- Email: [email protected]
Ehhmbp45 is a novel hemoglobin-binding protein identified in Entamoeba histolytica
FEBS Letters 582 (2008) 2806–2810
Ehhmbp45 is a novel hemoglobin-binding protein identified in Entamoeba histolytica Areli Cruz-Castan˜eda, Jose´ J. Olivares-Trejo* Posgrado en Ciencias Geno´micas, Universidad Auto´noma de la Ciudad de Me´xico, 290 C.P. 03100, D.F., Me´xico Received 30 April 2008; revised 9 June 2008; accepted 27 June 2008 Available online 14 July 2008 Edited by Stuart Ferguson
Abstract Hemoglobin-binding proteins are necessary for pathogens to obtain iron from Hb. Entamoeba histolytica can grow using Hb as source of iron, but the underlying mechanism has not previously been established. In this work, we identified a 45 kDa Hb-binding protein of E. histolytica, which we named Ehhmbp45. In silico analysis showed that Ehhmbp45 contains the conserved domains needed for Hb-binding, while overlay assays demonstrated that Ehhmbp45 is able to bind Hb. In addition, we found that Ehhmbp45 mRNA levels were up-regulated under iron starvation conditions and were subsequently restored to basal levels when Hb was added to the cell cultures. These findings provide the first insights on the role of Ehhmbp45 in iron acquisition from Hb. 2008 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. Keywords: Hemoglobin; Hb-binding protein; Iron starvation; Overexpression
1. Introduction Iron is essential to nearly all known organisms. Since the free form of iron is highly toxic to cells [1], it is generally stored in the center of metalloproteins as transferrins and hemoproteins [2]. Pathogens have developed mechanisms to obtain iron from different sources [3–5]. One efficient way is the expression of proteins capable of binding hemoglobin (Hb) (hemophores and Hb receptors) [6]. Hemophores are proteins secreted by cells to uptake Hb [7], while Hb receptors are attached to the outside cellular membrane and are necessary to bind external Hb [3]. Also, there are receptors attached to internal membranes such as the hemoglobin receptor (HbR) of Leishmania donovani [8]. In gram-negative bacteria, these Hb-receptors are TonB-dependent [9] and require ABC type permease activity (ATP-binding cassette) to transport iron [10]. Hb-receptors bind Hb using two conserved motifs, FRAP and NPNL, which are separated from each other by a divergent region of 10–20 amino acids [9]. Entamoeba histolytica is a protozoan that infects human. This pathogen can grow axenically in the laboratory and also can maintain its growth using different sources of iron (free iron, Holo-lactoferrin or human Hb). It has been shown that *
Corresponding author. E-mail addresses: [email protected], [email protected] (J.J. Olivares-Trejo).
E. histolytica specifically binds Holo-lactoferrin expressing a membrane protein [11]. Even though E. histolytica uses Hb as an iron source for its growth [12], a mechanism for the Hb utilization remains unknown. In this work, we present a strategy that allowed us to find a 45 kDa protein and predict that it has the FRAP and NPNL motifs. Also, purified protein was able to bind Hb. Our data suggest that an E. histolytica mechanism to use Hb as an iron source is happening.
2. Materials and methods 2.1. Cultures E. coli DH5a and BL-21 pLysS stains were typically maintained in Luria–Bertani (LB) medium supplemented with an appropriate antibiotic and incubated aerobically at 37 C. Candidates were selected by ampicillin resistance. Trophozoites of E. histolytica strain HM1-IMSS were axenically grown in TYI-S-33 medium [13], supplemented as Leon-Sicairos et al. reported [11]. To analyze the effect of iron, trophozoites were harvested by centrifugation at 500 · g for 5 min, the cell pellet was washed with PBS and suspended (1 · 106 amoebas/mL) in medium (TYI-S-33) without iron. Cells were iron starved for only 2 h to prevent cell death [11,14]. Trophozoites (104) were incubated in 10 ml TYI-S-33 medium supplemented with equimolar quantities (10 mM iron) of either Hb or ammonium ferric citrate, and incubated for 24 h. 2.2. RT-PCR analysis Total mRNA of trophozoites growing with different iron sources was purified using the phenol-chloroform technique [15]. RNA samples were tested by RT-PCR using SuperScript One-Step (Cat. 11922028, Invitrogen) and specific oligonucleotides (5 0 -CCATGGGGATCCATGACTTCAATTAAAGGACA-3 0 , forward and 5 0 CCCCCCCTCGAGTTATTCATCATCTTCTTTTTCTTCCACAG3 0 , reverse). The PCR conditions were: 1 cycle at 94 C for 5 min, 25 cycles (at 94 C for 1 min, 64 C for 1 min, and 72 C for 1 min), and 1 cycle at 72 C for 5 min. Primers were designed according to the published sequence of Pathema (locus name EHI_096540) and the BamHI and XhoI restriction sites forward and reverse, respectively, were added for subsequent cloning (see below). As a positive control, oligonucleotides, which amplify 220 bp of rRNA (18s), were used. 2.3. Ehhmpb45 gene cloning and expression The Ehhmpb45 gene was amplified from E. histolytica genomic DNA by PCR and was inserted into the BamHI and XhoI restriction sites of the pGEX-6P1 vector (Amersham-Biosciences) that contains an ampicillin resistance gene. The GST-Ehhmpb45 protein was induced with 1 mM IPTG for 3 h in the BL21pLysS strain. Protein expression was visualized by Coomassie blue-stained SDS–PAGE gel and corroborated by Western blotting using monoclonal (1:8000) anti-GST antibodies. 2.4. Purification of the GST-Ehhmpb45 protein and GST digestion Induced bacteria were suspended in PBS (pH 7.3) plus lysozyme (1 mg/mL). Then, cells were sonicated using a 60% amplitude until the cell suspension cleared (1 min with pulses of 10 s), and brought
0014-5793/$34.00 2008 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.febslet.2008.06.057
A. Cruz-Castan˜eda, J.J. Olivares-Trejo / FEBS Letters 582 (2008) 2806–2810 up to a final concentration of 1% with Triton X-100. After 1 h, the mix was centrifuged (10 000 · g for 20 min). Supernatant was passed through a glutathione-sepharose affinity column (Amersham-Biosciences). Flow-through was collected and the column was washed five times with PBS. Proteins were eluted with pH 7.4 buffer (75 mM HEPES, 150 mM NaCl, 15 mM reduced glutation, 0.5 mM DTT, 0.1% Triton-X 100). An aliquot of each fraction was analyzed by Coomassie blue-stained SDS–PAGE gel to determine protein purity. To corroborate the presence of GST-Ehhmbp45 protein, Western blotting was performed using anti-GST antibodies. Fractions containing the GST-Ehhmbp45 protein were dialyzed (12 h, 4 C) with PreScission cleavage buffer (50 mM Tris–HCL, 150 mM NaCl, 1 mM EDTA, 1 mM DTT), pH 7.5. Finally, the proteins were digested (12 h at 4 C) with PreScission Protease (PPS) to remove the GST polypeptide.
2807
3.2. Ehhmbp45 gene was amplified from E. histolytica genomic DNA Our in silico research suggested the presence of Ehhmbp45 gene, which could encode a putative protein that binds Hb. In order to experimentally determine whether this gene is present in this protozoan parasite, Ehhmbp45 ORF (estimated 1151 bp) was amplified by PCR using specific oligonucleotides from E. histolytica genomic DNA (Fig. 2A, lane 5). This result
1151 bp Ehhmbp45 gene
2.5. Overlay assay Purified protein that was separated by 12% SDS–PAGE was then electroblotted onto a nitrocellulose membrane (Bio-Rad). The membrane was blocked with 5% non-fat milk in PBST buffer (1· PBS with 1% Tween), then 5 lg of human Hb was added and the membrane was incubated for 12 h at 4 C. After three washes (45 min) with PBST, the membrane was incubated with monoclonal b-globin antibodies (1:10 000).
220 bp 18s rRNA
Negative control (without retrotranscriptase) 1
2
3
4
5
3. Results 3 18s rRNA
Up-regulation (Fold)
3.1. Ehhmbp45 protein, which contains FRAP and NPNL motifs, was identified in the E. histolytica genome by in silico analysis In order to investigate whether E. histolytica genome contains genes that encode an Hb-binding protein, we performed in silico analysis homology searches using a 20 amino acid region that included FRAP and NPNL motifs reported for the HmbR gene of N. meningitidis [16]. The amino acid sequence found in the E. histolytic genome is annotated in the Pathema database as a putative protein (locus name EHI_096540). In this work, we named this gene Ehhmbp45 (45 kDa E. histolytica hemoglobin-binding protein). Ehhmbp45 is intron-less (1151 bp), and encodes a 338 amino acid protein with a hypothetical molecular weight of 45 kDa. When HmbR and Ehhmbp45 sequences were compared, we found that they have 41% homology and 27% identity. In addition, in silico analysis in the ExPASy Swiss-Prot database did not show signal peptide. Multiple alignment of sequences from bacterial pathogens were compared with the Ehhmbp45 protein sequence to align the FRAP and NPNL motifs (Fig. 1). These results indicate that the Ehhmbp45 protein has motifs for Hbbinding and is completely different from the Hb-binding proteins reported.
2.5
Ehhmbp45 gene
2 1.5 1 0.5 0 1 2 3 4 Hemoglobin Iron Complete Iron medium starved supplemented supplemented
Fig. 2. Ehhmbp45 RNA is up-regulated under iron starvation conditions and the up-regulation is reversed when the media is supplemented with purified Hb. (A) Semi-quantitative RT-PCR of the Ehhmbp45 gene. (B) rRNA 18s is a constitutive control. (C) Negative control as in A, but the reverse retrotranscriptase enzyme was not added. (D) Plot shows differences in the expression after the densitometry analysis of A and B panels. White corresponds to rRNA and black to Ehhmbp45. Lane 1: basal conditions (complete medium). Lanes 2–4: RT-PCR reactions under different growth conditions. Lane 2: iron starvation (see 2). Lanes 3 and 4: after iron starvation, cultures were supplemented with purified human Hb or iron, respectively. Lane 5: PCR control Ehhmbp45 gene was amplified from genomic DNA.
Fig. 1. Multiple amino acid sequence alignments of the FRAP and NPNL boxes. Amino acids from different pathogen bacteria were aligned with the Ehhmbp45 sequence using ClustalW and BoxShade. The Ehhmbp45 sequence was obtained by using blastp on the Entamoeba histolytica genome (Pathema database). FRAP and NPNL boxes are shown with the line.
2808
A. Cruz-Castan˜eda, J.J. Olivares-Trejo / FEBS Letters 582 (2008) 2806–2810
indicates that the E. histolytica genome has the Ehhmbp45 gene. However, we do not know if the gene is transcribed. 3.3. Ehhmbp45 gene is up-regulated under iron starvation condition To investigate whether the Ehhmbp45 gene is being expressed in E. histolytica, we performed a semiquantitative RT-PCR assay. Total RNA was isolated from trophozoites growing in complete media or under in the presence of different iron sources (Fig. 2, lanes 2–5). Our results showed that Ehhmbp45 mRNA was expressed in complete media (Fig. 2, lane 1). Meanwhile, when cells were iron starved, Ehhmbp45 transcript levels were up-regulated (Fig. 2A,D, lane 2) in comparison with steady state condition levels (Fig. 2A,D, lane 1). Thereafter, when the media was supplemented with human Hb or iron (Fig. 2, lanes 3 and 4, respectively), this up-regulation was reversed. These results indicated that the Ehhmbp45 gene is up-regulated by iron starvation and it is necessary in basal levels when iron sources (Hb or iron) are supplied. 3.4. Expression and purification of a novel Ehhmbp45 protein The up-regulation of Ehhmbp45 mRNA under iron starvation conditions, and the return to lower levels by Hb supplementation, suggests that this gene is necessary to acquire iron from Hb. A strategy was designed to test whether the Ehhmbp45 gene encodes an Hb-binding protein. First, we cloned this gene into an expression vector. We then expressed and purified the Ehhmbp45 protein. Finally, we analyzed whether it binds Hb using overlay assays. BL-21pLysS total induced extract (Fig. 3A, lane 2) was passed through a glutathione affinity column. Flow-through proteins (Fig. 3A, lane 3) and washes (Fig. 3A, lanes 5–9) were collected. The GSTEhhmbp45 protein was eluted in two fractions (Fig. 3A, lanes
kDa
1
2
3 4
5
6
7
8
10 and 11). All fractions were loaded onto SDS–PAGE and stained with Coomassie brilliant blue. To verify the existence of purified GST-Ehhmbp45 protein (Fig. 3A, lanes 10 and 11), a Western blotting assay using monoclonal anti-GST antibodies was performed (Fig. 3B, lanes 12 and 13). This strategy allowed us to purify the GST-Ehhmbp45 protein. 3.5. GST-Ehhmbp45 and Ehhmbp45 bind Hb in overlay assay We performed overlay assays to test whether purified GSTEhhmbp45 protein binds Hb. The GST-Ehhmbp45 protein (arrow head shows 70 kDa) was capable of binding Hb (Fig. 4A, lane 1). Nevertheless, the protein was coupled to GST protein, so to show that the Hb-binding is not affected by GST, the GST-Ehhmbp45 protein was digested with PPS. After proteolytic digestion, we observed a 45 kDa polypeptide (Fig. 4A, lane 2). Although, the molecular weight is different between both proteins, 45 kDa for Ehhmbp45 and 25 kDa for GST, respectively, we decided to separate them by a second time on a glutathione affinity column. The Ehhmbp45 protein was now in the flow-through (Fig. 4A, lane 3) and the GST protein was in the elution fraction (Fig. 4A, lane 4). The absence of GST was confirmed by Western blotting using anti-GST antibodies (Fig. 4B, samples were the same as A). No presence of GST was detected (Fig. 4B, lane 3). An overlay negative control without Hb is shown (Fig. 4C, overlay negative control was performed without Hb). Our results further suggest that the Ehhmbp45 gene encodes an Hb-binding protein.
4. Discussion A novel 45 kDa Hb-binding protein was identified using a straightforward strategy. A 20 amino acid sequence (from
9 10
11
12
13
200 150 100
70 kDa
75 50 37
25 20
Coomasie blue SDS-PAGE
anti-GST antibodies Western bloting
Fig. 3. The GST-Ehhmbp45 protein is eluted from the glutation affinity column. Lane 1: molecular weight marker. Lane 2: total extract from induced BL-21 pLysS. Lane 3: flow-through. Lane 4: glutathione sepharose matrix sample. Lanes 5–9: washes. Lanes 10 and 11: elutions from the column in which the GST-Ehhmbp45 protein was found. (A) All fractions were loaded onto an SDS–PAGE gel and stained with Coomassie blue. Lanes 12 and 13: (B) Western blotting of eluted fractions was performed to corroborate the GST-Ehhmbp45 identity using monoclonal anti-GST antibodies.
A. Cruz-Castan˜eda, J.J. Olivares-Trejo / FEBS Letters 582 (2008) 2806–2810
A
B
2809
C
70 kDa 45 kDa
25 kDa
1
2 3 Overlay assay
4
1 2 3 Western bloting
4
1 2 3 4 Overlay assay, without Hb
Fig. 4. The Ehhmbp45 protein and the GST-Ehhmbp45 bind Hb. (A) An overlay assay was performed using purified human-Hb and anti-b-globin as primary antibodies. (B) Western blotting using anti-GST antibodies. (C) Negative control of the overlay assay without Hb. Lane 1: GSTEhhmbp45 was eluted from a glutathione-affinity column. Lane 2: GST-Ehhmbp45 was digested with PPS. Both GST and Ehhmbp45 proteins are in this sample. Lane 3: Ehhmbp45 is in the flow-through after a second round through a glutathione-affinity column. Lane 4: only the GST is eluted. Arrows show molecular weights: 70 kDa (GST-Ehhmbp45 protein), 45 kDa (Ehhmbp45 protein) and 25 kDa (GST protein).
Neisseria meningitidis) was sufficient to identify a candidate Hb-binding protein in the E. histolytica genome. The cloning of the Ehhmbp45 gene, and expression and purification of the Ehhmbp45 protein were used in an overlay assay to show that Ehhmbp45 is an Hb-binding protein. Although slight variations in FRAP and NPNL motifs were observed, they did not affect Hb-binding because purified protein was successfully able to bind Hb. The hypothetical 45 kDa molecular weight was experimentally corroborated by SDS–PAGE. The molecular weight was comparable to Hbbinding proteins previously reported, like the 44-kDa hemebinding protein of Bacteroides fragilis [17] and the 46-kDa hemoglobin receptor (HmR) located in the flagellar pocket of L. donovani protozoan [8]. The Ehhmbp45 protein could share similar functions with those proteins. Nevertheless, the complete amino acid sequence was divergent, so we cannot discard the idea that Ehhmbp45 is an orthologous protein. The fact that the Ehhmbp45 gene was up-regulated under iron starvation and that mRNA levels return to steady state by supplementation with Hb or iron, clearly demonstrated that the Ehhmbp45 gene is iron-repressible. This is consistent with the hypothesis that E. histolytica has a mechanism to obtain iron from Hb. These results correlate with the findings reported on the hpuAB operon of N. meningitidis [18]. To summarize, our results are the first insights into an Hb-binding protein from E. histolytica. In addition, we showed an efficient strategy to identify Hb-binding proteins. Finally, the findings presented here could be important in explaining some of the mechanisms necessary to obtain iron in the different tissues that E. histolytica infects. For example, lactoferrin in mucosa can be used as an iron source, while Hb can be used by E. histolytica when it reaches the blood. These results establish the first step to understand the E. histolytica mechanism of iron acquisition from Hb. Acknowledgements: We thank Mavil Lo´pez of Posgrade in Genomic Sciences at the University Autonomous of Mexico City for reading
the manuscript and Israel Lopez, Tomas Sanchez and Guillermina Garcı´a in the Department of Experimental Parasitology, CINVESTAV-IPN, for their excellent technical assistance. This work was supported by Grant Number 54212 from CONACyT, Mexico.
References [1] Otto, B.R., Verweij-Vught, A.M.J.J. and Maclaren, D.M. (1992) Transferrins and heme-compounds as iron sources for pathogenic bacteria. Crit. Rev. Microbiol. 18, 217–233. [2] De Freitas, J.M. and Meneghini, R. (2001) Iron and its sensitive balance in the cell. Mutat. Res. 475, 153–159. [3] Stojiljkovic, I., Larson, J., Hwa, V., Anic, S. and So, M. (1996) HmbR outer membrane receptors of phatogenic Neisseria spp.: iron regulated, hemoglobin-binding proteins with a high level of primary structure conservation. J. Bacteriol. 178, 4670–4678. [4] Weissman, Z. and Kornitzer, D. (2004) A family of candida cell surface haem-binding proteins involved in haemin and a haemoglobin–iron utilization. Mol. Microbiol. 53, 1209–1220. [5] Sengupta, S., Tripathi, J., Tandom, R., Raje, M., Roy, R., Basu, S. and Mukhopadhyay, A. (1999) Hemoglobin endocytosis in Leishmania is mediated through a 46-kDa located in the flagellar pocket. J. Biol. Chem. 274, 2758–2765. [6] Genco, A.C. and Dixon, W.D. (2001) Emerging strategies in microbial haem capture. Mol. Microbiol. 39, 1–11. [7] Le´toffe´, S., Ghigo, J.M. and Wandersman, C. (1994) Iron acquisition from heme and hemoglobin by a Serratia marcescens extracellular protein. Proc. Natl. Acad. Sci. USA 91, 9876–9880. [8] Krishnamurthy, G., Vikram, R., Singh, S.B., Patel, N., Agarwal, S., Mukhopadhyay, G., Basu, S.K. and Mukhopadhyay, A. (2005) Hemoglobin receptor in leishmania is a Hexokinase located in the flagellar pocket. J. Biol. Chem. 280, 5884–5891. [9] Simpson, W., Olczak, T. and Genco, A.C. (2000) Characterization and expression of HmuR, a TonB-dependent hemoglobin receptor of Porphyromonas gingivalis. J. Bacteriol. 182, 5737–5748. [10] Cescau, S., Cwerman, H., Letoffe, S., Delepelaire, P., Wandersman, C. and Biville, F. (2006) Heme acquisition by hemophores. Biometals 20, 603–613. [11] Leon-Sicairos, N., Reyes-Lopez, M., Canizalez-Roman, A., Bermudez-Cruz, R.M., Serrano-Luna, J., Arroyo, R. and de la Garza, M. (2005) Human holo-lactoferrin: endocytosis and use as an iron source by the parasite Entamoeba histolytica. Microbiology 151, 3859–3871.
2810
A. Cruz-Castan˜eda, J.J. Olivares-Trejo / FEBS Letters 582 (2008) 2806–2810
[12] Serrano-Luna, J.J., Negrete, E., Reyes, M. and de la Garza, M. (1998) Entamoeba histolytica HM1:IMSS hemoglobin-degrading neutral cisteine proteases. Exp. Parasitol. 89, 71–77. [13] Diamond, L.S., Harlow, D.R. and Cunnick, C.C. (1978) A new medium for axenic cultivation of Entamoeba histolytica and other Entamoeba. Trans. Roy. Soc. Trop. Med. Hyg. 72, 431– 432. [14] Vohra, H., Mahajan, R.C. and Ganguly, N.K. (1998) Role of serum in regulating the Entamoeba histolytica cell cycle: a flowcytometric analysis. Parasitol. Res. 84, 835–838. [15] Sambrook, J. and Russell, D.W. (2001) Molecular Cloning a Laboratory Manual, Cold Spring Harbor Laboratory Press, NY.
[16] Perkins-Balding, D., Baer, M.T. and Stojiljkovic, I. (2003) Identification of functionally important regions of a haemoglobin receptor from Neisseria meningitidis. Microbiology 149, 3423– 3435. [17] Otto, R.B., Kusters, G.J., Luirink, J., De Graaf, K.F. and Oudega, B. (1996) Molecular characterization of a hemebinding protein of Bacteroides fragilis. Infect. Immun. 64, 4345–4350. [18] Lewis, L.A., Gray, E., Wang, Y., Roe, B.A. and Dyer, D.W. (1997) Molecular characterization of hpuAB, the haemoglobin– haptoglobin-utilization operon of Neisseria meningitidis. Mol. Microbiol. 23, 737–749.
Ehhmbp45 is a novel hemoglobin-binding protein identified in Entamoeba histolytica Areli Cruz-Castan˜eda, Jose´ J. Olivares-Trejo* Posgrado en Ciencias Geno´micas, Universidad Auto´noma de la Ciudad de Me´xico, 290 C.P. 03100, D.F., Me´xico Received 30 April 2008; revised 9 June 2008; accepted 27 June 2008 Available online 14 July 2008 Edited by Stuart Ferguson
Abstract Hemoglobin-binding proteins are necessary for pathogens to obtain iron from Hb. Entamoeba histolytica can grow using Hb as source of iron, but the underlying mechanism has not previously been established. In this work, we identified a 45 kDa Hb-binding protein of E. histolytica, which we named Ehhmbp45. In silico analysis showed that Ehhmbp45 contains the conserved domains needed for Hb-binding, while overlay assays demonstrated that Ehhmbp45 is able to bind Hb. In addition, we found that Ehhmbp45 mRNA levels were up-regulated under iron starvation conditions and were subsequently restored to basal levels when Hb was added to the cell cultures. These findings provide the first insights on the role of Ehhmbp45 in iron acquisition from Hb. 2008 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. Keywords: Hemoglobin; Hb-binding protein; Iron starvation; Overexpression
1. Introduction Iron is essential to nearly all known organisms. Since the free form of iron is highly toxic to cells [1], it is generally stored in the center of metalloproteins as transferrins and hemoproteins [2]. Pathogens have developed mechanisms to obtain iron from different sources [3–5]. One efficient way is the expression of proteins capable of binding hemoglobin (Hb) (hemophores and Hb receptors) [6]. Hemophores are proteins secreted by cells to uptake Hb [7], while Hb receptors are attached to the outside cellular membrane and are necessary to bind external Hb [3]. Also, there are receptors attached to internal membranes such as the hemoglobin receptor (HbR) of Leishmania donovani [8]. In gram-negative bacteria, these Hb-receptors are TonB-dependent [9] and require ABC type permease activity (ATP-binding cassette) to transport iron [10]. Hb-receptors bind Hb using two conserved motifs, FRAP and NPNL, which are separated from each other by a divergent region of 10–20 amino acids [9]. Entamoeba histolytica is a protozoan that infects human. This pathogen can grow axenically in the laboratory and also can maintain its growth using different sources of iron (free iron, Holo-lactoferrin or human Hb). It has been shown that *
Corresponding author. E-mail addresses: [email protected], [email protected] (J.J. Olivares-Trejo).
E. histolytica specifically binds Holo-lactoferrin expressing a membrane protein [11]. Even though E. histolytica uses Hb as an iron source for its growth [12], a mechanism for the Hb utilization remains unknown. In this work, we present a strategy that allowed us to find a 45 kDa protein and predict that it has the FRAP and NPNL motifs. Also, purified protein was able to bind Hb. Our data suggest that an E. histolytica mechanism to use Hb as an iron source is happening.
2. Materials and methods 2.1. Cultures E. coli DH5a and BL-21 pLysS stains were typically maintained in Luria–Bertani (LB) medium supplemented with an appropriate antibiotic and incubated aerobically at 37 C. Candidates were selected by ampicillin resistance. Trophozoites of E. histolytica strain HM1-IMSS were axenically grown in TYI-S-33 medium [13], supplemented as Leon-Sicairos et al. reported [11]. To analyze the effect of iron, trophozoites were harvested by centrifugation at 500 · g for 5 min, the cell pellet was washed with PBS and suspended (1 · 106 amoebas/mL) in medium (TYI-S-33) without iron. Cells were iron starved for only 2 h to prevent cell death [11,14]. Trophozoites (104) were incubated in 10 ml TYI-S-33 medium supplemented with equimolar quantities (10 mM iron) of either Hb or ammonium ferric citrate, and incubated for 24 h. 2.2. RT-PCR analysis Total mRNA of trophozoites growing with different iron sources was purified using the phenol-chloroform technique [15]. RNA samples were tested by RT-PCR using SuperScript One-Step (Cat. 11922028, Invitrogen) and specific oligonucleotides (5 0 -CCATGGGGATCCATGACTTCAATTAAAGGACA-3 0 , forward and 5 0 CCCCCCCTCGAGTTATTCATCATCTTCTTTTTCTTCCACAG3 0 , reverse). The PCR conditions were: 1 cycle at 94 C for 5 min, 25 cycles (at 94 C for 1 min, 64 C for 1 min, and 72 C for 1 min), and 1 cycle at 72 C for 5 min. Primers were designed according to the published sequence of Pathema (locus name EHI_096540) and the BamHI and XhoI restriction sites forward and reverse, respectively, were added for subsequent cloning (see below). As a positive control, oligonucleotides, which amplify 220 bp of rRNA (18s), were used. 2.3. Ehhmpb45 gene cloning and expression The Ehhmpb45 gene was amplified from E. histolytica genomic DNA by PCR and was inserted into the BamHI and XhoI restriction sites of the pGEX-6P1 vector (Amersham-Biosciences) that contains an ampicillin resistance gene. The GST-Ehhmpb45 protein was induced with 1 mM IPTG for 3 h in the BL21pLysS strain. Protein expression was visualized by Coomassie blue-stained SDS–PAGE gel and corroborated by Western blotting using monoclonal (1:8000) anti-GST antibodies. 2.4. Purification of the GST-Ehhmpb45 protein and GST digestion Induced bacteria were suspended in PBS (pH 7.3) plus lysozyme (1 mg/mL). Then, cells were sonicated using a 60% amplitude until the cell suspension cleared (1 min with pulses of 10 s), and brought
0014-5793/$34.00 2008 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.febslet.2008.06.057
A. Cruz-Castan˜eda, J.J. Olivares-Trejo / FEBS Letters 582 (2008) 2806–2810 up to a final concentration of 1% with Triton X-100. After 1 h, the mix was centrifuged (10 000 · g for 20 min). Supernatant was passed through a glutathione-sepharose affinity column (Amersham-Biosciences). Flow-through was collected and the column was washed five times with PBS. Proteins were eluted with pH 7.4 buffer (75 mM HEPES, 150 mM NaCl, 15 mM reduced glutation, 0.5 mM DTT, 0.1% Triton-X 100). An aliquot of each fraction was analyzed by Coomassie blue-stained SDS–PAGE gel to determine protein purity. To corroborate the presence of GST-Ehhmbp45 protein, Western blotting was performed using anti-GST antibodies. Fractions containing the GST-Ehhmbp45 protein were dialyzed (12 h, 4 C) with PreScission cleavage buffer (50 mM Tris–HCL, 150 mM NaCl, 1 mM EDTA, 1 mM DTT), pH 7.5. Finally, the proteins were digested (12 h at 4 C) with PreScission Protease (PPS) to remove the GST polypeptide.
2807
3.2. Ehhmbp45 gene was amplified from E. histolytica genomic DNA Our in silico research suggested the presence of Ehhmbp45 gene, which could encode a putative protein that binds Hb. In order to experimentally determine whether this gene is present in this protozoan parasite, Ehhmbp45 ORF (estimated 1151 bp) was amplified by PCR using specific oligonucleotides from E. histolytica genomic DNA (Fig. 2A, lane 5). This result
1151 bp Ehhmbp45 gene
2.5. Overlay assay Purified protein that was separated by 12% SDS–PAGE was then electroblotted onto a nitrocellulose membrane (Bio-Rad). The membrane was blocked with 5% non-fat milk in PBST buffer (1· PBS with 1% Tween), then 5 lg of human Hb was added and the membrane was incubated for 12 h at 4 C. After three washes (45 min) with PBST, the membrane was incubated with monoclonal b-globin antibodies (1:10 000).
220 bp 18s rRNA
Negative control (without retrotranscriptase) 1
2
3
4
5
3. Results 3 18s rRNA
Up-regulation (Fold)
3.1. Ehhmbp45 protein, which contains FRAP and NPNL motifs, was identified in the E. histolytica genome by in silico analysis In order to investigate whether E. histolytica genome contains genes that encode an Hb-binding protein, we performed in silico analysis homology searches using a 20 amino acid region that included FRAP and NPNL motifs reported for the HmbR gene of N. meningitidis [16]. The amino acid sequence found in the E. histolytic genome is annotated in the Pathema database as a putative protein (locus name EHI_096540). In this work, we named this gene Ehhmbp45 (45 kDa E. histolytica hemoglobin-binding protein). Ehhmbp45 is intron-less (1151 bp), and encodes a 338 amino acid protein with a hypothetical molecular weight of 45 kDa. When HmbR and Ehhmbp45 sequences were compared, we found that they have 41% homology and 27% identity. In addition, in silico analysis in the ExPASy Swiss-Prot database did not show signal peptide. Multiple alignment of sequences from bacterial pathogens were compared with the Ehhmbp45 protein sequence to align the FRAP and NPNL motifs (Fig. 1). These results indicate that the Ehhmbp45 protein has motifs for Hbbinding and is completely different from the Hb-binding proteins reported.
2.5
Ehhmbp45 gene
2 1.5 1 0.5 0 1 2 3 4 Hemoglobin Iron Complete Iron medium starved supplemented supplemented
Fig. 2. Ehhmbp45 RNA is up-regulated under iron starvation conditions and the up-regulation is reversed when the media is supplemented with purified Hb. (A) Semi-quantitative RT-PCR of the Ehhmbp45 gene. (B) rRNA 18s is a constitutive control. (C) Negative control as in A, but the reverse retrotranscriptase enzyme was not added. (D) Plot shows differences in the expression after the densitometry analysis of A and B panels. White corresponds to rRNA and black to Ehhmbp45. Lane 1: basal conditions (complete medium). Lanes 2–4: RT-PCR reactions under different growth conditions. Lane 2: iron starvation (see 2). Lanes 3 and 4: after iron starvation, cultures were supplemented with purified human Hb or iron, respectively. Lane 5: PCR control Ehhmbp45 gene was amplified from genomic DNA.
Fig. 1. Multiple amino acid sequence alignments of the FRAP and NPNL boxes. Amino acids from different pathogen bacteria were aligned with the Ehhmbp45 sequence using ClustalW and BoxShade. The Ehhmbp45 sequence was obtained by using blastp on the Entamoeba histolytica genome (Pathema database). FRAP and NPNL boxes are shown with the line.
2808
A. Cruz-Castan˜eda, J.J. Olivares-Trejo / FEBS Letters 582 (2008) 2806–2810
indicates that the E. histolytica genome has the Ehhmbp45 gene. However, we do not know if the gene is transcribed. 3.3. Ehhmbp45 gene is up-regulated under iron starvation condition To investigate whether the Ehhmbp45 gene is being expressed in E. histolytica, we performed a semiquantitative RT-PCR assay. Total RNA was isolated from trophozoites growing in complete media or under in the presence of different iron sources (Fig. 2, lanes 2–5). Our results showed that Ehhmbp45 mRNA was expressed in complete media (Fig. 2, lane 1). Meanwhile, when cells were iron starved, Ehhmbp45 transcript levels were up-regulated (Fig. 2A,D, lane 2) in comparison with steady state condition levels (Fig. 2A,D, lane 1). Thereafter, when the media was supplemented with human Hb or iron (Fig. 2, lanes 3 and 4, respectively), this up-regulation was reversed. These results indicated that the Ehhmbp45 gene is up-regulated by iron starvation and it is necessary in basal levels when iron sources (Hb or iron) are supplied. 3.4. Expression and purification of a novel Ehhmbp45 protein The up-regulation of Ehhmbp45 mRNA under iron starvation conditions, and the return to lower levels by Hb supplementation, suggests that this gene is necessary to acquire iron from Hb. A strategy was designed to test whether the Ehhmbp45 gene encodes an Hb-binding protein. First, we cloned this gene into an expression vector. We then expressed and purified the Ehhmbp45 protein. Finally, we analyzed whether it binds Hb using overlay assays. BL-21pLysS total induced extract (Fig. 3A, lane 2) was passed through a glutathione affinity column. Flow-through proteins (Fig. 3A, lane 3) and washes (Fig. 3A, lanes 5–9) were collected. The GSTEhhmbp45 protein was eluted in two fractions (Fig. 3A, lanes
kDa
1
2
3 4
5
6
7
8
10 and 11). All fractions were loaded onto SDS–PAGE and stained with Coomassie brilliant blue. To verify the existence of purified GST-Ehhmbp45 protein (Fig. 3A, lanes 10 and 11), a Western blotting assay using monoclonal anti-GST antibodies was performed (Fig. 3B, lanes 12 and 13). This strategy allowed us to purify the GST-Ehhmbp45 protein. 3.5. GST-Ehhmbp45 and Ehhmbp45 bind Hb in overlay assay We performed overlay assays to test whether purified GSTEhhmbp45 protein binds Hb. The GST-Ehhmbp45 protein (arrow head shows 70 kDa) was capable of binding Hb (Fig. 4A, lane 1). Nevertheless, the protein was coupled to GST protein, so to show that the Hb-binding is not affected by GST, the GST-Ehhmbp45 protein was digested with PPS. After proteolytic digestion, we observed a 45 kDa polypeptide (Fig. 4A, lane 2). Although, the molecular weight is different between both proteins, 45 kDa for Ehhmbp45 and 25 kDa for GST, respectively, we decided to separate them by a second time on a glutathione affinity column. The Ehhmbp45 protein was now in the flow-through (Fig. 4A, lane 3) and the GST protein was in the elution fraction (Fig. 4A, lane 4). The absence of GST was confirmed by Western blotting using anti-GST antibodies (Fig. 4B, samples were the same as A). No presence of GST was detected (Fig. 4B, lane 3). An overlay negative control without Hb is shown (Fig. 4C, overlay negative control was performed without Hb). Our results further suggest that the Ehhmbp45 gene encodes an Hb-binding protein.
4. Discussion A novel 45 kDa Hb-binding protein was identified using a straightforward strategy. A 20 amino acid sequence (from
9 10
11
12
13
200 150 100
70 kDa
75 50 37
25 20
Coomasie blue SDS-PAGE
anti-GST antibodies Western bloting
Fig. 3. The GST-Ehhmbp45 protein is eluted from the glutation affinity column. Lane 1: molecular weight marker. Lane 2: total extract from induced BL-21 pLysS. Lane 3: flow-through. Lane 4: glutathione sepharose matrix sample. Lanes 5–9: washes. Lanes 10 and 11: elutions from the column in which the GST-Ehhmbp45 protein was found. (A) All fractions were loaded onto an SDS–PAGE gel and stained with Coomassie blue. Lanes 12 and 13: (B) Western blotting of eluted fractions was performed to corroborate the GST-Ehhmbp45 identity using monoclonal anti-GST antibodies.
A. Cruz-Castan˜eda, J.J. Olivares-Trejo / FEBS Letters 582 (2008) 2806–2810
A
B
2809
C
70 kDa 45 kDa
25 kDa
1
2 3 Overlay assay
4
1 2 3 Western bloting
4
1 2 3 4 Overlay assay, without Hb
Fig. 4. The Ehhmbp45 protein and the GST-Ehhmbp45 bind Hb. (A) An overlay assay was performed using purified human-Hb and anti-b-globin as primary antibodies. (B) Western blotting using anti-GST antibodies. (C) Negative control of the overlay assay without Hb. Lane 1: GSTEhhmbp45 was eluted from a glutathione-affinity column. Lane 2: GST-Ehhmbp45 was digested with PPS. Both GST and Ehhmbp45 proteins are in this sample. Lane 3: Ehhmbp45 is in the flow-through after a second round through a glutathione-affinity column. Lane 4: only the GST is eluted. Arrows show molecular weights: 70 kDa (GST-Ehhmbp45 protein), 45 kDa (Ehhmbp45 protein) and 25 kDa (GST protein).
Neisseria meningitidis) was sufficient to identify a candidate Hb-binding protein in the E. histolytica genome. The cloning of the Ehhmbp45 gene, and expression and purification of the Ehhmbp45 protein were used in an overlay assay to show that Ehhmbp45 is an Hb-binding protein. Although slight variations in FRAP and NPNL motifs were observed, they did not affect Hb-binding because purified protein was successfully able to bind Hb. The hypothetical 45 kDa molecular weight was experimentally corroborated by SDS–PAGE. The molecular weight was comparable to Hbbinding proteins previously reported, like the 44-kDa hemebinding protein of Bacteroides fragilis [17] and the 46-kDa hemoglobin receptor (HmR) located in the flagellar pocket of L. donovani protozoan [8]. The Ehhmbp45 protein could share similar functions with those proteins. Nevertheless, the complete amino acid sequence was divergent, so we cannot discard the idea that Ehhmbp45 is an orthologous protein. The fact that the Ehhmbp45 gene was up-regulated under iron starvation and that mRNA levels return to steady state by supplementation with Hb or iron, clearly demonstrated that the Ehhmbp45 gene is iron-repressible. This is consistent with the hypothesis that E. histolytica has a mechanism to obtain iron from Hb. These results correlate with the findings reported on the hpuAB operon of N. meningitidis [18]. To summarize, our results are the first insights into an Hb-binding protein from E. histolytica. In addition, we showed an efficient strategy to identify Hb-binding proteins. Finally, the findings presented here could be important in explaining some of the mechanisms necessary to obtain iron in the different tissues that E. histolytica infects. For example, lactoferrin in mucosa can be used as an iron source, while Hb can be used by E. histolytica when it reaches the blood. These results establish the first step to understand the E. histolytica mechanism of iron acquisition from Hb. Acknowledgements: We thank Mavil Lo´pez of Posgrade in Genomic Sciences at the University Autonomous of Mexico City for reading
the manuscript and Israel Lopez, Tomas Sanchez and Guillermina Garcı´a in the Department of Experimental Parasitology, CINVESTAV-IPN, for their excellent technical assistance. This work was supported by Grant Number 54212 from CONACyT, Mexico.
References [1] Otto, B.R., Verweij-Vught, A.M.J.J. and Maclaren, D.M. (1992) Transferrins and heme-compounds as iron sources for pathogenic bacteria. Crit. Rev. Microbiol. 18, 217–233. [2] De Freitas, J.M. and Meneghini, R. (2001) Iron and its sensitive balance in the cell. Mutat. Res. 475, 153–159. [3] Stojiljkovic, I., Larson, J., Hwa, V., Anic, S. and So, M. (1996) HmbR outer membrane receptors of phatogenic Neisseria spp.: iron regulated, hemoglobin-binding proteins with a high level of primary structure conservation. J. Bacteriol. 178, 4670–4678. [4] Weissman, Z. and Kornitzer, D. (2004) A family of candida cell surface haem-binding proteins involved in haemin and a haemoglobin–iron utilization. Mol. Microbiol. 53, 1209–1220. [5] Sengupta, S., Tripathi, J., Tandom, R., Raje, M., Roy, R., Basu, S. and Mukhopadhyay, A. (1999) Hemoglobin endocytosis in Leishmania is mediated through a 46-kDa located in the flagellar pocket. J. Biol. Chem. 274, 2758–2765. [6] Genco, A.C. and Dixon, W.D. (2001) Emerging strategies in microbial haem capture. Mol. Microbiol. 39, 1–11. [7] Le´toffe´, S., Ghigo, J.M. and Wandersman, C. (1994) Iron acquisition from heme and hemoglobin by a Serratia marcescens extracellular protein. Proc. Natl. Acad. Sci. USA 91, 9876–9880. [8] Krishnamurthy, G., Vikram, R., Singh, S.B., Patel, N., Agarwal, S., Mukhopadhyay, G., Basu, S.K. and Mukhopadhyay, A. (2005) Hemoglobin receptor in leishmania is a Hexokinase located in the flagellar pocket. J. Biol. Chem. 280, 5884–5891. [9] Simpson, W., Olczak, T. and Genco, A.C. (2000) Characterization and expression of HmuR, a TonB-dependent hemoglobin receptor of Porphyromonas gingivalis. J. Bacteriol. 182, 5737–5748. [10] Cescau, S., Cwerman, H., Letoffe, S., Delepelaire, P., Wandersman, C. and Biville, F. (2006) Heme acquisition by hemophores. Biometals 20, 603–613. [11] Leon-Sicairos, N., Reyes-Lopez, M., Canizalez-Roman, A., Bermudez-Cruz, R.M., Serrano-Luna, J., Arroyo, R. and de la Garza, M. (2005) Human holo-lactoferrin: endocytosis and use as an iron source by the parasite Entamoeba histolytica. Microbiology 151, 3859–3871.
2810
A. Cruz-Castan˜eda, J.J. Olivares-Trejo / FEBS Letters 582 (2008) 2806–2810
[12] Serrano-Luna, J.J., Negrete, E., Reyes, M. and de la Garza, M. (1998) Entamoeba histolytica HM1:IMSS hemoglobin-degrading neutral cisteine proteases. Exp. Parasitol. 89, 71–77. [13] Diamond, L.S., Harlow, D.R. and Cunnick, C.C. (1978) A new medium for axenic cultivation of Entamoeba histolytica and other Entamoeba. Trans. Roy. Soc. Trop. Med. Hyg. 72, 431– 432. [14] Vohra, H., Mahajan, R.C. and Ganguly, N.K. (1998) Role of serum in regulating the Entamoeba histolytica cell cycle: a flowcytometric analysis. Parasitol. Res. 84, 835–838. [15] Sambrook, J. and Russell, D.W. (2001) Molecular Cloning a Laboratory Manual, Cold Spring Harbor Laboratory Press, NY.
[16] Perkins-Balding, D., Baer, M.T. and Stojiljkovic, I. (2003) Identification of functionally important regions of a haemoglobin receptor from Neisseria meningitidis. Microbiology 149, 3423– 3435. [17] Otto, R.B., Kusters, G.J., Luirink, J., De Graaf, K.F. and Oudega, B. (1996) Molecular characterization of a hemebinding protein of Bacteroides fragilis. Infect. Immun. 64, 4345–4350. [18] Lewis, L.A., Gray, E., Wang, Y., Roe, B.A. and Dyer, D.W. (1997) Molecular characterization of hpuAB, the haemoglobin– haptoglobin-utilization operon of Neisseria meningitidis. Mol. Microbiol. 23, 737–749.