Efficient utilization of Escherichia coli transcriptional signals in Bacillus subtilis

J. Mol. Biol. (1985) 186, 547-555

Efficient Utilization of Escherichia cob Transcriptional Signals in Bacillus subtilis Ursula Peschke, Verena Beuck, Hermann Bujard Reiner Gentz and Stuart Le Gricet Zentrale Forschungseinheiten F, Hoffmann-La Roche and Co. AG CH-4002 Basel, Switzerland

(Received 9 July

1985)

Using purified o 55 RNA polymerase from Bacillus subtilis in an in vitro transcription system, we have shown that both promoters and terminators of Gram negative origin are recognized by this enzyme. Furthermore, when B. subtilis is transformed with a shuttle vector containing certain of these promoters, synthesis of the Staphylococcus aureus CAT protein is achieved, and levels up to 25% of the total cellular protein can be obtained. These findings indicate a closer evolutionary relationship of the expression machinery of these two bacterial species than has been assumed so far. On the basis of these results, the construction of new expression vectors for B. subtilis is likely to be facilitated, since a variety of well-characterized signal elements from Escherichia coli are available.

1. Introduction The mechanisms of gene expression of the Gram positive prokaryote Bacillus subtilis have recently evoked increasing interest primarily for two reasons. Firstly, B. subtilis is a sporulating organism and its differentiation programme appears largely directed by a cascade of modified RNA polymerases recogmzing different sets of promoters (Losick & Pero, 1981; Doi, 1982). Secondly, B. subtilis and related Gram positive organisms may be attractive systems for the expression of heterologous genetic material especially as effective protein secretion pathways are found in these bacterial species. During vegetative growth, the majority of transcripts in B. subtilis is produced by an RNA polymerase containing the 55,000 M, o-subunit (I%J~~). This enzyme recognizes promoters which show remarkable similarities to Escherichia coli promoters: the conserved regions around - 10 and -35 are defined by the same consensus sequences and the sequences between these two t Author to whom all correspondence should be addressed.

$ Abbreviations used: bp, base-pair(s);CAT, chloramphenicol acetyl transferase protein; SDS, sodium dodecyl sulphate;blu. structural genefor b-lactamase; ori. origin of replication; cat, structural gene for chloramphenicol acetyl transferase; kan, structural gene for kanamycin nucleotidyl transferase; Cm’, chloramphenicol-resistant. 002-2836/85/230547-09 19

$03.00/O

547

regions are also comparable (16 to 18 bp$: Moran et al., 1982). Nevertheless, following introduction of a number of E. coli promoters into B. subtilis it would appear that these signals are inefficiently utilized by Eos5 (Wiggs et al., 1979; Lee et al., 1980). One explanation proposed for these functional differences was the A +T-rich sequence preceding the -35 region in many vegetative B. subtilis promoters including promoters of the early expression class of B. subtilis phage SPOl (Moran et al., 1982). Promoters with striking A +Trich blocks around -43, however, are also found in the E. coli system (Bujard, 1980). Among the E. coli promoters most closely resembling a generalized sequence of B. subtilis vegetative promoter are those of phage T5, ribosomal promoters and promoter Al of phage T7 (Hawley & McClure, 1983). Tn this paper we have initially analysed promot’ers of Gram negative origin, derived from the E. coli chromosome (lacUV5, trp), the E. coli bacteriophages T5 and T7 as well as a “prototype” E. coli promoter (tat) in an in vitro transcription system catalysed by purified vegetative RNA polymerase from B. subtilis. A selection of these promoters was furthermore inserted into an E. coli/ B. subtilis shuttle vector. Results indicated here show that those promoters tested can mediat#eCAT synthesis in either organism. In addition, we have analysed both in vitro and in vivo four E. coli-derived transcriptional terminators in B. subtilis and find that all are 0 1985 Academic

Press Inc. (London)

Ltd.

548 recognized machinery.

U. Peschke et al. by

the

Gram

2. Materials

positive

transcriptional

and Methods

(a) Promoters and terminators Figure 1 indicates the DNA sequence of the promoters used in the present study. The wegI1 promoter was derived from the B. subtilis veg complex in a manner to be described in a forthcoming communication. The B. subtilis vegI/II complex is essentially that described by Le Grice & Sonenshein (1982). T5 promoters used here have recently been isolated and characterized by Gentz & Bujard (1985). The early T7 promoters Al and A2 were gifts from U. Deuschle; E. coli ZacUV5, trp and tat promoters (De Boer et al., 1982) were gifts from W. Kammerer. E. coli terminators t, (Rosenberg et al., 1976) Tl, T2 (Brosius et al., 1981) and T7 (Dunn & Studier, 1980), adapted for various insertion sites (U. Deuschle, unpublished results), were generous gifts from U. Deuschle and D. Stiiber. (b) In vitro transcription In vitro transcription with RNA polymerases of E. coli and B. subtilis was performed in 50-/d assays of the following composition: 40 miv-Tris. HCI (pH 7.9), 10 mM0.1 mw-dithiothreitol; 0.1 mM-EDTA, 50 to MgCl,. 206 mM-NaCl, 10% (v/v) glycerol, 150 PM-ATP, GTP. CTP, ~OFM-UTP, 5pCi of [32P]UTP (-3000Ci/mmol: Amersham Buchler, Braunschweig). 0.05 pmol endonucleolytically cleaved DKA and 0.25 pmol RKA polymerase. Reactions were initiated by addition of RNA polymerase and allowed to proceed for between 1 and 5 min at 37°C. Synthesized RNA was isolated by repeated precipitation with ethanol and analysed by high voltage electrophoresis through 0.4 mm thick 5 or 8% (w/v) polyacrylamide gels containing 8 M-urea. Following electrophoresis. gels were dried and subjected to autoradiography using Kodak X-OMAT XAR 5 film at room temperature.

(c) Protein analysis Protein synthesis was determined by two methods. depending on whether E. coli or B. subtzlis was assayed. For E. coli cultures, 200 ~1 of an overnight culture were centrifuged and the pellet mixed with 40 ~1 of SDS sample buffer (125 mlvr-Tris. HCl, pH 6.8. 3% (w/v) SDS, 3% (v/v) P-mercaptoethanol and 200/, (v/v) glycerol). These samples were thereafter heated for 10 min at 90°C. and 8 ~1 applied to a discontinuous 12.5% SDS/ polyacrylamide gel containing a 3.3% stacking gel. With B. subtilis: 200 ~1 of an overnight culture were centrifuged and resuspended in 20 ~1 of 50 mw-Tris . HCI (pH 7.2) containing 15% (w/v) sucrose. Then 4 ~1 of a 5 mg/ml lysozyme solution (in 0.25 M-Tris.HCl (pH 7.2)) were added and the suspension incubated at 37°C for 5 min; 36 ~1 of SDS sample buffer were then added and the samples were fully lysed by heating at 90°C for 10 min. 12 ~1 of this solution were applied to the SDS/polyacrylamide gel. Following electrophoresis. gels were stained for 30 min at room temperature in 45% methanol/10a/o acetic acid/ 0.2% Coomassie brilliant blue (Serva, Heidelberg) and destained in 5% methanol/4.2% acetic acid at 60°C.

(d) S, mapping RNA was isolated from logarithmic growth phase cultures (10 ml) of E. coli or B. subtilis carrying the plasmid p602/8 : N26 by the method of Glisin et al. (1974). Conditions for in vitro hybridization to end-labelled DNA and 8, digestion were essentially those described by Berk & Sharp (1977) with modifications described by U. Deuschle (personal communication). Following S, digestion, end-labelled DNA samples were applied to a O-4 mm thick 8% polyacrylamide/8 M-urea gel. Electrophoresis, drying of gels and autoradiography were as described earlier. (e) Microbiological

methods

E. coli strain AB1157 (Maniatis ‘et al.. 1982) was used throughout this work. Following promoter or terminator insertion into p602/8, these plasmids were introduced into competent cultures by the method of Cohen et al. (1972). Transformed cells were selected on LB agar containing 10 pg kanamycin/ml and chloramphenicol concentrations 10 and 200 pg/ml. After characterization. between plasmids were introduced into competent cultures of B. subtiZis strain BR151 (trp, met, Zys). Transformed cells (Contente & Dobnau, 1979) were selected on LB agar containing 10 pg kanamycin/ml and chloramphenicol concentrations ranging from 10 to 100 pg/ml. All plasmids introduced into B. subtilis were checked by restriction analysis to verify that they were structurally identical with their counterparts in E. coli. (f ) Routine chemicals Restriction endonucleases were purchased from either New England Biolabs or Boehringer. Radiochemicals were from Amersham, nucleoside triphosphates and electrophoresis reagents from Serva, Heidelberg. Unless otherwise stated, all routine chemicals were from Fluka, and of the highest grade possible. E. coli RNA polymerase was purchased from Boehringer; B. subtilis os5-containing RNA polymerase was isolated from strain BR151 by published procedures (Le Grice & Sonenshein. 1982) and shown to be free of a37 activity.

3. Results (a) In vitro analysis of E. coli promoters B. subtilis RNA polymerase

with

Figure 1 indicates t’he promoters used in the present work. As a preliminary study, their potential was determined by in vitro “run off” transcription, the results of which are presented in Figure 2. In each case, promoter utilization by B. subtilis a55 RNA polymerase had been assayed as a function of ionic strength, and compared with its efficiency when transcribed by F:. coli RNA polymerase in the presence of 200 m&r-NaCl. Each transcription assay contains, in addition to the promoter in question, as an internal standard, stoichiometric amounts of the B. subtilis zey promoter, shown previously to be efficiently utilized by B. subtilis o 55 RNA polymerase (Moran et al.. 1982). It is immediately clear from the data presented in Figure 2 that almost all E. coli promoters tested are recognized by B. subtilis RNA

E. coli Transcriptional

A7 Box ‘D/E

20

‘N 25

Signals

-35

in B. subtilis

549

-10

ACTGCAAAAAATAG;TmCCCTAGCCGATAGGCTTTAAGATGTACCCAGTTCGATGA

-

I III TCATAAAAAATTTATTTGCTTTCAGGAAAATTTTTCTGTATAATAGATTCATAAATTTGA

‘J 5

II I II I ATATAAAAACCGTTATTGACACAGGTGGAAATTTAGAATATACTGTTAGTAAACCTAATG

‘K 28a

I TAGTTAAAATTGTA 1’TTGCTAAATGCTTAAATACTTGCTmATTTATATAAATTGAT ’

‘K 28b

I II I ATTATAAAGTGGTTATTGACATTTTCGCCGCTTAGGTATATACTATTATCATTCAGTTGA

‘G 25

II I AAAAATAAAAATTTCTTGATAAAATTTTCCAATACTATTATAATATTGTTATTAAAGAGG

T7AI

II I TTATCAAAAAGAGTATTGACTTAAAGTCTAACCTATAGGATACTTACAGCCATCGAGAGG

T7A2

CACGAAAAACAGGTATTGACAACATGAAGTAACATGCAGTAAGATACAAATCGCTAGGTA

‘N 26

IAC udJv5

Ike

YiaiII yEIi I/II

I ACTTAAAAATTTCAGTTGCTTAATCCTACAATTCTTGATATAATATTCTCATAGTTTGAA

II

I

f’hagc T5

-

1

PhaCJQ T7

II I I II I CTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGAATTGTGAG I TTCTGAAATGAGCTGTTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTGAGCG

I II I I II I GTCAAAATAATTTTATTGACAACGTCTTATTAACGTTGATATAATTTGCAAGCTTGCAAA

TTCTGAAATGAGCTGTTGACAATTAATCATCGAACTAGTTAACTAGTACGCAAGTTCACG

II I

I TAATTTAAATTTTATTTGACAAAAATGGGCTCGTGTTGfAAAATGTAGTGAGGTGG IU

1 Ed

I Bsubtilis

Figure 1. DTU’A sequence of the promoters used in the present study. The sequence between -50 and + 10 has been presented, within which the - 35 hexamers and upstream A + T-rich regions have been boxed, whilst the - 10 hexamers have been overlined. Kate that (1) whilst the bacteriophage T5 promoters PK2sa and P,,,, are reported as individual sequences, they in fact exist here on a single restriction fragment; (2) vegI/II is reported here as only the downstream RKA polymerase binding site. The wild-type veg promoter contains in addition the normally inactive site II RNA polymerase binding site (Le Grice & Sonenshien, 1982); and (3), the UegII sequence reported here is that of an “activated” form of the isolated site II RNA polymerase binding site (Le Grice et al., unpublished results). Sequence hyphens have been omitted for clarity.

polymerase; levels of transcription less than, equal to, or exceeding that from the veg promoter can be achieved, depending upon the ionic strength under which transcription was allowed to proceed. Compared with the levels of transcription achieved from the internally added veg promoter, this effect is even more pronounced wit’h certain promoters, e.g. P,,, of phage T5, when one considers that the R,NA has been internally labelled. Those promoters utilized with least efficiency (kzcUV5 and trp) themselves present an interesting situation in B. subtilis, since the tat promoter derived from the lncUV5 and trp promoters (De Boer et al., 1982) is utilized in vitro and, as will be presented later, (aan also be utilized in viva. Furt,hermore, the effect of salt concentration on promoter utilization can clearly be demonstrated. At 50 mM-NaCl, B. subtilis RNA polymerase initiates transcription not only from the promoters in quest’ion, but also from the bla and ori promoters of t,he pBR322 vector. (For preliminary studies, all promoters were cloned into pBR322-derived vectors containing the bla gene. These plasmids were

subsequently cleaved such that the? yielded a constant 350.nucleotide bla transcript and a variable length t,ranscript from the promoter in question.) As the salt concentration is raised, promoter selection becomes clearly apparent, partitioning between the veg promoter and the Gram negative promoter we specifically wished to test. In order to determine whether the data presented in Figure 2 were not simply an in vitro occurrence which might have no relevance on in 2G2jo utilization of E. coli promoters in B. subtilis, a selection of the promoters found to be active was introduced into an E. colilB. subtilis shuttle vector and assayed in viva for ability to mediate synthesis of the Staphylococcus aureus CAT protein. These results are presented in the following section. (b) E:. coli promoters

can drive PA T qnthesis B. subtilis

in

The following promoters were inserted into the shuttle vector p602/8 (Fig. 3(a)) to probe for their function in vivo; tat, phage T5 P,, and PNz6. and

U. Peschke et al.

550

-

240 217 -

240 217

-

,

I-u-

PWE20

pN25

pN26

w7

IIUI

45

pG25

w

PK28a 'K28b

that analysis of the promoters presented in Fig. 1. The notation Bs indicates Figure 2. In vitro transcriptional with ;ion was performed with B. cubtilis RNA polymerase. whilst EC represents transcriptions performed transcripi was Figures in conjunction indicate the salt concentration under which transcription E. coli R #NA polymerase. performer 1. The panel indicated “vector” indicates the promoter-free vector into which promoters were initially cl1oned, veg indicated at the side of the Figure represents the transcript fror n the and from this arise the bla and ori transcripts.

E. coli Transcriptional

Signals in B. subtilis

551

Promoter ----4

p 602/B 5.7 kb

(b)

r-l

r-l

n

l-l

l-l

l-l

r-l

nnnnnnn

-CAT

-

LYS

Figure 3. (a) Structure of the basic shuttle vector, p602/S. The cat gene originates from the S. aureus plasmid pUBl12 (Bruckner et al., 1984), and the kan gene from the S. aureus plasmid pUBll0 (Ehrlich, 1977). ori denotes the region of the plasmid responsible for replication; + or - indicates whether it is Gram positive or Gram negative, respectively. The stippled area indicates the cat ribosome binding site. Tl is the ribosomal rmB terminator of E. coli. The positions for either promoter or terminator insertion have been indicated. Restriction sites indicated are: E, EcoRI; B, BumHI; Sm, SmaI; 8. SalI; H, HindIII; P, P&I; Pv, PwuII; X, XbaI; K, KpnI. kb = lo3 base-ps.irs. (b) Analysis of proteins synthesized in E. coli and B. mbtilis harbouring the shuttle vector ~60218 containing promoters of Gram negative and Gram positive origin. In each panel, P- indicates the plasmid-free strain, For each construction, duplicate cell lysates have been applied to the gel. The position of the CAT band has been indicated. Note the large amounts of 2 low molecular weight proteins in cell lysates of B. subtilis. The larger of these (LYS) represents lysozyme. which is externally added to lyse the B. subtilis cultures. The lower molecular weight protein appears to be plasmid-coded, since it does not appear in lysates of plasmid-free cells.

internally supplied veg promoter-containing DNA (see Materials and Methods), whilst veg indicated below certain panels represents transcription of solely the veg-containing fragment. M, molecular weight marker, ZZpaII-cleaved pBR322 DKA: only the sizes of the restriction fragments relevant to the present research have been indicated. Note that the has 2 new transcripts, since both promoters are present panel illustrating transcription from the promoters P,,s,/P,,s, on a single restriction fragment. In vitro transcription from the wegI1 promoter has been omitted here, as this will be the subject of a separate publication. Within each panel, the position of the expected transcript has been indicated with an arrow.

552

U. Peschke et al.

phage T7Al. As a control, t’he B. subtilis veg and vegI1 promoters were also int,roduced. The latter of these B. subtilis promoters is the upstream RNA polymerase binding site of the “veg complex” (Le Grice & Sonenshein, 1982) recently shown to be transcriptionally active when freed from the productive veg RNA polymerase binding site (Le Grice et al., unpublished results). The shuttle vector p602jS has been so constructed that the 8. aureus cat gene is preceded by its natural ribosome binding site and is no longer chloramphenicol inducible. Figure 3(b) illustrates total protein synthesis in both E. coli and B. subtilis following transformation with ~60218 containing the aforementioned promoters. As was to be expected, all promoters tested mediate CAT synthesis in E. coli. When these plasmids were isolated from E. coli and transformed into B. subtilis, the expectations from our in vitro findings were completely confirmed, i.e. all promoters recognized in vitro could mediate CAT synthesis in vivo. Using scanning microdensit,ometry, we have estimated that levels of CAT synthesis between 3% (tat) and 25% (wegI1or P,,,) of the soluble cellular protein could be achieved. Furthermore, the necessary inclusion of lysozyme to disrupt the B. subtilis cell wall prior to treatment with SDS sample buffer allowed us to estimate an absolute level of protein synthesis; a comparison of the CAT and lysozyme bands has revealed that vegIT and P,,, will mediate protein synthesis at approximately 150 mg per litre in late exponential growth cultures. One point to which we have also given consideration is the possibility that the promotercontaining fragments we have utilized may fortuitJously contain a B. subtilis RNA polymerase binding site that has no relationship to the E. coli promoter we wished to test. Whilst we feel that this would be extremely unlikely for every promotercontaining fragment tested. it was necessary to determine that transcription was initiating from the same nucleotide in both bacteria. Consequently, RNA was isolated from E. coli and B. subtilis harbouring the plasmid pSOS/S: N26 and subjected to S, analysis (Berk & Sharp, 1977) using an endlabelled DNA fragment containing the X26 promoter. Figure 4 shows the results of such an analysis, and it is clear that the transcriptional initiation site is the same in bot’h E. coli and B. subtilis. These results thus support’ our contention that the phage T5 promot’er I’,,, is faithfully recognized in B. subtilis. (c)

Ctilization

of

terminators

E. coli transcriptional in B. subtilis

After demonstrating that promoters of the E. coli system can mediate efficient CAT synthesis in B. subtilis, it was of interest to find out whether E. co&derived transcriptional terminators would be recognized by the B. subtilis transcriptional machinery. As a model system, we chose plasmid p602/8 : vegI1, which yields high levels of CAT in

M

0

b

c

M

201 -

so-

67

-

34

-

Figure 4. Analysis in viva of RKA synthesis from PN26 in E. coli and B. subtilis by S, nuclease mapping. RNA was isolated from B. subtilis (lane b) or lki’.coli (lane c) containing the plasmid p602/8: N26 and promoter

hybridized to an end-labelled DNA fragment containing P,,,. In lane a, no exogenous RNA has been added. M, molecular weight marker, HpaII-digested pBR322. Only the sizes of bands (in bp) relevant to the presented data have been indicated.

E. coli Transcriptional B. subtilis. Hind111 fragments containing the E. coli transcriptional terminators t,, Tl, T2 and T7 were inserted between the vegI1 promoter and the ribosome binding site of the cat gene. E. coli was transformed with these constructions and low level Cm’ transformants assayed for CAT synthesis by SDS/polyacrylamide gel electrophoresis (in the absence of terminators, p602/8 : vegI1 confers resistance to 750 pg chloramphenicol/ml in E. coli). As is shown in Figure 5(a), all terminators reduce the overall CAT synthesis in E. coli, albeit to varying degrees. These constructions were subsequently transformed into B. subtilis, and protein synthesis was monitored. Figure 5(a) shows the results of these experiments, where two facts become immediately clear. Firstly, terminators of Gram negative origin can be utilized in B. subtilis; secondly, the efficiency of utilization appears to be somewhat genus-dependent. This is particularly exemplified with the I terminator to, which is very

Signals in B. subtilis

efficient in B. subtilis, but does not appear fully to inhibit CAT synthesis in E. coli. The data we have presented in Figure 5(a) show that t, and T2 are utilized very efficiently in B. subtilis, whilst Tl and T7 appear to terminate transcription with only 80 to 90% efficiency. Further to characterize the nature of E. coli terminators, we have transcribed plasmid 602/S : vegI1 containing each of the terminators with B. subtilis RNA polymerase, the results of which are presented in Figure 5(b). In this experiment we have utilized the supercoiled form of each construction to enhance the overall levels of transcription. Transcription from the vegI1 promoter Gas initiated with either the mononucleotide GTP or dinucleotide GpC, since, in vitro, we911 transcription is far stronger with the latter (Le Grice et al., unpublished results). The inclusion of GpC has further advantages that it will reduce background transcription from the plasmid, since the elongation t-l-t ++++tt+++t

GPC GTP Terminator

T-

160 147

-

CAT

553

to T I

t++ T2

T7

t-4-t T-

to

T I T2

+ T7

-

122.

q&

IIO-

q#

76 67

8

E. coli

subfilis

M

JL

1 Es RNAP

(a)

i EC RNAP

(B)

or E. coli harbouring p602/8 : wegI1and transcriptional terminators. P-, Figure 5. (a) CAT synthesisin B. subtilis plasmid-freecells; T-, cells containing the plasmid p602/8:vegII. The relevant terminator constructions have been indicated over each lane. (b) In vitro transcription of piasmid p602/8 : vegI1 containing the transcriptional terminators t,. Tl. T2 and T’i. The left-hand panel represents data with B. subtilis RNA polymerase (Bs RNAP). and t’he righthand panel that with E. coli RKA polymerase (EC RNAP). The lower line above the autoradiogram indicates the terminator inserted between veg P II and the cut gene; T-, p602/8 vegI1. The upper lines above the autoradiogram indicates whether transcription was initiated with the mononucleoside triphosphate GTP or t.he dinucleotide GpC. M, molecular weight marker, HpaII-cleaved pBR322 (indicated on the left, of the Figure in bp).

554

U. Peschke et al.

nucleotides ATP, GTP, CTP and UTP are reduced to 10 PM; transcription from promoters other than those having the sequence GpC around the initiation site will subsequently be minimal. So, by comparison of the transcriptional patterns of p602jS : wegI1 with those containing the transcriptional terminators, it should be possible to monitor terminator activity in vitro through the appearance of novel truncated RNA species. As can be seen from Figure 5(b), parallel results have been achieved with the RNA polymerase of both E. coli and B. subtilis. Templates containing tc, Tl and T2 give rise to a new RNA species in both GTP and GpC-initiated transcription; as was to be expected, there were greater levels of transcription when GpC was included. With both RNA polymerases, substantial amounts of truncated transcript arise from templates containing t, and T2, whereas lesser amounts arise from templates containing Tl; such a result is directly in keeping with the in vivo data from B. subtilis in Figure 5(a). A curious result here is that, with either B. subtilis or E. coli RNA polymerase, we were unable to obtain a truncated transcript from templates containing T7 in vitro. although restriction analysis of the DNlZ transcribed confirmed that it did in fact contain the terminator (data not shown). One reason to explain this is that correct functioning of the T7 terminator in vitro may be salt-dependent, a possibility presently being analysed.

4. Discussion The transcriptional machinery’in the vegetative state of B. subtilis closely resembles that of E. coli: The RNA polymerases have similar subunit compositions and active “heteroenzymes” can be constituted by interchanging sigma factors (Shorenstein & Losick, 1973). Furthermore, the promoters from each species show a very similar overall structure and exhibit in some casesst’riking sequence homologies. It was therefore not too surprising that earlier findings demonstrated a rather efficient utilization of B. subtilis promoters by E. coli RNA polymerase (Moran et al., 1982). Nevertheless, it appeared puzzling that the reverse situation, i.e. E. coli promoters in the B. subtilis system, seemed in general not to constitute a functional signal/enzyme combination (Wiggs et aE., 1979; Lee et al., 1980). The analysis of various heterologous signal/enzyme combinations has therefore been of interest to us since some of these combinations might allow a dissection of the initial process of transcription into distinct phases. The study of such “arrested” complexes could contribute to our understanding of the structure/ function relationship of promoters. In the experiments described here we examined in the B. subtilis system E. coli promoters that exhibit a high degree of homology with promoter sequences characteristic for vegetative expression in B. subtilis. Our data show that not only this class of

promoters but also E. coli terminators can be utilized in vitro and in vivo by the vegetative form of B. subtilis RNA polymerase (Ea5’), and that’ some of the E. coli signals yield highly efficient expression of adjacent genetic material. Furthermore, the versatility of our system has been demonstrated in experiments where the S.aureus cat gene has been replaced by an E. cobi “CAT cartridge”, whereupon high level synthesis of the E. coli CAT protein, under the control of T5 or T7 promoters, could be achieved in B. subtilis (data not shown). The relat)ive efficiency in uiw with which certain E. coli promoters mediate CAT synthesis in B. subtilis is clearly evident in Figure 3(b). ranging from 3:/, from tat to 250/bfrom P,,,. However, the lower levels from the tat, T7Al and PJs promoters are in themselves considerable when compared with the synthesis pattern of B. subtilis cellular proteins. i.e. they may be likened in strength to an “average” B. subtalis promoter. Bearing this in mind, we have analysed the promoter sequences presented in Figure 1 for features which might allow or preclude their utilization in R. subtilis. One of the few consistencies we can derive from our promoter compilation concerns the DNA sequence immediately upstream from - 35. Moran et al. (1982) have suggested that, efficiently utilized B. subtilis promoters are extremely A + T-rich in this region. and its absence from E. coli promoters may account for their inactivity in B. subtilis. This feature is well exemplified with the B. subtilis ~egT1 or wild-type z’eg promoters; it is also present, without’ exception, in all the phage T5 promoters we have presented here, varying between 730/,, and 939,. The T7Al promoter is likewise SOo/, A +Trich in this region, but this feature falls ofi dramatically in the tat (6Ooj), T7A2 (SOc’b), trp (600/c) or ZacUVB (26%) promoters (we define here the upstream sequencesas those between -35 and -50). The importance of this region has been demonstrated by Banner et al. (1983), and we would likewise postulate that this feature plays a significant role in the activity of the T5 and TiAI promoters in B. subtilis. However, it would appear from our results that t,he region upstream from - 35 is not the sole contributory factor, clearly demonstrated by comparison of the result,s from the promoters I’,,. P,,, and TSAl. all 80’$, A + T-rich upstream from - 35, yet ut)ilized with strikingly different efficiencies, both in eitro and in r%to. At’ this point, it becomes dificuh t,o deduce anything positive from our promoter compilation; I’,,, and PJ5 have optimal homology at either -35 or - 10, but, not at both simultaneously. More interestingly, the T7A1 promoter has optimal homology with neither of these regions, yet is utilized in uivo more efficiently than PJ5. From these findings, it, would appear that promoter utilization arises from subtle interplay between RNA polymerase and multiple regions within the promoter. One additional point of promoter structurr we

E.

coli Transcriptional

feel is worth a mention is the so-called “spacer” region between the - 35 and - 10 hexamers. With E. coli promoters, this is usually 17bp, although promoters with spacing of 16 or 18bp have been reported (Hawley & McClure, 1983). The finding that the tat (16bp spacer)? P,,, (17bp spacer) and vegI1 (18bp spacer) all mediate CAT synthesis in B. subtilis indicates. as has been reported for E. coli promoters. that single base-pair lengthening or shortening of the region between the -35 and - 10 hexamers can be tolerated. The fact that the cegTI promoter, with an 18bp spacer but optimal homology at -35 and - 10, yields the highest CAT production underlines our contention that promoter ut’ilization results from interplay with multiple regions of the promoter as opposed t’o any one particular region within it. Whilst a considerable amount of literature exists concerning the applicabilit’y of E. coli ribosome binding sites and promoters, there are very few data available concerning E. coli-derived transcriptional terminators and their efficiency in B. subtilis. In E. coli. two mechanisms of transcription termination have been documented, one of which requires the transcription termination factor rho (Roberts, 1976); and a counterpart to this protein has recently been isolated and characterized from B. subtilis (Hwang & Doi, 1980). In view of this, it might not be too unreasonable to assume that the rho-independent transcription termination system of E. coli (Adhya & Gottesman, 1978) might similarly exist in B. subtilis. The results presented here indeed indicate that E. coli-derived transcriptional terminators are recognized by the transcriptional machinery of B. subtilis. One interesting feature we notice is that the efficiency with which an individual terminator is utilized is not the same in both bacteria, e.g. the terminator t, is more efficiently utilized in B. subtilis than in E’. coli. yet the converse holds for the terminator T7. Such findings again might be indicative of altered modes of interaction between the respective RKA polymerases and these terminators; one interesting extension to this study would be to isolat,e t,ranscriptional terminators from B. subtilis and determine how efficiently they are utilized in E. coli.

ln summary, we have shown here that it is possible to use well-characterized and more readily available promoters from E. coli when constructing expression vectors for B. subtilis. Furthermore, the need to safeguard the replication region of Gram positive vectors from uncontrolled transcription from strong promoters, a feature clearly demonstrated in E. coli (Gentz et al., 1981; Stiiber & Huj,ard, 1982) can be facilitated again by E. coliderived transcriptional terminators. We feel that our findings will aid future vector development; indeed. in our vector systems containing certain of these signals, we have as yet experienced no

Edited

in B. subtilis

Signals

555

instability or deletion problems are introduced into B. subtilis.

when

our plasmids

We thank W. Kammerer, U. Deuschle and D. Stiiber for generous gifts of promoter and terminator-containing fragments; C. Gray for critical reading of the manuscript; and Y. Kohlbrenner for secretarial assistance.

References Adyha, 47,

S. & Gottesman,

M. (1978). Ann,u.

Rev.

Biochem.

967-996.

Banner,

C. D. B., Moran. C. P. Jr & Losick. R. (1983). Biol. 168, 351-365. Berk, A. J. & Sharp, P. A. (1977). Cell, 12, 721-732. Brosius, J., Doll, T. J., Sleeter, D. D. & Noller, H. F. (1981). J. Mol. Biol. 148, 107-127. Briickner, R., Zyprian, E. & Matzura, H. (1984). Gene, 32, 151-160. Bujard, H. (1980). Trends Biochem. Sci. 5. 274-278. Cohen, S. K., Chang, A. C. Y. & Hsu, L. (1972). Proc. Nat. Acad. Sci., U.S.A. 69, 2110-2114. Contente, S. & Dobnau, D. (1979). Mol. Gen. Genet. 167, 251-258. De Boer, H. A., Cohstock, L. J., Yansura, D. G. & Heyneker, H. L. (1982). In Promoters Structure and Function (Rodriguez, R. L. & Chamberlin, M. J., eds), pp. 462-481, Praeger Press, New York. Doi, R. H. (1982). Arch. Biochem. Biophys. 217. 772-781. Dunn, J. J. & Studier, F. W. (1980). Nucl. Acids Res. 8, 2119-2132. Ehrlich, S. D. (1977). Proc. Nat. Acad. Sci.. U.S.A. 74, 1680-1682. Gentz. R. & Bujard, H. (1985). J. Bucteriol. 164. In press. Gentz. R., Langer, A., Chang, A. C. Y.. Cohen, S. N. & Bujard, H. (1981). Proc. Nat. Acad. Sci., I;.S.A. 78, J. Mol.

4936-4940.

Glisin,

V.,

Crkvenjakov, R. & Byus. C. (1974). 13, 2633-2637. Hawley, D. K. & McClure. W. D. (1983). Nucl. Acids Res. 11, 2237-2255. Hwang, J.-Y. & Doi, R. H. (1980). Eur. J. Biochem. 104, 313-320. Lee. G.. Talkington, C. & Pero, J. (1980). Mol. Gen. Genet. 180. 57-65. Le Grice, S. F. J. & Sonenshein, A. L. (1982). J. ;ol. Biol. 162, 551-564. Losick, R. & Pero, J. (1981). Cell, 25, 585-587, Maniatis, T.. Fritsch, E. F. & Sambrook. ,J. (1982). In Molecular Cloning. pp. 504-506, Cold Spring Harbor Laboratory Press, Cold Spring Harbor. Moran, C. P. Jr, Lang, N.. Le Grice, S. F. J.. Lee. G., Stephens, M.. Sonenshein, A. L., Pero, J. & Losick, R. (1982). Mol. Gen. Genet. 186, 339-346. Roberts, J. W. (1976). In RNA Polymerase (Losick, R. & Chamberlin, M.. eds), pp. 247-271. Cold Spring Harbor Laboratory Press, Cold Spring Harbor. Rosenberg, M., De Crombrugghe. B. & Musso, R. (1976). Biochemistry,

Proc.

Nat.

Acad.

Sci.,

U.S.A.

73. 717-721.

Shorenstein. R. G. & Losick, R. (1973). J. Biol. (‘hem. 248, 6170-6173. Stiiber, D. & Bujard, H. (1982). EMBO J. 1, 1394-1404. Wiggs, J. L., Bush, J. W. & Chamberlin. M. J. (1979). Cell, 16. 97-109.

by P. Chambon