different primers. RT-PCR products were obtained from grapevine extracts prepared by the TissueLyser method. Lane 1 is the RT-PCR product from 10-fold dilution of virus-infected grapevine extracts in the extraction buffer. Lanes 2–7 indicate two-fold dilutions of virus-infected grapevine extracts, starting from 2 × 102 dilution. M: 100 bp DNA ladder marker (New England Biolabs, MA, USA). C: 10-fold dilution of healthy control.

dT primer in RT reaction, it was efficient synthesize simultaneously cDNA from viral RNAs. Fig. 2 shows typical results of an amplification of grapevine viruses from three types of RT product from grapevine extract prepared by the TissueLyser method. GLRaV-1 and GLRaV-3 do not have a poly-A tail at the 3 terminal of their genome (Fazeli and Rezaian, 2000; Ling et al., 1998), and oligo dT primer was thought not to be efficient in cDNA synthesis of these viruses. However, contrary to our expectations, GLRaV-1 was amplified from a cDNA synthesized with oligo dT primer. In GLRaV-1 (AF195822), adenine rich sequences were found at positions 11,183–11,190 (aaaagaaaa), 12,075–12,088 (aagaaaagaaataa), and 12,315–12,344 (aaaataaaaccaaaataaaataaaataaaa), and it is possible that the cDNA was synthesized by oligo dT primer from these adenine rich sequences. Similar results were obtained occasionally by amplification of GLRaV-3 from cDNA synthesized with oligo dT primer (data not shown). On the other hand, oligo dT primer was remarkably efficient for the amplification of GVA, GVB and GRSPaV (Fig. 2). These viruses have poly-A tail in the 3 termi-

nal (Minafra et al., 1994; Meng et al., 1998; Zhang et al., 1998a). Besides, PCR primers for these viruses were designed for the sequences close to the 3 terminal. Therefore, the oligo dT primer would be more suitable for cDNA synthesis from these viral RNAs than random primers. GLRaV-2, GFkV and GFLV were amplified efficiently from all types of cDNA (Fig. 2) as GLRaV-2 has an adenine rich sequence in the 3 terminal (AF039204, Zhu et al., 1998), whereas both GFkV and GFLV have a poly-A tail at the 3 terminal (Sabanadzovic et al., 2001; Ritzenthaler et al., 1991). In amplification of these viruses, because PCR primers were designed at a position 2–3 kb from the 3 terminal, these viruses were amplified efficiently from cDNA synthesized with either primer. By using random primers and oligo dT primer simultaneously in RT-reaction, all viruses tested were detected clearly in a 103 -fold or higher dilution of the original extract, and amplified fragments were confirmed as viral sequences. The sequences were submitted to the DDBJ database under the accession numbers: GLRaV-1 (AB222849, AB222850), GLRaV-2 (AB222851, AB222852), GLRaV-3 (AB222853, AB222854),

248

R. Nakaune, M. Nakano / Journal of Virological Methods 134 (2006) 244–249

References

Fig. 3. Agarose gel electrophoretic analysis of RT-PCR products of HSVd and GYSVd1. The cDNA was synthesized with random hexamers and oligo d(T)16 from grapevine extracts prepared by the TissueLyser method. Lanes 1–7 indicate two-fold dilutions of viroid-infected grapevine extracts in the extraction buffer, starting from 10-fold dilution. M: 100 bp DNA ladder marker (New England Biolabs). C: 10-fold dilution of healthy control.

GVA (AB222855, AB222856), GVB (AB222857), GRSPaV (AB222858, AB222859), GFkV (AB222860, AB222861), and GFLV (AB222862). No significant difference was observed in the detection obtained by the sandpaper method and by the TissueLyser method (data not shown). Five grapevine viroids, HSVd, Citrus exocortis viroid (CEVd), GYSVd1, GYSVd2, and Australian grapevine viroid (AGVd) have been reported to occur worldwide (Sano et al., 1985; Garcia-Arenal et al., 1987; Koltunow and Rezaian, 1988, 1989; Koltunow et al., 1989; Rezaian, 1990; Little and Rezaian, 2003). In Japan, HSVd, GYSVd1 and AGVd have been detected from commercial grapevines plantations (Sano et al., 1985, 2000, 2004). In this study, HSVd and GYSVd1 were amplified in PCR using primer pair HSV83H-HSV78P (Sano et al., 2001) and PBCV100C-PBCV194H (Sano et al., 2000), respectively. The HSVd and GYSVd1 sequences were submitted to the DDBJ database under accession numbers AB222864 and AB222865, respectively. By using the same method for grapevine virus detection, these viroids were amplified in a 102 -fold or higher dilution of original extract (Fig. 3). In conclusion, the TissueLyser and the sandpaper sample processing methods would allow the use of PCR for large-scale virus and viroid testing. Additionally, the cDNA synthesis method described in this article was efficient for simultaneous cDNA synthesis from viral RNAs. Acknowledgement We thank Dr. Teruo Sano (Faculty of Agriculture and Life Science, Hirosaki University, Hirosaki, Japan) for providing helpful information about PCR-based detection of HSVd and GYSVd1. This work was partially supported by NARO Research Project No. 166 ‘Establishment of Agricultural Production Technologies Responding to Global Warming’.

Dovas, C.I., Katis, N.I., 2003a. A spot nested RT-PCR method for the simultaneous detection of members of the Vitivirus and Foveavirus genera in grapevine. J. Virol. Meth. 107, 99–106. Dovas, C.I., Katis, N.I., 2003b. A spot multiplex nested RT-PCR for the simultaneous and generic detection of viruses involved in the aetiology of grapevine leafroll and rugose wood of grapevine. J. Virol. Meth. 109, 217–226. Fazeli, C.F., Rezaian, M.A., 2000. Nucleotide sequence and organization of ten open reading frames in the genome of grapevine leafroll-associated virus 1 and identification of three subgenomic RNAs. J. Gen. Virol. 81, 605–615. Garcia-Arenal, F., Pallas, V., Flores, R., 1987. The sequence of a viroid from grapevine closely related to severe isolates of citrus exocortis viroid. Nucleic Acids Res. 15, 4203–4210. Koltunow, A.M., Rezaian, M.A., 1988. Grapevine yellow speckle viroid: structural features of a new viroid group. Nucleic Acids Res. 16, 849–864. Koltunow, A.M., Krake, L.R., Johnson, S.D., Rezaian, M.A., 1989. Two related viroids cause grapevine yellow speckle disease independently. J. Gen. Virol. 70, 3411–3419. Koltunow, A.M., Rezaian, M.A., 1989. Grapevine viroid 1B, a new member of the apple scar skin viroid group contains the left terminal region of tomato planta macho viroid. Virology 170, 575–578. La Notte, P., Minafra, A., Saldarelli, P., 1997. A spot-PCR technique for the detection of phloem-limited grapevine viruses. J. Virol. Meth. 66, 103–108. Levy, L., Lee, I.M., Hadidi, A., 1994. Simple and rapid preparation of infected plant tissue extracts for PCR amplification of virus, viroid, and MLO nucleic acids. J. Virol. Meth. 49, 295–304. Ling, K.-S., Zhu, H.-Y., Drong, R.F., Slightom, J.L., McFerson, J.R., Gonsalves, D., 1998. Nucleotide sequence of the 3 -terminal two-thirds of the grapevine leafroll-associated virus-3 genome reveals a typical monopartite closterovirus. J. Gen. Virol. 79, 1299–1307. Little, A., Rezaian, M.A., 2003. Grapevine viroids. In: Hadidi, A. (Ed.), Viroids. Science publishers Inc., New Hampshire, pp. 195–206. Mackenzie, D.J., McLean, M.A., Mukerji, S., Green, M., 1997. Improved RNA extraction from woody plants for the detection of viral pathogens by reverse transcription-polymerase chain reaction. Plant Dis. 81, 222– 226. Meng, B., Pang, S.-Z., Forsline, P.L., McFerson, J.R., Gonsalves, D., 1998. Nucleotide sequence and genome structure of grapevine rupestris stem pitting associated virus-1 reveal similarities to apple stem pitting virus. J. Gen. Virol. 79, 2059–2069. Minafra, A., Hadidi, A., 1994. Sensitive detection of grapevine virus A, B, or leafroll-associated III from viruliferous mealybugs and infected tissue by cDNA amplification. J. Virol. Meth. 47, 175–188. Minafra, A., Saldarelli, P., Grieco, F., Martelli, G.P., 1994. Nucleotide sequence of the 3 terminal region of the RNA of two filamentous grapevine viruses. Arch. Virol. 137, 249–261. Nassuth, A., Pollari, E., Helmeczy, K., Stewart, S., Kofalvi, S.A., 2000. Improved RNA extraction and one-tube RT-PCR assay for simultaneous detection of control plant RNA plus several viruses in plant extracts. J. Virol. Meth. 90, 37–49. Nolasco, G. 2003. Diagnosis: recent developments and routine implementation. In: Extended Abstracts. 14th Meeting ICVG, Locorotondo, Italy, 12–17 September, pp. 184–187. Nolasco, G., Mansinho, A., Teixeira Santos, M., Sequeira, Z., Sequeira, C., Correia, P.K., Sequeira, O.A., 2000. Large scale evaluation of primers for diagnosis of rupestris stem pitting associated virus-1. Eur. J. Plant Pathol. 106, 311–318. Rezaian, M.A., 1990. Australian grapevine viroid-evidence for extensive recombination between viroids. Nucleic Acids Res. 18, 1813–1818. Ritzenthaler, C., Viry, M., Pinck, M., Margis, R., Fuchs, M., Pinck, L., 1991. Complete nucleotide sequence and genetic organization of grapevine fanleaf nepovirus RNA1. J. Gen. Virol. 72, 2357–2365. Rowhani, A., Biardi, L., Johnson, R., Saldarelli, P., Zhang, Y.P., Chin, J., Green, M. 2000. Simplified sample preparation method and one-tube RT-

R. Nakaune, M. Nakano / Journal of Virological Methods 134 (2006) 244–249 PCR for grapevine viruses. In: Extended Abstracts. 13th Meeting ICVG, Adelaide, SA, Australia, 12–17 March, p.148. Sabanadzovic, S., Ghanem-Sabanadzovic, N.A., Saldarelli, P., Martelli, G.P., 2001. Complete nucleotide sequence and genome organization of grapevine fleck virus. J. Gen. Virol. 82, 2009–2015. Sano, T., Uyeda, I., Shikata, E., Meshi, T., Ohno, T., Okada, Y., 1985. A viroid-like RNA isolated from grapevine has high sequence homology with hop stunt viroid. J. Gen. Virol. 66, 333–338. Sano, T., Kobayashi, T., Ishiguro, A., Motomura, Y., 2000. Two type of grapevine yellow speckle viroid 1 isolated from commercial grapevine had the nucleotide sequence of yellow speckle symptom-inducing type. J. Gen. Plant Pathol. 66, 68–70. Sano, T., Mimura, R., Ohshima, K., 2001. Phylogenetic analysis of hop and grapevine isolates of hop stunt viroid supports a grapevine origin for hop stunt disease. Virus Gene 22, 53–59. Sano, T., Yoshida, H., Goshono, M., Monma, T., Kawasaki, H., Ishizaki, K., 2004. Characterization of a new viroid strain from hops: evidence

249

for viroid speciation by isolation in different host species. J. Gen. Plant Pathol. 70, 181–187. Zhang, Y.-P., Uyemoto, J.K., Golino, D.A., Rowhani, A., 1998a. Nucleotide sequence and RT-PCR detection of a virus associated with grapevine rupestris stem-pitting disease. Phytopathology 88, 1231–1237. Zhang, Y.-P., Uyemoto, J.K., Kirkpatrick, B.C., 1998b. A rapid, small scale procedure for extracting virus, viroid, MLO, and bacterial nucleic acids from plants for analysis by PCR. J. Virol. Meth. 71, 45– 50. Zhu, H.-Y., Ling, K.-S., Goszczynski, D.E., McFerson, J.R., Gonsalves, D., 1998. Nucleotide sequence and genome organization of grapevine leafroll associated virus-2 are similar to beet yellow virus, the closterovirus type member. J. Gen. Virol. 79, 1289–1298. Wetzel, T., Jardak, R., Meunier, L., Ghorbel, A., Reustle, G.M., Krczal, G., 2002. Simultaneous RT/PCR detection and differentiation of arabis mosaic and grapevine fanleaf nepoviruses in grapevines with a single pair of primers. J. Virol. Meth. 101, 63–69.